close

Вход

Забыли?

вход по аккаунту

?

208

код для вставкиСкачать
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
РОССИЙСКАЯ АКАДЕМИЯ МЕДИЦИНСКИХ НАУК
ВЕСТНИК РОССИЙСКОЙ
АКАДЕМИИ
МЕДИЦИНСКИХ НАУК
Ежемесячный научно-теоретический журнал
Основан в 1946 г.
Входит в Перечень ведущих научных журналов и изданий ВАК
Учредитель — Роcсийская академия медицинских наук
Главный редактор И.И. ДЕДОВ
РЕДАКЦИОННАЯ КОЛЛЕГИЯ:
Э.К. АЙЛАМАЗЯН, А.И. АРЧАКОВ, Л.И. АФТАНАС, А.А. БАРАНОВ, В.В. БЕРЕГОВЫХ (зам. гл. редактора),
Л.А. БОКЕРИЯ, Н.Н. ВОЛОДИН, Н.Ф. ГЕРАСИМЕНКО, Е.К. ГИНТЕР, П.В. ГЛЫБОЧКО, Е.З. ГОЛУХОВА,
В.В. ЗВЕРЕВ, Р.С. КАРПОВ, С.И. КОЛЕСНИКОВ, В.В. КУХАРЧУК. Е.В. ЛУГИНИНА (отв. секретарь),
Г.А. МЕЛЬНИЧЕНКО. Н.А. МУХИН, Е.Л. НАСОНОВ, Г.Г. ОНИЩЕНКО, В.И. ПЕТРОВ, В.И. ПОКРОВСКИЙ,
В.П. ПУЗЫРЕВ, В.С. САВЕЛЬЕВ, В.Г. САВЧЕНКО, В.И. СЕРГИЕНКО, Г.А. СОФРОНОВ, В.И. СТАРОДУБОВ,
З.А. СУСЛИНА (зам. гл. редактора), Г.Т. СУХИХ, В.А. ТУТЕЛЬЯН (зам. гл. редактора), И.Б. УШАКОВ. Р.М. ХАИТОВ,
Е.И. ЧАЗОВ. В.П. ЧЕХОНИН, В.И. ЧИССОВ, Е.В. ШЛЯХТО
НАУЧНЫЙ РЕДАКТОР: Д.А. НАПАЛКОВ
2/2013
Журнал «Вестник Российской академии медицинских наук» зарегистрирован в Федеральной службе по надзору в сфере связи,
информационных технологий и массовых коммуникаций 16.09.1992 г. Регистрационный номер №01574.
Редакция не несет ответственности за содержание рекламных материалов.
Воспроизведение или использование другим способом любой части издания без согласия редакции
является незаконным и влечет за собой ответственность, установленную действующим законодательством РФ
Подписные индексы: в агентстве Роспечать – 71488, в агентстве «Пресса России» – 38814
Издательство «ПедиатрЪ»: 119991, Москва, Ломоносовский пр-т, 2/62, тел./факс: (499) 132-30-43, e-mail: www.spr-journal.ru
Адрес редакции: 109240, Москва, ул. Солянка, 14, тел.: (495) 698-52-59, e-mail: luginina@ramn.ru, vestramn@mail.ru
Отпечатано ООО «Ларго», 117342, Москва, Севастопольский проспект, 56/40
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
THE RUSSIAN ACADEMY OF MEDICAL SCIENCES
ANNALS OF THE RUSSIAN
ACADEMY
OF MEDICAL SCIENCES
Published monthly
Founded in 1946
The Journal is in the List of the leading scientific journals and publications
of the Supreme Examination Board (VAK)
Founder – The Russian Academy Of Medical Sciences
Editor-in-chief I.I. Dedov
EDITORIAL BOARD:
E.K. AILAMAZYAN, A.I. ARCHAKOV, L.I. AFTANAS, A.A. BARANOV, V.V. BEREGOVYKH (deputy editors-in-chief),
L.A. BOKERIYA, N.N. VOLODIN, N.F. GERASIMENKO, E.K. GINTHER, P.V. GLYBOCHKO, L.Z. GOLUKHOVA,
V.V. ZVEREV, R.S. KARPOV, S.I. KOLESNIKOV, V.V. KUKHARCHUK, E.V. LUGININA (editorial secretary),
G.A. MELNICHENKO. N.A. MUKHIN, E.L. NASONOV, I.I. ONISHCHENKO, V.I. PETROV, V.I. POKROVSKII,
V.P. PUZYREV, V.S. SAVELIEV, V.G. SAVCHENKO, V.I. SERGIENKO, G.A. SOFRONOV, V.I. STARODUBOV,
Z.A. SUSLINA (deputy editors-in-chief), G.T. SUKHIKH, V.A. TUTELYAN (deputy editors-in-chief), I.B. USHAKOV,
R.M. KHAITOV, E.I. CHAZOV, V.P. CHEKHONIN, V.I. CHISSOV, E.V. SHLYAKHTO
RESEARCH EDITOR: D.A. NAPALKOV
2/2013
Mass media registration certificate dated September, 16, 1992. Series № 01574 Federal service for surveillance over non-violation
of the legislation in the sphere of mass communications and protection of cultural heritage.
Editorial office takes no responsibility for the contents of advertising material.
No part of this issue may be reproduced without permission from the publisher. While reprinting publications one must make reference
to the journal « Annals Of The Russian Academy Of Medical Sciences »
Subscription indices are in the catalogue «Rospechat» 71488
Publisher «PEDIATR»: 2/62, Lomonosov avenue, Moscow, 119991, tel./fax: (499) 132-30-43, e-mail: www.spr-journal.ru
Correspondence address: 14, Solyanka, Moscow, 109240, tel.: (495) 698-52-59, e-mail: luginina@ramn.ru; vestramn@mail.ru
Printed in the printing-office «Largo», 56/40, Sevastopolsky prospect, Moscow, 117342
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
СОДЕРЖАНИЕ
CONTENTS
РЕДАКЦИОННАЯ СТАТЬЯ
EDITORIAL
И.Е. Чазова, Е.В. Ощепкова Итоги реализации Федераль- 4 I.E. Chazova, E.V. Oschepkova Results of the Federal (National)
ной целевой программы по профилактике и лечению
Project for prevention and treatment essential hypertension
артериальной гипертензии в России в 2002–2012 гг.
patients in Russia from 2002–2012 years
АКТУАЛЬНЫЕ ВОПРОСЫ ГИГИЕНЫ
НYGIENE: CURRENT ISSUES
М.П. Дьякович, Е.В. Катаманова, П.В. Казакова Количест- 12 M.P. Diakovich, E.V. Katamanova, P.V. Kazakova Quantifying
венная оценка динамики фактического здоровья лиц,
the dynamics of the health status of persons occupationally
подвергавшихся воздействию паров ртути на произexposed to mercury vapor: a remote period of intoxication
водстве: отдаленный период интоксикации
Н.В. Зайцева, М.А. Землянова, В.Н. Звездин, О.В. Лебединс- 18 N.V. Zaitseva, M.A. Zemlyanova, V.N. Zvezdin, O.V. Lebedinskaya,
кая, С.В. Мелехин, Е.В. Саенко, Р.Р. Махмудов МорфоS.V. Melekhin, E.V. Sayenko3, R.R. Makhmudov Toxicological
логические особенности тканей внутренних органов
evaluation of nanodispersed manganese oxide (III, IV)
и систем при воздействии нанодисперсного оксида
effect on morphological peculiarities of different tissues
марганца (III, IV)
under experiment
АКТУАЛЬНЫЕ ВОПРОСЫ
СЕРДЕЧНО-СОСУДИСТОЙ ХИРУРГИИ
CARDIOVASCULAR SURGERY: CURRENT ISSUES
Е.А. Медведева, Ю.В. Щукин, Е.И. Селезнев Профилактика 24 E.A. Medvedeva, Y.V. Shchukin, E.I. Seleznev Prevention
кардиальных осложнений при выполнении аортоподof cardiovascular complications in patients undergoing
вздошных реконструкций посредством коррекции
aortic-iliac reconstructions by correction of inflammation
воспаления и эндотоксемии
and endotoxemia
АКТУАЛЬНЫЕ ВОПРОСЫ ЭНДОКРИНОЛОГИИ
ENDOCRINOLOGY: CURRENT ISSUES
Л.М. Берштейн, Д.А. Васильев, Т.Е. Порошина, М.П. Бояр- 29 L.M. Berstein, D.A. Vasilyev, T.E. Poroshina, M.P. Boyarkina,
кина, Е.В. Цырлина Гормонально-метаболические
E.V. Tsyrlina Hormonal-metabolic pattern of postmenoособенности постменопаузальных женщин с впервые
pausal females with new onset of diabetes mellitus type 2:
выявленным сахарным диабетом: роль онкологичеthe role of cancer and hereditary predisposition to diabetes
ского заболевания и наследственной предрасположенности к диабету
С.А. Мартынов, М.В. Шестакова, И.М. Кутырина, 35 S.A. Martynov, M.V. Shestakova, I.M. Kutyrina, A.V. Ilyin,
А.В. Ильин, М.И. Арбузова, И.И. Дедов Роль циркулируM.I. Arbuzova, I.I. Dedov Role of circulating angiogenic
ющих ангиогенных факторов в поражении почек при
factors in diabetic kidney disease
сахарном диабете
А.А. Спасов, В.И. Петров, Н.И. Чепляева, К.В. Ленская 43 A.A. Spasov, V.I. Petrov, N.I. Chepljaeva, K.V. Lenskaja
Фундаментальные основы поиска лекарственных
Fundamental bases of search of medicines for therapy
средств для терапии сахарного диабета 2-го типа
of a diabetes mellitus type 2
АКТУАЛЬНЫЕ ВОПРОСЫ ФИЗИОЛОГИИ
PHYSIOLOGY: CURRENT ISSUES
Г.М. Элбакидзе, А.Г. Меденцев Внутриорганные и внутри- 50 G.M. Elbakidze, A.G.Medentsev Intraorganic and intratissue
mechanisms of protective action of activated kupffer cells
тканевые механизмы регуляторных воздействий клеon hepatocytes
ток Купфера на гепатоциты
НАУЧНЫЕ СООБЩЕНИЯ
SCIENTIFIC REPORTS
В.К. Ильин, А.Н. Суворов, Н.В. Кирюхина, Н.А. Усанова, 56 V.K. Il’in, A.N. Suvorov, N.V. Kiryukhina, N.A. Usanova,
L.V. Starkova, V.V. Boyarintsev, A.B. Karaseva AutochthoЛ.В. Старкова, В.В. Бояринцев, А.Б. Карасева Аутопроnous probiotics in prevention of infectious and inflammatory
биотики как средство профилактики инфекционноdiseases of a human in the altered habitats
воспалительных заболеваний у человека в искусственной среде обитания
М.М. Тарских, М.А. Шумбасов, С.И. Колесников 63 M.M. Tarskikh, M.A. Shumbasov, S.I. Kolesnikov Carcinogenicity of acrylonitrile and evaluation of approaches
Канцерогенность акрилонитрила и оценка возможноto pathogenetic correction of acrylate toxicity and
стей патогенетической коррекции токсичности акриantitumorigenic anthracycline doxorubicin toxicity during
лата и противоопухолевого антрациклина доксорубиchemotherapy
цина при химиотерапии опухолей
ЮБИЛЕИ, ПОЗДРАВЛЕНИЯ
Борис Дмитриевич Комаров
ANNIVERSARIES, CONGRATULATIONS
67 Boris Dmitrievich Komarov
3
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
РЕДАКЦИОННАЯ СТАТЬЯ
И.Е. Чазова, Е.В. Ощепкова
Российский кардиологический научно-производственный комплекс, Москва, Российская Федерация
Итоги реализации Федеральной
целевой программы по профилактике
и лечению артериальной гипертензии
в России в 2002–2012 гг.
4
Проанализирована эффективность мероприятий по борьбе с артериальной гипертензией в Российской Федерации за период с 2002 по 2012 гг.,
проводимых в рамках Федеральной целевой программы и основной деятельности медицинских и научных организаций с организационнометодическим руководством Российского кардиологического научно-производственного комплекса как головного учреждения по профилю
«Кардиология».
Основным достижением явилось снижение смертности населения от болезней системы кровообращения, начиная с 2004 г. Наиболее выраженные позитивные изменения отмечены в смертности от цереброваскулярных болезней, уровень которой снизился в 1,5 раза — с 339,9 случаев
на 100 тыс. населения в 2003 г. до 224,1 в 2012 г., в т.ч. от фатальных инсультов (уменьшение на 114,8 тыс. случаев по сравнению с 2004 г.).
Снижение смертности от болезней системы кровообращения достигнуто за счет раннего выявления лиц с артериальной гипертензией; разработки и внедрения в практическое здравоохранение новых методов профилактики («Школы здоровья»), диагностики и лечения больных
артериальной гипертензией; повышения образовательного уровня врачей первичного звена здравоохранения в области кардиологии, а также
использования программно-целевого подхода государства в решении проблемы, направленного на достижение конечного результата —
снижения смертности от болезней системы кровообращения.
Ключевые слова: артериальная гипертензия, сердечно-сосудистая смертность, профилактика инсульта, профилактика, диагностика
и лечение больных артериальной гипертонией.
Значительное повышение уровня смертности населения от болезней системы кровообращения (БСК)
в 90-е гг. прошлого столетия в период перестройки, равного которому еще не было в истории медицины, наряду
со снижением рождаемости явилось причиной формирования тяжелой демографической ситуации в России в тот
период времени. Уровень смертности от БСК прогрессивно увеличивался с 618,7 случаев на 100 тыс. населения
в 1990 г. до 864,1 в 2000 г. Среди всех причин смертности
53–55% лиц умирали от сердечно-сосудистых заболеваний (ССЗ). Ежегодно от ССЗ погибало более 1,1 млн
жителей страны. Среди всех умерших 30% составляли
лица трудоспособного возраста, из них 80% — мужчины,
смертность которых в 4,6–5 раз превышала смертность
женщин. Ожидаемая продолжительность жизни мужчин
была на 10,6–15,1 лет ниже, чем продолжительность жиз-
I.E. Chazova, E.V. Oschepkova
Russian Cardiology Research and Production Complex, Moscow, Russian Federation
Results of the Federal (National) Project for prevention and treatment
essential hypertension patients in Russia from 2002–2012 years
The analysis of measures efficiency for prevention by essential hypertension (EH) in Russian Federation within the space of 2002–2012 years
was realized. Those measures were carrying out Federal (National) Project and primary activity of the medical and scientific institutions under
the leadership Russian Cardiology Research and Production Complex.
The basic result was decrease in cardiovascular disease death rate starting with 2004 year. The most pronounced significant changes were found
in death rate from the cerebrovascular diseases. From 2003 to 2012, the annual cerebrovascular disease death rate decreased in 1,5 times
(in 2003 — 339,9 by 100 thousands, to compare with 2012 — 224,1 by 100 thousands). Moreover, in 2012 the fatal stroke death rate was decreased
on 114,8 thousands (to compare with 2004).
Decrease of cardiovascular disease death rate is achieved from: early revealing of essential hypertension pts; development and introduction
in practical public health of new methods of prevention («Schools of Health»), adequate diagnostic and treatment of essential hypertension patients;
increase of an educational level by cardiology in polyclinics, also use by the government of special purposes for Cardiovascular disease death rate
decrease.
Key words: essential hypertension, cardiovascular disease death rate, stroke prevention, prevention, diagnostic and treatment essential hypertensive
patients.
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
РЕДАКЦИОННАЯ СТАТЬЯ
ни женщин, что свидетельствовало о «сверхсмертности»
мужчин трудоспособного возраста. Показатели ожидаемой продолжительности жизни населения, особенно
мужчин, в России были значительно ниже, чем в большинстве экономически развитых стран. БСК явились
одной из главных причин преждевременной смертности
лиц трудоспособного возраста.
В 1992–1996 гг. в стране в общей сложности умерло
3,5 млн человек. Исправление сложившейся ситуации
было признано одной из главных государственных задач.
Артериальная гипертензия (АГ), по данным экспертов Всемирной организации здравоохранения, признана ведущим фактором, определяющим высокую смертность населения в современном обществе. У больных АГ
в 3–4 раза чаще развивается ишемическая болезнь сердца
(ИБС) и в 7 раз чаще — инсульт. Анализ причин развития
сердечно-сосудистых и цереброваскулярных заболеваний,
проведенный в США, показал, что у 69% больных, впервые перенесших инфаркт миокарда (ИМ), у 77% с сердечной недостаточностью и у 77% пациентов с инсультом
в анамнезе присутствовала неконтролируемая АГ [1].
Проведенные в 90-х гг. эпидемиологические исследования позволили установить высокую распространенность АГ среди населения России (39,9%
у мужчин, 41,1% у женщин), что свидетельствовало о развитии эпидемии АГ и неудовлетворительном ее контроле.
В 2002 г. было официально зарегистрировано только
6,2 млн больных АГ, что составило всего 15% всех лиц
с повышенным АД среди населения. Значительная часть
людей не были информированы о наличии у них АГ, опасной для здоровья и жизни свойственными ей тяжелыми
осложнениями [2, 3].
Риск сердечно-сосудистой смерти удваивается на
каждое повышение систолического артериального давления (САД), равное 20 мм рт.ст., и диастолического артериального давления (ДАД) в 10 мм рт.ст., начиная с уровня
135/85 мм рт.ст. Оптимальный уровень АД, при котором
наблюдается минимальный риск развития ССЗ, равен
115/75 мм рт.ст. [4]. У лиц с АГ ожидаемая продолжительность жизни короче на 5,1 лет у мужчин и на 4,9 лет
у женщин по сравнению с лицами с нормальным АД.
В период перестройки сформировался комплекс проблем в обществе и в здравоохранении: прогрессивный
рост факторов риска ССЗ, включая высокую распространенность АГ и ее плохой контроль среди населения; ослабление профилактической деятельности медицинскими
учреждениями; устаревшая нормативно-правовая база
в части организации медицинской помощи кардиологическим больным; недостаточная подготовка врачей по
вопросам современных методов профилактики, диагностики и лечения кардиологических больных; разрушение
системы диспансерного наблюдения. Все вышеперечисленное относится к числу факторов резкого снижения
качества оказания медицинской помощи больным АГ
и другими ССЗ. Указанные проблемы требовали принятия безотлагательных мер по борьбе с высокой смертностью населения от ССЗ.
Накопленный к этому периоду времени мировой
и отечественный опыт свидетельствовал о возможности снижения заболеваемости и смертности от БСК, в
первую очередь от инсультов при эффективном лечении
АГ. Профилактические программы, проведенные в ряде
городов бывшего СССР в 80-х гг. прошлого столетия
специалистами Всесоюзного кардиологического научного центра совместно со специалистами НИИ неврологии РАМН, доказали эффективность воздействия на АГ
как ведущий фактор риска ССЗ. Лечение лиц с АГ в тече-
ние 5 лет привело к снижению заболеваемости инсультом
на 50%, инфарктом миокарда — на 23% и смертности от
инсультов на 48,4% [5]. По данным экспертов Всемирной
организации здравоохранения, снижение повышенного
АД в популяции даже на 2 мм рт.ст. приводит к снижению уровня смертности населения от инсульта на 6%,
а от ИБС — на 4% [4].
Уменьшение числа инсультов, регистрируемое в большинстве экономически развитых стран мира в течение
последнего десятилетия, связывают главным образом
с переходом к активной государственной политике в отношении охраны здоровья населения этих стран: оздоровлением образа жизни, характера питания и особенно
с успехами в борьбе с важнейшим фактором риска развития БСК — АГ. Проведенные за 9 лет мероприятия по оздоровлению образа жизни людей (рациональное питание,
повышение физической активности) и лечению больных
АГ современными медикаментозными средствами в Финляндии привели к снижению заболеваемости инсультом
и смертности от цереброваскулярных болезней на 56%,
включая лиц трудоспособного возраста [6].
По инициативе академика Е.И. Чазова, вопрос о влиянии ССЗ на состояние здоровья нации был предметом
обсуждения 30 июня 1995 г. на Межведомственной комиссии Совета Безопасности РФ по охране здоровья населения, которая рекомендовала Министерству здравоохранения РФ разработать Федеральную целевую программу
(ФЦП) по борьбе с АГ в целях профилактики развития
ее тяжелых осложнений (инсульт, ИБС, ИМ, сердечная
недостаточность).
По поручению Правительства РФ Российский кардиологический научно-производственный комплекс Министерства здравоохранения РФ (РКНПК) как головное
учреждение по проблемам кардиологии в стране разработал комплекс мероприятий по борьбе с высокой смертностью от ССЗ, который лег в основу ФЦП «Профилактика
и лечение артериальной гипертонии в Российской Федерации», утвержденной постановлением Правительства
РФ от 17 июля 2001 г. № 540, а с 2007 года — в подпрограмму «Артериальная гипертония» ФЦП «Предупреждение и борьба с социально значимыми заболеваниями»
(2007–2012) (далее Программа) [7].
Согласно рекомендациям экспертов Всемирной организации здравоохранения, в Программе предусмотрена
популяционная стратегия, направленная на снижение
частоты встречаемости факторов риска ССЗ среди населения с целью предупреждения развития новых случаев
заболеваний, и индивидуальная стратегия, заключающаяся в повышении эффективности лечения больных АГ.
Основными задачами Программы были: разработка
мер по выявлению больных АГ на ранних стадиях заболевания; разработка современных эффективных методов
профилактики, диагностики, лечения АГ, реабилитации
больных, перенесших инсульт вследствие АГ, и внедрение их в широкую практику; повышение квалификации
участковых терапевтов, врачей общей практики, педиатров, неврологов и кардиологов в области кардиологии;
разработка мероприятий по повышению приверженности
к лечению больных АГ («Школы здоровья»); создание
системы динамического контроля эпидемиологической
ситуации по АГ и системы учета больных АГ (регистр
АГ), а также укрепление материально-технической базы
амбулаторно-поликлинических учреждений, кабинетов
врачей общей практики, терапевтических и кардиологических стационаров. Конечная цель Программы —
снижение уровня заболеваемости и смертности населения от БСК, включая инсульт.
5
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
6
Принятие и реализация Программы не только дали
возможность решить часть указанных проблем за счет
выделенных (хотя и достаточно ограниченных) средств,
но и послужили стимулом к активной деятельности по
организации борьбы с АГ на местах главных кардиологов
и терапевтов регионов, ведущих профессоров-кардиологов вузов и органов управления здравоохранением субъектов РФ. В 75 субъектах реализовывались аналогичные
Федеральной Региональные программы. Работа по борьбе
с АГ не ограничивалась мероприятиями Программы,
а чаще выполнялась за счет основной деятельности медицинских организаций, а также путем привлечения внебюджетных и спонсорских средств. Более чем в 65 субъектах РФ регулярно освещались вопросы профилактики
ССЗ в средствах массовой информации. В течение ряда
лет в 100 городах России проводились акции по измерению АД у населения; организовывались «Дни здоровья»;
проводились измерения АД в учебно-образовательных
учреждениях; в сельской местности — подворовые обходы с измерением АД у всех членов каждой семьи [7].
В первичном звене здравоохранения выполнялась активная работа по обнаружению больных АГ: АД
измеряли у всех лиц, обратившихся по любому поводу
в амбулаторно-поликлинические учреждения, были организованы кабинеты доврачебного контроля, кабинеты
профилактики, в последние годы — «Кабинеты здоровья». В результате осуществления указанных мероприятий
за период с 2002 по 2011 гг. более чем у 8 млн лиц была
впервые диагностирована АГ.
По инициативе РКНПК (акад. Е.И. Чазов) совместно с Союзом журналистов России (В.Л. Богданов), был
создан Благотворительный общественный фонд «Артериальная гипертония», силами которого (врачи-кардиологи
и журналисты) была проведена огромная просветительская работа по профилактике АГ: прошла серия конференций в ряде городов России, опубликовано более
300 научно-популярных статей по проблемам АГ.
Большая организационно-методическая работа
РКНПК по обсуждению конкретных тактических и стратегических мер по борьбе с АГ и ССЗ была выполнена
на съездах, научно-практических конференциях, совещаниях в федеральных округах, субъектах РФ, а также на
ежегодных Всероссийских съездах кардиологов.
Обновлена нормативно-правовая база по оказанию
медицинской помощи больным АГ. Утвержденный Министерством здравоохранения РФ приказ от 24 января
2003 г. № 4 «О мерах по совершенствованию организации
медицинской помощи больным с артериальной гипертонией в Российской Федерации» способствовал использованию в работе врачей современной классификации АГ,
новых методов профилактики, диагностики и лечения
АГ, а Положение об организации деятельности «Школ
здоровья» для больных АГ — активному их развитию.
Многочисленными зарубежными и отечественными исследованиями показана значимость «Школ здоровья»,
в которых проводится просветительская работа с больными АГ по вопросам профилактики ССЗ, в повышении
приверженности к лечению. Формируемое у больных
сознание причин болезни, освоение методов контроля АД, приемов самопомощи в неотложных ситуациях
и методов профилактики способствует улучшению течения заболевания и профилактике осложнений АГ. Доказана экономическая эффективность работы «Школ
здоровья»: снижаются прямые и непрямые затраты
на лечение АГ за счет уменьшения финансовых потерь, связанных с оказанием различных видов медицинских услуг (вызовы скорой медицинской помощи,
оплата больничных листов). В группе больных, ознакомившихся с просветительскими программами, в течение
года в 6,3 раза сократились затраты на госпитализацию,
в 7,9 раза — на амбулаторную помощь и в 18,3 раза —
на вызовы скорой медицинской помощи [8].
В 2006 г. в амбулаторно-поликлинических учреждениях и стационарах страны уже функционировало
2788 «Школ здоровья»; в 2002–2010 гг., по данным Министерства здравоохранения РФ, свыше 7,3 млн больных
АГ прослушали информационно-просветительские программы.
Особое внимание было уделено повышению квалификации врачей первичного звена здравоохранения в области кардиологии. В рамках реализации Программы было
издано и передано во все регионы для врачей практического здравоохранения 48 пособий и методических рекомендаций, учебных видеофильмов. Активную позицию
в вопросах образования врачей по кардиологии выполняет Российское медицинское общество по АГ (РМОАГ),
созданное в 2006 г. по инициативе РКНПК с поддержкой
Европейского общества по артериальной гипертензии.
В 55 субъектах РФ функционируют региональные отделения РМОАГ, которые возглавляют ведущие кардиологи
этих регионов. Ежегодно проводится более 100 образовательных школ для врачей. Только в 2011 г. было проведено
148 школ и 20 круглых столов по профилактике, особенностям диагностики и лечения различных форм АГ,
включая детей и подростков. С 2006 г. более 50 тыс. врачей
различных специальностей (терапевты, кардиологи, врачи общей практики — семейные врачи, неврологи, педиатры) получили сертификаты по программе этих школ.
Также были разработаны новые методы диагностики,
профилактики и лечения больных АГ. В выполнении
научно-исследовательских работ в рамках Программы
принимали участие 17 научных организаций РАМН, Министерства здравоохранения, Министерства образования
и Министерства сельского хозяйства РФ. Трудно осветить
все новые разработки, выполненные за эти годы. В популяционных исследованиях установлены факторы риска
развития АГ у подростков в возрасте 15–17 лет, диагностические критерии АГ. Для педагогов общеобразовательных школ разработаны обучающие программы и модули
для детей и подростков по рациональному питанию,
физической активности и формированию здорового образа жизни. Для врачей, проводящих занятия в «Школах
здоровья», созданы обучающие программы и модули по
АГ. Разработан комплекс неинвазивных методов функциональной (электрокардиография, вариабельность ритма
сердца, суточное мониторирование АД, метод самоконтроля АД и др.) и ультразвуковой диагностики с использованием новых технологий получения, обработки данных
и совершенствования методов контроля за структурнофункциональным состоянием органов-мишеней у больных АГ в процессе лечения. Для больных АГ с избыточным
весом внесены новые коррективы в оценку гипертрофии левого желудочка, определяемой методом электрои эхокардиографии [9]. Впервые установлено, что такие методы, как корригированная ортогональная векторкардиография и дипольная электрокардиотопография,
являются чувствительными и адекватными в диагностике гипертрофии левого желудочка [10]. Разработаны
новые способы оценки вазомоторной функции эндотелия:
с использованием регистрации скорости пульсовой волны
в плечевой артерии при объемной сфигмографии и пульсового кровенаполнения кисти при реовазографии (реографические аппараты широко применяются в практическом здравоохранении) [11].
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
РЕДАКЦИОННАЯ СТАТЬЯ
В ходе работ по изучению суточного профиля АД,
оцененного методом суточного мониторирования
(СМАД) была определена значимость его характеристик
для поражения органов-мишеней и прогноза заболевания, проведена их количественная оценка с использованием автоматической обработки. Разработаны правила его проведения, типовое заключение по результатам
обследования, показания к проведению в учреждениях
практического здравоохранения. Метод СМАД успешно
внедрен в практику для оценки особенностей течения
АГ и адекватности лечения [12]. Научное обеспечение
специалистами РКНПК разработки приборов для СМАД
совместно с отечественными производителями медицинской техники позволило обеспечить импортозамещение
этих приборов.
РКНПК был одним из первых научных учреждений,
в котором начали разрабатывать инновационные информационные технологии в кардиологии. В 80-х гг. прошлого столетия во Всесоюзном кардиологическом научном
центре (ранее РКНПК) была создана методика передачи
электрокардиограммы от пациента к врачу на расстоянии.
В настоящее время разработана оригинальная система
цифровой электрокардиограммы с использованием современных средств связи (через Интернет), с централизованным хранением и экспертной оценкой данных. Принципиальным отличием от существующих в стране аналогов
является разработка специального модуля, сопряженного
с медицинскими информационными системами.
Специалистами РКНПК разработаны новые дифференцированные подходы к диагностике и индивидуальные методы лечения сложных для практического здравоохранения рефрактерных форм АГ. Впервые в России
внедрен в клиническую практику инновационный метод
лечения больных с тяжелой, резистентной к лечению АГ —
селективная катетерная аблация почечных симпатических нервов [13]. Разработаны алгоритмы диагностики
синдрома апноэ во сне у больных АГ для разных уровней
медицинских организаций [14, 15]; метаболического синдрома (фактор риска развития ССЗ и сахарного диабета),
распространенность которого в нашей стране значительна [16, 17]. Изданы российские рекомендации по диагностике и лечению метаболического синдрома. Изучена
эффективность терапии различными классами гипотензивных препаратов у больных АГ, в т.ч. у перенесших
нарушения мозгового кровообращения и транзиторные
ишемические атаки.
РКНПК совместно с неврологами Центра неврологии
РАМН, которые под руководством директора Центра,
академика РАМН З.А. Суслиной активно подключились
к реализации Программы, были установлены новые, ранее неизученные в нашей стране факторы риска развития
инсульта при АГ, к которым относятся утолщение комплекса интима–медиа общих сонных артерий и «немые»
лакунарные инфаркты мозга [18–20].
Специалистами Научного центра неврологии РАМН
также разработан ряд новых методик восстановления
нарушенных функций у больных, перенесших инсульт
вследствие АГ, с использованием различных, включая
отечественные, реабилитационных систем и комплексов,
в которых предусмотрены индивидуальные подходы к нагрузкам у больных в раннем восстановительном периоде
инсульта, что позволяет избежать свойственных этому
периоду существенных колебаний АД.
С 90-х гг. прошлого столетия в клинической практике в России стали появляться новые классы антигипертензивных препаратов. Известен факт различной
чувствительности больных АГ к антигипертензивным
препаратам, которая зависит от расовой и этнической
принадлежности, генетического фактора, характера питания, индивидуальных процессов метаболизма и др.
Данные, полученные в ходе лечения на одной популяции
больных, могут отличаться от эффекта воздействия на
другую популяцию. Было необходимо проведение крупномасштабных исследований по оценке эффективности
и безопасности новых классов антигипертензивных препаратов, их комбинаций, различных режимов лечения
у больных АГ российской популяции. По инициативе,
под руководством и при участии специалистов РКНПК,
а также практических врачей более чем из 40 регионов
страны была проведена серия крупных многоцентровых исследований («РОСА», «ЭКО», «ИРИС», «КЛИПАККОРД», «МИНОТАВР», «ЭТНА», «РЕГАТА», «ПРИЗ»,
«ФАГОТ» и др.) по изучению эффективности и безопасности различных новых антигипертензивных средств, их
комбинаций при разных формах и вариантах течения АГ
с целью разработки оптимальных методов и алгоритмов
лечения [21–26]. Подтверждено, что адекватная антигипертензивная терапия, обеспечивающая долговременное
поддержание целевого АД, позволяет более чем в 3 раза
снизить частоту развития ССЗ у больных АГ. В результате
этих исследований был накоплен отечественный опыт по
эффективности, безопасности различных классов антигипертензивных препаратов, их комбинаций у больных
с разными формами АГ, что наряду с другими разработками в 2004 г. легло в основу Российских рекомендаций
по диагностике и лечению больных АГ и их обновленных
версий в 2008 и 2010 гг.
Для оценки эффективности проводимых мероприятий по борьбе с АГ было создано 2 инновационных метода
на основе Интернет-технологий: мониторинг эпидемиологической ситуации по АГ (Мониторинг) и Регистр АГ.
По данным Мониторинга, разработанного специалистами ФГБУ «ГНИЦ ПМ», на представительной выборке
населения более чем из 40 субъектов РФ были получены
объективные данные о распространенности факторов
риска ССЗ, АГ среди населения и эффективности их контроля. При первоначальном обследовании (2003–2004)
были получены базовые данные, с которыми проводилось
сравнение в последующие годы.
Пристальное внимание органами управления здравоохранением уделялось вопросу качества оказания медицинской помощи, был издан приказ Министерства
здравоохранения РФ по ее улучшению; разработаны стандарты оказания медицинской помощи больным с ССЗ.
Вместе с тем вопросы качества организации медицинской
помощи, трактуемые ФЗ № 323 «Об основах охраны здоровья граждан в Российской Федерации» как своевременность оказания медицинской помощи, правильность
выбора методов профилактики, диагностики, лечения
и реабилитации и степень достижения запланированного
результата, остаются до конца нерешенными.
Профилактика осложнений АГ в большей степени
зависит от эффективности работы врачей амбулаторно-поликлинического звена здравоохранения, поскольку именно в этих медицинских организациях состоит
под наблюдением преобладающая часть больных АГ.
В ряде стран (Великобритания, Финляндия и др.)
для определения недостатков в медицинской помощи
используют регистры заболеваний (Регистр острого коронарного синдрома, Регистр инсульта, Регистр АГ и др.)
и клинический аудит.
Для получения объективной информации о качестве лечебной работы врачей с больными АГ с позиций
полноты и адекватности диагностики и достижения целей
7
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
40
30
22
26
20
10
22
20
20
20
9
0
2005 г.
2009 г.
2006 г.
2010 г.
2007 г.
2011 г.
2008 г.
Рис. 1. Доля больных артериальной гипертензией (%), у которых
был достигнут и поддерживался целевой уровень артериального
давления.
8
лечения специалистами РКНПК совместно со специалистами Саратовского НИИ кардиологии на основе
инновационных Интернет-технологий был создан Регистр АГ (компьютерная программа), который с 2005 г.
выборочно внедрен в работу поликлиник и кардиодиспансеров 12 субъектов РФ [27]. В течение 2005–2012 гг.
были набраны медицинские данные из амбулаторных
историй болезни (клинико-демографические характеристики, объем выполненных диагностических, профилактических и лечебных мероприятий) более чем о 77 тыс.
первичных больных АГ, часть из которых наблюдалась
в динамике за этот период времени. Среди них 38,8%
мужчин (средний возраст 58±8 лет) и 61,2% женщин
(средний возраст 60±11 лет).
Полноту и адекватность обследования и лечения
оценивали с помощью специально разработанных индикаторов (формализованных причин невыполнения
предписанных процедур по оценке качества оказания
медицинской помощи), рассчитывающихся в Регистре
АГ автоматически. Анализ качества лечебно-диагностической работы проводили путем сравнения индикаторов
с российскими рекомендациями «Диагностика и лечение
артериальной гипертензии», утвержденных Российским
медицинским обществом по АГ и Всероссийским научным обществом кардиологов в 2010 г. Кроме того, изучали
причины невыполнения индикаторов.
Одной из задач, стоящих перед врачом, является определение индивидуального сердечно-сосудистого риска
у больного АГ (т.е. риска развития тяжелых осложнений),
который определяется не только степенью повышения АД,
но и наличием других факторов риска (дислипидемии, нарушения углеводного обмена, отягощенной наследственности и др.), степенью вовлеченности в патологический
процесс органов-мишеней (сосуды, сердце, мозг, почки) и
ассоциированными клиническими состояниями, фактически являющимися осложнениями АГ: ИБС, перенесенный
ИМ, цереброваскулярное заболевание и др.
Диагностика факторов риска в 2005 г. в полном объеме проводилась только у 5%, а в 2012 г. — у 12% больных.
Такие важные показатели, в т.ч. и для выбора тактики лечения, как общий холестерин, холестерин липопротеидов
низкой плотности и триглицериды, в 2005 г. не оценивали
у 33,51 и 48% больных АГ, соответственно. В 2011 г. работа врачей по определению факторов риска существенно
улучшилась.
Диагностика поражения органов-мишеней и ассоциированных клинических состояний была проведена у
90% больных АГ, из них только у 37% пациентов обследование проводилось в соответствии с Рекомендациями.
У остальных больных было недостаточно документированных данных для обоснованного суждения об ассоциированных клинических состояниях и поражении
органов-мишеней. Например, 13% больных АГ не была
выполнена электрокардиография, а при обследовании
методом ультразвуковой диагностики сердца отсутствовали количественные данные о массе миокарда левого
желудочка, что считается «золотым стандартом» в оценке гипертрофии левого желудочка. Не лучшим образом
проводилось обследование почек. У 33% больных не
было анализов мочи, у 32,7% в анализах крови отсутствовали данные о содержании креатинина. Вместе с тем
креатинин был повышен у 22% больных из числа тех,
у которых он определялся. Это свидетельствовало о том,
что у каждого 4–5-го пациента имело место нарушение
функции почек, на которое нередко не обращали должного внимания. С учетом размера обследуемой выборки
(свыше 77 тыс. больных АГ) и учитывая только один факт
снижения функции почек, можно констатировать, что заболевание у значительного числа больных АГ находится
далеко не на ранней стадии.
Качество диспансерного наблюдения, а следовательно, и эффективность лечения оценивали по достижению
и поддержанию целевого уровня АД в течение каждого
года наблюдения. В 2005 г. целевое АД в среднем по всей
выборке достигалось только у 9% больных, в последующие годы этот показатель улучшился, но в течение последних 3 лет (2009–2011) сохранялся на одном уровне
и составлял 20% (рис. 1). Следует также сказать о значительно более высоких показателях качества диагностики
и лечения (достижение целевого АД у 50–60% наблюдаемых больных) в кардиологических диспансерах.
Таким образом, данные Регистра АГ, полученные на
первом этапе его работы (2005), свидетельствовали о недостаточном обследовании больных АГ, что приводило
к недооценке суммарного сердечно-сосудистого риска
и, следовательно, неадекватному выбору тактики лечения. У 91% больных АГ не была достигнута цель лечения,
вследствие чего они продолжали находиться в зоне высокого риска развития сердечно-сосудистых осложнений
(инсульт, ИМ). В учреждениях кардиологического профиля (кардиоцентры, кардиодиспансеры) врачи-кардиологи,
как наиболее подготовленные по вопросам кардиологии,
чем участковые врачи-терапевты, значительно лучше проводили диагностическую и лечебную работу с больными
АГ. В связи с этим в последующие годы особое внимание
было уделено подготовке участковых врачей-терапевтов
первичного звена здравоохранения, врачей общей практики по вопросам профилактики, диагностики и лечения АГ.
Данные Регистра АГ о качестве обследования и лечения больных АГ в первичном звене здравоохранения
и выявленные недостатки в этой работе ежегодно обсуждались на конференциях с врачами, главными кардиологами и главными терапевтами субъектов РФ для принятия
управленческих решений с целью улучшения оказания
медицинской помощи больным.
Итоги реализации Программы в 2002–2012 гг. были
оценены по данным Росстата, эпидемиологического мониторинга и Регистра АГ. По некоторым показателям,
отсутствующим в Росстате в 2012 г., данные приведены
по 2011 г.
В целом, за указанные годы проведения различных
мероприятий по борьбе с АГ в стране получены следующие результаты:
• в 1,7 раза улучшилась выявляемость первичных больных АГ; с 2002 по 2011 г. АГ была диагностирована
у 8,1 млн лиц;
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
РЕДАКЦИОННАЯ СТАТЬЯ
• охват диспансерным наблюдением больных АГ увеличился с 40,5% в 2002 г. до 49,1% в 2011 г.
Повторные обследования представительной выборки
населения в регионах методом эпидемиологического мониторинга продемонстрировали положительные тенденции в лечении больных АГ:
• врачи стали использовать современные антигипертензивные препараты с доказанной способностью
улучшать прогноз заболевания, что свидетельствует
о повышении квалификации врачей-терапевтов и врачей-кардиологов;
• наблюдается улучшение показателей лечения больных
АГ, оцениваемых по достижению целевого АД в процессе лечения; так, если в 2003–2004 гг. эффективность
лечения составляла 23,1%, то в 2007–2008 гг. она повысилась до 30,4% (в США данный показатель равен 56%
и считается наиболее высоким среди всех стран мира);
вдвое уменьшилось число больных (мужчин и женщин)
с тяжелыми формами АГ, что также свидетельствует о
повышении эффективности лечения.
По данным Регистра АГ, также установлены положительные тенденции в обследовании и лечении больных АГ
в первичном звене здравоохранения в 2009–2012 гг. Улучшилось качество диагностики поражений органов-мишеней (сердца, сосудов, почек) и ассоциированных клинических состояний (ИБС, сердечная недостаточность
и др.). Повысилась эффективность лечения больных АГ.
В 2005 г. только у 9% больных достигался целевой уровень
АД, в последующие годы (2007–2012) этот показатель
увеличился до 20–26%.
Результатами проведенных мероприятий по борьбе
с АГ стали позитивные изменения в показателях смертности населения от БСК в стране, начиная с 2004 г., когда
появилась тенденция к их снижению (рис. 2).
Уровень смертности от БСК в 2011 г. снизился до 749
(в 1,2 раза) по сравнению с 2003 г., степень снижения составила 19%. В 2012 г. (январь–ноябрь) также регистрировалось снижение коэффициента смертности от БСК
до 729,5 (на 100 тыс. населения). За период 2003–2012 гг.
было сохранено более 309 тыс. человеческих жизней.
Анализ динамики смертности населения от БСК
за период 1993–2012 гг. показал, что за 10-летний период
(1993–2002) число умерших превышало число сохраненных жизней в 3,6 раза. В 2002–2012 гг. принципиально
изменилась направленность вектора смертности от ССЗ:
число сохраненных жизней превысило число умерших
лиц в 6,2 раза.
Важнейшим результатом явилось снижение смертности лиц трудоспособного возраста от БСК, начиная
с 2006 г. По сравнению с 2005 г. число смертей в 2011 г.
снизилось на 71,6 тыс. случаев, или на 30,4% (рис. 3).
Наиболее выраженные позитивные изменения наблюдаются в показателях смертности от цереброваскулярных
болезней. За период с 2004 по 2012 гг. число умерших
от этих заболеваний сократилось на 154,8 тыс. Уровень
смертности от цереброваскулярных болезней снизился
в 1,5 раза: с 339,9 в 2003 г. до 224,1 в 2012 г. (январь–ноябрь); степень снижения составила 34,1%.
С учетом того, что АГ является важнейшим фактором риска развития фатальных инсультов, был проведен
анализ динамики смертности населения от инсультов
в 2001–2011 гг., который показал снижение на 114,8 тыс.
случаев, начиная с 2004 г. (рис. 4).
С 2006 г. регистрируют ежегодное снижение смертности от цереброваскулярных болезней лиц трудоспособного возраста. Число умерших за этот период уменьшилось
на 14,5 тыс., или на 31,5%. Снижение частоты в большей
Число умерших на 100 тыс. населения
950
907
895,4 908
900
864,6
927,5
864,8
850
833,9
800
835,5
801 805,9
749
750
700
650
600
550
500
2001
2002
2003
2004
2005
2006
2007
2008
2009
2010
2011
Годы (январь–декабрь)
Рис. 2. Динамика уровня смертности населения от болезней
системы кровообращения за период 2001–2011 гг.
Абсолютное число умерших
25000
9
18300
15884
19500
Снижение
14000
8500
11103
6768
5361
3000
292
-2500
-1514
-8000
-13500
-15392
-19000
-12356
-17639
-24500
-24568
-3000
2001
2002 2003 2004
2005
2006 2007 2008
2009 2010
2011
Годы
Рис. 3. Динамика () числа умерших лиц трудоспособного возраста от болезней системы кровообращения в 2001–2011 гг.
Число умерших
25000
19500
Снижение
5364
14000
239
8500
3000
-5149
-2500
-8000
-7189
-10143
-10563
-9977
-14625
-13500
-12312
-19000
-24500
-24502
-25532
-3000
2001
2002 2003 2004
2005
2006 2007 2008
2009 2010
2011
Годы
Рис. 4. Динамика () числа лиц, умерших то инсульта в 2001–
2011 гг.
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
степени цереброваскулярных болезней, включая инсульт,
и смертности от них при проведении мероприятий по
борьбе с АГ согласуется с общемировыми данными о том,
что АГ является наиболее значимым фактором риска развития инсультов и хронических форм цереброваскулярных заболеваний.
С 2004 г. фиксируют снижение уровня смертности
от ИБС, число смертей от которой сократилось более
чем на 66,2 тыс. случаев. Снижение смертности от ИБС
установлено и среди лиц трудоспособного возраста: число
умерших с 2006 по 2011 гг. (по сравнению с 2005 г.) сократилось на 34,1 тыс. случаев, или на 29,8%. В предупреждении смертности от ИБС наряду с адекватным лечением
АГ большое значение имеет контроль и других факторов
риска ССЗ — дислипидемии, низкой физической активности, отказа от курения, нерационального питания и др.,
распространенность которых среди населения России
остается высокой.
Анализ показателей заболеваемости БСК с временной утратой трудоспособности продемонстрировал снижение числа случаев заболеваний с 2,7 млн в 2002 г.
до 2,3 млн в 2011 г., и числа дней временной нетрудоспособности — с 47,8 до 38,7 млн. Оценка заболеваемости с временной утратой по причине АГ за этот
период также показала снижение числа случаев с 1,5
до 1,2 млн и дней временной нетрудоспособности —
с 20,3 до 14,6 млн, что позволило значительно сэкономить
денежные средства.
Смертность от БСК, занимая лидирующее место среди всех причин смертности населения, играет важную
роль в развитии демографической ситуации в стране.
Снижение смертности от ССЗ, регистрируемое в 2004–
2012 гг., внесло свой вклад в демографические показатели.
Увеличилась ожидаемая продолжительность жизни как
мужчин (на 3,6 года), так и женщин (на 2,4 года).
Подводя итоги реализации мероприятий по борьбе
с АГ в нашей стране, следует еще раз подчеркнуть, что
снижение смертности от БСК достигнуто за счет раннего
выявления лиц с АГ; разработки и внедрения в практическое здравоохранение новых методов профилактики
(«Школы здоровья»), диагностики и лечения больных АГ;
повышения образовательного уровня врачей первичного
звена здравоохранения в области кардиологии, а также в
результате использования программно-целевого подхода
государства в решении проблемы, направленной на достижение конечного результата — снижения смертности
от болезней системы кровообращения (реализация Федеральной целевой программы по борьбе с АГ).
10
ЛИТЕРАТУРА
1.
Heart disease and Stroke statistics — 2012 update: a report from the
American Heart Association. Circulation. 2012; 125: 2–220.
2. Чазов Е.И. Руководство по артериальной гипертонии.
М.: Медиа-Медика. 2005.
3. Чазова И.Е. Ощепкова Е.В. Чихладзе Н.М. Артериальная гипертония (принципы диагностики и лечения). Пос.
для врачей. М. 2005.
4. Борьба с артериальной гипертонией. Доклад Комитета экспертов
ВОЗ. Всемирная организация здравоохранения. Женева. 1996.
5. Бритов А.Н., Оганов Р.Г. Национальная программа борьбы
с артериальной гипертонией в СССР. Тер. архив. 1985; 11: 67.
6. Jakovljevie D., Sarti C., Sivenius J., Torppa J., Mahonen M.,
Immonen-Raiha P., Kaarsalo E., Alhainen K., Kuulasmaa K.,
Tuomilehto J., Puska P., Salomaa V. Socioeconomic status and
ischemic stroke: The FINMONICA Stroke Register. Stroke. 2001;
32 (7): 1492–1498.
7. Ощепкова Е.В. Федеральная целевая программа «Профилактика и лечение артериальной гипертонии в Российской
Федерации» — 5-летние итоги ее реализации. Здравоохранение
в Российской Федерации. 2007; 5: 18–21.
8. Калинина А.М., Ощепкова Е.В., Позднякова Ю.М. Оценка
эффективности «Школ здоровья» для больных артериальной
гипертонией в первичном звене здравоохранения. Профилактика заболеваний и укрепление здоровья. 2006; 4: 41–47.
9. Салтыкова М.М., Ощепкова Е.В. Атауллаханова Д.М., Атауллаханова Д.М., Лазарева Н.В., Бобохонова А.С., Рогоза А.Н.
Электрокардиографическая диагностика гипертрофии миокарда левого желудочка у пациентов с артериальной гипертензией. Тер. архив. 2006; 78 (12): 40–45.
10. Блинова Е.В., Сахнова Т.А., Сергакова Л.М., Атауллаханова Д.М., Ощепкова Е.В., Лазарева Н.В., Аиду Э.А.И., Трунов В.Г., Титомир Л.И. Новые подходы к диагностике гипертрофии левого желудочка методом дипольной электрокардиотопографии («ДЭКАРТО»). Тер. архив. 2005; 4: 8–10.
11. Рогоза А.Н., Заирова А.Р., Ощепкова Е.В. Измерение скорости пульсовой волны при пробе с реактивной гиперемией как
метод оценки вазомоторной функции эндотелия у больных
гипертонической болезнь. Тер. архив. 2008; 4: 29–33.
12. Рогоза А.Н., Ощепкова Е.В., Цагареишвили Е.В., Гориева Ш.Б.
Современные неинвазивные методы измерения артериального давления для диагностики артериальной гипертонии
и оценки эффективности антигипертензивной терапии.
Пос. для врачей. М. 2007.
13. Данилов Н.М., Чазова И.Е., Савченко А.П. Реноваскулярная
артериальная гипертензия: диагностика и лечение. Системные
гипертензии. 2009; 1: 71–73.
14. Чазова И.Е., Литвин А.Ю. Синдром обструктивного апноэ сна
и связанные с ним сердечно-сосудистые осложнения. Кардиология. 2002; 11: 86–92.
15. Болотова М.Н., Галицин П.В., Колос И.П., Литвин А.Ю., Чазова И.Е. Синдром обструктивного апноэ сна как независимый
фактор риска развития сердечно-сосудистых осложнений. Кардиоваскулярная терапия и профилактика. 2009; 5: 103–112.
16. Чазова И.Е., Мычка В.Б. Метаболический синдром. Кардиоваскулярная терапия и профилактика. 2003; 3: 32–38.
17. Мамырбаева К.М., Мычка В.Б., Чазова И.Е. Артериальная
гипертензия и метаболический синдром. Consilium Medicum.
2004; 5: 320–323.
18. Прокопович М.Е., Варакин Ю.Я., Ощепкова Е.В., Реброва О.Ю.
Прогностические факторы развития острых нарушений
мозгового кровообращения при гипертонической болезни.
Тер. архив. 2006; 10: 14–18.
19. Суслина З.А., Варакин Ю.Я., Максимова М.Ю., Ощепкова Е.В. Концептуальные основы профилактики сосудистых
заболеваний головного мозга. Клиническая фармакология
и терапия. 2004; 5: 35–43.
20. Варакин Ю.Я. Профилактика ОНМК. Инсульт: диагностика, лечение, профилактика. 2-е изд. Монография под ред.
З.А. Суслиной, М.А. Пирадова. М.: МЕДПресс-информ. 2009.
С. 155–196.
21. Чазова И.Е., Остроумова О.Д. ФЛЕЙТА — российская рандомизированная открытая многоцентровая сравнительная
программа по оценке эффективности и безопасности лечения пациентов с артериальной гипертонией и когнитивными
нарушениями фиксированным комбинированным препаратом «Тарка» (Abbott Laboratories, США) по сравнению с про-
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
РЕДАКЦИОННАЯ СТАТЬЯ
извольными антигипертензивными препаратами длительного
действия («пошаговая» стратегия). Системные гипертензии.
2009; 4: 34–36.
22. Чазова И.Е., Мартынюк Т.В. Оптимизация антигипертензивной терапии у больных артериальной гипертонией высокого
риска: новая российская программа «СТРАТЕГИЯ А». Системные гипертензии. 2010; 2: 47–52.
23. Чазова И.Е., Фомин В.В., Разуваева М.А., Вигдорчик А.В.
Резистентная и неконтролируемая артериальная гипертония в
Российской Федерации: эпидемиологическая характеристика
и подходы к лечению (Российский регистр неконтролируемой
и резистентной артериальной гипертонии «РЕГАТА»). Кардиологический вестник. 2011; 1: 40–48.
24. Чазова И.Е., Мартынюк Т.В., Колос И.П. Первые результаты
Российской программы «СТРАТЕГИЯ» у пациентов с артериальной гипертензией: оценка эффективности Нолипрела при
недостаточном контроле артериального давления. Consilium
medicum. 2007; 5: 5–9.
25. Чазова И.Е., Ратова Л.Г., Галявич А.С., Гапон Л.И., Ивашкин В.Т., Кательницкая Л.И., Марцевич С.Ю., Недогода С.В.,
Никитин Ю.П., Оганов Р.Г., Петричко Т.А., Симонова Г.И.,
Соколов И.М., Фомин И.В., Шляхто Е.В, Якусевич В.В.
Эффективность антигипертензивной терапии у больных артериальной гипертонией в зависимости от риска сердечно-сосудистых осложнений. Кардиоваскулярная терапия и профилактика. 2008; 2: 78–82.
26. Чазова И.Е., Беленков Ю.Н., Ратова Л.Г. Российское исследование по оптимальному снижению артериального давления
(«РОСА 2»): два года наблюдения. Что в итоге? Кардиоваскулярная терапия и профилактика. 2005; 4: 4–14.
27. Довгалевский П.Я., Ощепкова Е.В., Гриднев В.И. Регистр артериальной гипертонии. Тер. архив. 2007; 1: 46–48.
КОНТАКТНАЯ ИНФОРМАЦИЯ
Чазова Ирина Евгеньевна, доктор медицинских наук, профессор, член-корреспондент РАМН, директор ИКК
им. А.Л. Мясникова ФГБУ «РКНПК» МЗ РФ
Адрес: 121552, Москва, ул. 3-я Черепковская, д. 15-а; тел.: (495) 415-52-05; e-mail: tt34@cardio.ru
Ощепкова Елена Владимировна, доктор медицинских наук, профессор, руководитель отдела Регистров сердечнососудистых заболеваний ИКК им. А.Л. Мясникова ФГБУ «РКНПК» МЗ РФ
Адрес: 121552, Москва, ул. 3-я Черепковская, д. 15-а; тел.: (495) 414-66-63; e-mail: arthyplab@list.ru
11
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ГИГИЕНЫ
М.П. Дьякович, Е.В. Катаманова, П.В. Казакова
Ангарский филиал Федерального государственного бюджетного учреждения «Восточно-Сибирский научный
центр экологии человека» СО РАМН – Научно-исследовательский институт медицины труда и экологии человека,
Российская Федерация
Количественная оценка динамики
фактического здоровья лиц, подвергавшихся
воздействию паров ртути на производстве:
отдаленный период интоксикации
Представлены результаты динамического клинического наблюдения за пострадавшими от хронической ртутной интоксикации профессионального генеза в отдаленном постконтактном периоде заболевания. Дана оценка динамики синдромальных проявлений хронической ртутной интоксикации, интеркуррентной заболеваемости. Показана роль стажевой ртутной нагрузки как предиктора ухудшения состояния
фактического здоровья пострадавших в отдаленном периоде интоксикации.
Ключевые слова: профессиональное заболевание, хроническая ртутная интоксикация, стажевая ртутная нагрузка, интеркуррентная
заболеваемость.
12
Введение
Хронические нейротоксикозы, составляющие небольшую долю в структуре профессиональной заболеваемости
РФ, имеют серьезную социальную значимость из-за выраженных отдаленных последствий, приводящих к инвалидизации лиц трудоспособного возраста. Среди профессиональных токсикозов, установленных на территории
Иркутской области, хроническая ртутная интоксикация
занимает ведущее место.
Интерес исследователей к отдаленному постконтактному периоду нейроинтоксикаций вызван противоречивостью сведений о регрессии психоэмоциональных
и вегетативных нарушений на фоне глубоких морфологических изменений, завершающихся дегенеративными
явлениями в обменных процессах, нервной и сердечно-сосудистой системе, желудочно-кишечном тракте
[1, 2]. Многолетние исследования сотрудников нашего
института [3] подтверждают данные ряда авторов [4, 5]
о прогрессировании в отдаленном периоде заболевания
психопатологических проявлений, доминирующих над
неврологической симптоматикой, с формированием энцефалопатий и развитием выраженных форм психоорганического синдрома. У больных с ртутной энцефалопатией обнаруживают значительные личностные нарушения,
которые свидетельствуют о социально-психической дезадаптации [6], обусловливающей сложность реабилитации.
Хотя подробное описание клинической картины поражения нервной системы при промышленных отравлениях ртутью, а также результаты экспериментальных
работ российскими исследователями публиковались
с конца 20-х гг. прошлого столетия (С.Н. Давиденков,
А.Е. Кульков, Б.Е. Серебряник, В.С. Сурат и др.) [7],
описанию психоневрологических и поведенческих нарушений больных в отдаленном периоде хронической
ртутной интоксикации (ХРИ) заболевания в отечественной литературе уделено недостаточно внимания: нет
сведений о взаимосвязи между стажевой ртутной нагрузкой и психофизиологическими нарушениями. В зарубежной литературе такие работы найти удалось. У лиц,
M.P. Diakovich, E.V. Katamanova, P.V. Kazakova
Research Institute of Occupational Health and Human Ecology ESSC HE SD RAMS, Angarsk, Russian Federation
Quantifying the dynamics of the health status of persons occupationally
exposed to mercury vapor: a remote period of intoxication
The article presents the results of the dynamic clinical observation for persons suffered from occupational chronic mercury intoxication in the remote
post-exposure period of the disease. The estimation of the dynamics of syndrome manifestations of chronic mercury intoxication and co-morbidity
are presented. The important role of mercury exposure load as a predictor of deterioration of actual health of the patients in the remote period
of intoxication is demonstrated.
Key words: occupational disease, chronic mercury intoxication, mercury exposure load, intercurrent morbidity.
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ГИГИЕНЫ
подвергавшихся хроническому воздействию паров ртути
на рабочем месте в концентрациях, в 6–10 раз превышающих предельно допустимые, и прекративших контакт
с ртутью более 10 лет назад, выраженность когнитивных
и неврологических нарушений достоверно коррелировала с дозой ртутной экспозиции [8–10]. В то же время
осталась неизученной динамика изменения тяжести (стадийности) профессионального хронического отравления
ртутью, а также интеркуррентной заболеваемости в отдаленном периоде ХРИ в зависимости от стажевой ртутной
нагрузки как предиктора ухудшения состояния здоровья.
Цель исследования: количественно оценить динамику
фактического здоровья лиц, пострадавших от хронической ртутной интоксикации профессионального генеза
с учетом стажевой ртутной нагрузки.
Пациенты и методы
Участники исследования
Объектом исследования были 86 пациентов мужского
пола, бывших работников цеха ртутного электролиза, наблюдавшихся в клинике Института с конца 70-х гг., когда
им был постановлен первичный диагноз: «Хроническая
ртутная интоксикация профессионального генеза». Пациенты на момент исследования не работали, имели
стойкую утрату трудоспособности, проживали в г. УсольеСибирское, имели сходные социально-бытовые условия.
В качестве отправной точки исследования был выбран
2001 г., поскольку к этому моменту все пациенты уже
не имели контакта с ртутью на протяжении длительного
времени (в среднем 14,8±0,7 лет). Стаж работы с ртутью
на этот момент составлял в среднем 13,6±0,6 лет, средний
возраст обследованных — 46,6±0,8 лет. Второй точкой исследования приняли 2008 г.
Методы исследования
Для оценки связи нарушений здоровья в динамике ХРИ с накопленным воздействием нейротоксиканта
применяли расчеты индивидуальной стажевой ртутной
нагрузки (ИСРН) с учетом потребления воздуха за смену
в зависимости от степени тяжести трудового процесса
на основе Руководства [11] с использованием среднегодовых величин концентраций ртути в воздухе рабочей
зоны по данным территориального ФГУЗ «Центр гигиены
и эпидемиологии» по г. Усолье-Сибирское и лаборатории производственного контроля предприятия. Характеристика фактического состояния здоровья больных
с ХРИ осуществлялась по данным медицинского обследования, отраженным в историях болезни. Диагноз ХРИ
устанавливали на основании санитарно-гигиенической
характеристики, стажа, жалоб больных, анамнеза, а также психоневрологического осмотра и дополнительных
инструментальных методов, включающих электроэнцефалографию, вызванные потенциалы головного мозга,
ультразвуковую допплерографию сосудов головы, магнитно-резонансную томографию головного мозга и биохимические исследования крови.
Статистическая обработка данных
Для математико-статистической обработки данных
использовали пакет прикладных программ STATISTICA
for Windows v. 8. Для анализа соответствия вида распределения признаков закону нормального распределения использовался критерий Шапиро–Уилка. При нормальном
распределении результаты представлены в виде средней
± стандартная ошибка средней (M±m). Для величин, вы-
раженных в процентах, результаты представлены в виде
относительного показателя ± ошибки относительного
показателя (P±m). Анализ групповых различий оценивали по t-критерию Стьюдента для несвязанных выборок
при 95% уровне значимости. Различия между выборками
считались достоверными при p<0,05. Рассчитывались
ранговые корреляции по Спирмену с уровнем значимости
α=0,05.
Результаты и обсуждение
В ходе исследования было выяснено, что 29,1% обследованных прекратили работать на ртутном производстве
сразу после постановки им профессионального диагноза. Средний постконтактный период на 2001 г. составил
6,7±1,2 лет.
Следует отметить, что 22,1% пациентов диагноз ХРИ
был поставлен лишь после прекращения работы в контакте с ртутью. Средний период времени до установления
диагноза после прекращения контакта с ртутью составил 4,7±0,9 лет. Причем большинству пациентов (57,9%)
диагноз профессионального заболевания был поставлен
через 1–5 лет после прекращения работы в контакте
с ртутью, 42,1% лиц — через 6–10 лет.
Чуть меньше 1/2 обследованных (48,8%) продолжали
работать в контакте с ртутью и после подтверждения
наличия профессионального заболевания от 1 до 10 лет.
Средний период продолжающегося контакта составил
3,3±0,4 лет.
В 2001 г. доля пациентов с I стадией интоксикации
составляла 40,6%, что клинически проявлялось астеническим расстройством с тревожно-ипохондрическими
и вегетативными нарушениями. Ключевыми для формирования астении и неврозоподобных расстройств были
изменения в сфере эмоций: для таких лиц характерно
наличие мелкоамплитудного асимметричного тремора
пальцев вытянутых рук.
Доля пациентов с церебрально-органической (II) стадией интоксикации составила 56,9%. Эти люди имели
поражение головного мозга дегенеративного характера —
токсическую энцефалопатию, на начальных этапах развития которой преобладало легко выраженное когнитивное
расстройство с полиморфной симптоматикой невротического круга с повышенной эмоциональной гиперестезией, аффектами субдепрессивного типа. Вегетативная
дисфункция носила полисистемный, перманентно-пароксизмальный характер симпатической направленности.
При умеренно выраженной энцефалопатии для клинической картины была характерна хроническая выраженная
астения с обсессивно-фобическими, ипохондрическими
включениями, субсиндромальным тревожным генерализованным расстройством с выраженным вегетативным
сопровождением (с признаками гипоталамической недостаточности). Вегетативные нарушения сопровождались
сосудистой реакцией, сердцебиением, покраснением
лица, потливостью, одышкой с явлениями тетании. Тремор принимал интенционный характер, амплитуда его
увеличивалась. Для этих пациентов была характерна повышенная раздражительность, слезливость, обидчивость,
подозрительность, склонность к агрессивным реакциям
и депрессии, а также нарастание когнитивного дефицита. Описанные изменения указывали на значительные
нарушения в личностной сфере и отражали динамику
органического процесса в центральной нервной системе.
У 2,3% пациентов зарегистрировали III стадию интоксикации, характеризующуюся органическим расстройством личности с выраженными когнитивными и патохарактерологическими изменениями по психастеническому
13
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
типу с аффектами эксплозивного характера, развитием
деменции. У них отмечались асимметрия иннервации
лицевой мускулатуры, мозжечковые расстройства (нарушения речи по типу дизартрии или скандирования, атактическая походка, адиадохокинез, дисметрия, нарушение
мышечного тонуса), повышение сухожильных рефлексов
(признаки пирамидной недостаточности).
Расчеты предельной безопасной ртутной нагрузки (накопление токсиканта при условии его воздействия на уровне предельно допустимой концентрации за время индивидуальной экспозиции), а также наибольшего (16,8 мг) и
наименьшего (0,8 мг) значения реальной ИСРН позволили
сформировать из числа обследованных 3 группы с различными уровнями превышения предельной безопасной ртутной нагрузки: условно умеренным (с 3-кратным), высоким
(с 6-кратным) и чрезвычайно высоким (с 9-кратным).
Анализ динамики тяжести заболевания с учетом ИСРН
показал наибольшую долю лиц, имеющих стадии II, III,
в группе с чрезвычайно высокой ИСРН в 2008 г. (табл. 1).
В ходе исследования состояния здоровья пострадавших
от ХРИ были установлены слабые, но достоверные
(p <0,05) корреляционные зависимости тяжести (стадийности) основного заболевания от величины ИСРН (коэффициент корреляции Спирмена RS =0,21).
На фоне достоверного увеличения общего числа синдромов ХРИ, а также эмоциональных и когнитивных
расстройств у всех обследованных, у лиц с высокой
и чрезвычайно высокой ИСРН отмечались следующие
достоверные изменения (табл. 2): увеличение частот дрожательного гиперкинеза и вестибуло-координаторных
нарушений, снижение частоты легковыраженного астенического синдрома за счет увеличения его выраженности. У лиц с умеренной ИСРН подобных явлений не
установлено. Указанные факты свидетельствуют о важной
роли ИСРН в прогрессировании заболевания в отдаленном постконтактном его периоде.
Большое влияние на течение ХРИ оказывает сопутствующая патология, которая выявлялась у большинства
пациентов. У всех пациентов в динамике наблюдения
отмечалось достоверное увеличение заболеваемости как
в целом, так и в связи с патологией нервной системы,
органов чувств и органов дыхания (табл. 3).
Таблица 1. Распределение пациентов по стадиям заболевания в зависимости от ртутной нагрузки, %
Стадии хронической ртутной
интоксикации
14
I
II, III
Уровни ртутной нагрузки
Условно умеренный, n =31
Высокий и чрезвычайно высокий, n =55
51,6±8,9*
44,4±5,8*
12,9±3,9**
5,6±2,6**
48,4±8,9*
55,6±5,8*
87,1±3,9**
94,4±2,6**
Примечание. Над чертой — показатели 2001 г., под чертой — показатели 2008 г.; * — достоверное различие показателей по годам
(p <0,05); ** — достоверное различие показателей в группе с одним уровнем стажевой ртутной нагрузки (p <0,05).
Таблица 2. Распространенность синдромов в динамике наблюдения в зависимости от ртутной нагрузки (на 100 больных), M±m
Наименование синдромов
Гиперкинетический
Вестибуло-координаторный
Астенический (легкий и средний)
Астенический (выраженный)
Вегетативной дисфункции
Эмоциональных нарушений
Когнитивных нарушений
Прочие
Всего
Уровни ртутной нагрузки
Условно умеренный, n =31
Высокий и чрезвычайно высокий, n =55
2001 г.
2008 г.
2001 г.
2008 г.
12,9±6,4
25,8±9,1
1,8±1,8*
16,4±5,5*
12,9±6,4
32,3±10,2
16,4±5,4*
58,2±10,2*
61,3±14,1
29,0±9,6
60,0±10,0*
16,3±5,5*
12,9±6,4
22,5±8,5
9,1±4,0
21,8±6,2
77,4±15,8
54,8±13,2
63,6±10,7
43,6±8,9
38,7±11,1*
90,3±17,0*
41,8±8,7*
98,2±13,3*
29,0±9,6*
90,3±17,0*
49,1±9,4*
96,4±13,2*
16,1±7,2
22,6±8,5
7,2±3,6
16,4±5,4
261,2,0±29,0*
367,6±34,4*
249,0±21,2*
367,3±25,8*
Примечание. * — достоверное различие показателей 2001 и 2008 гг. в группе с одним уровнем стажевой ртутной нагрузки (p <0,05).
Таблица 3. Распространенность сопутствующих заболеваний в динамике наблюдения (на 100 больных), M±m
Заболевания
Системы кровообращения
Нервной системы
Пищеварительной системы
Костно-мышечной системы
Мочеполовой системы
Органов чувств
Органов дыхания
Эндокринной системы
Прочие
ВСЕГО
Уровни ртутной нагрузки
Условно умеренный, n =31
Высокий и чрезвычайно высокий, n =55
2001 г.
2008 г.
2001 г.
2008 г.
51,6±12,0*
132,0±19,1*
109,0±14,1
147,0±16,3
16,1±6,7*
41,9±10,8*
12,7±4,8*
27,3±7,0*
48,4±11,6
48,4±11,6
21,8±6,3
29,1±7,3
67,7±13,7
106,0±17,2
78,2±11,9
109,0±14,1
19,4±7,3
25,8±8,5
12,7±4,8
21,8±6,2
35,5±9,9*
154,8±20,7*
18,2±5,8*
121,8±14,8*
29,0±9,0*
68,0±13,7*
20,0±6,0*
96,0±13,0*
3,2±2,9
16,1±6,7
7,3±3,6*
27,3±7,0*
16,1±6,7
25,8±8,5
9,1±4,1*
29,1±7,2*
287,0±28,2*
616,0±41,4*
289,0±22,9*
609,0±33,3*
Примечание. * — достоверное различие показателей 2001 и 2008 гг. в группе с одним уровнем стажевой ртутной нагрузки (p <0,05).
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ГИГИЕНЫ
Сравнительный анализ интеркуррентной заболеваемости в зависимости от величины ИСРН показал наиболее неблагоприятную ее динамику в группе
с высокой и чрезвычайно высокой ИСРН, где рост показателей заболеваемости органов дыхания (4,8 против 2,3),
органов чувств (6,7 против 4,3), эндокринной системы (6,3 против 5,0) значительно превышал таковой
в группе с умеренной ИСРН.
В структуре сопутствующих заболеваний вне зависимости от ИСРН в 2001 г. доминировали болезни системы кровообращения, костно-мышечной и пищеварительной системы. Патология системы кровообращения
в основном была представлена артериальной гипертензией
1-й или 2-й степени и ишемической болезнью сердца
в соотношении 4:1. Артериальная гипертензия 1-й степени имела место у 14,4±3,5%, 2-я степень повышения
артериального давления — у 16,8±3,8%, 3-я степень —
лишь у 8,4±2,8% пациентов. Среди факторов риска артериальной гипертензии преобладали дислипидемия, гиперфибриногенемия и отягощенная наследственность.
Следует отметить, что в 2001 г. у лиц с высокой и чрезвычайно высокой ИСРН достоверно чаще выявлялись
заболевания системы кровообращения.
Среди заболеваний костно-мышечной системы преобладала вертеброгенная патология различных уровней
в виде дегенеративных дискогенных нарушений с рефлекторными, сосудистыми, корешковыми синдромами
(47,6±4,9%), что не превышало общепопуляционных значений [12].
Патология системы пищеварения включала язвенную
болезнь желудка или двенадцатиперстной кишки, хронический гастрит и составляла 11,6±3,2%, что согласуется
с распространенностью этих заболеваний в общей популяции [13].
К 2008 г. в структуре интеркуррентной заболеваемости ведущие позиции заняли болезни органов чувств,
системы кровообращения, костно-мышечной системы. Уровень заболеваемости органов чувств увеличился
в 5,4 раза. Если в 2001 г. патология, связанная с нарушением рефракции и аккомодации, в виде миопии, гиперметропии и астигматизма была диагностирована лишь
у 3 человек, то к 2008 г. ее уровень достиг 33,7±6,3%,
при этом не превысив таковой в популяции (27–45%)
[14]. Следует отметить, что у 3 пациентов, относящихся
к группе высокой и чрезвычайно высокой ИСРН, впервые была установлена атрофия зрительного нерва, которую можно расценивать как показатель дегенеративных
процессов головного мозга. Учитывая экспериментальные данные о способности ртути вызывать структурные
изменения звездчатых и корзинчатых клеток молекулярного слоя коры мозжечка, нейронов 2–4-го слоев
теменной и затылочной областей коры головного мозга
[15], можно предположить, что атрофия зрительного
нерва у больных ХРИ происходит под воздействием нейротоксиканта. Доля лиц с нейросенсорной тугоухостью
превысила аналогичный показатель 2001 г. в 3,8 раза
и составила 17,4±3,8%, что можно объяснить не только контактом с шумом в процессе предыдущей трудовой деятельности, но и присоединением сосудистых
поражений. В динамике наблюдения у больных с ХРИ
отмечалось прогрессирование нейросенсорной тугоухости и выявление новых случаев этого заболевания, преимущественно 1-й степени. Увеличения числа случаев нейросенсорной тугоухости в зависимости от ИСРН
установлено не было.
Уровень заболеваемости артериальной гипертензией
и ишемической болезнью сердца вырос в 1,5 раза
(76,7±9,4 против 50,8±7,7%), превысив общепопуляционные показатели распространенности (39,2%) по артериальной гипертензии (54,7±7,9%) [16]. Достоверно
возросла доля пациентов с артериальной гипертензией
3-й степени (30,1±4,7 против 8,4±2,8%) и снизилась
доля пациентов с артериальной гипертензией 1-й степени (2,7±1,8 против 14,4±3,5%). Несмотря на то, что
в группе с высокой и чрезвычайно высокой ИСРН прирост
к 2008 г. числа случаев вновь обнаруженных заболеваний системы кровообращения был менее значимым,
у пациентов этой группы наблюдались более выраженные
нарушения в функционировании сердечно-сосудистой
системы. Так, в группе пациентов с высокой и чрезвычайно высокой ИСРН имела место более выраженная степень повышения артериального давления. У них
превалировала артериальная гипертензия 3-й степени,
II и III стадии с риском осложнений 3-й и 4-й степени
(30,9±4,7 против 6,4±2,3% в группе с условно умеренной ИСРН). В группе с умеренной ИСРН регистрировалась артериальная гипертензия преимущественно
1-й и 2-й степени и средним риском развития осложнений. Следует отметить зависимость выраженности
клинических проявлений артериальной гипертензии
и ишемической болезни сердца от величины ИСРН.
Среди больных с высокой и чрезвычайно высокой ИСРН
в динамике наблюдения отмечена более высокая доля
лиц с утяжелением функциональной недостаточности
со стороны сердечно-сосудистой системы (21,8±4,2 против 12,9±3,4%).
Уровень заболеваемости костно-мышечной системы
увеличился в 1,4 раза, в основном за счет возрастных
дегенеративных изменений позвоночника и суставов.
Достоверных различий по частоте заболеваний костномышечной системы среди пациентов с умеренной и высокой степенью ИСРН выявлено не было.
В динамике наблюдения у пациентов обеих групп
достоверно увеличилось число случаев заболеваний органов дыхания (до 62,5±5,4% против 20,4±4,1 в 2001 г.),
среди которых преобладали хронический фарингит,
ларингит и бронхит. Доля лиц с хроническим бронхитом составила 20,9±4,1%, что достоверно не превышает общепопуляционный уровень распространенности заболевания (16,1%) [17]. У 10,8±3,1% впервые
диагностирована хроническая обструктивная болезнь
легких с превалирующим этиологическим фактором — курением. Достоверных различий случаев указанной патологии в зависимости от величины ИСРН
не установлено.
Изучение уровней заболеваемости мочеполовой
системы, представленной хронической болезнью почек (мочекаменная болезнь, хронический пиелонефрит
и гломерулонефрит) и доброкачественной гиперплазией предстательной железы, в обеих точках наблюдения
не выявило их достоверной динамики.
Уровень патологии пищеварительной системы остался на прежнем уровне.
В динамике наблюдения отмечено отчетливое прогрессирование патологии эндокринной системы. В 2001 г.
патология эндокринной системы диагностировалась преимущественно в виде ожирения I–II степени и сахарного
диабета. К 2008 г. у 9 человек (12,3±3,2%) был выявлен
сахарный диабет 2-го типа и нарушение толерантности
к глюкозе, что превышало общепопуляционные значения в 1,5–2 раза (6–8%) [18], и у 2 человек — патология
щитовидной железы (эндемический зоб с явлениями субклинического гипотиреоза). При этом сахарный диабет
2-го типа наиболее часто встречался в группе с высокой
15
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
%
100
80
60
40
20
0
88,4
57
40,7
4,7
2,3
II
I
2001 г.
6,9
III
Стадии
2008 г.
Рис. 1. Распределение больных по стадиям заболевания в зависимости от ртутной нагрузки в динамике наблюдения, %.
Токсическая
и сосудистая
энцефалопатия
Токсическая
энцефалопатия
36,1
18,6
50,0
40,7
16
Органическое
расстройство
личности
95,4
30,2
0,0
50,0
100,0
150,0
Число больных
2001 г.
2008 г.
Рис. 2. Распространенность синдромокомплексов, связанных
с воздействием ртути, в динамике наблюдения (на 100 больных).
ИСРН (14,5±3,4 против 3,2±1,5%), что согласуется с данными о распространенности патологии щитовидной железы, расстройства питания и нарушения обмена веществ
у пациентов, подверженных хроническому воздействию
ртути [19].
Заболевания нервной системы включали в себя полинейропатию конечностей смешанного генеза (токсического и дисметаболического) и дисциркуляторную энцефалопатию. За изучаемый период уровень патологии
нервной системы достоверно не отличался в зависимости от ИСРН, и во всей группе пациентов увеличился
с 11,6±3,2 до 22,1±4,8%, в основном за счет сосудистой
патологии головного мозга.
Среди прочих сопутствующих заболеваний регистрировали заболевания кожи и подкожно-жировой клетчатки, в единичных случаях (2 человека) — опухолевые заболевания. К 2008 г. достоверно увеличилось число случаев
псориаза, имеющего аутоиммунный механизм развития
(с 1,1±0,8 до 5,8±2,3%), превысив общепопуляционный
показатель распространенности в 5 раз [20].
Клинические наблюдения за больными в постконтактном периоде ХРИ свидетельствуют о том, что профессиональное заболевание является отправной точкой
проградиентного дегенеративного процесса в центральной нервной системе, токсической энцефалопатии. Клинические проявления поражения центральной нервной
системы долгое время могут сглаживаться компенсаторными механизмами, однако дальнейшее присоединение артериальной гипертензии, ишемической
болезни сердца, сахарного диабета и психотравмирующих ситуаций вызывает срыв компенсации, что ведет к прогрессированию токсической энцефалопатии.
Установленное в ходе динамического наблюдения достоверное снижение доли лиц, имеющих I, и увеличение числа лиц, имеющих II стадию заболевания, подтверждает прогрессирование церебральной патологии
и нарастание тяжести клинических проявлений ХРИ
в отдаленном периоде, установленное О.Л. Лахманом
и соавт. [21]. Повышение степени тяжести заболевания
до II и III стадии произошло за 7 лет у 39,5% пациентов.
Так, к 2008 г. только у 4,7% обследованных сохранялась
I стадия заболевания (рис. 1).
В ходе исследования было установлено достоверное
увеличение числа случаев сочетанной формы энцефалопатии (токсической и сосудистой) к 2008 г. (рис. 2),
что может быть связано с дисциркуляторно-метаболическими возрастными изменениями. У 4 человек к 2008 г.
диагностировали осложнение сосудистой патологии
в виде ишемического инсульта, субарахноидального кровоизлияния и транзиторной ишемической атаки в вертебро-базилярном бассейне. В динамике наблюдения установлено, что неспецифические реакции по клиническим
проявлениям не регрессируют и даже нарастают, наслаиваясь с увеличением возраста пациента на клинические
проявления, связанные с нарушением микроциркуляции
вследствие системного атеросклероза.
Заключение
Таким образом, величина ИСРН в отдаленном периоде ХРИ обусловливает тяжесть (стадийность) течения основного заболевания и частоту сопутствующей
патологии. Наличие выраженных интеркуррентных болезней благоприятствует прогрессированию ХРИ в отдаленном постконтактном периоде. Распространенность
заболеваний органов дыхания, чувств, эндокринной
системы, сопутствующих основной патологии, наиболее велика у лиц с высокой и чрезвычайно высокой
ИСРН. Выявляемую сосудистую и метаболическую патологию головного мозга у больных с ХРИ следует
расценивать как патологию сочетанного генеза и считать осложнением профессионального заболевания.
Полученные результаты, с одной стороны, позволяют
решать экспертные вопросы о связи наблюдаемых неспецифических реакций с перенесенной интоксикацией, а с другой — ориентировать лечащих врачей на
необходимость учета ИСРН пациентов и соответствующей коррекции «непрофессиональной» составляющей
в отдаленном периоде.
Исследования выполнены при поддержке Российского
гуманитарного научного фонда, грант № 08-06-00528а.
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ГИГИЕНЫ
ЛИТЕРАТУРА
1.
2.
3.
4.
5.
6.
7.
8.
9.
Соркина Н.С., Никитина Л.С., Сулейманова Ч.Т. Отдаленные
последствия профессиональных интоксикаций. Проблемы
охраны здоровья населения и защиты окружающей среды от
химических вредных факторов. Тез. докл. I Всесоюзного съезда
токсикологов. Ростов-на-Дону. 1988. С. 445–446.
Тарасова Л.А., Думкин В.Н. Профессиональные заболевания с преимущественным поражением нервной системы.
Профессиональные заболевания. Под ред. Н.Ф. Измерова.
М.: Медицина. 1996. С. 136–200.
Колесов В.Г., Мещерягин В.А., Лахман О.Л., Шевченко О.И.
Психопатологические проявления в отдаленном периоде профессиональных нейротоксикозов. Журн. неврол. и психиатр.
2005; 1: 25–29.
Пивень Б.Н. Экзогенно-органические заболевания головного
мозга. М.: Медицина. 1998. 144 с.
Трошин В.В. Последствия хронических профессиональных
нейротоксикозов и вопросы нейрореабилитации. Бюлл. ВСНЦ
СО РАМН. 2009; 1: 201–204.
Дьякович М.П., Казакова П.В. Ценностно-мотивационная
сфера и качество жизни больных с хронической ртутной
интоксикацией профессионального генеза. Известия Самарского научного центра Российской академии наук. 2008; 2: 32–35.
Матусевич Я.З., Фрумина Л.М. Клинические наблюдения над
хроническим отравлением малыми дозами ртути. К вопросу
о действии на организм малых доз ртути. Библиотека Ленинградского института по изучению профессиональных заболеваний. Под ред. И.Г. Липковича. С.-Пб. 1934. XIII. С. 32–49.
Ellingsen D.G., Morland T., Anderson A., Kjuus H. Relation
between exposure indices and neurological and neurophysiological
effects in workers previously exposed to mercury vapour. Br. J. Ind.
Med. 1993; 50 (8): 736–744.
Kishi R., Doi R., Fukuchi Y., Satoh ., Satoh T., Ono A., Moriwaka F.,
Tashiro K., Takahata N., Sasatani H. Residual neurobehavioural
effects associated with chronic exposure to mercury vapour. Occup.
Environ. Med. 1994; 51 (1): 35–41.
10. Meyer-Baron M., Schaeper M., van Thriel C., Seeber A. Neurobehavioural test results and exposure to inorganic mercury: in search
of dose-response relations. Arch. Toxicol. 2004; 78 (4): 207–211.
11. Руководство по оценке риска для здоровья населения при воздействии химических веществ, загрязняющих окружающую
среду: Р2.1.10.1920-04. М.: ФЦ Госсанэпиднадзора Минздрава
России. М. 2004. 143 с.
12. Попелянский Я.Ю. Вертеброгенные заболевания нервной
системы. Казань. 1981. 368 с.
13. Никитин А.В., Малюков Д.А. Лазеротерапия при хроническом
гастрите и язвенной болезни. Естествознание и гуманизм.
2007; 4: 71–72.
14. Трубинин В.Н. Рефракционная хирургия и офтальмология.
2005; 3: 4–9.
15. Куценко С.А. Основы токсикологии. Научн.-метод. изд.
С.-Пб.: Фолиант. 2004. 720 с.
16. Драпкина О.М. ИБС: Основные направления терапевтического воздействия. Справочн. поликлин. врача. 2005; 3 (1): 8–11.
17. Метельский С.М., Бова А.А. Диагностика легочной гипертензии при хронических обструктивных заболеваниях легких.
Медицинские новости. 2004; 8: 7–11.
18. Кочергина И.И. Сахароснижающая терапия при диабетической нефропатии у больных сахарным диабетом 2 типа. Трудный пациент. 2006; 12: 39–43.
19. Шилов В.В., Чащин В.П., Великова В.Д., Полозова Е.В.,
Константинов Р.В. Острые и хронические отравления ртутью
(клиническая картина, диагностика, профилактика, лечение,
экспертиза): Пособие для врачей. С.-Пб.: СПбМАПО. 2006. 39 с.
20. Перламутров Ю.Н., Соловьев А.М. Псориаз и современные методы его лечения. Дерматовенерология.
2004; 5: 38–43.
21. Лахман О.Л, Колесов В.Г., Андреева О.К. Течение энцефалопатии в отдаленном периоде профессиональной хронической
ртутной интоксикации. Медицина труда и промышленная экология. 2003; 3: 46–48.
КОНТАКТНАЯ ИНФОРМАЦИЯ
Дьякович Марина Пинхасовна, доктор биологических наук, ведущий научный сотрудник Ангарского филиала
Федерального государственного бюджетного учреждения «Восточно-Сибирский научный центр экологии человека» СО РАМН – Научно-исследовательский институт медицины труда и экологии че ловека
Адрес: 665827, Иркутская обл., Ангарск, а/я 1170; тел.: (3955) 55-90-66; е-mail: marik914@rambler.ru
Катаманова Елена Владимировна, кандидат медицинских наук, заместитель главного врача по медицинской части
Ангарского филиала Федерального государственного бюджетного учреждения «Восточно-Сибирский научный
центр экологии человека» СО РАМН – Научно-исследовательский институт медицины труда и экологии человека
Адрес: 665827, Иркутская обл., Ангарск, а/я 1170; тел.: (3955) 55-43-27; е-mail: krisla08@rambler.ru
Казакова Полина Валерьевна, медицинский психолог Ангарского филиала Федерального государственного бюджетного учреждения «Восточно-Сибирский научный центр экологии человека» СО РАМН – Научно-исследовательский
институт медицины труда и экологии человека
Адрес: 665827, Иркутская обл., Ангарск, а/я 1170; тел.: (3955) 55-75-60; е-mail: imt@irmail.ru
17
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ГИГИЕНЫ
Н.В. Зайцева1, М.А. Землянова1, В.Н. Звездин1, О.В. Лебединская2, С.В. Мелехин2, Е.В. Саенко3,
Р.Р. Махмудов1
1 Федеральный
научный центр медико-профилактических технологий управления рисками здоровью населения,
Пермь, Российская Федерация
2 Пермская государственная медицинская академия им. акад. Е.А. Вагнера, Российская Федерация
3 Институт технической химии Уральского отделения РАН, Пермь, Российская Федерация
Морфологические особенности тканей
внутренних органов и систем при воздействии
нанодисперсного оксида марганца (III, IV)
18
Исследование морфологических особенностей тканей внутренних органов экспериментальных животных при однократном внутрижелудочном введении водной суспензии нанодисперсного оксида марганца (III, IV) в дозах 2000, 3500 и 5000 мг/кг продемонстрировало комплекс
морфологических изменений в виде нарушения кровообращения вплоть до стаза крови и кровоизлияний, приводящих к изменению структуры
органов, усиленному апоптозу клеток; активизацию макрофагальной системы в виде пролиферации и фагоцитоза макрофагами продуктов разрушения клеток; гипертрофию лимфоидной ткани в органах иммуногенеза и формирование лимфогистиоцитарных инфильтратов
в паренхиматозных органах, органах центральной нервной системы. В случае введения микроразмерного аналога в тех же дозах морфологические изменения в системе кровообращения, макрофагальной системе и органах иммуногенеза обнаружены преимущественно при применении
дозы в 5000 мг/кг. Изменения носили значительно менее выраженный характер и заключались в активации макрофагальной системы в печени
в виде активизации клеток Купфера, пролиферации лимфоидной ткани в селезенке, лимфогистиоцитарных инфильтратов средних размеров
в печени и почках.
Ключевые слова: нанодисперсный и микродисперсный оксид марганца (III, IV), морфологические изменения.
Введение
Наряду с информационными и биотехнологиями нанотехнологии являются фундаментом научно-технической революции в XXI в., одним из наиболее перспективных и востребованных направлений науки, технологий
и промышленности в индустриально развитых странах.
По оценкам экспертов исследовательского агентства
Global Industry Analysts, Inc. (США), мировой объем
рынка продукции наноиндустрии в 2008 г. составил около
700 млрд долларов США. К 2015 г. прогнозируемый объем
рынка возрастет до 1,2–1,5 трлн долларов США. Рынок
нанопродукции России, составляющий сегодня порядка 81 млрд рублей, вырастет к 2016 г. до 1 трлн рублей,
N.V. Zaitseva1, M.A. Zemlyanova1, V.N. Zvezdin1, O.V. Lebedinskaya2, S.V. Melekhin2,
E.V. Sayenko3, R.R. Makhmudov1
1 Federal
Scientific Center for Medical and Preventive Health Risk Management Technologies, Perm, Russian Federation
2 E.A. Wagner Perm State Medical Academy, Russian Federation
3 Institute of Technical Chemistry, Ural Branch of the Russian Academy of Sciences, Perm, Russian Federation
Toxicological evaluation of nanodispersed manganese oxide (III, IV)
effect on morphological peculiarities of different tissues
under experiment
The study of morphological features of tissue organs of experimental animals after a single intragastric administration of an aqueous suspension
nanodis-dispersed manganese (III, IV) at doses of 2000, 3500 and 5000 mg/kg showed complex of morphological changes in the form of circulatory
disorders up to hemostasis and bleeding which lead to changes in the structure of organs, enhanced apoptosis, activation of macrophage system
by proliferation and macrophage phagocytosis of degradation products of cells, hypertrophy of lymphoid tissue of immune system; development
of histiocytic infiltrates in parenchymal organs and central nervous system. With the introduction of microsized analogues in the same doses of the
morphological changes in the circulatory system, macrophage system and immune organs found predominantly in a dose of 5000 mg/kg. Changes
were less significant and were presented as activation of macrophages in the liver in the form of activation of Kupffer cells, proliferation of lymphoid
tissue in the spleen, lymph histiocytic infiltrates in the liver, kidney, medium size.
Key words: nanoparticles and microparticles of manganese oxide (III, IV), morphological changes.
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ГИГИЕНЫ
т.е. более чем в 10 раз, а доля отечественной продукции наноиндустрии в общем объеме продукции наноиндустрии, реализованной на мировом рынке высоких технологий, составит около 3,0% при 0,04%
в 2008 г. [1, 2].
Формирование национальной наноиндустрии, обозначенное Программой развития наноиндустрии в Российской Федерации до 2015 г., как важнейшее приоритетное стратегическое направление, определяющее
новые подходы к преобразованию отечественной промышленности, диктует необходимость системного развития работ по изучению потенциальных угроз
в сфере жизнедеятельности человека, связанных с мировым развитием и распространением нанотехнологий
и нанобиотехнологий.
Прогнозируемый рост экономики, вызванный
внедрением нанотехнологий, требует ясного понимания всех возможных рисков для здоровья, связанных
с их использованием [3, 4]. Наличие совершенно иных
физико-химических свойств у наноматериалов может
обусловливать и другие виды биологического, в т.ч. токсического, действия, чем у веществ в обычном физико-химическом состоянии [3]. В связи с постоянным
увеличением контакта населения с продуктами наноиндустрии в различных сферах производства и потребления
особую значимость приобретают вопросы токсиколого-гигиенической оценки безопасности наноматериалов
для здоровья человека.
Недостаточная изученность особенностей проникновения, локализации и развивающихся морфологических эффектов действия наноразмерных частиц в органах
и тканях при поступлении в организм диктует необходимость изучения структурных изменений тканей внутренних органов в эксперименте для прогнозирования и разработки критериев безопасности продукции, содержащей
в своем составе наночастицы.
В перечень синтезируемых наноматериалов входит
нанодисперсный оксид марганца, являющийся высокоперспективным для использования в качестве активной
субстанции в производстве магнитных материалов, сорбентов, катализаторов, полупроводниковых термисторов
[2]. При этом возможно прямое экспонирование персонала, участвующего в процессе производства, и населения,
являющегося потребителями данной продукции.
Предварительная оценка потенциальной опасности для здоровья человека, выполненная в соответствии с «Методическими рекомендациями по выявлению наноматериалов, представляющих потенциальную
опасность для здоровья человека» (МР 1.2.2522-09),
на основании аналитического обобщения результатов
собственных исследований и данных аннотируемой литературы о физико-химических, молекулярно-биологических, биохимических, цитологических, экологических характеристиках свидетельствует об опасности
нанодисперсного оксида марганца для здоровья человека (критерий «частной» опасности D составил 1,75,
что соответствует диапазону 1,111–1,779 — «средняя
степень потенциальной опасности» [5, 6]) и требует
дальнейших токсиколого-гигиенических исследований. Вместе с тем практически отсутствуют сведения
о морфологических особенностях тканей внутренних
органов и систем при воздействии на них наночастиц
оксида марганца.
Цель работы: исследовать и оценить морфологические особенности тканей внутренних органов
и систем при воздействии нанодисперсного оксида
марганца (III, IV).
Материалы и методы
В экспериментальных условиях была изучена водная суспензия нанодисперсного оксида марганца (III,
IV), полученная методом непосредственного взаимодействия ионов Mn2++MnO4– в присутствии нанореакторов — мицелл цетилтриметиламмония бромида (СТАВ,
C16H33(CH3)3NBr) [6]. Использование мицелл поверхностно-активного вещества предотвращало рост частиц
и позволило синтезировать стабилизированные частицы
определенных размеров, коррелирующие с размерами
мицелл [7]. CTAB удаляли многократной экстракцией
этанолом в подкисленной среде (с помощью соляной
кислоты), степень экстракции составила не менее 98%.
Для сравнительного анализа при оценке морфологических особенностей синтезирован водный микродисперсный раствор оксида марганца (III, IV) по аналогичной
методике, но без добавления CTAB. Оценку размера
и формы нано- и микродисперсных частиц вещества
в водной суспензии выполняли методом динамического
светорассеяния на анализаторе «Horiba LB-550» (Япония)
и на лазерном анализаторе «Microtrac S3500» (США),
соответственно. Удельную площадь поверхности (SBET)
частиц определяли методом ВЕТ (Брунауэра, Эммета и
Тейлора) [8], текстурные параметры — сорбцией азота
при температуре -196 °С на анализаторе «ASAP 2020»
(Micromeritics, США). Концентрацию частиц в водной
суспензии определяли методом атомно-адсорбционной
спектрометрии с ацетилено-воздушным пламенем на анализаторе «Perkin Elmer 3110» (Perkin Elmer Inc., США).
Оценку морфологических особенностей тканей внутренних органов и систем при введении тестируемых
веществ проводили на материале половозрелых мышей линии С57BL/6J, самцов массой 27,0±2,0 г. Экспериментальные животные были разделены на 10 групп
по 10 мышей в каждой. Водную суспензию нанодисперсного оксида марганца (III, IV) в концентрации
41 мг/мл вводили животным 1-й, 2-й, 3-й опытной
группы однократно зондово внутрижелудочно в дозах
2000, 3500 и 5000 мг/кг, соответственно. Животным 1-й,
2-й, 3-й группы сравнения в аналогичных дозах и таким
же способом вводили микродисперсный водный раствор оксида марганца (III, IV) в концентрации 54,6 мг/кг.
Животным 1-й, 2-й, 3-й контрольных групп вводили дистиллированную воду в эквивалентном объеме (1,3; 2,3
и 3,0 мл). Объем, превышающий 1,5 мл, вводили в 2 приема с интервалом 30 мин. Срок наблюдения за животными после введения тестируемых веществ составил 14 сут.
В ходе наблюдения оценивали летальный эффект, среднее
время гибели животных, клиническую картину развития
интоксикации.
Животные на протяжении всего эксперимента содержались в условиях лабораторного вивария (по 5 особей
в полипропиленовых клетках стандартного размера Т/3)
на полусинтетическом рационе согласно методическим
указаниям «Токсиколого-гигиеническая оценка безопасности наноматериалов» (МУ 1.2.2520-09). Доступ к корму
и питью не ограничивали. Температура в помещениях
в период наблюдения составляла 23,0±2,0 °C, влажность
воздуха — 60,0±5,0%. Экспериментальные манипуляции
производили в соответствии с требованиями «Правил
проведения работ с использованием экспериментальных
животных». Выживших животных выводили из эксперимента методом декапитации.
У животных, погибших во время эксперимента
и выведенных из опыта после его завершения, забирали
последовательно печень, селезенку, почки, сердце, полу-
19
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
шария головного мозга, мозжечок. Органы фиксировали
в 10% растворе нейтрального формалина, затем заливали
в парафин. Серийные срезы с блоков окрашивали гематоксилином и эозином. Визуализацию микропрепаратов осуществляли на световом микроскопе «Micros»
(Австрия) при увеличении ×100–1000.
Результаты и обсуждение
20
Исследованная в эксперименте водная суспензия нанодисперсного оксида марганца (III, IV) имела структуру
бернессита. Размер частиц в 97,8% случаев от общего количества частиц в дисперсном растворе составил
34–39 нм, форма — несферическая. Микродисперсный
аналог имел размер частиц в 98,0% случаев 5,5–37,0 мкм,
форма — несферическая. Удельная площадь поверхности наночастиц составила 150,23 м2/г, что в 1,2 раза
выше удельной площади поверхности микродисперсного
аналога.
Острая токсичность (LD50, LD — летальная доза)
наноразмерного и микроразмерного оксидов марганца (III, IV) в дисперсных растворах составила, соответственно, 2340 (3-й класс опасности) и 6000 мг/кг
(4-й класс опасности). Гибель экспериментальных животных при введении нанодисперсного оксида марганца
(III, IV) отмечалась преимущественно в 1-е сут, при введении микродисперсного раствора — в период от 24 до 48 ч.
Клиническая картина интоксикации была однотипной
и имела общий неспецифический характер.
Результаты морфологических исследований свидетельствуют, что после введения водной суспензии нанодисперсного оксида марганца (III, IV) в дозе 2000 мг/кг
у погибших животных через 1 сут от начала эксперимента
регистрировались изменения в структуре тканей всех изученных органов. Обнаружено умеренное расширение
и полнокровие венозных сосудов в печени, почках,
головном мозге. У животных группы сравнения изменений и нарушений в системе кровообращения не
выявлено, морфология соответствовала контролю.
При введении нанодисперсных частиц зафиксирована
лимфогистиоцитарная инфильтрация разной степени
выраженности в паренхиматозных органах. Определялись единичные перипортальные, перисинусоидальные
лимфоидные инфильтраты средних и крупных размеров
в печени, многочисленные мелкоочаговые межканальцевые — в почках, диффузная лимфоидная инфильтрация — в рыхлой соединительной ткани перикарда
сердца. Инфильтрация органов лимфоцитами была
настолько активной, что мелкоочаговые лимфоидные
инфильтраты обнаруживались даже в веществе больших полушарий головного мозга и в коре мозжечка.
Это свидетельствует о преодолении гематоэнцефалического барьера. Наблюдался заметный периваскулярный
отек наружного зернистого и пирамидного слоя серого
и некоторых участков белого вещества больших полушарий головного мозга. В группе сравнения изменений
лимфоидной ткани в органах иммуногенеза (селезенка,
тимус) не обнаружили. У животных опытной группы
отмечено увеличение числа клеток макрофагальной
системы, их активизация и дифференцировка в печени,
почках, не выявленные у животных группы сравнения.
Во многих печеночных дольках синусоидные капилляры расширены с умеренной активацией в стенке
звездчатых макрофагов (клетки Купфера). Большое
число почечных телец имело капсулы с расширенными
просветами, а в части сосудистых клубочков отмечалась
гипертрофия мезангиальных клеток, выполняющих
фагоцитарную функцию.
Результаты морфологических исследований показали,
что введение водной суспензии нанодисперсного оксида
марганца (III, IV) в дозе 3500 мг/кг у погибших животных в 1-е сут приводит к еще более выраженным морфологическим изменениям в тканях изученных органов.
Отмечено резкое расширение и полнокровие венозных
сосудов печени, почек. При умеренном расширении венозных сосудов в сердце было заметно переполнение
кровью микроциркуляторного русла миокарда и эпикарда, а также камер сердца. В миокарде определялись тонкостенные полости с неровными контурами, выстланные
эндотелием, с форменными элементами в них. Обнаружены кровоизлияния в корковом и мозговом веществе
почек с расположением эритроцитарных масс не только
между канальцами, но и вокруг почечных телец. В печени выявлялись дольки с дезинтегрированными балками, с резко расширенными синусоидными капиллярами
и стазом эритроцитов в них. Многие гепатоциты имели
гипертрофированные ядра (рис. 1, а). У животных группы
сравнения наблюдалось расширение синусоидных капилляров печени (рис. 1, б) и сосудов микроциркуляторного
русла почки.
Во всех исследованных органах животных опытной
группы имели место пролиферативные процессы клеток
макрофагальной системы и лимфоидного ряда. В печени
клетки Купфера были увеличены в размерах и вдавались
в просвет синусоидных капилляров, часто отделяясь от
их стенок. Мезангиальные клетки в почечных тельцах
гипертрофированы. В селезенке преобладала красная
пульпа с явлениями выраженной диффузно-очаговой
лимфатизации и умеренной гиперемии с повышенным
числом мегакариоцитов. В результате гемолиза эритроцитов в красной пульпе определялся как свободный
гемосидерин, так и гемосидерин, содержащийся в цитоплазме сидерофагов. Лимфоидные узелки белой пульпы
органа имели средние и крупные размеры без типичного
подразделения на зоны с очагами разрежения, заметным апоптозом лимфоидных элементов и скоплением
клеточного детрита. Хорошо заметны гипертрофированные стромальные клетки и макрофаги, фагоцитирующие детрит и апоптозные тельца. Пролиферация клеток лимфоцитарного и макрофагального ряда приводила
к лейкоцитарной инфильтрации паренхиматозных органов: выявлялись многочисленные перипортальные и внутридольковые лимфоидно-гистиоцитарные инфильтраты
в печени, периваскулярные и межканальцевые — в почках
(рис. 1, в). В группе сравнения отмечались ограниченные
признаки лимфоидной пролиферации только в печени
и почках (рис. 1, г); активации макрофагальной системы
практически не зарегистрировано. В опытной группе
обнаруживали более крупные, чем в предыдущей группе,
лимфоидные инфильтраты в белом веществе больших полушарий головного мозга и мозжечка. В ткани головного
мозга перицеллюлярный и периваскулярный отек усиливался, особенно в коре больших полушарий (рис. 1, д).
В группе сравнения аналогичных изменений выявлено не
было (рис. 1, е).
Наибольшие изменения структуры тканей изученных
органов экспериментальных животных обнаружили после введения водной суспензии нанодисперсного оксида
марганца (III, IV) в дозе 5000 мг/кг. У погибших животных
через 1 сут от начала эксперимента отметили выраженные
расстройства кровообращения в виде резкого расширения
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ГИГИЕНЫ
a
б
21
в
г
д
е
Рис. 1 (а–е). Морфологические изменения при однократном внутрижелудочном введении в дозе 3500 мг/кг водного раствора нанодисперсного оксида марганца (III, IV) (а, в, д) и водного раствора микродисперсного оксида марганца (III, IV) (б, г, е); а, б — печень;
в, г — левая почка; д, е — кора больших полушарий. Окраска гематоксилином и эозином. а–е — об. ×20, ок. ×10.
и заполнения эритроцитами практически всех кровеносных сосудов (особенно венозных) в изученных органах.
Между расширенными и полнокровными сосудами в рыхлой соединительной ткани мягкой мозговой оболочки
выявлялась диффузно-очаговая лейкоцитарная инфильтрация и очаговые кровоизлияния. По сравнению с пре-
дыдущими группами в сером и белом веществе головного
мозга перицеллюлярный и периваскулярный отек был
более заметным. Повышенный объем рыхлой волокнистой
соединительной ткани и жировых клеток определялся во
многих участках срезов миокарда сердца. Расширенные
капилляры, проходившие между кардиомиоцитами, были
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
22
полнокровны. У животных группы сравнения наблюдалось
значительное расширение и полнокровие синусоидных
капилляров печени, сосудов почки, незначительное расширение сосудов мягкой мозговой оболочки без явлений
стаза крови. В опытной группе имела место диффузная
и среднеочаговая лимфоидная инфильтрация в миои эпикарде. Определялось значительное увеличение полости капсул почечных телец, расширение и разрушение апикальных частей эпителиальных клеток канальцев
в корковом веществе почек. В мозговом веществе встречались многочисленные кровоизлияния. В печени была
слабо выражена дольчатость с нарушением балочного типа
строения долек. Определялось умеренное число гепатоцитов с гипертрофией и гиперхромией ядер, в расширенных синусоидных капиллярах выявлены многочисленные
«лимфоидные пробки». Наблюдалась деструкция печеночных клеток с явлениями некроза. Яркая пролиферативная
реакция лимфоидной ткани отмечалась в лимфоидных
органах. Лимфоидные узелки белой пульпы селезенки
приобретали большие размеры с тенденцией к слиянию,
но не имели герминативных центров; зафиксирован выраженный апоптоз лимфоцитов с большим количеством
клеточного детрита и гипертрофированных макрофагов,
фагоцитирующих его. В красной пульпе органа определялась выраженная диффузно-очаговая лимфоидная инфильтрация и массивные кровоизлияния. В паренхиматозных органах увеличено число лимфогистиоцитарных
очаговых инфильтратов крупных размеров: в печени —
множественные периваскулярные, внутридольковые;
в почках — периваскулярные, межканальцевые, вокруг почечных телец. Зафиксирована более активная, по сравнению с предыдущими группами, реакция макрофагальной
системы в печени, почках. В печени клетки Купфера активизировались, увеличивались в размерах, дифференцировались в макрофаги и выходили в просвет синусоидных
капилляров. В почках зарегистрирована реакция многих
мезангиальных клеток. В группе сравнения отмечали выраженные признаки активации макрофагальной системы
в печени в виде активизации клеток ретикулоэндотелиальной системы; также отмечена пролиферация лимфоидной
ткани в селезенке, лимфогистиоцитарные инфильтраты
средних размеров в печени и почках.
При введении водной суспензии нанодисперсного
оксида марганца в тканях всех изученных внутренних
органов экспериментальных животных наблюдали комплекс морфологических изменений, которые включали нарушения кровообращения вплоть до стаза крови
и кровоизлияний, приводящих к нарушению нормальной
структуры органов; усиление апоптотических процессов;
активацию макрофагальной системы в виде дифференцировки, пролиферации и активного фагоцитоза сформированными макрофагами продуктов разрушения клеток и эритроцитов; размножение клеток лимфоидного ряда, ведущее
к гипертрофии лимфоидной ткани в органах иммуногенеза
и формированию лимфогистиоцитарных инфильтратов
в паренхиматозных органах и органах центральной нервной системы. При этом с увеличением дозы тестируемого
вещества степень выраженности и распространенность
морфологических изменений увеличивались. При введении микроразмерного оксида марганца морфологические
изменения в системе кровообращения паренхиматозных
органов, макрофагальной системе и органах иммуногенеза
выявлены преимущественно в дозе 5000 мг/кг. Изменения
носили значительно менее выраженный характер по сравнению с таковыми при введении нанодисперсных частиц.
Характер морфологических изменений при действии
водной суспензии нанодисперсного оксида марганца
определяется, вероятно, рядом физических свойств. Значительная удельная площадь поверхности наночастиц
и несферическая форма способствуют снижению скорости их выведения из организма фагоцитирующими клетками иммунной системы и обусловливают возрастание
времени контакта частиц с тканями [5]. Эти факты объясняют выявленные нарушения в сосудистой системе органов и высокую степень активности макрофагов в тканях.
Известно, что наночастицы оксида марганца при
взаимодействии с клеточными мембранами стимулируют избыточное образование активных форм кислорода [9–11]. Активация перекисного окисления липидов
и избыточная продукция активных форм кислорода из
поврежденных мембран приводят к индукции выработки
цитокинов (в основном фактора некроза опухолей альфа)
и повреждению ДНК, что может вызывать активацию
факторов транскрипции, в частности NF-B, отвечающего за полигенную экспрессию. В результате запускается
апоптотический механизм преждевременной клеточной
гибели [12]. Данные свойства наночастиц оксида марганца объясняют установленную в эксперименте высокую степень апоптотических процессов, приводящих
к нарушению структуры изученных органов и активации
макрофагальной и лимфоидной системы.
Морфологические признаки отрицательного воздействия наночастиц оксида марганца на органы центральной нервной системы, имеющие характер перицеллюлярных и периваскулярных отеков, а также лимфоцитарной
инфильтрации мягкой мозговой оболочки и ткани коры
больших полушарий и мозжечка, согласуются с известными данными о появлении нейродегенеративных нарушений уже через 2–3 нед экспозиции и о накоплении
в клетках головного мозга наночастиц оксида марганца
в эксперименте [13, 14].
Заключение
Таким образом, результаты морфологических исследований по влиянию водной суспензии нанодисперсного
оксида марганца (III, IV) на структуру тканей внутренних
органов экспериментальных животных демонстрируют
сосудистые нарушения, приводящие к кровоизлияниям
и некротическим изменениям в паренхиматозных органах
(печени, почках); выраженной лимфоидной пролиферации и активации макрофагальной системы в паренхиматозных органах и органах центральной нервной системы
(в больших полушариях головного мозга, мозжечке).
Степень выраженности и распространенности нарушений зависит от дозы нанодисперсного оксида марганца
(III, IV). При этом установленные морфологические изменения могут носить компенсаторный характер, ряд из
них имеет признаки иммунных и аутоиммунных реакций,
что находит подтверждение в работах других авторов
и может быть объяснено особыми физико-химическими
свойствами наночастиц оксида марганца (III, IV). Водная
суспензия микродисперсного оксида марганца вызывает
морфологические изменения в системе кровообращения,
макрофагальной системе и органах иммуногенеза преимущественно в наибольшей из изученных доз. Глубина
и распространенность изменений значительно менее выражены относительно морфологических изменений при
введении нанодисперсных частиц.
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ГИГИЕНЫ
ЛИТЕРАТУРА
1.
2.
3.
4.
5.
6.
Программа развития наноиндустрии в Российской Федерации до 2015 г. [Электронный ресурс]. URL: http://www.
portalnano.ru/read/documents/met/mon-sm-538_16_16072010/
program_2015 (дата обращения: 08.10.2012).
Маркетинговое исследование рынка нанопорошков (вер. 5):
Аналитический отчет от 16.12.2011 [Электронный ресурс].
URL: http://www.research-techart.ru-/report-/nanopowdermarket.htm (дата обращения: 02.10.2012).
Онищенко Г.Г. Стратегия безопасности наноиндустрии. Здоровье населения и среда обитания. 2011; 5: 4–8.
Онищенко Г.Г., Зайцева Н.В., Землянова М.А. Гигиеническая
идентификация последствий для здоровья при внешнесредовой экспозиции химических факторов. Под ред. Г.Г. Онищенко.
Пермь: Книжный формат. 2011. 529 с.
Зайцева Н.В., Землянова М.А., Звездин В.Н., Саенко Е.В.,
Тарантин А.В., Махмудов Р.Р., Лебединская О.В., Мелехин С.В.,
Акафьева Т.И. Токсиколого-гигиеническая оценка безопасности нанодисперсного и микродисперсного оксида марганца
(III, IV). Вопросы питания. 2012; 5: 13–19.
Гырдасова О.И., Красильников В.Н., Базуев Г.В. Синтез
микро- и наноразмерных оксидов марганца из гидратированных оксалатов марганца и продуктов их химического
модифицирования этиленгликолем. Неорг. химия. 2009;
7: 1097–1102.
7.
8.
9.
10.
11.
12.
13.
14.
Уайтсайдс Дж., Эйглер Д., Андерс Р. Нанотехнология в ближайшем десятилетии. Прогноз направления исследований.
Под ред. М.К. Роко, Р.С. Уильямса и П. Аливисатоса. Пер.
с англ. М.: Мир. 2002. 292 с.
Грег С., Синг К. Адсорбция, удельная поверхность, пористость. Пер. с англ. М: Мир. 1984. 306 с.
Lison D., Lardot C., Huaux F., Zanetti G., Fubini B. Infuence
of partice surface area on the toxicity of insoluble manganese dioxide dusts. Arch. Toxicol. 1997; 71: 725–729.
Оberdorster G. Nanotoxicology: Am emerging discipline evolving
from studies of ultrafine particles. Environmental Health Perspective.
2005; 7: 823–839.
Pahl H.L. Activators and target genes of Rel/NF-kB transcription
factors. Oncogene. 1999; 18: 6853–6866.
Sakon S., Xue X., Takekawa M., Sasazuki T., Okazaki T.,
Kojima Y., Piao J.H., Yagita H., Okumura K., Doi T., Nakano H.
NF-kB inhibits TNF-induced accumulation of ROS that mediate
prolonged MAPK activation and necrotic cell death. EMBO J. 2003;
22: 3898–3909.
Oberdorster G., Sharp Z, Atudorei V. Translocation of inhaled
ultrafine particles to the brain. Inhal. Toxicol. 2004; 16: 437–445.
Ostiguy C., Malo S., Asselin P. Synthese des connaissances scientifiques sur les risques d’atteinte a la sante suite a une exposition professionnelle au manganese: rapport IRSST № 339. Montreal. 2003. 41 p.
23
КОНТАКТНАЯ ИНФОРМАЦИЯ
Зайцева Нина Владимировна, доктор медицинских наук, профессор, академик РАМН, заслуженный деятель науки
РФ, директор ФБУН «Федеральный научный центр медико-профилактических технологий управления рисками
здоровью населения»
Адрес: 614045, Пермь, ул. Монастырская, д. 82; тел.: (342) 237-25-34; е-mail: root@fcrisk.ru
Землянова Марина Александровна, доктор медицинских наук, заведующая отделом биохимических и цитогенетических методов диагностики ФБУН «Федеральный научный центр медико-профилактических технологий управления
рисками здоровью населения»
Адрес: 614045, Пермь, ул. Монастырская, д. 82; тел.: (342) 236-39-30; е-mail: zem@fcrisk.ru
Лебединская Ольга Витальевна, доктор медицинских наук, доцент кафедры гистологии, эмбриологии и цитологии
ГБОУ ВПО «Пермская государственная медицинская академия им. ак. Е.А. Вагнера»
Адрес: Пермь, 614000, ул. Петропавловская, д. 26; тел.: (342) 217-10-30; е-mail: lebedinska@mail.ru
Звездин Василий Николаевич, младший научный сотрудник лаборатории цитогенетики ФБУН «Федеральный
научный центр медико-профилактических технологий управления рисками здоровью населения»
Адрес: 614045, Пермь, ул. Монастырская, д. 82; тел.: (342) 237-25-34; е-mail: zvezdin@fcrisk.ru
Саенко Екатерина Владимировна, кандидат химических наук, старший научный сотрудник лаборатории многофазных дисперсных систем Института технической химии Уральского отделения РАН
Адрес: 614013, Пермь, ул. ак. Королева, д. 3; тел.: (342) 237-82-72; е-mail: saenko_ekaterina@mail.ru
Мелехин Сергей Владимирович, ассистент кафедры гистологии, эмбриологии и цитологии ГБОУ ВПО «Пермская
государственная медицинская академия им. ак. Е.А. Вагнера»
Адрес: 614000, Пермь, ул. Петропавловская, д. 26; тел.: (342) 217-10-30; е-mail: rector@psma.ru
Махмудов Рамиз Рагибович, кандидат фармакологических наук, старший научный сотрудник лаборатории метаболизма и фармакокинетики ФБУН «Федеральный научный центр медико-профилактических технологий управления рисками здоровью населения»
Адрес: 614045, Пермь, ул. Орджоникидзе, д. 82; тел.: (342) 237-25-34; е-mail: bav@psu.ru
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ СЕРДЕЧНО-СОСУДИСТОЙ ХИРУРГИИ
Е.А. Медведева, Ю.В. Щукин, Е.И. Селезнев
Самарский государственный медицинский университет, Российская Федерация
Профилактика кардиальных осложнений
при выполнении аортоподвздошных
реконструкций посредством коррекции
воспаления и эндотоксемии
В работе представлены результаты обследования и лечения 130 пациентов с атеросклерозом. Цель состояла в оптимизации предоперационной подготовки больных атеросклерозом путем коррекции эндогенной интоксикации и воспаления аторвастатином для профилактики
периоперационных кардиальных осложнений при аортоподвздошных реконструкциях. Установлена исходная и послеоперационная активация
воспаления и интоксикации у больных с мультифокальным атеросклерозом. Показано, что кратковременная терапия аторвастатином
в дозе 60 мг в сут имеет значимое преимущество перед низкодозовой в коррекции пред- и послеоперационного эндогенного воспаления, интоксикации и в профилактике кардиальных осложнений при выполнении аортоподвздошных реконструкций.
Ключевые слова: атеросклероз, аортоподвздошные реконструкции, воспаление, эндотоксемия, аторвастатин.
24
Введение
На современном этапе развития сосудистой хирургии послеоперационные кардиоваскулярные осложнения
являются главной причиной летальности и имеют место
в 10,4–29,5% общего числа случаев осложнений [1]. Ключевым механизмом их развития считается дестабилизация
атеросклеротического процесса [2]. Согласно данным литературы, декомпенсация атеросклероза сопряжена с активацией каскада патологических реакций, участвующих
в атерогенезе. Так, процессы эндогенного воспаления
и интоксикации могут претерпевать значительные изменения в послеоперационном периоде реконструктивных
сосудистых операций. Данная проблематика изначально
более широко изучалась в кардиохирургичеcкой практике: регистрировалась значительная активация процессов
эндогенного воспаления и эндотоксемии в послеоперационном периоде аортокоронарного шунтирования.
Высокая частота кардиальных осложнений, необходи-
мость патогенетически обоснованной профилактики их
развития стали предпосылкой для анализа этих процессов
в ангиохирургии. В многочисленных клинических испытаниях и метаанализах проспективных исследований
установлено, что высокий уровень высокочувствительного С-реактивного белка (вч-СРБ) достоверно сопряжен
с увеличением в 2–3 раза риска развития сердечно-сосудистых осложнений как у здоровых лиц, так и у больных
с атеросклерозом [3, 4]. В ряде работ доказано, что активация эндогенного воспаления ухудшает прогноз после
реконструктивных сосудистых операций [5, 6]. Таким
образом, для снижения частоты послеоперационных осложнений особую актуальность приобретает поиск путей
ингибирования процесса воспаления.
В настоящее время определено, что для стабилизации атеросклеротического поражения нет альтернативы
применению статинов, посредством которых возможно снизить частоту возникновения острых коронарных
событий, в т.ч. и при выполнении реконструктивных
E.A. Medvedeva, Y.V. Shchukin, E.I. Seleznev
Samara State Medical University, Russian Federation
Prevention of cardiovascular complications in patients undergoing
aortic-iliac reconstructions by correction of inflammation
and endotoxemia
There were presented the results of examination and treatment of 130 patients with atherosclerosis. Objective is to study the role of atorvastatin
in correction of inflammation, endotoxemia and prevention of cardiovascular complications in patients with atherosclerosis undergoing aorto-iliac
reconstruction. There were observed initial and postoperative activation of inflammation, endotoxemia in patients with multifocal atherosclerosis.
We found that short-term therapy with atorvastatin 60 mg per day had a significant advantage over low-dose in correction of pre- and postoperative
endogenous inflammation, endotoxemia and prevention of cardiac events after aorto-iliac reconstruction.
Key words: atherosclerosis, aorto-iliac reconstruction, inflammation, endotoxemia, atorvastatin.
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ СЕРДЕЧНО-СОСУДИСТОЙ ХИРУРГИИ
сосудистых операций [7]. В то же время механизмы такого влияния ингибиторов 3-гидрокси-3-метилглутарилкофермент А-редуктазы (ГМГ-КоА-редуктазы) остаются
до конца не изученными.
Цель исследования: оптимизировать предоперационную подготовку больных атеросклерозом для профилактики периоперационных кардиальных осложнений
при аортоподвздошных реконструкциях путем коррекции
эндогенной интоксикации и воспаления аторвастатином.
Пациенты и методы
Участники исследования
В исследование было включено 130 больных (средний
возраст 57,5±2,5 лет) с мультифокальным атеросклерозом. Диагноз устанавливали и уточняли на основании
данных клинического и ультразвукового исследования
(допплерография артерий брахиоцефальной зоны, восходящей и брюшной аорты, артерий нижних конечностей) на аппарате «Logic-5» (США). У 42 больных (32%)
в анамнезе присутствовал инфаркт миокарда; стабильная
стенокардия напряжения II–III функциональных классов
была установлена у 88 (68%) человек; артериальная гипертензия — у 33 (25%); у 86 (66%) выявлены стенозы брахиоцефальных артерий. Перед включением в исследование каждому пациенту было проведено полное клиническое, электрокардиографическое (ЭКГ) и эхокардиографическое (ЭхоКГ) исследование.
Критериями исключения пациентов из исследования
были предшествующая терапия статинами (в течение
последнего месяца), наличие декомпенсированной сердечной недостаточности, сахарного диабета, хронической
почечной недостаточности, перенесенный инфаркт миокарда давностью менее 6 мес, нестабильная стенокардия.
су хронической сердечной недостаточности и стабильной
стенокардии, частоте выявления артериальной гипертензии и перенесенного инфаркта миокарда до операции,
а также по сопутствующей патологии. Контрольную группу составили 36 пациентов (средний возраст 53±2,4 года)
без клинико-инструментальных признаков мультифокального атеросклероза. В раннем послеоперационном
периоде всем пациентам выполняли контрольные исследования: определение в сыворотке крови содержания тропонина I, КФК-МВ, а также проведение ЭКГ и ЭхоКГ.
В сыворотке крови иммуноферментным методом
определяли следующие биомаркеры воспаления: вч-СРБ,
секреторную фосфолипазу А2 типа IIА (сек ФЛА2-IIА).
Уровень эндотоксемии изучали по концентрации тирозинсодержащих пептидов (ТЗП) в плазме крови по методу
В.Б. Гаврилова [8]. Наблюдение и оценка всех указанных
показателей осуществлялись исходно, после лечения,
на 1-е, 5-е и 15-е сут после оперативного вмешательства.
Статистическая обработка данных
Для статистического анализа результатов исследования был использован пакет прикладных программ
«STATISTICA 6.0». Для обследуемых групп условие нормальности распределения не выполнялось, поэтому
применяли непараметрические критерии оценки. Совокупность данных представляли в виде медианы и процентилей (25-го и 75-го). Критерий Манна–Уитни применяли для сравнения показателей между группами, критерий
Вилкоксона — для сравнения данных до и после лечения,
критерий Фридмана — для динамической оценки показателей в разные временные интервалы (на 1-е, 5-е,
15-е сут после операции). Различия считали статистически значимыми при p <0,05.
Результаты
Методы исследования
Всем больным были выполнены операции бифуркационного аортобедренного шунтирования или протезирования брюшного отдела аорты. В зависимости
от дозы предоперационного назначения статинов больные были разделены на 2 группы. В 1-ю группу было
включено 64 пациента, которым назначали аторвастатин
в дозе 10 мг/сут, во 2-ю группу — 66 больных, получавших
аторвастатин в дозе 60 мг/сут в течение 12 сут. Других
отличий в медикаментозной предоперационной подготовке и интраоперационном ведении между группами
не было. Пациенты обеих групп статистически значимо
не различались по возрасту, полу, функциональному клас-
Исходный уровень вч-СРБ у больных атеросклерозом
в группах был сопоставим (табл. 1) и достоверно превышал показатель контроля (р <0,01). Высокодозовая
предоперационная терапия аторвастатином у больных
2-й группы сопровождалась значительным снижением
(на 34%; р <0,01) содержания вч-СРБ относительно его
исходного содержания, тогда как у пациентов 1-й группы
с низкодозовым лечением наблюдалась лишь недостоверная тенденция к снижению данного показателя. Таким
образом, предоперационный уровень вч-СРБ у больных
2-й группы был на 28,6% (р <0,01) ниже, чем у пациентов
1-й группы. В 1-е сут послеоперационного периода в обе-
Таблица 1. Содержание высокочувствительного С-реактивного белка (мг/л) у больных атеросклерозом до операции и в раннем послеоперационном периоде
Показатели/Сроки исследования
Исходный уровень
После лечения
p
1-е сут после операции
5–6-е сут после операции
14–15-е сут после операции
Больные атеросклерозом
1-я группа (n =64)
2-я группа (n =66)
M [25;75]
M [25;75]
3,9 [3,45;4,3]*
3,8 [3,25;4]*
3,5 [3;4]*
2,5 [2;3]* **
0,069
0,000001
10 [9,25;11]* **^
6,1 [5,5;6,75]* ** ^
7 [6,5;8]* **^
4 [3,5;5]*
4,5 [4;5,25]* **
3,25 [2,65;3,5]*
p1–2
0,42
<0,01
–
<0,001
<0,01
<0,01
Примечание (здесь и в табл. 2, 3). М — медиана, [25;75] — 25-й и 75-й процентили, * — наличие достоверных различий с показателями
контрольной группы, ** — наличие достоверных различий с исходным уровнем, ^ — наличие достоверных различий с предоперационным уровнем, p — уровень достоверности различий между показателями до и после лечения, p1–2 — уровень достоверности различий
между показателями 1-й и 2-й группы.
25
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
26
их группах наблюдалась выраженная активация реакций
эндогенного воспаления, при этом его интенсивность
у обследуемых 1-й группы была на 42% (p <0,01) выше,
чем у пациентов 2-й группы.
В последующие сроки наблюдения у больных обеих групп отмечалось снижение активности воспаления, но в 1-й группе оно реализовывалось медленнее. Так, на 14–15-е сут после операции показатель
в 1-й группе достоверно превышал таковой во 2-й группе
на 27,8% (p <0,01).
У больных мультифокальным атеросклерозом отмечалась также значимая активация секФЛА2-IIA по сравнению с контрольным значением. Лечение аторвастатином
сопровождалось достоверным снижением данного показателя только во 2-й группе (табл. 2).
Значения активности секФЛА2-IIА при межгрупповом сравнении достоверно различались на протяжении всего послеоперационного периода. На 14–15-е сут
показатель во 2-й группе был на 8% меньше, чем
в 1-й (р <0,01).
Особый интерес представляет исследование эндогенной интоксикации у данной категории больных. С одной
стороны, он обусловлен развитием в настоящее время эндотоксиновой концепции атерогенеза, с другой —
изучением проблемы хирургического стресса при сосудистых операциях. Уровень эндогенной интоксикации
у лиц контрольной группы составил 0,31 ммоль/л,
а у больных атеросклерозом был достоверно увеличен в обеих группах. После высокодозового лечения аторвастатином
эндогенная интоксикация снизилась на 33,3% (p <0,01),
а в 1-й группе достоверно не изменилась (табл. 3).
В 1-е сут послеоперационного периода степень эндогенной интоксикации у больных обеих групп значительно
повысилась, но показатель во 2-й группе был достоверно ниже, чем в 1-й (37,5%; p <0,01). Такое усиление
эндотоксиновой агрессии после операции закономерно
и объясняется факторами хирургического стресса. В последующие сроки наблюдения уровень интоксикации
снижался: во 2-й группе она достигла исходного значения к 5–6-м сут, а предоперационных значений —
к 14–15-м сут, в то время как у пациентов 1-й группы
на 14–15-е сут данный показатель только приближался
к исходному.
При сравнении общей частоты кардиальных осложнений в обследуемых группах больных с использованием
точного двустороннего критерия Фишера зафиксировано
достоверное различие (табл. 4). Таким образом, терапия
аторвастатином в дозе 60 мг/сут имела значимое преимущество перед низкодозовой в профилактике кардиальных
осложнений при реконструктивных сосудистых операциях. При сравнении не отмечено достоверных различий
между двумя режимами терапии в профилактике кардиальных интраоперационных осложнений, в то же время
различие между послеоперационными кардиальными событиями оказалось достоверным (см. табл. 4).
Обсуждение
На современном этапе большую актуальность приобретает мультимаркерная тенденция исследования воспаления не только с целью диагностики, но и рискстратификации [5]. В проведенном исследовании
у больных мультифокальным атеросклерозом регистрировали достоверную активацию воспалительного процесса:
повышение содержания вч-СРБ на 225% (p <0,01), секФЛА2 — на 73,6% (p <0,01) по сравнению с группой контроля. Отдельно необходимо отметить, что медиана, 25-й
и 75-й процентили концентрации вч-СРБ у обследуемых
больных превышали 3 мг/л, что, согласно рекомендациям
American Heart Association and the Centers for Disease Control
and Prevention, ассоциировано с высоким риском развития сердечно-сосудистых осложнений [9]. Исходно повышенное содержание СРБ отражает системное воспаление
в сосудистой стенке при мультифокальном атеросклерозе.
В свою очередь, выявленное значимое увеличение его
концентрации в 1-е сут после операции, а также дальнейшая динамика в послеоперационном периоде характеризуют патогенетическую активацию сосудистого воспаления в ответ на хирургический стресс.
Таблица 2. Динамика активности секФЛА2 -IIA (пг/мл) у больных атеросклерозом в пред- и послеоперационном периоде аортобедренного шунтирования (протезирования) брюшного отдела аорты
Показатели/Сроки исследования
Исходный уровень
После лечения
p
1-е сут после операции
5–6-е сут после операции
14–15-е сут после операции
Больные атеросклерозом
1-я группа (n =64)
2-я группа (n =66)
M [25;75]
M [25;75)
850 [750;900]*
890 [750;905]*
800 [700;900]*
750 [650;800]* **
0,24
0,00001
1000 [850;1035]* **^
920 [800;975]* ** ^
950 [850;1000]* **^
860 [810;900]*^
870 [800;900]*^
800 [750;875]* ^
p1–2
0,074
<0,01
–
<0,05
<0,01
<0,01
Таблица 3. Динамика эндогенной интоксикации (концентрации тирозинсодержащих пептидов, ммоль/л) у больных атеросклерозом в
пред- и послеоперационном периоде аортобедренного шунтирования (протезирования) брюшного отдела аорты
Сроки исследования
Исходный уровень
После лечения
p
1-е сут после операции
5–6-е сут после операции
14–15-е сут после операции
Группы больных атеросклерозом
1-я группа (n =64)
2-я группа (n =66)
M [25;75]
M [25;75]
0,58 [0,45;0,6]*
0,6 [0,45;0,7]*
0,53 [0,45;0,6]*
0,4 [0,3;0,55]* **
0,07
0,00003
1,6 [1,43;1,75]* **^
1 [0,7;1,25]* ** ^
1,15 [0,9;1,3]* **^
0,6 [0,5;0,8]*^
0,7 [0,6;1]* **^
0,45 [0,35;0,6]* **
p1–2
0,25
<0,01
–
<0,001
<0,01
<0,01
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ СЕРДЕЧНО-СОСУДИСТОЙ ХИРУРГИИ
Таблица 4. Частота кардиальных интра- и ранних послеоперационных осложнений в зависимости от особенностей предоперационной
подготовки
Осложнения
Интраоперационные нарушения ритма
Интраоперационная ишемия миокарда
Фатальный инфаркт миокарда
Нефатальный инфаркт миокарда
Нестабильная стенокардия
Острая сердечно-сосудистая
недостаточность
Общее число фатальных кардиальных
осложнений
Общее число послеоперационных
кардиальных осложнений
Общее число кардиальных сложнений
Аторвастатин, 10 м (n =64)
n
%
4
7,81
2
3,13
1
1,56
2
3,13
3
4,68
Аторвастатин, 60 мг (n =66)
n
%
2
3,03
1
1,52
0
0
1
1,52
p1–2
0,680
0,619
0,496
0,496
0,619
2
3,13
0
0,496
2
3,13
0
0,496
8
12,5
1
1,52
0,034
14
21,88
4
6,06
0,025
Примечание. p1–2 — уровень достоверности различий между показателями 1-й и 2-й группы; жирным шрифтом выделены статистически
значимые различия.
Высокая прогностическая значимость данного маркера обусловлена его многомерным участием в атерогенезе.
Известно, что синтез СРБ гепатоцитами стимулируют
цитокины, это приводит к повышению его содержания и
реализации провоспалительных функций при атеросклерозе [10]. Также в последних исследованиях показали,
что и пораженная сосудистая ткань локально способна
продуцировать СРБ. Это подтверждает роль данного белка в прогрессировании атеросклеротической бляшки.
Наряду с вч-СРБ, секФЛА2-IIА также является одним
из чувствительных маркеров эндогенного воспаления в
сосудистой стенке. Данный фермент стимулирует освобождение липидных медиаторов — ненасыщенных жирных кислот, окисленных ненасыщенных жирных кислот,
лизофосфолипидов; вызывает модификацию ароВ100липопротеинов в более атерогенную форму, способствует
аккумуляции липопротеинов в интиме [11] и, что имеет
особое значение для обследуемой нами когорты больных,
принимает участие в прогрессии аневризмы [12].
Нами было установлено снижение концентрации вчСРБ на 34% (р <0,01), секФЛА2-IIA — на 15,7% (р <0,01)
под влиянием высокодозовой предоперационной статинотерапии и не отмечено достоверных изменений указанных показателей в группе больных, получавших низкую дозу аторвастатина. Дозозависимость плейотропного
противовоспалительного влияния статинов была ранее
продемонстрирована в ряде исследований [3, 13]. Однако
в нашей работе впервые оценен этот эффект как в пред-,
так и в послеоперационном периоде реконструктивных
сосудистых операций. Актуальность изучения данного
аспекта подтверждается и аналитическим обзором авторов, согласно которому у больных с исходно высоким
уровнем цитокинов и СРБ повышается риск развития
осложнений после сосудистых операций [5]. Полученные
результаты показали выраженную активацию воспалительного ответа в раннем послеоперационном периоде
аортобедренного шунтирования (протезирования) брюшного отдела аорты, однако различие между группами в
его интенсивности прослеживалось на протяжении всего
срока наблюдения. Так, в 1-е сут после операции уровень
вч-СРБ во 2-й группе был на 42% ниже, чем в 1-й, на
14–15-е сут — на 27,8% (р <0,01). По показателю концентрации секФЛА2-IIA в послеоперационном периоде
также зарегистрированы достоверные различия.
По данным литературы, имеет место высокая частота развития послеоперационных осложнений у боль-
ных атеросклерозом с высоким уровнем эндотоксемии.
Именно поэтому проблема купирования эндотоксиновой
агрессии в реконструктивной хирургии представляет особый интерес [14]. Нами выявлен антиэндотоксиновый
эффект высокодозовой статинотерапии: уровень ТЗП
во 2-й группе снизился на 33,3% (p <0,01). 1-е сут после
операции характеризовались значительным увеличением
уровня эндотоксемии у пациентов обеих групп, однако
во 2-й группе показатель был ниже аналогичного в 1-й
на 37,5% (p <0,01). В дальнейшие сроки наблюдения содержание ТЗП в 1-й группе к 14–15-м сут превышало
исходное значение, а во 2-й группе уже к 5–6-м сут было
сопоставимо с ним и на 14–15-е сут достигло предоперационного уровня. Такое влияние высокодозовой терапии
статинами на эндотоксемию во многом может быть обусловлено ее противовоспалительным и антиоксидантным
эффектами, разрывающими «порочный» патогенетический круг «окислительный стресс – эндотоксемия –
воспаление».
Необходимо также подчеркнуть, что в литературе отсутствуют данные, аналогичные полученным в данном
исследовании, по преимуществу высокодозовой терапии
статинами для профилактики периоперационных кардиальных осложнений в реконструктивной ангиохирургии.
Заключение
Установлена исходная активация эндогенного воспаления и интоксикации у больных с распространенным атеросклерозом, характеризующаяся достоверным
повышением содержания в сыворотке и плазме крови
всего комплекса исследованных биомаркеров: вч-СРБ,
секФЛА2-IIA, ТЗП. Показано, что плейотропный противовоспалительный и антиэндотоксиновый эффект статинов достоверно реализовывался только во 2-й группе
больных с использованием высоких доз статинов. Наиболее выраженное воздействие аторвастатина, по нашим
данным, наблюдалось в отношении вч-СРБ.
Показано, что кратковременная терапия аторвастатином в дозе 60 мг/сут имеет значимое преимущество перед
низкодозовой в коррекции пред- и послеоперационного
эндогенного воспаления, интоксикации и в профилактике ранних кардиальных осложнений при выполнении
операции аортобедренного шунтирования (протезирования) брюшного отдела аорты.
27
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
ЛИТЕРАТУРА
1.
2.
3.
4.
5.
6.
28
7.
Казаков А.Ю. Диагностика и тактика лечения больных
с окклюзирующими поражениями брюшной аорты и артерий
нижних конечностей при наличии сочетанной ИБС. Автореф.
дисс. … докт. мед. наук. М. 2009. 46 с.
Покровский А.В., Кунцевич Г.И., Зотиков А.Е., Головюк А.Л.,
Бурцева Е.А., Иванов Л.О., Сунцов Д.С. Применение розувастатина в профилактике кардиальных осложнений при оперативном лечении больных с патологией сосудов. Ангиология
и сосудистая хирургия. 2009; 15 (3): 9–13.
Ridker P.M., Cannon C. P., Morrowet D., Rifai N., Rose L.M.,
McCabe C.H., Pfeffer M.A., Braunwald E. Pravastatin or atorvastatin evaluation and infection therapy-thrombolysis in myocardial
infarction 22 (PROVE IT-TIMI 22) investigators C-reactive protein
levels and outcomes after statin therapy. N. Engl. J. Med. 2005;
352: 20–28.
Аршинов А.В., Маслова И.Г. Роль инфекции и воспаления
в развитии атеросклероза (обзор литературы). Ангиология
и сосудистая хирургия. 2011; 17 (1): 35–41.
Гавриленко А.В., Воронов Д.А., Кочетов C.В. Прогнозирование результатов артериальных реконструкций и вероятности
прогрессирования атеросклероза на основании уровня плазменных цитокинов. Ангиология и соcудистая хирургия. 2010;
16 (3): 146–151.
Полянцев А.А., Мозговой П.В., Фролов Д.В., Новочадов В.В.,
Спельчук А.М. Оценка прогностической значимости морфометрических параметров воспаления сосудистой стенки
в отношении отдаленных результатов реконструктивных операций в аортоподвздошной зоне. Ангиология и сосудистая
хирургия. 2011; 17 (1): 42–46.
Chan Y.C., Cheng S.W., Irwin M.G. Perioperative use of statins
in noncardiac surgery. Vasc. Health Risk Manag. 2008; 4 (1): 75–81.
8.
9.
10.
11.
12.
13.
14.
Гаврилов В.Б., Лобко Н.Ф., Гаврилова А.Р., Конев С.В.
Определение тирозинсодержащих пептидов в плазме крови
с коррекцией фонового поглощения. Резкое повышение чувствительности теста к интоксикации организма. Клиническая
и лабораторная диагностика. 2004; 6: 19–22.
Pearson T.A., Mensah G.A., Alexander R.W., Anderson J.L.,
Cannon R.O. 3rd, Criqui M., Fadl Y.Y., Fortmann S.P.,
Hong Y., Myers G.L., Rifai N., Smith S.C. Jr, Taubert K.,
Tracy R.P., Vinicor F. Centers for Disease Control and Prevention; American Heart Association. Markers of inflammation and
cardiovascular disease: application to clinical and public health
practice — a statement for healthcare professionals from the Centers
for Disease Control and Prevention and the American Heart Association. Circulation. 2003; 107: 499–511.
Kajinami K., Kawai Y. C-reactive protein; new evidence for another
inflammatory biomarker predicting cardiovascular disease risk. Atherosclerosis. 2011; 214: 39–40.
Holvoet P., Keyzer D. De, Jacobs D.R. Oxidized LDL and the
metabolic syndrome. Future Lipidol. 2008; 3 (6): 637–649.
Federici M., Menghini R. s-PLA2: linking atherosclerosis to aneurism progression. Atherosclerosis. 2011; 214: 41–42.
Тутунов В.С., Попкова Т.В., Новикова Д.С., Насонов Е.Л.,
Кухарчук В.В. Сравнительная оценка противовоспалительного действия низко- и высокодозовых вариантов применения
аторвастатина при ишемической болезни сердца и ревматоидном артрите. Кардиоваскулярная терапия и профилактика.
2008; 7: 43–48.
Швальб П.Г., Калинин Р.Е. Некоторые биохимические изменения в крови больных с облитерирующим атеросклерозом
артерий нижних конечностей до и после оперативного лечения. Ангиология и сосудистая хирургия. 2007; 13 (3): 34–36.
КОНТАКТНАЯ ИНФОРМАЦИЯ
Медведева Елена Александровна, кандидат медицинских наук, ассистент кафедры пропедевтической терапии ГБОУ
ВПО «Самарский государственный медицинский университет» МЗ РФ
Адрес: 443099, Самара, ул. Чапаевская, д. 89; тел.: (846) 276-78-37; е-mail: elena5583@mail.ru
Щукин Юрий Владимирович, доктор медицинских наук, профессор, заведующий кафедрой пропедевтической
терапии ГБОУ ВПО «Самарский государственный медицинский университет» МЗ РФ
Адрес: 443099, Самара, ул. Чапаевская, д. 89; тел.: (846) 276-78-37; е-mail: samgmu_pt@mail.ru
Селезнев Евгений Иванович, кандидат медицинских наук, ассистент кафедры пропедевтической терапии ГБОУ ВПО
«Самарский государственный медицинский университет» МЗ РФ
Адрес: 443099, Самара, ул. Чапаевская, д. 89; тел.: (846) 995-90-33; е-mail: sonteg@mail.ru
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ЭНДОКРИНОЛОГИИ
Л.М. Берштейн, Д.А. Васильев, Т.Е. Порошина, М.П. Бояркина, Е.В. Цырлина
Научно-исследовательский институт онкологии им. Н.Н. Петрова, Санкт-Петербург, Российская Федерация
Гормонально-метаболические особенности
постменопаузальных женщин с впервые
выявленным сахарным диабетом:
роль онкологического заболевания
и наследственной предрасположенности
к диабету
В исследовании участвовали 85 женщин, у 35 из которых имел место впервые диагностированный сахарный диабет 2-го типа (СД2),
а у других 50 помимо диабета недавно было зарегистрировано также злокачественное новообразование (ЗН+СД2), главным образом в гормонозависимых тканях. Группе с сочетанием рака и нарушением углеводного обмена были свойственны более высокие значения массы тела,
инсулинемии, эстрадиолемии, концентрации интерлейкина 6 в сыворотке и активности глиоксалазы I в мононуклеарах крови, а также
тенденция к повышению окружности талии и большей величине прогностического диабетического балльного индекса. В то же время у пациенток из группы ЗН+СД2, в случае если у них имелись родственники, страдающие сахарным диабетом 2-го типа, была отмечена тенденция
к более низким значениям индекса массы тела, общего и висцерального жира, окружности талии, инсулинемии, гликированного гемоглобина
и интерлейкина 6 в сыворотке крови, вязкости эритроцитарных мембран, процента комет в мононуклеарах и к более высокой активности глиоксалазы I в последних по сравнению с больными с неотягощенной наследственностью по сахарному диабету. Эти данные по своей
направленности были в основном противоположны результатам, полученным при сравнении аналогичных подгрупп больных сахарным диабетом 2-го типа без онкологического заболевания. Сделан вывод о том, что наличие наследственной отягощенности по сахарному диабету
2-го типа различным образом реализуется в популяции диабетиков с большей или меньшей предрасположенностью к развитию злокачественных опухолей, механизмы которой, в т.ч. имеющие генетическую природу, нуждаются в дальнейшем изучении.
Ключевые слова: диабет, рак, наследственная отягощенность, гормонально-метаболический фенотип, повреждение ДНК.
Введение
Сахарный диабет 2-го типа (СД2) принадлежит
к числу основных неинфекционных заболеваний человека и характеризуется достаточно высокой распространенностью и неуклонным нарастанием популяционной
частоты, что позволило присвоить ему в последние десятилетия статус эпидемии [1]. Наличие СД2 повышает,
хотя и в различной степени, риск развития сердечно-сосудистой патологии и некоторых злокачественных новообразований [1, 2]. Другим неблагоприятным моментом
является тот факт, что сочетание рака и диабета суще-
L.M. Berstein, D.A. Vasilyev, T.E. Poroshina, M.P. Boyarkina, E.V. Tsyrlina
N.N. Petrov Research Institute of Oncology, St. Petersburg, Russian Federation
Hormonal-metabolic pattern of postmenopausal females with new onset
of diabetes mellitus type 2: the role of cancer and hereditary
predisposition to diabetes
85 females were studied, 35 females had new onset of diabetes (DM2) and in 50 women DM2 was associated with recently diagnosed cancer
(C+DM2). Group C+DM2 was characterized by higher levels of body mass index, insulinemia, estradiolemia, interleukin 6 in serum, and glyoxalase
I activity in mononuclears. At the same time patients in C+DM2 group who had familial predisposition to DM2 were characterized by lower body
mass index, body fat content, waist circumference, insulinemia, serum interleukin 6, viscosity of erythrocyte membranes and percent of comets
in mononuclears in comparison with patients without familial predisposition to DM2. These trends were mostly opposite to the data of subgroups
comparison (with or without relatives with DM2) in females with DM2 without cancer. The conclusion is made that the hereditary load with DM2
is differently realized in diabetics with higher or lower predisposition to cancer that deserves further study.
Key words: diabetes, cancer, family history of diabetes, hormonal-metabolic pattern, DNA damage.
29
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
ственно снижает выживаемость онкологических больных
[3], что дополнительно обусловливает не только медицинскую, но и социальную значимость этой проблемы. Следует добавить, что наличие СД2 в семье нередко относится к числу факторов, способствующих еще большему его
распространению [4]. Между тем вопрос о том, меняется
ли онкологическая заболеваемость у больных диабетом
с семейной отягощенностью по СД2, и за счет каких механизмов происходит это изменение, находится, по сути,
на начальных этапах своего изучения [5, 6].
Цель исследования: с учетом семейной предрасположенности к СД2 сравнить гормонально-метаболический
фенотип больных с впервые диагностированным сахарным диабетом, страдающих или не страдающих недавно
обнаруженными онкологическими заболеваниями.
Пациенты и методы
30
Участники исследования
В исследование были включены женщины (n=85)
с ранее недиагностированным сахарным диабетом/
нарушенной толерантностью к глюкозе, длительностью
менопаузы не менее 1 года и возрастом в интервале
от 48 до 79 лет. 35 обследуемых не страдали какой-либо онкологической патологией, а у 50 женщин имелось недавно (в пределах от 2 до 10 нед) обнаруженное
онкологическое заболевание, более чем в 60% случаев
представлявшее собой рак молочной железы, тела матки
или толстой кишки.
Методы исследования
Все пациентки прошли антропометрическое исследование (в т.ч. с оценкой состава тела методом биоэлектрического импеданса) и дообследование после
10–12-часового ночного голодания. Это исследование,
помимо определения гликемии и уровня гликилированного гемоглобина (HbA1c), включало в себя оценку липидемии, инсулинемии, индекса инсулинорезистентности (HOMA), эстрадиолемии и тестостеронемии,
уровня лептина, адипонектина, фактора некроза опухолей альфа (ФНО ), интерлейкина 6 (ИЛ 6), тиреотропина и показателя повреждения ДНК 8-гидрокси2-дезоксигуанозина (8-OH-dG) в сыворотке крови
методами энзимоколориметрического и иммуноферментного анализа. При работе с мононуклеарами, выделенными из цельной крови в градиенте фикола/верографина, изучали процентное содержание клеток, несущих
кометы, и длину «хвостов» последних методом электрофореза в агарозе, активность компонента детоксификации метилглиоксаля (глиоксалазы I), а также интенсивность генерации реактивных форм кислорода методом
люминометрии в базальных условиях и после инкубации
мононуклеаров с перекисью водорода. В эритроцитах,
полученных из тех же образцов крови, оценивали вязкость мембран спектрофлуориметрическим методом
с использованием флуоресцентного зонда пирена. Тщательный сбор анамнестических данных включал в себя
оценку величины диабетического балльного индекса
в модификации, учитывающей, помимо прочего, роль
семейного фактора и степени родства (родители, сестры,
братья и т.д.) [7].
Статистическая обработка данных
Статистическую обработку результатов производили
с помощью пакета прикладных программ SigmaPlot for
Windows и Statistica 7.0. Сравнение показателей в отдельных группах осуществляли на основе критериев Стьюдента или Вилкоксона. Критический уровень значимости
при проверке статистических гипотез принимался равным 0,05. Данные в таблицах представлены как среднее
значение + ошибка средней.
Результаты
При отсутствии различий между постменопаузальными больными СД2/больными с низкой толерантностью
к глюкозе, имеющими и не имеющими онкологического заболевания, по возрасту (62,4±1,2 и 62,9±1,4 года,
соответственно) и содержанию HbA1c (6,41±0,15
и 6,55±0,42%, соответственно) в крови группа с сочетанием рака и нарушения углеводного обмена характеризовалась более высокими значениями массы тела, индекса массы тела (ИМТ), инсулинемии, индекса HOMA,
эстрадиолемии и концентрации ИЛ 6 в сыворотке крови,
а также тенденцией к повышению содержания жира
в теле и окружности талии (табл. 1).
В тех же сравниваемых группах, т.е., соответственно,
«недавно обнаруженное злокачественное новообразование + впервые выявленный СД2» (ЗН+СД2) и «нелеченый СД2 без онкологического заболевания» (СД2-ЗН),
не было установлено различий по уровням отдельных
липидных фракций, лептина, адипонектина, ФНО 
и тестостерона. В первой из этих групп была обнаружена
тенденция к более низким значениям тиреотропинемии,
а также большая величина прогностического диабетического балльного индекса (табл. 2).
Группа ЗН+СД2 характеризовалась (по сравнению
с СД2-ЗН) более высокой активностью глиоксалазы I
в мононуклеарах крови на фоне тенденции к снижению процентного содержания мононуклеаров с кометами
и отсутствия отличий в тех же клетках по генерации
реактивных форм кислорода, вязкости эритроцитарных
мембран, а также уровню 8-OH-dG в сыворотке крови
(табл. 3).
Таблица 1. Сравнительная характеристика больных сахарным диабетом, имеющих и не имеющих онкологических заболеваний, по
некоторым антропометрическим параметрам, инсулинемии, эстрадиолемии и содержанию интерлейкина 6 в сыворотке крови (M±m)
Группа
ЗН+СД2
СД2-ЗН
p
Масса тела,
кг
ИМТ,
усл.ед.
СЖТ, %
87,0±2,7
78,5±2,5
<0,05
33,25±0,97
30,31±0,83
<0,05
44,31±0,74
42,02±1,39
–
Окружность
талии, см
мкЕД/мл
Инсулин,
HOMA,
усл.ед.
Эстрадиол,
пмоль/л
ИЛ 6,
пг/мл
99,70±1,93
95,57±2,27
–
19,84±2,75
12,20±1,38
<0,05
6,38±1,12
3,34±0,40
<0,05
101,3±27,8
43,5±10,8
<0,05
5,39±1,50
0,17±0,07
<0,05
Примечание. ЗН — злокачественное новообразование, СД2 — сахарный диабет 2-го типа; ИМТ — индекс массы тела (Кетле); СЖТ —
содержание жира в теле; HOMA — индекс инсулинорезистентности [(гликемия натощак  инсулинемия натощак)/22,5]; p — уровень
достоверности.
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ЭНДОКРИНОЛОГИИ
Таблица 2. Сравнительная характеристика больных сахарным диабетом, имеющих и не имеющих онкологических заболеваний, по
величине диабетического балльного индекса, содержанию в крови липидов, факторов, ассоциированных с жировой тканью, тестостерона и тиреотропина (M±m)
Группа
ЗН+СД2
СД2-ЗН
p
ДБИ,
усл. ед.
16,57±0,48
13,60±0,71
ОХС,
ммоль/л
6,05±0,18
6,03±0,23
ХС-ЛПВП,
ммоль/л
1,77±0,15
1,65±0,10
ТГ,
ммоль/л
1,93±0,07
1,77±0,12
Лептин,
нг/мл
21,73±2,94
17,40±2,58
Адипонектин,
мкг/мл
11,92±1,14
14,10±1,47
ФНО ,
пг/мл
1,66±0,18
1,34±0,18
ТС,
нг/дл
0,40±0,04
0,46±0,04
ТТГ,
мкМЕ/мл
1,66±0,19
3,55±1,11
< 0,05
–
–
–
–
–
–
–
–
Примечание (см. также табл. 1). ДБИ — диабетический балльный индекс; ОХС — общий холестерин; ХС-ЛПВП — липопротеиды
высокой плотности; ТГ — триглицериды; ФНО  — фактор некроза опухолей альфа; ТС — тестостерон; ТТГ — тиреотропный гормон;
p — уровень достоверности.
Таблица 3. Сравнение больных сахарным диабетом, имеющих и не имеющих онкологических заболеваний, по параметрам, характеризующим некоторые клеточные функции и степень повреждения ДНК (M±m)
Группа
ЗН+СД2
СД2-ЗН
p
Активность
глиоксалазы I, усл.ед.
116,9±12,7
87,5±9,7
<0,05
Вязкость БЛК,
усл. ед.
1,11±0,07
1,24±0,09
–
Вязкость ЛЛК,
усл. ед.
1,67±0,17
1,87±0,16
–
Кометы,
%
29,4±6,3
46,3±10,7
–
Генерация РФК,
усл. ед.
1,76±0,16
1,77±0,12
–
8-OH-dG,
пг/мл
1,53±0,11
1,62±0,27
–
Примечание (см. также табл. 1 и текст). БЛК — белок-липидные контакты, ЛЛК — липид-липидные контакты; РФК — реактивные формы кислорода; 8-OH-dG — содержание 8-гидрокси-2-дезоксигуанозина (маркера повреждения ДНК) в сыворотке крови
(определялось иммуноферментным методом); p — уровень достоверности. Другой маркер повреждения ДНК — доля мононуклеаров,
содержащих «хвосты» (кометы), исследовали путем гель-электрофореза изолированных клеток в агарозе. Активность глиоксалазы I
в мононуклеарах изучали спектрофотометрическим методом по образованию лактоглютатиона при реакции глютатиона с метилглиоксалем. Вязкость эритроцитарных мембран в зонах белок-липидных и липид-липидных контактов оценивали по коэффициенту эксимеризации пирена; величина коэффициента, представленная в таблице, обратна вязкости (т.е. более высокие цифры свидетельствуют
о более низкой вязкости). Образование РФК (величина этого параметра в стимулированных в течение 3 мин 10–7М раствором перекиси
водорода мононуклеарах по отношению к показателю в нестимулированных клетках) оценивали по люминолзависимой хемилюминесценции в присутствии частиц латекса.
В группах ЗН+СД2 и СД2-ЗН оказалось, соответственно, по 24,0% (12 из 50) и 34,3% (12 из 35) женщин,
у которых не только впервые были выявлены нарушения углеводного обмена, но и имелись родственники
(преимущественно кровные), сами болеющие или болевшие СД2. Анализ полученных данных позволил установить, что та часть группы ЗН+СД2, которая имела родственников, страдавших СД2, характеризовалась
тенденцией к более низким значениям ИМТ, общего
и висцерального жира, окружности талии, инсулинемии,
индекса HOMA, HbA1c и ИЛ 6 в сыворотке крови, вязкости эритроцитарных мембран, процентного содержания
комет в мононуклеарах и имела склонность к более высокой активности глиоксалазы I в последних по сравнению
с больными без отягощенного семейного анамнеза по
СД2 (рис. 1А). В отношении большинства перечисленных
маркеров эти тенденции по своей направленности отличались от тех, которые были обнаружены при сравнении
подгрупп больных СД2 без онкологических заболеваний
(СД2-ЗН), соответственно, имевших или не имевших
больных СД2 среди родственников (рис. 1Б). Подобные
различия касались, в частности, и употребления кофе
в течение дня, которое было большим в группе ЗН+СД2
с отягощенной по диабету наследственностью, что не
было свойственно соответствующей подгруппе больных
СД2-ЗН (рис. 2).
Обсуждение
Участвовавшие в настоящем исследовании женщины
постменопаузального возраста характеризовались рядом
особенностей. Помимо того, что никому из обследованных диагноз СД2 ранее не ставился, уровень гликемии
натощак при первом обследовании был повышен умеренно и лишь в 7,1% случаев (у 6 пациенток) характеризовался значениями в пределах 8,4–10,7 ммоль/л, что при
анализе позволяло абстрагироваться от ответа на вопрос
о зависимости результатов от степени выраженности
гипергликемии. В группе, в которой СД2 либо нарушенная толерантность к глюкозе были обнаружены у онкологических больных, злокачественное новообразование
выявлялось незадолго до проводившегося обследования,
в большей части случаев оно не характеризовалось выраженной вариабельностью клинической стадии процесса или предоперационным похуданием, и никакой
терапии до начала исследования больным не назначали.
Соблюдение этих, достаточно жестких, ограничений,
естественно, затрудняло формирование основных групп,
однако (в силу последовательного, практически без пропусков, подбора лиц с указанными характеристиками
и учета гендерного и возрастного критерия) делало такие
группы гомогенными.
Следует подчеркнуть, что сопоставление особенностей больных с только что выявленным и предположительно находящимся на относительно ранних этапах своего развития диабетом (о чем говорит
и относительно невысокий средний уровень гликированного гемоглобина), сочетающимся и не сочетающимся с также относительно недавно обнаруженным злокачественным новообразованием,
проводилось, насколько нам известно, впервые.
В связи с этим, говоря о выбранных для исследования маркерах и параметрах, необходимо отме-
31
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
%
%
А
130
Б
200
120
180
110
160
100
140
90
120
80
100
70
80
60
60
50
40
ИМТ
ЖТ
ВЖ
ОТ ИНС
ИР
ГлГ ИЛ+6 ВЗК Ком 8+ОНГ CI РФК
ИМТ
ЖТ
ВЖ
ОТ ИНС
ИР
ГлГ ИЛ+6 ВЗК Ком 8+ОНГ CI РФК
Рис. 1. Сопоставление относительной величины исследованных параметров в группах «недавно обнаруженное злокачественное новообразование + впервые диагностированный сахарный диабет 2-го типа» (А) и «нелеченый сахарный диабет 2-го типа без онкологического заболевания» (Б).
32
Примечание. Данные в подгруппах больных без наследственной отягощенности по сахарному диабету приняты за 100% и обозначены
штриховой линией; результаты в подгруппах с отягощенной наследственностью по диабету в семье обозначены сплошной линией.
ИМТ — индекс массы тела; ЖТ — содержание жира в теле; ВЖ — доля висцерального жира; ОТ — окружность талии; ИНС — инсулинемия; ИР — индекс инсулинорезистентности, HOMA; ГлГ — гликированный гемоглобин; ИЛ 6 — содержание интерлейкина 6
в сыворотке крови; ВЗК — вязкость эритроцитарных мембран; Ком — процентное содержание комет в мононуклеарах; 8-OH — содержание 8-гидрокси-2-дезоксигуанозина в сыворотке крови; ГС I — активность глиоксалазы I в мононуклеарах; РФК — степень люминол-зависимой стимуляции образования реактивных форм кислорода в мононуклеарах.
2,0
1,8
1,6
1,4
1,2
1,0
0,8
0,6
0,4
0,2
0,0
ЗН+СД2
СД2+ЗН
Рис. 2. Употребление кофе в течение дня в сравниваемых группах
больных.
Примечание. ЗН+СД2 — группа «недавно обнаруженное злокачественное новообразование + впервые диагностированный
сахарный диабет 2-го типа»; СД2-ЗН — группа «нелеченый
сахарный диабет 2-го типа без онкологического заболевания».
Синие столбики — больные с отягощенной наследственностью
по диабету, светлые столбики — без наследственной отягощенности. По оси ординат — среднее число чашек кофе, употребляемое
в течение дня.
тить, что они были призваны ответить на вопросы,
не только типичные для обследования больных СД2/
метаболическим синдромом (антропометрия, инсулин/инсулинорезистентность, лептин/адипонектин, цитокины, ассоциированные с легким хроническим воспалением, и т.д.), но и на позволяющие
составить представление о некоторых других сторо-
нах деятельности эндокринной системы, в частности
о тиреоидной функции и содержании половых гормонов (тестостерона и эстрадиола) в сыворотке крови.
На первый взгляд странное в контексте настоящей работы изучение количества употребляемого кофе объясняется предположением о модифицирующем влиянии
последнего на риск развития СД2 именно посредством
изменения уровня связывающего половые гормоны
глобулина и эстрадиола в циркуляторном русле [8].
Наконец, использование методов, характеризующих
функциональное состояние клеток, имело целью оценить особенности передачи внутриклеточного сигнала
(вязкость эритроцитарных мембран), взаимодействие
гликолиза и его побочного продукта, метилглиоксаля, обладающего ДНК-повреждающим действием (активность глиоксалазы I), а также исследовать менее
косвенные параметры присущего диабету [9, 10] генотоксического повреждения (содержание комет и генерация реактивных форм кислорода в мононуклеарах
и 8-гидрокси-2-дезоксигуанозина в крови). Это представляло для данной работы дополнительную важность,
поскольку ранее мы предположили, что парадоксальное отсутствие повышенного онкологического риска и
даже некоторое его снижение у больных диабетом с наследственной отягощенностью [5, 6, 11, 12] может быть
среди прочих факторов связано с т.н. наследственной
метаболической защитной адаптацией. При этом допускалось, что при переходе от предыдущей генерации
больных диабетом (родителей) к более молодой группе
родственников (потомкам) последние могут приобретать дополнительные характеристики, помогающие
преодолевать генотоксический стресс и тем самым
противодействовать риску развития злокачественных
новообразований [6]. Попытка использования одного
из возможных подходов к анализу оправданности данного предположения и была предпринята в настоящем
исследовании.
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ЭНДОКРИНОЛОГИИ
Обсуждая полученные результаты с учетом вышесказанного, остановимся лишь на нескольких моментах. Наиболее характерными отличиями больных группы ЗН+СД2
от пациенток группы СД2-ЗН оказались большая величина массы тела и, очевидно, сопряженные с ней большая
выраженность инсулинемии/инсулинорезистентности
и эстрогенемии, а также повышение диабетического
балльного индекса и уровня ИЛ 6 в крови (см. табл. 1 и 2).
Несомненно, что помимо ведущей роли избытка жира
в теле в этих сдвигах имеется и онкологический компонент
с присущей ряду новообразований гормонозависимых тканей (в частности, постменопаузальному варианту рака
молочной железы) связью и с ожирением, и с избыточной
эстрогенной стимуляцией, и с гиперпродукцией ИЛ 6 [13,
14]. С другой стороны, достоверное повышение в группе
ЗН+СД2 активности глиоксалазы I, участвующей в разрушении мутагенного метилглиоксаля [15], соответствует
тенденции к снижению в той же группе пациенток доли
мононуклеаров, содержащих кометы, т.е. к меньшему повреждению ДНК (см. табл. 3).
Один из вероятных ответов на вопрос, как можно объяснить данные наблюдения, дают сведения, нашедшие отражение на рис. 1 и характеризующие роль семейного фактора (наличие случаев СД2 в семье). В то время как в группе
ЗН+СД2 семейность по СД2 в анамнезе сочеталась с менее
выраженными ожирением, гиперинсулинемией, содержанием ИЛ 6-емией, вязкостью липидных мембран и генотоксичностью (по доле клеток с кометами) (см. рис. 1А),
в группе больных диабетом без онкологических заболеваний тот же семейный фактор к подобным сдвигам по большинству параметров не приводил (см. рис. 1Б). Ранее отмечалось, что для больных СД2, у которых родители страдали
диабетом, характерны начало болезни в более молодом возрасте, большая масса тела и более выраженная дислипидемия [16]. Вполне очевидно, что, как впервые было показано
в нашей работе, наличие семейной отягощенности
по диабету в случае сочетания ЗН+СД2, напротив, скорее несколько нивелирует исследованные метаболические проявления и неблагоприятные клеточные реакции.
Не исключено, что этим отчасти и может быть объяснена
кажущаяся парадоксальной тенденция к снижению риска развития некоторых злокачественных новообразований у больных диабетом определенного пола и возраста
со случаями СД2 в семье [5, 6, 11, 12]. Другим потенциально важным компонентом трактовки установленных
особенностей могут оказаться определенные особенности
генома, имеющие отношение не только к риску возникновения СД2 или рака, но и к индивидуальной чувствительности к ряду пищевых факторов (примером служит
квартет «кофесвязывающий половые гормоны глобулин–
генотип–риск СД2» — см. [8] и рис. 2) и противодиабетических препаратов, однако данная гипотеза нуждается
в дополнительном изучении.
Заключение
Различия, выявившиеся при проведении настоящего
исследования между постменопаузальными женщинами —
больными диабетом 2-го типа в сочетании со злокачественным новообразованием и больными СД2 без онкопатологии, с одной стороны, и между больными СД2 с отягощенной и не отягощенной по диабету наследственностью,
с другой, заставляют обращать внимание на гетерогенность
СД2 (в том числе с учетом его расширяющейся эпидемии)
и, возможно, искать дополнительные подходы к выбору
мер рациональной профилактики и терапии обсуждавшихся подвариантов данного заболевания.
Работа выполнена в соответствии с научным планом
учреждения и частично поддержана грантом РФФИ 12-0400084а.
ЛИТЕРАТУРА
1.
2.
3.
4.
5.
6.
7.
8.
Дедов И.И., Шестакова М.В. Сахарный диабет и артериальная
гипертензия. М.: МИА. 2006. 340 с.
Giovannucci E., Harlan D.M., Archer M.C., Bergenstal R.M.,
Gapstur S.M., Habel L.A., Pollak M., Regensteiner J.G., Yee D.
Diabetes and cancer: a consensus report. Diabetes Care. 2010;
33 (7): 1674–1685.
Liu X., Ji J., Sundquist K., Sundquist J., Hemminki K. The impact
of type 2 diabetes mellitus on cancer-specific survival: a follow-up
study in Sweden. Cancer. 2012; 118 (5): 1353–1361.
Pappas Y., Wei I., Car J., Majeed A., Sheikh A. Computer-assisted
versus oral-and-written family history taking for identifying people
with elevated risk of type 2 diabetes mellitus. Cochr. Database Syst.
Rev. 2011; 12: CD008489.
Hemminki K., Li X., Sundquist J., Sundquist K. Risk of cancer following hospitalization for type 2 diabetes. Oncologist. 2010; 15 (6):
548–555.
Берштейн Л.М., Бояркина М.П., Тесленко С.Ю., Васильев Д.А.
Частота семейного диабета у страдающих диабетом онкологических больных. Вопр. онкологии. 2011; 57 (4): 443–447.
Lindstrom J., Tuomilehto J. The diabetes risk score: a practical tool to predict type 2 diabetes risk. Diabetes Care. 2003;
26: 725–731.
Goto A., Song Y., Chen B.H., Song Y., Aziz N., You N.C.,
Wellons M.F., Manson J.E., White D.L., Butch A.W., Liu S.
Coffee and caffeine consumption in relation to sex hormone-binding globulin and risk of type 2 diabetes in postmenopausal women.
Diabetes. 2011; 60 (1): 269–275.
9.
10.
11.
12.
13.
14.
15.
16.
Dandona P., Thusu K., Cook S., Snyder B., Makowski J., Armstrong D., Nicotera T. Oxidative damage to DNA in diabetes mellitus. Lancet. 1996; 347 (8999): 444–445.
Piconi L., Quagliaro L., Ceriello A. Oxidative stress in diabetes.
Clin. Chem. Lab. Med. 2003; 41 (9): 1144–1149.
Brauer P.M., Mc Keown-Eyssen G.E., Jazmaji V., Logan A.G.,
Andrews D.F., Jenkins D., Marcon N., Saibil F., Cohen L.,
Stern H., Baron D., Greenberg G., Diamandis E., Kakis G., Singer W., Steiner G. Familial aggregation of diabetes
and hypertension in a case-control study of colorectal neoplasia.
Am. J. Epidemiol. 2002; 156 (8): 702–713.
Berstein L.M., Boyarkina M.P., Teslenko S.Y. Familial diabetes is
associated with reduced risk of cancer in diabetic patients: a possible
role for metformin. Medical Oncology. 2012; 29 (2): 1308–1313.
Calle E.E., Kaaks R. Overweight, obesity and cancer: epidemiological evidence and proposed mechanisms. Nat. Rev. Cancer. 2004;
4 (8): 579–591.
Ravishankaran P., Karunanithi R. Clinical significance of preoperative serum interleukin-6 and C-reactive protein level in breast
cancer patients. World J. Surg. Oncol. 2011; 9: 18.
Резцова В.В., Коваленко И.Г., Берштейн Л.М. Метилглиоксаль и глиоксалаза при опухолевом росте и диабете. Вопр.
онкологии. 2008; 54 (2): 142–147.
Papazafiropoulou A., Sotiropoulos A., Skliros E., Kardara M.,
Kokolaki A., Apostolou O., Pappas S. Familial history of diabetes
and clinical characteristics in Greek subjects with type 2 diabetes.
BMC Endocrine Disorders. 2009; 9: 12.
33
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
КОНТАКТНАЯ ИНФОРМАЦИЯ
Берштейн Лев Михайлович, доктор медицинских наук, профессор, руководитель лаборатории онкоэндокринологии
ФГБУ «Научно-исследовательский институт онкологии им. Н.Н. Петрова» МЗ РФ
Адрес: 197758, Санкт-Петербург, пос. Песочный, ул. Ленинградская, д. 68; тел.: (812) 596-86-54;
е-mail: levmb@endocrin.spb.ru
Васильев Дмитрий Алексеевич, кандидат медицинских наук, старший научный сотрудник лаборатории онкоэндокринологии ФГБУ «Научно-исследовательский институт онкологии им. Н.Н. Петрова» МЗ РФ
Адрес: 197758, Санкт-Петербург, пос. Песочный, ул. Ленинградская, д. 68; тел.: (812) 596-85-49;
е-mail: dvasilyev@hotmail.com
Порошина Татьяна Евгеньевна, врач клинико-лабораторной диагностики лаборатории эндокринологии ФГБУ
«Научно-исследовательский институт онкологии им. Н.Н. Петрова» МЗ РФ
Адрес: 197758, Санкт-Петербург, пос. Песочный, ул. Ленинградская, д. 68; тел.: (812) 596-85-49;
е-mail: levmb@endocrin.spb.ru
Бояркина Марина Петровна, врач-эндокринолог лаборатории эндокринологии ФГБУ «Научно-исследовательский
институт онкологии им. Н.Н. Петрова» МЗ РФ
Адрес: 197758, Санкт-Петербург, пос. Песочный, ул. Ленинградская, д. 68; тел.: (812) 596-85-49;
е-mail: bomari@list.ru
Цырлина Евгения Владимировна, кандидат медицинских наук, ведущий научный сотрудник лаборатории онкоэндокринологии ФГБУ «Научно-исследовательский институт онкологии им. Н.Н. Петрова» МЗ РФ
Адрес: 197758, Санкт-Петербург, пос. Песочный, ул. Ленинградская, д. 68; тел.: (812) 596-85-49;
е-mail: evg.tsyrlina@gmail.com
34
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ЭНДОКРИНОЛОГИИ
С.А. Мартынов1, М.В. Шестакова1, И.М. Кутырина2, А.В. Ильин1, М.И. Арбузова1, И.И. Дедов1
2
1 Эндокринологический научный центр, Москва, Российская Федерация
Первый Московский государственный медицинский университет им. И.М. Сеченова, Москва, Российская
Федерация
Роль циркулирующих ангиогенных факторов
в поражении почек при сахарном диабете
В статье приведены собственные данные авторов, касающиеся гомеостаза ангиогенных факторов роста (сосудистый эндотелиальный фактор роста — СЭФР, ангиопоэтин 1 и 2 — Анг-1 и Анг-2) при диабетическом поражении почек. Целью исследования была оценка изменения
сывороточной концентрации циркулирующих СЭФР, Анг-1 и Анг-2 и их связи с маркерами почечного повреждения (альбуминурия, скорость
клубочковой фильтрации) и анемией у больных сахарным диабетом с хронической болезнью почек. В исследование было включено 78 больных
сахарным диабетом 1-го и 2-го типа (из них хроническая болезнь почек была диагностирована у 37 человек). Содержание СЭФР в сыворотке
было повышено у больных сахарным диабетом 1-го типа с поражением почек и связано со степенью выраженности протеинурии. Уровень
циркулирующего Анг-2 был выше при наличии хронического заболевания почек (сахарный диабет 1-го и 2-го типа), почечной недостаточности (сахарный диабет 1-го типа), протеинурии и анемии (сахарный диабет 2-го типа). Анг-2 тесно коррелировал с альбуминурией (сахарный диабет 1-го и 2-го типа), скоростью клубочковой фильтрации (сахарный диабет 1-го типа) и гемоглобином крови (сахарный диабет
2-го типа). Полученные данные свидетельствуют, что диабетическое поражение почек характеризуется повышением концентрации циркулирующих ангиогенных факторов в сыворотке СЭФР и Анг-2 (но не Анг-1), наличием их связи с маркерами повреждения почек и анемией, что
говорит о нарушении их гомеостаза и активности при наличии хронических болезней почек у больных сахарным диабетом.
Ключевые слова: ангиопоэтины, диабетическое поражение почек, сахарный диабет, сосудистый эндотелиальный фактор роста.
Введение
Поражение почек при сахарном диабете (СД) характеризуется развитием гипертрофии клубочков, утолщением
базальной мембраны клубочков в мезангии и интерстиции, дистрофией канальцевого аппарата с формированием тубулинтерстициального фиброза. Эти изменения,
сопровождающиеся внутриклубочковой гипертензией,
клинически проявляются повышенной экскрецией альбумина с мочой и прогрессирующей потерей фильтрационной функции почек [1, 2].
Одним из ведущих механизмов в патогенезе диабетического поражения почек является воздействие
различных факторов роста, в числе которых находится
трансформирующий фактор роста , инсулиноподобный
фактор роста 1, тромбоцитарный фактор роста и др. [3].
Особое место среди них занимают сосудистые (ангиогенные) факторы. В настоящее время наиболее изученным
при диабетической нефропатии (ДН) считается сосудистый эндотелиальный фактор роста (СЭФР), который
служит основным стимулятором вазодилатации, проницаемости стенки сосудов, пролиферации и миграции
эндотелиальных клеток [4–7]. Роль других ангиогенных
факторов, таких как ангиопоэтины 1 и 2 (Анг-1, Анг-2),
при диабетическом поражении почек остается малоизученной [8–10].
Цель исследования: изучить гомеостаз циркулирующих факторов ангиогенеза (СЭФР, Анг-1, Анг-2) у больных СД с поражением почек и оценить их связь с маркерами почечного повреждения (альбуминурия, скорость
S.A. Martynov1, M.V. Shestakova1, I.M. Kutyrina2, A.V. Ilyin1, M.I. Arbuzova1, I.I. Dedov1
1 Scientific
2 I.M.
Centre of Endocrinology, Moscow, Russian Federation
Sechenov First Moscow State Medical University, Moscow, Russian Federation
Role of circulating angiogenic factors in diabetic kidney disease
This original article contains the authors own data on homeostasis of angiogenic growth factors (vascular endothelial growth factor — VEGF,
angiopoietin 1 and 2 — Ang-1, Ang-2) in diabetic kidney disease. The aims of study were evaluation of alteration on serum concentration
of circulating VEGF, Ang-1 and Ang-2, and of their association with markers of renal damage (albuminuria, glomerular filtration rate) and anemia
in patients with diabetes mellitus. We studied 78 patients type 1 diabetes mellitus (T1DM) and type 2 diabetes mellitus (T2DM). Among this group
37 patients had chronic kidney disease. The serum level of VEGF was elevated in T1DM patients and was associated with degree of proteinuria.
The serum concentration of Ang-2 was higher in patients with chronic kidney disease (T1DM and T2DM), renal failure (T1DM), proteinuria and
anemia (T2DM). Ang-2 strongly associated with albuminuria (T1DM and T2DM), glomerular filtration rate (T1DM) and hemoglobin (T2DM).
Obtained results demonstrate that levels of VEGF and Ang-2 (but not Ang-1) are raised in patients with diabetic kidney disease and associated with
markers of renal damage and anemia. These data indicate the presence of the disturbance of angiogenic growth factors (VEGF, Ang-2) homeostasis
and activity in diabetic patients with chronic kidney disease.
Key words: angiopoietins, diabetes mellitus, diabetic kidney disease, vascular growth factor.
35
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
клубочковой фильтрации — СКФ) и показателем оксигенации тканей — гемоглобином крови (Hb).
Пациенты и методы
Участники исследования
В исследование были включены 78 человек: 39 больных СД 1-го типа и 39 больных СД 2-го типа. Критериями наличия хронической болезни почек (ХБП)
были: стойкая микроальбуминурия (МАУ)/протеинурия
(ПУ) или при их отсутствии — снижение СКФ ниже
60 мл/мин/1,73 м2 в течение последних 3 мес, согласно
формуле MDRD [11]. ХБП классифицировалась по критериям National Kidney Foundation/ Kidney Disease Quality
of Life (NKF/DOQI) [12]. Больные СД 1-го и СД 2-го типа
были разделены на группы по наличию ХБП, почечной
недостаточности (СКФ <60 мл/мин/1,73 м2; 3–4-я стадии
ХБП), степени выраженности альбуминурии (нормоальбуминурия — НАУ, а также МАУ и ПУ). Число больных
в соответствующих группах указано в табл. 1–3.
Методы исследования
36
Анемию у больных без поражения почек диагностировали по критериям Всемирной организации здравоохранения: при Hb <130 г/л у мужчин и Hb <120 г/л
у женщин; при наличии почечной патологии (по критериям, предложенными NKF/DOQI) — Hb <135 г/л
у мужчин и Hb <120 г/л женщин [13, 14]. Клинико-лабораторная характеристика больных представлена в табл. 1.
Определение Анг-1 и Анг-2 и 165-й изоформы СЭФР
(СЭФР165) в сыворотке крови, взятой в утреннее время натощак, выполняли методом иммуноферментного
анализа (ELISA) при помощи коммерческих наборов по
описанной производителем инструкции («R&D Systems»,
Abingdon, OX, Великобритания, и «Biosource», Carlsbad,
CA, США, соответственно). Для более четкого отражения взаимодействия изученных ангиопоэтинов, чем
их индивидуальные значения в сыворотке, был рассчитан коэффициент Анг-2/Анг-1. Пациенты с СКФ менее
15 мл/мин/1,73 м2 (5-я стадия ХБП) и лица, получавшие
средства, стимулирующие эритропоэз, были исключены
из исследования.
Статистическая обработка данных
Для статистической обработки данных рассчитывали
среднее арифметическое значение (M) и стандартное
отклонение (SD), достоверность различий оценивали
с помощью теста Манна–Уитни. Оценку связей между
исследуемыми показателями проводили с помощью непараметрического корреляционного анализа по Спирмену.
Различия считали статистически значимыми при p <0,05;
0,05 p <0,1 рассматривали как тенденцию к различию.
Результаты
Сахарный диабет 1-го типа
У больных с ДН концентрация СЭФР165 в сыворотке
крови была практически в 2 раза выше, чем в группе без
поражения почек (см. табл. 2). Уровень СЭФР165 в сыворотке у больных с НАУ и МАУ достоверно не различался
и был значимо больше при наличии ПУ по сравнению
с НАУ (см. табл. 3). По всей группе больных СД 1-го типа
имела место прямая ассоциация СЭФР165 сыворотки и соотношения альбумин/креатинин мочи (r =0,35; p <0,05),
как и у больных с ДН, но с сохраненной азотовыделительной функцией (СКФ 60 мл/мин/1,73 м2) (r =0,70; p <0,05).
Значение СЭФР165 у пациентов с сохраненной фильтрационной функцией почек (СКФ 60 мл/мин/1,73 м2)
и почечной недостаточностью достоверно не различалось (698,8±456,6 и 588,0±536,2 пг/мл, соответственно;
p =0,3). Корреляции между СЭФР165 и СКФ установленоне было.
Концентрация Анг-1 в сыворотке не менялась в зависимости от наличия ДН, степени альбуминурии
(см. табл. 2 и 3), отсутствия или развития почечной недостаточности (929,7±234,2 и 819,0±247,5 пг/мл, соответственно; р =0,3). Также не было обнаружено связи между содержанием Анг-1 сыворотки, степенью альбуминурии и СКФ.
В группе больных с ДН наблюдали двукратный подъем концентрации Анг-2 и коэффициента Анг-2/Анг-1
в сыворотке по сравнению с больными без почечной
патологии (см. табл. 2). Повышение Анг-2 и Анг-2/
Анг-1 в сыворотке по мере усиления потери белка с мочой не было статистически значимым (см. табл. 3). При
наступлении почечной недостаточности концентрация
Таблица 1. Клинико-лабораторные показатели обследованных больных
Показатели
Возраст, лет
Длительность СД, лет
ИМТ, кг/м2
HbA1c, %
СКФ, мл/мин/1,73 м2
Гемоглобин, г/л
Анемия, n
Соотношение альбумин/креатинин мочи, мг/ммоль
НАУ/МАУ/ПУ (n)
Больные с ХБП и с СКФ60 мл/мин/1,73 м2/больные
с ХБП и СКФ<60 мл/мин/1,73 м2 (n/n)
Все больные
(n =78)
47,6±16,5
16,6±9,0
27,0±6,0
9,0±1,9
68,9±28,7
132,5±19,5
25
73,8±174,1
41/15/22
14/28
Больные СД 1-го типа
(n =39)
35,4±11,2
20,1±9,4
22,9±3,8
9,0±1,8
71,3±30,4
132,5±18,3
14
47,1±108,2
21/7/11
9/11
Больные СД 2-го типа
(n =39)
59,9±10,9****
13,1±7,1****
31,1±4,8****
9,0±1,9
66,4±27,1
132,5±20,9
11
100,5±219,6
20/8/11
5/17
Примечание. Данные представлены в виде средних значений (M) и стандартного отклонения (SD). Достоверность различий показателей по критерию Манна–Уитни между больными с СД 1-го и СД 2-го типа: **** p <0,001.
СД — сахарный диабет, ИМТ — индекс массы тела, МАУ — микроальбуминурия, НАУ — нормоальбуминурия, ПУ — протеинурия,
СКФ — скорость клубочковой фильтрации, ХБП — хроническая болезнь почек, Hb — гемоглобин, HbA1c — гликированный гемоглобин, n — число больных.
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ЭНДОКРИНОЛОГИИ
Таблица 2. Концентрация циркулирующих ангиогенных факторов (СЭФР165, Анг-1 и Анг-2) у больных сахарным диабетом 1-го и 2-го
типа с поражением почек и без почечной патологии
Показатели
СЭФР165, пг/мл
Анг-1, пг/мл
Анг-2, пг/мл
Анг-2/Анг-1
Больные СД 1-го типа (n =39)
ХБП (n =20)
Нет ХБП (n =19)
637,9±492,2**
376,5±165,4
868,8±241,9
934,3±251,2
813,5±618,9**
481,1±189,2
1,0±0,8**
0,5±0,2
Больные СД 2-го типа (n =39)
ХБП (n =22)
Нет ХБП (n =17)
563,5±406,6
495,8±333,4
657,3±253,3
758,1±347,6
707,9±365,3**
487,8±260,2
1,3±1,2*
0,8±0,6
Примечание. Данные представлены в виде средних значений (M) и стандартного отклонения (SD). Достоверность различий показателей по критерию Манна–Уитни между больными с ХБП и без ХБП: ** p <0,05; * 0,05 p <0,1.
СД — сахарный диабет, Анг-1 — ангиопоэтин-1, Анг-2 — ангиопоэтин-2, СЭФР165 — сосудистый эндотелиальный фактор роста,
ХБП — хроническая болезнь почек, n — число больных.
Таблица 3. Концентрация циркулирующих ангиогенных факторов (СЭФР165, Анг-1 и Анг-2) у больных сахарным диабетом 1-го и 2-го
типа в зависимости от степени альбуминурии
Показатели
СЭФР165, пг/мл
Анг-1, пг/мл
Анг-2, пг/мл
Анг-2/Анг-1
Больные СД 1-го типа (n =39)
НАУ (n =21)
МАУ (n =7)
ПУ (n =11)
390,6±180,2**
481,6±406,1
758,0±560,4
911,2±252,8
823,2±237,9
930,1±248,6
501,1±191,9
654,3±377,4
937,1±776,8
0,6±0,2
0,8±0,5
1,1±1,0
Больные СД 2-го типа (n =39)
НАУ (n =20)
МАУ (n =8)
ПУ (n =11)
523,9±334,7
376,0±230,3
667,3±489,4
752,8±331,9
616,6±300,2
668,9±230,6
480,7±264,2***
542,3±203,9**
901,2±400,5
0,8±0,5***
1,2±1,1
1,6±1,5
Примечание. Данные представлены в виде средних значений (M) и стандартного отклонения (SD). Достоверность различий показателей по критерию Манна–Уитни по отношению к столбцу «ПУ»: *** p <0,01; ** p <0,05.
СД — сахарный диабет, Анг-1 — ангиопоэтин-1, Анг-2 — ангиопоэтин-2, МАУ — микроальбуминурия, НАУ — нормоальбуминурия,
ПУ — протеинурия, СЭФР165 — сосудистый эндотелиальный фактор роста, n — число больных.
Анг-2 в сыворотке увеличивалась в 2 раза по сравнению
со случаями сохраненной фильтрационной функции почек (1017,1±727,9 и 564,6± 347,4 пг/мл, соответственно;
p <0,05), как и значение Анг-2/Анг-1 (1,3±0,9 и 0,7±0,5,
соответственно; p <0,05). У всех больных из группы СД
1-го типа была обнаружена прямая связь между уровнем Анг-2 и степенью альбуминурии (r =0,36; p <0,05)
и обратная — между уровнем Анг-2 и СКФ (r = -0,38;
p <0,05), равно как и между коэффициентом Анг-2/Анг-1
и данными показателями (соотношение альбумин/креатинин мочи — r =0,37; p <0,05; СКФ — r = -0,48; p <0,01).
В группе больных с ДН сохранялась связь Анг-2/Анг-1
с СКФ (r = -0,49; p <0,05) (рис. 1 А).
Сахарный диабет 2-го типа
У больных СД 2-го типа развитие ХБП не влияло на
уровень СЭФР165 и Анг-1 в сыворотке (см. табл. 2). Наличие почечной недостаточности или ее отсутствие также не
играло роли в изменении концентрации сывороточного
СЭФР165 (605,8±441,9 и 419,8±231,0 пг/мл, соответственно; р =0,3) и Анг-1 (703,1±240,9 и 501,3±256,0 пг/мл,
соответственно; р =0,2). Значение СЭФР165 и Анг-1 в сыворотке достоверно не различалось при нормальной и патологической экскреции альбумина с мочой (см. табл. 3).
Однако у больных с НАУ (среди них 3 пациента
с 3-й стадией ХБП) была установлена отрицательная
связь СЭФР165 и Анг-1 с альбуминурией (r = -0,66; p <0,01
и r = -0,80; p <0,001, соответственно). У больных без ХБП
также имелась обратная связь СЭФР165 и Анг-1 с соотношением альбумин/креатинин мочи (r = -0,66; p <0,01
и r = -0,77; p <0,001).
У больных СД 2-го типа с ХБП, как и у пациентов
с СД 1-го типа с ДН, уровень Анг-2 в сыворотке был существенно выше, чем при отсутствии поражения почек,
хотя различия в коэффициентах Анг-2/Анг-1 между данными группами имели лишь тенденцию к достоверности
(см. табл. 2). Значение Анг-2 в сыворотке было достоверно выше у больных с ПУ по сравнению с пациентами
с НАУ и МАУ, а коэффициент Анг-2/Анг-1 оказался
выше у пациентов с ПУ, чем у лиц с НАУ (см. табл. 3).
Анг-2 сыворотки и коэффициент Анг-2/Анг-1 тесно коррелировали с соотношением альбумин/креатинин мочи
у всей группы обследованных (r =0,42; p <0,01 и r =0,53;
p <0,001, соответственно) и у пациентов с ХБП (r =0,52;
p <0,05 — рис. 1 Б, и r =0,51; p <0,05, соответственно).
Снижение фильтрационной функции почек не влияло
на концентрацию Анг-2 в сыворотке в группе больных
СД 2-го типа. Так, у больных СД 2-го типа с почечной
недостаточностью и с сохраненной функцией почек содержание Анг-2 и соотношение Анг-2/Анг-1 не различались (734,6±404,8 и 617,2±178,2 пг/мл, соответственно;
р =0,7 и 1,3±1,4 и 1,4±0,7, соответственно; р=0,2) и не
было обнаружено их связи с СКФ у всей группы больных
и у пациентов с поражением почек.
Анемия
В группе пациентов с СД 1-го типа без анемии установили значимо более высокую концентрацию Анг-1
сыворотки (955,5,9±243,5 пг/мл) по сравнению с больными, имеющими анемию (802,9±225,1 пг/мл) (p <0,05).
Показатель СЭФР165 оставался неизменным в зависимости от наличия анемии, как и значение Анг-2, хотя коэффициент Анг-2/Анг-1 у больных с анемией был достоверно выше (1,1±0,8 и 0,6±0,3, соответственно; p <0,05).
У больных СД 2-го типа с анемией отмечали двукратное повышение Анг-2 в сыворотке (922,7±308,4 пг/мл) по
сравнению с пациентами без анемии (489,5±266,6 пг/мл)
(p <0,001), как и Анг-2/Анг-1 (1,8±1,6 и 0,9±0,6, соответственно; p <0,05). Значения Анг-1 и СЭФР165 в сыворотке
не зависели от снижения концентрации Hb крови, хотя
у больных без ХБП имелась прямая связь между показателем Hb и содержанием Анг-1 в сыворотке (r =0,60;
37
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
3,5
Ангиопоэтин+2/Анггиопоэтин+1
А
ных СД 1-го типа с ДН (r = -0,49; p <0,05). Аналогичную
связь обнаружили у всех больных СД 2-го типа (r = -0,61;
p <0,001). Имела место прямая связь СЭФР165 с Анг-1
у всех больных из группы СД 2-го типа (r =0,56; p <0,001)
и у пациентов с СД 2-го типа с ХБП (r =0,58; p <0,01),
однако не было выявлено корреляции между концентрацией СЭФР165 и Анг-2.
r= + 0,49
p<0,05
3,0
2,5
20
2,0
1,5
1,0
Обсуждение
0,5
0,0
0
1800
20
40
60
80
100
120
140
Скорость клубочковой фильтрации, мл/мин/1,73 м
160
2
1600
Б
Ангиопоэтин+2, пг/м
мл
1400
1200
1000
800
600
400
r=0,52
p<0,05
200
38
0
+200
0
200
400
600
800
1000
1200
1400
Альбумин/креатинин мочи, мг/ммоль
1800
В
1600
600
r= + 0,67
p<0,001
Анг и
иопоэтин+2, пг/мл
1400
1200
1000
800
600
400
200
0
70
80
90
100
110
120
130
140
150
160
170
Гемоглобин, г/л
Рис. 1. А. Корреляция между Анг-2/Анг-1 и СКФ у больных СД
1-го типа с диабетической нефропатией (n =20). Б. Корреляция
между Анг-2 и соотношением альбумин/креатинин мочи
у больных СД 2-го типа с хронической болезнью почек (n =22).
В. Корреляция между Анг-2 и гемоглобином крови у больных СД
2-го типа с хронической болезнью почек (n =22).
Примечание. Анг-1 — ангиопоэтин-1, Анг-2 — ангиопоэтин-2,
СД — сахарный диабет, n — число больных.
p <0,05) и обратная — между Hb и коэффициентом Анг-2/
Анг-1 (r = -0,68; p <0,01). Обнаружена также тесная отрицательная корреляция концентрации Анг-2 и коэффициента Анг-2/Анг-1 в сыворотке со значением Hb
по всей группе больных СД 2-го типа (r = -0,62;
p <0,001 и r = -0,63; p <0,001, соответственно) и у больных
СД 2-го типа с поражением почек (r = -0,67; p <0,001 —
рис. 1 В, и r = -0,47; p <0,05, соответственно).
Взаимосвязь ангиогенных факторов
Обратная корреляция между коэффициентом Анг-2/
Анг-1 и значением Анг-1 в сыворотке крови имелась
у всех больных СД 1-го типа (r = -0,40; p <0,05) и у боль-
В интактных почечных клубочках СЭФР экспрессируется подоцитами, а его тирозинкиназные рецепторы
первого ряда (СЭФРR1-Flt-1 и СЭФРR2-KDR) — эндотелиальными и мезангиальными клетками клубочков
[15, 16]. Принято считать, что СЭФР играет ключевую
роль в формировании почечного клубочкового аппарата,
сохранении фильтрационного барьера почек за счет пролиферации и дифференциации прилегающего эндотелия
[17]. Следовательно, поддержание баланса продукции
СЭФР подоцитами является чрезвычайно важным, особенно для гломерулярной сосудистой системы, которая
чутко реагирует на любое изменение в экспрессии и активности СЭФР с дальнейшей морфофункциональной
перестройкой фильтрационного барьера клубочка. При
ДН патологическая альбуминурия сопровождается гиперпродукцией СЭФР в почках и развитием выраженной
системной эндотелиальной дисфункции [18, 19]. Однако
значение СЭФР в патогенезе ДН до сих пор остается не
вполне ясным, хотя его ведущая роль в формировании
и прогрессировании диабетической пролиферативной
ретинопатии не вызывает сомнений [20, 21]. Предполагают, что патогенетическая роль СЭФР в поражении почек
реализуется за счет стимуляции продукции коллагеназы
и протеолитической деструкции эндотелия базальных
мембран клубочков, что приводит к повышению проницаемости сосудистой стенки клубочков с развитием
альбуминурии [22]. Установленное нами повышение содержания циркулирующего СЭФР165, имеющего особую
активность в почечной ткани, у больных СД 1-го типа
с ДН по сравнению с больными без почечной патологии,
как и у пациентов с макроальбуминурией, при отсутствии
различий его концентрации в сыворотке больных с НАУ
и МАУ может указывать на активность патологического
процесса в гломерулярном аппарате. Полученные результаты сопоставимы с данными других исследователей,
которые изучали содержание СЭФР в плазме у больных
СД 1-го и 2-го типа в зависимости от степени выраженности альбуминурии [18, 19]. В работе D.R. Cha и соавт.
у больных СД 2-го типа с начальной стадией ДН был отмечен высокий уровень экспрессии СЭФР в клубочках.
Однако при прогрессировании поражения почек зафиксировано не только снижение его продукции склерозированными гломерулами, но и дислокация образования
СЭФР в сторону эпителиальных клеток проксимальных
канальцев. Морфологические исследования на животных моделях СД убедительно продемонстрировали, что
по мере прогрессирования диабетического поражения
почек снижается интенсивность экспрессии СЭФР поврежденными подоцитам и эпителиальными клетками
канальцев [23]. Клиническим отражением этих данных
может послужить описанная нами прямая взаимосвязь
между уровнем циркулирующего СЭФР165 и степенью выраженности альбуминурии у больных СД 1-го типа именно с сохраненной функцией почек. Одинаковый уровень
сывороточного СЭФР165 при сохраненной и сниженной
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ЭНДОКРИНОЛОГИИ
фильтрационной функции почек и отсутствие его связи
с СКФ у больных СД 1-го и 2-го типа в нашем исследовании может указывать на то, что повышение содержания
СЭФР165 в сыворотке не является показателем ухудшения азотовыделительной функции почек. Следовательно,
можно утверждать, что на ранних стадиях нефропатии
наблюдается повышение уровня экспрессии СЭФР165
почками, которая снижается или «истощается» при формировании диабетического гломерулосклероза. Обращает на себя внимание выявленная нами у больных СД
2-го типа обратная связь между концентрацией СЭФР165
и соотношением альбумин/креатинин мочи, но только
в рамках НАУ. В связи с этим особый интерес представляют экспериментальные работы, указывающие, что
именно СЭФР165 обладает репаративными свойствами
в отношении структуры гломерулярной мембраны при диабетическом и недиабетическом поражении почек [24–26].
Помимо СЭФР, другими важнейшими сосудистыми
факторами роста, активно вовлеченными в процесс ангиоваскулогенеза, роста и ремоделирования сосудов, считают ангиопоэтины Анг-1 и Анг-2, являющиеся лигандами для второго ряда эндотелиальных тирозинкиназных
рецепторов, в основном Tie-2 [27–29]. В экспериментальных исследованиях показали, что ангиопоэтины активно участвуют в созревании почечных сосудов [30–32].
Во взрослом состоянии Анг-1 продуцируется в клубочках
подоцитами, в то время как в постнатальном периоде
образование Анг-2 в клубочках резко снижается, иногда
до неопределяемого значения [30, 33].
Анг-1 путем повышения стабильности и выживаемости эндотелиальных клеток стимулирует рост капилляров
и ограничивает влияние СЭФР на проницаемость сосудов и тем самым обеспечивает поддержание целостности
фильтрационного барьера почек [28–30, 34, 35]. У мышей
со стрептозотоцин-индуцированным СД было показано,
что экспрессия мРНК Анг-1 повышалась в клубочках
на 4-й и 8-й нед заболевания с дальнейшим снижением
с 12-й нед, что указывает на истощение его продукции почками при гипергликемии [10]. Однако в работах H.S. Lim
и соавт. не было устаовлено влияния гипергликемии
на уровень Анг-1 в сыворотке крови. Так, у больных
СД 2-го типа и в контрольной группе без диабета значение Анг-1 достоверно не различалось [8, 9]. Кроме того,
не было отмечено влияния на сывороточный уровень
Анг-1 имеющихся у обследованных больных СД 2-го
типа сердечно-сосудистых заболеваний (ишемия миокарда, инфаркт миокарда, инсульт, реваскуляризация
коронарных или периферических артерий) [8]. В нашем
исследовании при СД 1-го и 2-го типа концентрация
Анг-1 в сыворотке не различалась в зависимости от наличия поражения почек, почечной недостаточности, СКФ,
степени альбуминурии. Следует подчеркнуть, что обнаруженная обратная связь Анг-1 и альбуминурии в группе
больных СД 2-го типа как с НАУ, так и без ХБП может
быть некоторым отражением эффекта Анг-1, предупреждающего развитие патологической альбуминурии. О наличии ренопротективных свойств Анг-1 свидетельствует
исследование с введением мышам с СД 2-го типа рекомбинантной формы Анг-1 — COMP (cartilage oligomeric
matrix protein)-Анг-1 [36]. При этом отмечалось снижение
степени альбуминурии, выраженности экспансии мезангия, утолщения базальных мембран клубочков и отрыва
ножек подоцитов. Кроме того, уменьшалось образование в почечной ткани фактора межклеточной адгезии-1,
моноцитарного хемоаттрактантного белка-1, трансформирующего фактора роста 1, -гладкомышечного
актина, фибронектина и инфильтрации моноцитами
и макрофагами.
Анг-2, являющийся эндогенным антагонистом Анг-1,
конкурентно ингибирует присоединение Анг-1 к рецептору Tie-2. Он вырабатывается в эндотелиальных клетках (в тельцах Вейбеля–Паладе) и высвобождается при
активации эндотелия, гипергликемии, под действием
фактора некроза опухолей , а особенно его продукция
повышается при гипоксии. Анг-2 вызывает не только
«пропотевание» сосудов, дестабилизацию их целостности
с последующей регрессией при дефиците или отсутствии
СЭФР, но и усиление миграции и пролиферации эндотелиальных клеток совместно с СЭФР [28–30, 37]. В настоящее время еще недостаточно данных о функциях Анг-2
в норме и при развитии патологии [30, 33].
В последнее время активно изучают влияние активации системы Анг-2/Tie-2 на прогрессирование ХБП.
Ранее повышение продукции Анг-2 при одновременном снижении синтеза Анг-1 было показано на моделях животных с гломерулярными заболеваниями
(анти-БМК-нефрит, поражение клубочков, вызванное
даунорубицином и др.) [38, 39]. Недавно были опубликованы интересные результаты клинических исследований.
Так, в исследовании P. Kumpers и соавт. продемонстрировано, что у больных АНЦА (антинейтрофильные цитоплазматические антитела)-ассоциированным васкулитом
с поражением почек, характеризующимся тяжелейшим
повреждением эндотелия мелких сосудов с их последующей деструкцией и некрозом, наблюдается 6-кратное повышение Анг-2 в сыворотке крови по сравнению
с контрольной группой здоровых добровольцев (6,1±3,5
и 1,0±0,7 нг/мл, соответственно). Поскольку значение
Анг-2 у больных с ремиссией заболевания (1,7±0,7 нг/мл)
и с «изолированным» гранулематозным поражением органов дыхания (1,7±1,1 нг/мл) достоверно не отличалось
от такового контрольной группы, высказывают предположение, что источником Анг-2 может быть пораженный почечный эндотелий [40]. В нашем исследовании
значение Анг-2 было достоверно выше при наличии
поражения почек у больных СД 1-го и 2-го типа. Зафиксированное повышение концентрации Анг-2 при ПУ
у больных СД 2-го типа и ее прямая связь с выраженностью
макроальбуминурии сопоставимы с результатами работы
H.S. Lim и соавт., изучавших содержание циркулирующих ангиопоэтинов у больных СД 2-го типа [8]. S. Davis
и соавт. были исследованы эффекты Анг-2 на почечную
ткань у трансгенных мышей с повышенным уровнем экспрессии Анг-2 в подоцитах [41]. Они наблюдали апоптоз
эндотелиальных клеток гломерул без признаков коллапса
капилляров клубочка и «оголения» базальной мембраны,
что клинически выражалось в усилении альбуминурии.
Авторы подчеркивают, что эти патологические изменения
могут быть следствием дестабилизации целостности эндотелиальных клеток клубочков, уменьшения количества
нефрина с образованием дефекта щелевой диафрагмы без
структурных изменений самих подоцитов.
В другом исследовании, включавшем больных ХБП
недиабетического генеза, уровень Анг-2 значимо увеличивался по мере снижения фильтрационной функции почек (с 1,0±0,6 нг/мл на 1-й стадии ХБП до 1,9±0,8 нг/мл
на 4-й стадии и достигал 6,1±4,2 нг/мл на 5-й стадии).
При этом достоверное повышение концентрации Анг2 впервые фиксировали только с 3-й стадии ХБП, т.е.
при снижении СКФ менее 60 мл/мин/1,73 м2, а тесная отрицательная корреляция Анг-2 с СКФ имелась
в группе больных с СКФ не менее 15 мл/мин/1,73 м2,
39
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
40
что соответствует 1–4-й стадии ХБП) [42]. Полученные нами результаты (двукратное повышение Анг-2
и коэффициента Анг-2/Анг-1 при снижении СКФ менее
60 мл/мин/1,73 м2 и обратная связь с СКФ) подтверждают
вышеупомянутые данные, но только в популяции больных СД 1-го типа.
Изучение гомеостаза ангиопоэтинов у больных после
пересадки почки показало двукратное снижение повышенной концентрации Анг-2 в сыворотке и появление
прежде отсутствовавшей у больных, находящихся на лечении диализом, отрицательной связи Анг-2 с СКФ
[43]. В связи с тем, что Анг-2 не определяется в моче, т.е.
он не подвергается клубочковой фильтрации и/или канальцевой секреции, авторы утверждают, что богатым источником гиперпродукции Анг-2, как и в случае с больными
с АНЦА-ассоциированным васкулитом, является сам пораженный почечный эндотелий. Следовательно, можно
утверждать, что циркулирующий уровень Анг-2 может
являться маркером степени выраженности поражения почечного эндотелия. Наличие связи Анг-2 и коэффициента
Анг2/Анг-1 с СКФ и невозможность почечной ретенции
Анг-2 по мере снижения фильтрационной функции могут
свидетельствовать о том, что Анг-2 допустимо рассматривать в качестве еще одного ключевого медиатора формирования нефросклероза при прогрессирующих гломерулярных заболеваниях почек.
В связи с тем, что гипоксия считается ведущим триггером экспрессии Анг-2 [44], обращает на себя внимание
выявленное нами при анемии повышение коэффициента
Анг-2/Анг-1 с одновременным снижением концентрации Анг-1 в сыворотке крови у больных СД 1-го типа,
и значимое увеличение содержания циркулирующих
Анг-2 и Анг-2/Анг-1 с наличием их прямой связи с Hb
у пациентов с СД 2-го типа. Эти данные могут косвенно
свидетельствовать об усилении экзоцитоза эндотелиальных телец Вейбеля–Паладе в условиях гипоксии/анемии
с высвобождением Анг-2.
Показателем антагонистических отношений Анг-1
и Анг-2 стало наличие у обследованных отрицательной
связи коэффициента Анг-2/Анг-1 и Анг-1 в группах
больных СД 1-го и 2-го типа и отдельно у больных
СД 1-го типа с ДН. Сложные взаимоотношения СЭФР
и ангиопоэтинов в сыворотке могут быть отражением их
физиологического взаимодействия в различных патологических состояниях. В исследовании H. Singh и соавт.
было показано, что СЭФР активизирует рецепторы Tie-2
посредством механизма протеолитического распада другого тирозинкиназного рецептора — Tie-1, ведущего
к трансфосфорилированию Tie-2, и тем самым к интегративному регулированию сигналов между двумя рецепторами [45]. В нашем исследовании у больных СД
2-го типа имелась прямая связь СЭФР165 и Анг-1. Предполагается, что гиперпродукция СЭФР может вызывать
ответное образование Анг-1 для ослабления его эффекта.
Так, в эксперименте на перицитах сетчатки крупного рогатого скота была зарегистрирована стимуляция
образования мРНК Анг-1 под действием СЭФР [46].
Хотя в нашей работе не было обнаружено ассоциации
между СЭФР и Анг-2, ранее в работе H.S. Lim и соавт.
была показана связь СЭФР и Анг-2 и их корреляция
с индексами эндотелиальной дисфункции у больных
СД 2-го типа [8]. Наличие данной связи, возможно,
предполагает существование совместного, более агрессивного и неблагоприятного воздействия СЭФР и Анг-2
на эндотелий сосудов.
После получения неоднозначных результатов по применению ингибиторов СЭФР и анти-СЭФР-антител
в экспериментальных работах (повреждение эндотелиальных клеток и подоцитов, отложение комплекса СЭФР–
анти-СЭФР-антитело, С3-компонента комплемента
и др.) активно изучается эффективность других антиангиогенных препаратов при ДН (ангиостатина, эндостатина
и тумстатина) [23]. При их использовании в почечной
ткани наблюдали уменьшение степени выраженности
гипертрофии клубочков, экспансии мезангия, инфильтрации макрофагами, экспрессии СЭФР и трансформирующего фактора роста , восстановление экспрессии
нефрина, а также снижение гиперфильтрации, альбуминурии. Таким образом, продемонстрированная в различных исследованиях на животных моделях СД активация
системы Анг-1–Анг-2/Tie-2 в почечной ткани и возможности воздействия на нее предполагают проведение
дальнейших исследований [10, 30, 36, 47–50]. Недавно
закончилась I фаза клинического испытания по оценке
безопасности, фармакокинетики и противоопухолевой
активности рекомбинантного Fc-пептидного антитела,
действие которого направлено на связывание с Анг-1
и Анг-2 и препятствование их соединению с рецепторами
Tie-2 у больных солидным раком, которое показало обнадеживающие результаты относительно эффективности
изучаемого препарата [51].
Заключение
Таким образом, на основании полученных результатов
можно сделать следующие выводы.
• Повышение концентрации СЭФР165 в сыворотке при
ДН у больных СД 1-го типа сопряжено с нарушением проницаемости фильтрационного барьера почек
(альбуминурией). Значение СЭФР165 сыворотки
не является маркером состояния азотовыделительной
функции почек.
• У больных СД 1-го и 2-го типа с поражением почек
уровень Анг-1 в сыворотке не зависит от значения
альбуминурии, снижения фильтрационной функции почек, наличия анемии. Однако у больных
СД 2-го типа повышение уровня Анг-1 в сыворотке при нормоальбуминурии или отсутствии поражения почек может быть связано с низким значением
альбуминурии.
• Наличие диабетического поражения почек (у больных СД 1-го и 2-го типа), хронической почечной
недостаточности (при СД 1-го типа), макроальбуминурии (при СД 2-го типа) и анемии (при СД 2-го
типа) сопровождается значительным повышением
содержания циркулирующего в сыворотке Анг-2.
Повышение Анг-2 тесно коррелирует с усилением альбуминурии (СД 1-го и 2-го типа), снижением СКФ (СД 1-го типа) и Hb (СД 2-го типа), что
может свидетельствовать о его роли маркера выраженности дисфункции эндотелия, повреждения почек
и прогрессировании ХБП.
• Реципрокные взаимоотношения между содержанием
в сыворотке Анг-2/Анг-1 и Анг-1 являются отражением их физиологического антагонизма в организме.
• В механизме прогрессирования диабетического поражения почек играет роль дисрегуляция образования
и активности ангиогенных факторов роста (СЭФР165
и Анг-2, Анг-1). Повышение уровня экспрессии Анг-2
при почечной патологии у больных СД предполагает
проведение дальнейших исследований взаимосвязи
патофизиологии почек и гомеостаза Анг-2 для определения будущих терапевтических подходов.
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ЭНДОКРИНОЛОГИИ
ЛИТЕРАТУРА
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
Дедов И.И., Шестакова М.В. Диабетическая нефропатия.
М.: Универсум Паблишинг. 2000. 239 с.
Шестакова М.В., Дедов И.И. Сахарный диабет и хроническая
болезнь почек. М.: МИА. 2009. 482 с.
Flyvbjerg A., Gronbaek, Bak M., Nielsen B., Christiansen T., Hill C., Logan A., Orskov H. Diabetic kidney disease:
the role of growth factors. Nephrol. Dial. Transplant. 1998;
13: 1104–1107.
Aiello L.P., Wong J.-S. Role of vascular endothelial growth factor
in diabetic vascular complications. Kidney Int. 2000; 58 (Suppl. 77):
1427–1430.
Khamaisi M., Scrijvers B.F., Vriese A.S.D., Raz I., Flyvbjerg A. The
emerging role of VEGF in diabetic kidney disease. Nephrol. Dial.
Transplant. 2003; 18: 1104–1107.
Ferrara N. Role of vascular endothelial growth factor in regulation
of physiological angiogenesis. Am. J. Physiol. Cell. Physiol. 2001;
280: 1358–1366.
Ferrara N., Gerber H.-P., LeCouter J. The biology of VEGF and its
receptors. Nat. Med. 2003; 9 (6): 669–676.
Lim H.S., Blann A.D., Chong A.Y., Freestone B., Lip G.H. Plasma
vascular endothelial growth factor, angiopietin-1, and angiopoietin-2 in diabetes. Diabetes Care. 2004; 27 (12): 2918–2924.
Lim H.S., Lip G.Y.H., Blann A.D. Angiopoietin-1 and angiopoietin-2 in diabetes mellitus: relationship to VEGF, glycaemic control,
endothelial damage/dysfunction and atherosclerosis. Atherosclerosis. 2005; 180 (1): 113–118.
Yang Y.B., Chen Z.J., Liu F., Huang S.M. The expression and
significance of the angiopoietin-1 in the kidney of diabetic rats.
Sichuan Da Xue Xue Bao Yi Xue Ban. 2007; 38 (1): 93–96.
Levey A.S., Bosch J.P., Lewis J.B., Greene T., Rogers N.,
Roth D. A more accurate method to estimate glomerular filtration rate from serum creatinine: A new prediction equation. Ann.
Intern. Med. 1999; 130: 461–470.
National Kidney Foundation: K/DOQI Clinical Practice Guidelines for Chronic Kidney Disease: Evaluation, Classification and
Stratification. Am. J. Kidney Dis. 2002; 39 (Suppl. 1): 1–266.
World health organization. Nutritional Anemia: Report of WHO
Scientific Group 1968. World Health Organization. Geneva.
National Kidney Foundation: K/DOQI clinical practice guidelines
for the treatment of anemia of chronic kidney disease. Update 2000.
Am. J. Kidney Dis. 2001; 37 (Suppl. 1): 182–238.
Simon M., Grone N.J., Johren H.J., Kullmer J., Plate K.H.,
Risau W., Fuchs E. Expression of vascular endothelial growth factor
and its receptors in human renal ontogenesis and in adult kidney.
Am. J. Physiol. 1995; 268: 240–250.
Thomas S., Vanuystel J., Gruden G., Rodriguez V., Burt D.,
Gnudi L., Hartley B., Viberti G. Vascular endothelial growth factor receptors in human mesangium in vitro and glomerular disease.
J. Am. Soc. Nephrol. 2000; 11: 1236–1243.
Eremina V., Cui S., Gerber H., Ferrara N., Haigh J., Nagy A.,
Ema M., Rossant J., Jothy S., Miner J.H., Quaggin S.E. Vascular
endothelial growth factor for a signaling in the podocyte-endothelial
compartment is required for a mesangial cell migration and survival.
J. Am. Soc. Nephrol. 2006; 17: 724–735.
Cha D.R., Kim N.H., Yoon J.W., Jo S.K., Cho W.Y., Kim H.K.,
Won N.H. Role of vascular endothelial growth factor in diabetic
nephropathy. Kidney Int. 2000; 58 (Suppl. 77): 104–112.
Hovid P., Tarnow L., Oestergaard P.B., Parving H.-H. Elevated
vascular endothelial growth factor in type 1 diabetic patients
with diabetic nephropathy. Kidney Int. 2000; 57 (Suppl. 75):
56–61.
Cai J., Boulton M. The pathogenesis of diabetic retinopathy:
old concepts and new questions. Eye. 2002; 16: 242–260.
Mohamed Q., Gillies M.C., Wong T.Y. Management of diabetic
retinopathy. Syst. Review. JAMA. 2007; 298: 902–916.
22. Unemori E.N., Ferrara N., Bauer F.A., Amento E.P. Vascular endothelial growth factor induces interstitial collagenases expression
in human endothelial cells. J. Cell. Physiol. 1992; 153: 557–562.
23. Nakagawa T., Kosugi T., Haneda M., Rivard C.J., Long D.A.
Abnormal angiogenesis in diabetic nephropathy. Diabetes. 2009;
58: 1471–1478.
24. Bortoloso E., Del Prete D., Vestra M.D., Gambaro G., saller A.,
Antonucci F., Baggio B., Anglani F., Fioretto P. Quantitave
and qualitative changes in vascular endothelial growth factor
gene expression in glomeruli of patients with type 2 diabetes.
Eur. J. Endocrin. 2004; 150: 799–807.
25. Ostendorf T., Kunter U., Eitner F. et al. VEGF165 mediates glomerular endothelial repair. J. Clin. Invest. 1999; 104 (7): 913–923.
26. Masuda Y., Shimizu A., Mori T., Ishiwata T., Kitamura H., Ohashi R.,
Ishizaki M., Asano G., Sugisaki Y., Yamanaka N. Vascular endothial growth factor enhances glomerular capillary repair and accelerates resolution of experimentally induced glomerulonephritis.
Am. J. Pathol. 2001; 159: 599–608.
27. Thomas M., Augustin H.G. The role of angiopoietins in vascular
morphogenesis. Angiogenesis. 2009; 12: 125–137.
28. Thurston G. Role angiopoietins and Tie receptor tyrosine kinases in
angiogenesis and lymphagenesis. Cell Tissue Res. 2003; 314: 61–68.
29. Feldeman D.C., Blann A.D., Lip G.Y.H. Angiogenesis: basic
pathophisiology and implication for disease. Eur. Heart J. 2003;
24: 586–603.
30. Woolf A., Gnudi L., Long D.A. Roles of angiopoietins in kidney
development and disease. J. Am. Soc. Nephrol. 2009; 20: 239–244.
31. Suri C., Jones P.F., Patan S., Bartunkova S., Maisonpierre P.C.,
Davis S., Sato T.N., Yancopoulos G.D. Requisite role of angiopoietin-1, a ligand for the TIE-2 receptor, during embryonic angiogenesis. Cell. 1996; 87: 1171–1180.
32. Pitera J.E., Woolf A.S., Gale N.W., Yancopoulos G.D.,
Yuan H.T. Dysmorphogenesis of kidney cortical peritubular capillaries in angiopoietin-2 deficient mice. Am. J. Pathol. 2004;
165: 1895–1906.
33. Satchell S.C., Harper S.J., Tooke J.E., Kerjaschki D., Saleem M.A.,
Mathieson P.W. Human podocytes express angiopoietin-1, a potential regulator of glomerular vascular endothelial growth factor.
J. Am. Soc. Nephrol. 2002; 13: 544–550.
34. Kim I., Kim H.G., So J-N., Kim J.H., Kwak H.J., Koh G.Y. Angiopoietin-1 regulates endothelial cell survival through the phosphatidylinositol 3’-kinase/Akt signal transduction pathway. Circ. Res.
2000; 86: 24–29.
35. Thurston G., Rudge J.S., Ioffe E.,, Zhou H., Ross L., Croll S.D.,
Glazer N., Holash J., McDonald D.M., Yancopoulos G.D. Angiopoietin-1 protects the adult vasculature against plasma leakage.
Nat. Med. 2000; 6: 460–463.
36. Lee S., Kim W., Moon S.-O., Sung M.J., Kim D.K., Kang K.P.,
Jang K.Y., Lee S.Y., Park B.H., Koh G.Y., Park S.K. Renoprotective
effect of COMP-angiopoietin-1 in db/db mice with type 2 diabetes.
Nephrol. Dial. Transplant. 2007; 22: 396–408.
37. Pfister F., Wang Y., Schreiter K., von Hagen F., Altvater K., Hoffmann S., Deutsch U., Hammes H-P., Feng Y. Retinal overexpression of angiopoietin-2 mimics diabetic retinopathy and enhances
vascular damage in hyperglycemia. Acta Diabetol. 2010; 47: 59–64.
38. Yuan H.T., Tipping P.G., Li X.Z., Long D.A., Woolf A.S. Angiopoietin correlates with glomerular capillary loss in anti-glomerular basement membrane glomerulonephritis. Kidney Int. 2002;
61: 2078–2089.
39. Lu Y.H., Deng A.G., Li N., Song M.N., Yang X., Liu J.S. Changes
in angiopoietin expression in glomeruli involved in glomerulosclerosis in rats with daunorubicin-induced nephrosis. Acta Pharmacol.
Sin. 2006; 27: 579–587.
40. Kumper P., Hellpap J., David S., Horn R., Leitolf H., Haller H.,
Haubitz M. Circulating angiopoietin-2 is a marker and potential
41
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
41.
42.
43.
44.
45.
46.
mediator of endothelial cell detachment in ANCA-associated vasculitis with renal involvement. Nephrol. Dial. Transplant. 2009; 24:
1845–1850.
Davis B., Cas A.D., Long D.A., White K.E., Hayward A., Ku C-H.,
Woolf A.S., Bilous R., Viberti G., Gnudi L. Podocyte-specific
expression of angiopoietin-2 causes proteinuria and apoptosis of
glomerular endothelia. J. Am. Soc. Nephrol. 2007; 18: 2320–2329.
David S., Kumper P., Lukasz A., Fliser D., Martens-Lobenhoffer J.,
Bode-Boger S.M., Kliem V., Haller H., Kielstein J.T. Circulating
angiopoietin-2 levels increase with progress of chronic kidney disease. Nephrol. Dial. Transplant. 2010; 25: 2571–2579.
David S., Kumpers P., Hellpap J., Horn R., Leitolf H., Haller H.,
Kielstein T. Angiopoietin 2 and cardiovascular disease in
dialysis and kidney transplantation. Am. J. Kidney Dis. 2009;
53: 770–778.
Fiedler U., Scharpfenecker M., Koidl S. et al. The Tie-2 ligand angiopoietin-2 is stored in and rapidly released upon stimulation from
endothelial cell Weibel-Palade bodies. Blood. 2004; 103: 4150–4156.
Singh H., Milner C.S., Aguilar Hernandez M.M., Nicholas N.P.,
Brindle P.J. Vascular endothelial growth factor activates
the Tie family of receptor tyrosine kinases. Cell Signal. 2009;
21: 1346–1350.
Parka Y.S., Kimb N.H., Joa I. Hypoxia and vascular endothelial
growth factor acutely up-regulate angiopoietin-1 and Tie2 mRNA
in bovine retinal pericytes. Microvasc. Res. 2003; 65: 125–131.
47. Rizkalla B., Forbes J.M., Cao Z., Boner G., Cooper M.E. Temporal
renal expression of angiogenic growth factors and their receptors
in experimental diabetes: role of the renin-angiotensin system.
J. Hypertens. 2005; 23: 153–164.
48. Yamamoto Y., Maeshima Y., Kitayama H. Y., Kitamura S., Takazawa Y., Sugiyama H., Yamasaki Y., Makino H. Tumstatin peptide,
an inhibitor of angiogenesis, prevents glomerular hypertrophy in the
early stage of diabetic nephropathy. Diabetes. 2004; 53: 1831–1840.
49. Ichinose K., Maeshima Y., Yamamoto Y., Kitayama H., Takazawa Y.,
Hirokoshi K., Sugiyama H., Yamasaki Y., Eguchi K., Makino H.
Anti-angiogenic endostatin peptide ameliorates renal alterations
in the early stage of type 1 diabetic nephropathy model. Diabetes.
2005; 54: 2891–2903.
50. Ichinose K., Maeshima Y., Yamamoto Y., Kinomura M., Hirokoshi K.,
Kitayama H., Takazawa Y., Sugiyama H., Yamasaki Y., Agata N.,
Makino H. 2-(8-hydroxy-6-methoxy-1-oxo-1h-2-benzopyran3-yl) propionic acid, an inhibitor of angiogenesis, ameliorates
renal alterations in obese type 2 diabetic mice. Diabetes. 2006;
55: 1232–1242.
51. Mita A.C., Takimoto C.H., Mita M., Tolcher A., Sankhala K.,
Sarantopoulos J., Valdivieso M., Wood L., Rasmussen E.,
Sun Y-N., Zhong Z.D., Bass M.B., Le N., LoRusso P. Phase 1 Study
of AMG 386, a selective angiopoietin 1/2-neutralizing peptibody,
in combination with chemotherapy in adults with advanced solid
tumors. Clin. Cancer Res. 2010; 16 (11): 3044–3056.
42
КОНТАКТНАЯ ИНФОРМАЦИЯ
Шестакова Марина Владимировна, член-корреспондент РАМН, доктор медицинских наук, профессор, директор
Института диабета ФГБУ «Эндокринологический научный центр» МЗ РФ
Адрес: 117036, Москва, ул. Дмитрия Ульянова, д. 11; тел: (499) 124-45-00; е-mail: nephro@endocrincentr.ru
Мартынов Сергей Андреевич, кандидат медицинских наук, ведущий научный сотрудник ФГБУ «Эндокринологический
научный центр» МЗ РФ
Адрес: 117036, Москва, ул. Дмитрия Ульянова, д. 11; тел.: (495) 500-01-45; е-mail: smartynov@inbox.ru
Кутырина Ирина Михайловна, доктор медицинских наук, профессор, ведущий научный сотрудник отдела нефрологии Научно-исследовательского центра ГБОУ ВПО «Первый Московский государственный медицинский университет им. И.М. Сеченова» МЗ РФ
Адрес: 119992, Москва, ул. Россолимо д. 11, стр. 4; тел.: (499) 248-41-66; е-mail: nephro@endocrincentr.ru
Ильин Александр Викторович, заведующий лабораторией клинической биохимии ФГБУ «Эндокринологический
научный центр» МЗ РФ
Адрес: 117036, Москва, ул. Дмитрия Ульянова, д. 11; тел.: (499) 126-76-00; е-mail: viktor.ilin2011@inbox.ru
Арбузова Маргарита Ивановна, кандидат медицинских наук, ведущий научный сотрудник лаборатории клинической
биохимии ФГБУ «Эндокринологический научный центр» МЗ РФ
Адрес: 117036, Москва, ул. Дмитрия Ульянова, д. 11; тел.: (499) 612-78-58; е-mail: margarita.arbuzova2010@inbox.ru
Дедов Иван Иванович, академик РАН и РАМН, доктор медицинских наук, профессор, Президент РАМН, директор
ФГБУ «Эндокринологический научный центр» МЗ РФ
Адрес: 117036, Москва, ул. Дмитрия Ульянова, д. 11; тел.: (499) 124-43-00; е-mail: nephro@endocrincentr.ru
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ЭНДОКРИНОЛОГИИ
А.А. Спасов, В.И. Петров, Н.И. Чепляева, К.В. Ленская
Волгоградский государственный медицинский университет, Российская Федерация
Фундаментальные основы поиска
лекарственных средств для терапии сахарного
диабета 2-го типа
В обзоре проанализированы литературные данные о поиске новых препаратов для лечения сахарного диабета, направленных на коррекцию
трех основных метаболических нарушений, приводящих к гипергликемии: дисфункции -клеток, периферической инсулинорезистентности,
избыточной продукции глюкозы печенью.
Ключевые слова: сахарный диабет, антидиабетические препараты.
Введение
Несмотря на достижение значительных успехов
в области диабетологии, сахарный диабет (СД) остается
одной из значимых медико-социальных проблем в мире,
что обусловлено его высокой распространенностью, тенденцией к росту числа больных, хроническим течением, высокой инвалидизацией и смертностью больных.
По данным Министерства здравоохранения Российской
Федерации, смертность от СД составляет 6,7 случаев,
а инвалидизация по причине СД наступает в 2,1 случаев
на 100 тыс. населения [1].
Принимая во внимание гетерогенность СД 2-го типа,
необходимо отметить, что развитие патологии имеет фазный характер. Многие исследователи полагают, что резистентность периферических тканей к инсулину является
первичным дефектом в патогенезе СД 2-го типа, который
вызывает компенсаторное усиление секреции инсулина
клетками островков Лангерганса [2]. В норме -клетки
быстро адаптируются к снижению чувствительности
к инсулину на уровне печени или периферических тканей,
повышая секрецию инсулина и предотвращая развитие
гипергликемии натощак [3]. В случаях недостаточности
синтеза и секреции -клетками инсулина, необходимого
для преодоления инсулинорезистентности, сначала развивается нарушение толерантности к глюкозе (преддиабет), а затем, при нарастании дефекта, манифестирует
и диабет. Чаще всего СД диагностируют при сохранении
инсулиносекреторной функции менее чем на 20%. Одними из важных факторов в прогрессировании дисфункции
-клеток являются глюкозо- и липотоксичность, которые
приводят как к количественным, так и к качественным
дефектам, что выражается в снижении или полном отсутствии первой фазы секреции инсулина, нарушении пульсирующей секреции инсулина и конверсии проинсулина
в инсулин [3, 4].
Следует отметить, что за последние 20 лет формулировка целей лечения СД претерпела значительные
изменения. Если до недавнего времени целью терапии было лишь устранение симптомов гипергликемии,
то в настоящее время адекватная рациональная фармакологическая коррекция данной патологии направлена
на протекцию -клеток поджелудочной железы от истощения, поддержание оптимального баланса глюкозы,
предотвращение развития макро- и микрососудистых
осложнений [1, 5]. Препараты для лечения СД 2-го типа
представлены следующими группами: секретогены инсулина — производные сульфонилмочевины (глибенкламид,
глипизид, гликлазид, гликвидон, глимепирид); постпрандиальные регуляторы секреции инсулина (репаглинид
и натеглинид), бигуаниды (метформин); сенситайзеры
инсулина (росиглитазон, пиоглитазон); инкретиномиметики (вилдаглиптин, ситаглиптин, саксаглиптин) [6].
Следует отметить, что монотерапия одним из антидиабетических препаратов эффективна лишь непродолжительное время, в дальнейшем возникает необходимость
A.A. Spasov, V.I. Petrov, N.I. Chepljaeva, K.V. Lenskaja
Volgograd State Medical University, Russian Federation
Fundamental bases of search of medicines for therapy of a diabetes
mellitus type 2
In the presented review the data on searching for new drugs for diabetes mellitus treatment are analyzed. These drugs are used for metabolic disorder
correction leading to hyperglycemia: -cells dysfunction, peripheral insulin resistance, increased hepatic glucose output.
Key words: diabetes mellitus, antidiabetic agents.
43
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
назначения 2 или более препаратов. Комбинированная
пероральная сахароснижающая терапия на ранних и последующих этапах заболевания позволяет достичь и сохранить адекватный уровень глюкозы и предупреждает
развитие острых и поздних осложнений заболевания.
Комбинированные схемы лечения увеличивают эффективность терапии, а также уменьшают дозу каждого
из препаратов и тем самым снижают до минимума выраженность побочных эффектов [7].
Современный уровень научных исследований этиологии и патогенеза СД позволяет находить новые мишени
для антидиабетических соединений и создавать новые
классы препаратов для пероральной сахароснижающей
терапии. Следует отметить разнонаправленность поиска
лекарственных средств и условно выделить 4 основных
направления: нормализацию биологического действия
инсулина и устранение инсулинорезистентности, восстановление физиологической секреции инсулина, снижение продукции глюкозы печенью и раннюю профилактику осложнений СД.
Нормализация механизмов биологического действия
инсулина и снижение инсулиновой резистентности
44
С учетом того, что инсулинорезистентность является
одним из ведущих, а по мнению большинства исследователей, и первичным дефектом при СД, активно ведется
поиск высокоэффективных препаратов для коррекции
данного фактора в патогенезе СД 2-го типа [8]. Снижение инсулинорезистентности периферических тканей
возможно посредством модуляции активности рецепторов, активирующих пролиферацию пероксисом (PPAR),
одного из регуляторов метаболизма углеводов, жиров
и белков [9]. Первым препаратом данной группы, допущенным к применению в качестве антидиабетического средства, был синтезированный в 1983 г. троглитазон, однако
в 2000 г. его использование было запрещено из-за высокой гепатотоксичности метаболита. После проведения
дополнительных исследований специфической токсичности препаратов была подтверждена безопасность применения всей группы [8]. Кроме того, по данным ретроспективного исследования установлено, что применение
росиглитазона увеличивает риск развития инфаркта миокарда, инсульта, сердечной недостаточности. На основании этого FDA ограничило, а ЕМА в Европе временно
запретило применение данного препарата до выяснения,
у каких групп пациентов польза от препарата перевешивает потенциальный вред [10]. III фазу клинических
испытаний проходят частичный агонист PPAR- балаглитазон и полный агонист ривоглитазон [11]. Соединения,
мишенями которых являются - и -PPAR, имеют комбинированную активность препаратов группы тиазолидиндионов и фибратов, поэтому представляют интерес
для поиска новых антидиабетических средств с гиполипидемическими свойствами [12]. Среди данной новой
группы веществ выделяют производные тиазолидиндионов (DRF-2189, KRP-297) и вещества, не являющиеся
по химической структуре тиазолидиндионами: ITT-501,
BSM-298585 (мураглитазар), AZ-242 (тесаглитазар), NNC
61-0029 или (-)DRF2725 (рагаглитазар), GI262570 (фарглитазар), LY519818 (навеглитазар) [11].
Физиологическая регуляция действия инсулина контролируется посредством баланса между фосфорилированием и дефосфорилированием инсулинового рецептора. Протеинтирозинфосфатаза 1В (PTP1B) — первый
фермент из группы протеинтирозинфосфатаз, у кото-
рого была обнаружена способность дефосфорилировать
инсулиновый рецептор и свойства регулятора инсулинового сигнального пути по принципу отрицательной
обратной связи [12]. У нокаутных по PTP1B мышей
фиксируется усиление фосфорилирования рецептора
и повышение чувствительности скелетных мышц и печени
к гормону [13].
Блокирование данного фермента является оптимальной мишенью для поиска препаратов для лечения СД
2-го типа и ожирения. Учитывая результаты многочисленных исследований, среди ингибиторов данного белка выделяют 4 основных группы низкомолекулярных
соединений: дифтормителенфосфонаты, производные
2-карбометоксибензоевой кислоты, 2-оксалиламинобензойной кислоты, липофильные соединения [14, 15].Однако
на данном этапе ведутся исследования только по молекулярному конструированию и докингу высокоселективных
ингибиторов PTP1B, и не решена проблема, касающаяся создания соединений, доступных для перорального
введения [16, 17].
В качестве мишени для действия препаратов рассматривается и 3-адренорецептор, селективная стимуляция
которого приводит к усилению липолиза, а следовательно, к усилению потребления энергии в скелетных
мышцах и жировой ткани [18]. В качестве модуляторов
β3-рецептора исследуют соединения под шифрами «SR58611» и «TAK-677» [18, 19]. Соединение «TAK-677»
в настоящее время проходит клинические испытания [20].
В ходе многочисленных исследований установлено, что ряд неорганических соединений, а именно соли
ванадия, селена, хрома, марганца, молибдена и вольфрама, имитируют эффекты инсулина [21, 22]. Однако
особый интерес у исследователей вызывает применение
антидиабетических препаратов на основе неорганических
и органических солей ванадия. Инсулиноподобный
эффект соединений ванадия связан с ингибированием
протеинтирозинфосфатаз — ферментов, дефосфорилирующих остатки фосфотирозина в белках и пептидах
и играющих ключевую роль в передаче инсулинового сигнала [21]. Следует отметить, что неорганические соли ванадия плохо всасываются в желудочно-кишечном тракте,
поэтому с целью улучшения абсорбции, терапевтической
безопасности и эффективности были синтезированы различные органические соединения ванадия. Так, комплексы на основе мальтола и этилмальтола, бис-(мальтолато)оксованадий и бис-(этилмальтолато)-оксованадий,
имеют требуемую промежуточную стабильность для пролекарства. Бис-(этилмальтолато)-оксованадий (AKP-020)
прошел I и IIa фазы клинических испытаний [22].
Восстановление физиологических механизмов
секреции инсулина
Следует отметить, что не менее важную роль в патогенезе СД играет снижение секреции инсулина, связанное с прогрессирующим снижением функциональной
активности -клеток поджелудочной железы, сопутствующее развитию инсулинорезистентности. Длительность
сохранения секреторной функции островков Лангерганса
определяет начало инсулинотерапии при СД 2-го типа.
Снижение эффекта инкретинов — один из важных дефектов, приводящий к снижению глюкозозависимой
секреции инсулина [8]. В последнее десятилетие благодаря фундаментальным и клиническим исследованиям
в данной области развилось новое и перспективное
направление в лечении СД 2-го типа, базирующееся
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ЭНДОКРИНОЛОГИИ
на использовании инкретинового эффекта. Выделяют
2 основных группы соединений, регулирующих энтероинсулярную ось: агонисты GLP-1 рецепторов (GLP-1
миметики, инкретиномиметики) и ингибиторы дипептидилпептидазы-4 (DPP4) (инкретинэнхансеры) [23].
Препараты данных групп либо восполняют дефицит инкретинов, либо тормозят процессы деградации и таким
образом стимулируют секрецию инсулина и ингибируют секрецию глюкагона, тормозят процессы апоптоза
-клеток поджелудочной железы и усиливают их регенерацию, что позволяет достичь пролонгированного
эффекта и воздействовать на одно из звеньев патогенеза
заболевания [24].
Эксенатид является первым представителем лекарственного класса агонистов GLP-1-рецепторов, синтетической формой экзендина-4, первоначально выделенного
из слюны ядовитой южно-американской ящерицы [25].
Еще один препарат, аналог человеческого GLP-1, на 97%
представляющий собой структуру, гомологичную нативному человеческому GLP-1 — лираглутид [26]. Наличие
данных препаратов только в инъекционных формах несколько ограничивает их применение. Учитывая данную
проблему, ведется направленный поиск непептидных
молекул, которые связываются и стимулируют GLP1-рецептор. Из библиотеки в 48 168 соединений были
найдены соединения среди замещенных хиноксалина
и производных циклобутана S4P и Boc 5, которые оказывают эффекты, подобные аналогам GLP-1 [27].
Еще один класс препаратов — ингибиторы DPP4,
представителями которого являются вилдаглиптин, ситаглиптин, саксаглиптин, алоглиптин. Эти средства воздействуют на тот же биохимический процесс, что и агонисты
GLP-1, но другим способом: они не пополняют естественный запас GLP-1, а ингибируют фермент, ответственный
за его расщепление. Ингибирование DPP4 позволяет преодолеть некоторые проблемы, связанные с клиническим
применением GLP-1 и его аналогов: отсутствие пероральных форм и быструю деградацию GLP-1 [25, 28]. Однако,
помимо GLP и GIP, субстратами для фермента являются
нейропептид Y, пептид YY, 9 хемокинов, что обусловливает наличие иммунотропной и психотропной активности
у данной группы средств [29]. DPP-4 входит в состав семейства, которое включает 4 фермента DPP-4, протеинактиватор фибробластов (FAP), дипептидилпептидазу-8,
дипептидилпептидазу-9 и 2 белка без ферментативной
активности — DPP-4-подобный протеин-6 (DPP-6) и
дипептидилпептидазу-10 [28]. Аминокислотная последовательность в каталитическом домене данных ферментов
аналогична, однако ингибирование DPP-8/9 приводит
к появлению таких побочных эффектов, как алопеция,
тромбоцитопения, ретикулоцитопения, поэтому ведется
поиск новых высокоселективных ингибиторов только в
отношении DPP4 [29].
Сконструированы гибридные полипептидные молекулы на основе GLP-1 и глюкагона, т.н. dual-acting peptide for diabetes (DAPD), которые проходят доклинические исследования. Для устранения у данных соединений
побочных эффектов со стороны желудочно-кишечного
тракта (тошнота и рвота) были получены пегилированные
DAPD [30].
G-сопряженные рецепторы являются одними из
важных модуляторов секреции GLP-1. GPR119 — это
G-сопряженный рецептор, который селективно экспрессируется на -клетках поджелудочной железы и эндокринных клетках кишечника. GPR119 выполняет функцию глюкозозависимого инсулинотропного рецептора и
подобно рецепторам к GLP-1 и другим пептидам регули-
рует усиление глюкозозависимого высвобождения инсулина. Агонисты GPR119 стимулируют глюкозозависимую
секрецию инсулина in vitro и снижают повышенный
уровень глюкозы в крови in vivo. Дополнительно продемонстрировано, что данные соединения стимулируют
высвобождение инкретинов GLP-1 и GIP. В качестве агонистов GPR119 испытывали различные соединения APD668 и APD-597 (исследования прекращены), SAR-260093/
MBX-2982 (II фаза испытаний), GSK-1292263 (II фаза испытаний), PSN-821 (II фаза испытаний) [31]. Возможно,
данный механизм действия — основа противодиабетического действия экстракта гимнемы лесной и его препаратов [32]. Согласно данным исследований, экстракт из
листьев гимнемы лесной повышает высвобождение GIP
и GLP-1 под влиянием глюкозы [32, 33].
Однако возможно и создание препаратов, стимулирующих секрецию инсулина посредством усиления
активности гексокиназы -клеток. Активно ведется
поиск лекарственных средств в данном направлении,
но все исследования находятся на доклиническом этапе,
и лишь некоторые соединения проходят клинические
испытания. Данный класс препаратов является весьма
перспективным, поскольку гексокиназа не только контролирует переход глюкозы в гликоген, но и является
глюкозным сенсором инсулинопродуцирующих клеток
поджелудочной железы, что позволит препарату воздействовать на 2 основных звена патогенеза СД: продукцию
глюкозы печенью и дисфункцию -клеток. Среди соединений, способных активировать гексокиназу в зависимости от фармакофора, располагающегося в центре
молекулы, выделяют 4 основных класса: с углеродом
в центре (RO0281675, RO4389620, LY2121260, PsN-GK1),
с ароматическим кольцом (GKA-50), с аминокислотой
и с другими структурами [34, 35].
Также перспективен поиск постпрандиальных регуляторов уровня глюкозы среди циклических гуанидинов.
Так, экспериментально продемонстрирована противодиабетическая активность соединения РУ-254, которая
связана как с панкреотропными, так и с экстрапанкреатическими эффектами вещества. Кроме того, соединение
корректирует реологические параметры крови, что способствует профилактике микроциркуляторных нарушений при СД 2-го типа [36].
Необходимо учитывать, что хроническая гипергликемия при СД приводит к нарушениям функции инсулинпродуцирующих клеток, которые со временем становятся
необратимыми. Токсическое действие высоких концентраций глюкозы связано с десенситизацией -клеток,
усилением свободнорадикальных процессов, снижением
высвобождения, а затем синтеза и депонирования инсулина и в конечном итоге — с активацией процессов апоптоза β-клеток [37, 38]. Перспективным направлением
в данном случае является создание группы лекарственных
препаратов, ограничивающих процессы апоптоза и стимулирующих регенерацию -клеток [38].
Первым из средств, испытанных для профилактики
повреждения островков Лангерганса, является никотинамид. Никотинамид способствует угнетению активности поли-(АДФ-рибозо)-полимеразы (ПАРП) и (моно-)
АДФ-рибозилтрансферазы, что предотвращает снижение
уровня NAD+ в -клетках, необходимого для синтеза инсулина и контроля аутоиммунных процессов, в частности
экспрессии генов НLA II класса [39]. In vivo никотинамид повышает репликацию -клеток в трансплантируемых островках, стимулирует регенерацию у животных
с частичной панкреатэктомией, предотвращает повреждение поджелудочной железы при стрептозотоцино-
45
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
46
вом диабете, улучшает инсулиносекреторную функцию
у пациентов с высоким риском развития СД 1-го типа
[39–43]. Предполагалось применять никотинамид как
средство для профилактики СД у ближайших родственников пациентов с СД 1-го типа, однако в ходе клинических испытаний не было получено данных об эффективности вещества [39]. По данным ряда авторов, терапия
никотинамидом приводит к существенному увеличению
частоты клинической ремиссии заболевания со снижением потребности в экзогенном инсулине [44, 45]. Однако
передозировка никотинамидом (более 2 мг/кг) может
приводить к повышению концентрации его метаболита, N1-метилникотинамида — потенциального триггера
окислительного стресса и инсулинорезистентности при
СД 2-го типа [46]. Клинические исследования профилактического действия данного препарата противоречивы
и требуют дальнейшего уточнения.
Осуществляют поиск новых высокоселективных ингибиторов ПАРП-1 среди различных классов веществ.
Ингибиторы ПАРП разделяют на 2 основные группы:
производные нуклеиновых кислот и нуклеозидов и ингибиторы, созданные с учетом строения каталитического
центра фермента (PJ-34 и INO-1001) [47]. Некоторые из
этих соединений проходят I и II фазу клинических испытаний [48].
INGAP (islet neogenesis associated protein — островковый неогенез-ассоциированый белок) — один из первых
кандидатов для создания препаратов, индуцирующих неогенез островков, выделенный из протоков поджелудочной железы хомячков [49]. Результаты исследований
in vitro на животных подтвердили активность пептида,
INGAP повышает содержание С-пептида у пациентов
с СД 1-го типа и улучшает контроль концентрации глюкозы у пациентов с СД 2-го типа [50].
Проводятся исследования по применению в качестве протектора от свободнорадикальных повреждений и апоптоза поджелудочной железы миметика СОД
AEOL10150 [51].
Соединения, снижающие продукцию глюкозы
печенью
Глюконеогенез — естественный метаболический процесс, поддерживающий оптимальный уровень глюкозы в период между приемами пищи, однако при СД,
как вследствие снижения концентрации инсулина, так
и из-за резистентности тканей к инсулиновому сигналу, активируется процесс синтеза глюкозы в печени
из неуглеводных источников. Таким образом, повышение продукции глюкозы печенью является одним из
основных и ведущих факторов в патогенезе СД и требует
дополнительной фармакологической коррекции. Следует отметить, что повышение интенсивности глюконеогенеза в печени в 3 раза и более, наблюдающееся при умеренной недостаточности инсулина, связано
с тем, что для угнетения глюконеогенеза требуется сравнительно больше количества инсулина, чем для угнетения
гликогенолиза [52].
Регуляция ключевых ферментов углеводного обмена
в печени, активация ферментов гликолиза и синтеза
гликогена (гликогенсинтазы, гексокиназы, фосфофруктокиназы, пируваткиназы) и ингибирование ферментов
глюконеогенеза и гликогенолиза (гликогенфосфорилазы,
фруктозобифосфатазы, глюкозо-6-фосфатазы, фосфоенолпируваткарбоксилазы) [53] служат точкой приложения действия соединений и одним из перспективных
направлений поиска и создания нового класса препаратов
для лечения СД 2-го типа.
Метформин является единственным препаратом, ингибирующим глюконеогенез в печени, однако данный
эффект связан со снижением печеночной инсулинорезистентности [54]. Согласно данным Y.C. Long [55], метформин стимулирует АМФ-активируемую протеинкиназу
и внутриклеточный сигнал истощения запасов энергии,
что приводит к повышению захвата глюкозы скелетными
мышцами и торможению глюконеогенеза.
В качестве эффективных антидиабетических препаратов могут применяться селективные ингибиторы киназы
гликогенсинтазы-3. Так, у солей лития были обнаружены инсулиноподобные свойства, которые, возможно,
связаны с блокированием киназы гликогенсинтазы-3,
однако следует помнить, что ионы лития селективны не
только к данному ферменту, но также ингибируют инозитолмонофосфатазу [56]. Низкомолекулярные ингибиторы киназы гликогенсинтазы-3 активно разрабатывались
исследовательской группой компании GlaxoSmithKline,
и ими были получены производные малеимидов SB216763 и SB-415286, которые стимулировали синтез гликогена изолированными гепатоцитами человека. Кроме
того, ингибирующая активность была обнаружена у производных аминопиримидина, CT98014 и CT98023, которые увеличивали синтез гликогена, а также повышали инсулинопосредованный захват глюкозы периферическими
тканями при экспериментальном СД [57].
Активно исследуются соединения из группы ингибиторов фруктозо-1,6-бифосфатазы. Так, CS-917
(MB 06322) угнетал глюконеогенез на различных генетических моделях СД (ZDF и GK-крысы) и снижал содержание глюкозы в плазме крови у пациентов с СД. Ведется
поиск ингибиторов гликогенфосфорилазы А. Установлен
ряд соединений с данным видом активности: производные дигидропиридина (BAYR3401 и др.) [58]; СP 91149
[59], которые эффективны в условиях in vitro и на экспериментальных моделях СД; S-3483 — производное хлорогеновой кислоты, ингибитор глюкозо-6-фосфатазы, на
модели перфузии изолированной печени крыс, дозозависимо подавляющий глюконеогенез и гликогенолиз [60].
Таким образом, поиск препаратов, снижающих продукцию глюкозы печенью, является одним из приоритетных направлений в диабетологии.
Препараты на основе моноклональных антител
в терапии сахарного диабета
Перспективным направлением в терапии СД является
создание лекарственных препаратов на основе моноклональных антител. Если первоначально исследования
в данной области были направлены на ограничение аутоиммунных процессов при СД 1-го типа, то на сегодняшний момент рассматривают применение моноклональных антител для коррекции СД 2-го типа. Одним из
первых препаратов на основе моноклональных антител
к CD3 стал отеликсизумаб, который связывается с CD3/
TCR-комплексом и блокирует активацию Т клеток, пролиферацию и высвобождение цитокинов. Эффективность
и безопасность данного вещества оценивалась в исследованиях DEFEND-1 и DEFEND-2 (2010) у пациентов
с вновь диагностированным СД. III фазу клинических испытаний проходит препарат теплизумаб — человеческие
Fc-сконструированные моноклональные антитела [61].
Проводятся экспериментальные исследования высокоаффинных моноклональных антител к рецепто-
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ЭНДОКРИНОЛОГИИ
ру инсулина (XMetA) в качестве средств для лечения
СД 2-го типа. Данные антитела выполняют функцию
специфических парциальных агонистов инсулинового
рецептора, усиливая аутофосфорилирование, фосфорилирование тирозина субстрата инсулинового рецептора-1, что приводит к повышению интенсивности утилизации глюкозы [62]. Создан препарат на основе антител
к С-концевому фрагменту -субъединицы рецептора инсулина, оказывающий модулирующее действие на активность рецептора инсулина, а именно на активность
С-концевого фрагмента -субъединицы рецептора, являющегося сайтом прикрепления Shc [63].
Кроме того, активно изучают высокоаффинные моноклональные антитела, антагонисты глюкагонового рецептора, например mAb B и mAb Ac. Они эффективно
корригируют уровень глюкозы, не вызывая гипогликемии. Кроме того, следует отметить, что моноклональные
антитела-антагонисты глюкагонового рецептора компенсаторно увеличивают концентрацию активного GLP1, что вносит значительный вклад в сахароснижающее
действие [64].
Препараты с различными механизмами действия
В последние несколько лет большое внимание уделяется новой группе средств, которая может применяться
в терапии СД 2-го типа — ингибиторам Na+/глюкозного
котранспортера 2-го типа [65]. Первым агентом, который
стал применяться в качестве ингибитора Na+/глюкозного котранспортера (SGLT), был флоризин. Однако он является
неселективным по отношению к транспортерам и супрессирует SGLT1 в желудочно-кишечном тракте, кроме того,
блокирует ГЛЮТ-1 и приводит к развитию такого побочного эффекта, как диарея. Помимо этого, данное веще-
ство быстро разрушается кишечными -глюкозидазами.
Для оптимизации биодоступности и селективности были
синтезированы селективные к SGLT2 серглифлозин
и ремоглифлозин, однако наличие в молекуле О-гликозида
способствует быстрой деградации соединений в кишечнике и, как следствие, значительному снижению эффективности при пероральном приеме. Устойчивости
к действию ферментов кишечника удалось достичь присоединением С-арилгликозидного фрагмента [66, 67].
Дапаглифлозин, первый высокоселективный ингибитор
Na+/глюкозного котранспортера 2-го типа, — препарат
нового класса, проходящий III фазу клинических испытаний. Канаглифлозин и BI 10773 — еще 2 соединения
данной группы, избирательно блокирующие SGLT2. Активно исследуются в качестве ингибиторов Na+/глюкозного котранспортера вещества TS-071, BI-44847, CSG-452,
LX-4211, ASP-1941, DSP-3235 [67].
Кроме того, ведется поиск соединений, оказывающих
влияние на гормональную регуляцию среди агонистов
D2-рецепторов (Bromocriptine); ингибиторов амилоида
А (Eprodisate/NC-503); ингибиторов синтеза кортизола
(DIO-902/2S,4R-ketoconazole); ингибиторов 11-β-гидроксистероиддегидрогеназы (INCB 13739); аналог гастрина
(TT-223) [11].
47
Заключение
Описанные в работе направления поиска пероральных сахароснижающих препаратов являются наиболее
перспективными в области фармакотерапии СД. Однако
следует отметить, что поиск антидиабетических средств
в будущем значительно расширится с получением новых
данных о генетической основе и молекулярных механизмах патогенеза СД.
ЛИТЕРАТУРА
1.
Дедов И.И., Шестакова М.В., Сунцов Ю.И. и др. Фармакоэкономическое моделирование отдаленных результатов
лечения сахарного диабета 2 типа у пациентов, получавших
современные аналоги инсулина, по сравнению с терапией
пероральными сахароснижающими препаратами. Сахарный
диабет. 2010; 46 (1): 102–112.
2. Балаболкин М.И., Клебанова Е.М., Креминская В.М. Лечение сахарного диабета и его осложнений. М. 2005.
3. Аметов А.С. Роль -клеток в регуляции гомеостаза глюкозы
в норме и при сахарном диабете 2 типа. Сахарный диабет. 2008;
41 (4): 6–12.
4. Stolar M.W., Hoogwerf B.J., Gorshow S.M. et al. Managing Type 2
Diabetes: Going Beyond Glycemic Control. J. Manag. Care Pharm.
2008; 14 (5): 2–19.
5. Lerario A.C., Chacra A.R., Pimazoni-Netto A. et al. Algorithm for
the treatment of type 2 diabetes: a position statement of Brazilian
Diabetes Society. Diabetology& Metabolic Syndrome. 2010; 35 (2).
6. Дедов И.И., Шестакова М.В. Алгоритмы специализированной медицинской помощи больным сахарным диабетом.
М. 2007.
7. Спасов А.А., Чепурнова М.В. Научные подходы к комбинированной терапии сахарного диабета типа 2. Вестн. ВолгГМУ.
2011; 1: 8–12.
8. Сахарный диабет: диагностика, лечение, профилактика. Под
ред.И.И. Дедова, М.В. Шестаковой. М.: МИА. 2011. 808 с.
9. O’Moore-Sullivan T.M., Prins J.B. Thiazolidinediones and type 2
diabetes: new drugs for an old disease. MJA. 2002; 116: 381–386.
10. Graham D.J., Ouellet-Hellstrom R., MaCurdy T.E. Risk of acute
myocardial infarction, stroke, heart failure, and death in elderly
11.
12.
13.
14.
15.
16.
17.
18.
19.
medicare patients treated with rosiglitazone or pioglitazone. JAMA.
2010; 304 (4): 411–418.
Levien, T.L., Baker DE. New drugs in development for the treatment of diabetes. Diabetes Spectrum. 2009; 22: 92–106.
Sharma R. Novel dual-acting peroxisome proliferator-activated
receptor alpha and gamma agonists. J. Clin. Diagn. Res. 2008;
2: 659–667.
Ukkola O., Santaniemi M. Protein tyrosine phosphatase 1B: a new
target for the treatment of obesity and associated co-morbidities.
J. Intern. Med. 2002; 251: 467–475.
Johnson T.O., Ermolieff J., Jirousek M.R. Protein tyrosine phosphatase 1b inhibitors for diabetes. Drug discovery. 2002; 1: 696–709.
Kumar Vats R., Kumar V., Kothari A. et al. Emerging targets
for diabetes. Curr. sci. 2005; 88 (2): 241–249.
Black E., Breed J., Breeze A. L. et al. Structure-based design of protein tyrosine phosphatase-1B inhibitors. Bioorg. & Medicinal Chem.
2005; 15: 2503–2507.
Wilson D.P., Wan Z.-K., Xu W.-X. et al. Structure-based optimization of protein tyrosine phosphatase 1B inhibitors: from the active
site to the second phosphotyrosine binding site. J. Med. Chem. 2007;
50: 4681–4698.
Coman O.A., Paunescu H., Ghita I. et al. Beta 3 adrenergic
receptors: molecular, histological, functional and pharmacological approaches. Romanian J. Morphol. Embryol. 2009; 50 (2):
169–179.
Schaeffer P., Bernat A., Arnone M. et al. Effect of SR58611A,
a potent beta-3 adrenoceptor agonist, on cutaneous wound healing
in diabetic and obese mice. Eur. J. Pharmacol. 2006; 529 (1–3):
172–178.
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
48
20. Francke S. TAK-677 (Dainippon/Takeda). Curr. Opin. Investig.
Drug. 2002; 11 (3): 1624–1628.
21. Sakurai H.A New concept: the use of vanadium complexes in the
treatment of diabetes mellitus. Chem. Rec. 2002; 2: 237–248.
22. Thompson K.H., Lichter J., Le Be C. Vanadium treatment of
type 2 diabetes: A view to the future. J. Inorganic Biochem. 2009;
103: 554–558.
23. Gallwitz B. The evolving place of incretin-based therapies in type 2
diabetes. Pediatr. Nephrol. 2010; 25: 1207–1217.
24. Ranganath L.R. The entero-insular axis: implications for human
metabolism. Clin. Chem. Lab. Med. 2008; 46 (1): 43–56.
25. Ross A.S. Incretin agents in type 2 diabetes. Can. Fam. Physician.
2010; 56: 639–648.
26. Dharmalingam M., Sriram U., Baruah M.P. Liraglutide: A review
of its therapeutic use as a once daily GLP-1 analog for the management of type 2 diabetes mellitus. Indian J. Endocrinol. Metab. 2011;
15 (1): 9–17.
27. Chena D., Liaoa J., Lia N. et al. A nonpeptidic agonist of glucagonlike peptide 1 receptors with efficacy in diabetic db/ db mice. PNAS.
2007; 104 (3): 943–948.
28. Gorrell M.D. Dipeptidyl peptidase IV and related enzymes in cell
biology and liver disorders. Clin. Sci. 2005; 108: 277–292.
29. Gupta R, Walunj S.S., Tokala R.K. Emerging drug candidates of
dipeptidyl peptidase IV (DPP IV) inhibitor class for the treatment
of type 2 diabetes. Curr. Drug Targets. 2009; 10: 71–87.
30. Green B.D., Flatt P.R. Incretin hormone mimetics and analogues in
diabetes therapeutics. Best Pract. Res. Clin. Endocrinol. Metab. 2007;
4 (21): 497–516.
31. Overton H.A., Fyfe M.C.T., Reynet C. GPR119, a novel G proteincoupled receptor target for the treatment of type 2 diabetes and
obesity. Brit. J. Pharmacol. 2008; 153: 76–81.
32. Спасов А.А., Буланов А.Е., Самохина М.П. Антидиабетогенные свойства гимнемы лесной (обзор). Химико-фармацевтический журнал. 2008; 42 (11): 10–14.
33. Fushiki T., Kojima A., Imoto T. An extract of Gymnema sylvestre leaves and purified gymnemic acid inhibits glucose-stimulated gastric inhibitory peptide secretion in rats. J. Nutr. 1992;
122: 2367–2373.
34. Matschinsky F.M. Assessing the potential of glucokinase activators
in diabetes therapy. Nat. Rev. Drug Disc. 2009; 8: 399–416.
35. Matschinsky F.M., Porte D. Glucokinase activators (GKAs) promise a new pharmacotherapy for diabetics. F1000. Med. Reports. 2010;
43 (2): 1776–1783.
36. Спасов А.А., Петров В.И., Анисимова В.А. и др. Мат-лы IV
Всеросс. диабетол. конгр. М. 2008. 336 с.
37. Fujimoto K., Polonsky K. S. Pdx1 and other factors that regulate pancreatic в-cell survival. Diabetes Obes. Metab. 2009; 11
(Suppl. 4.) 30–37.
38. Robertson R.P., Harmon J.S. Pancreatic islet β-cell and oxidative
stress: the importance of glutathione peroxidase. FEBS Lett. 2007;
581 (19): 3743–3748.
39. Полторак В.В., Горбенко Н.И., Сакало Е.А. Профилактика
сахарного диабета 1 типа: патофизиологическое обоснование,
стратегия и клиническая реализация. Украинский медицинский
часопис. 2001; 22 (2): 83–91.
40. Yonemura Y., Takashima T., Miwa K. et al. Amelioration of diabetes
mellitus in partially depancreatized rats by poly(ADP-ribose) synthetase inhibitors: evidence of islet B-cell regeneration. Diabetes.
1984; 33: 401–404.
41. Sandler S., Andersson A. Stimulation of cell replication in transplanted pancreatic islets by nicotinamide treatment. Transplantation. 1988; 46: 30–31.
42. Manna R., Migliore A., Martin L.S. et al. Nicotinamide treatment
in subjects at high risk of developing IDDM improves insulin secretion. Brit. J. Clin. Pract. 1992; 46: 177–179.
43. Hu Y., Wang Y., Wang L. et al. Effects of nicotinamide on prevention
and treatment of streptozotocin-induced diabetes mellitus in rats.
Chin. Med. J. (Engl.). 1996; 109 (11): 819–822.
44. Pozzilli P., Visalli N., Cavallo M.G. Vitamin E and nicotinamide
have similar effects in maintaining residual beta cell function
in recent onset insulin-dependent diabetes (the IMDIAB IV study).
Eur. J. Endocrinol. 1997; 137: 234–239.
45. Crino A., Schiaffini R., Manfrini S. A randomized trial of nicotinamide and vitamin E in children with recent onset type 1 diabetes
(IMDIAB IX). Eur. J. Endocrinol. 2004; 150: 719–724.
46. Zhou S.-S., Li D., Sun W.-P. Nicotinamide overload may play a role
in the development of type 2 diabetes. World J. Gastroenterol. 2009;
43 (15): 5674–5684.
47. Jagtap P. G., Baloglu E., Southan G. J. et al. Discovery of potent
poly(ADP-ribose) polymerase-1 inhibitors from the modification of
indeno[1,2-c]isoquinolinone. J. Med. Chem. 2005; 48: 5100–5103.
48. Szabo C., Biser A., Benko R. et al. Poly(ADP-Ribose) polymerase
inhibitors ameliorate nephropathy of type 2 diabetic Leprdb/db
mice. Diabetes. 2006; 55 (11): 3004–3012.
49. Pittenger G.L., Taylor-Fishwick D., Vinik A.I. The role of islet
neogeneis-associated protein (INGAP) in pancreatic islet neogenesis. Curr. Protein Pept Sci. 2009; 10 (1): 37–45.
50. Dungan K.M., Buse J.B., Ratner R.E. Effects of therapy in type 1
and type 2 diabetes mellitus with a peptide derived from islet neogenesis associated protein (INGAP). Diabetes Metab. Res. Rev.
2009; 25 (6): 558–565.
51. Bottino R., Balamurugan A.N., Tse H. Response of human islets
to isolation stress and the effect of antioxidant treatment. Diabetes.
2004; 53: 2559–2568.
52. Felig P., Wahren J. Influence of endogenous insulin secretion on
splanchnic glucose and amino acid metabolism in man. J. Clin.
Invest. 1971; 50 (8): 1702–1711.
53. Wu C., Okar D. A., Kang J. et al. Reduction of hepatic glucose
production as a therapeutic target in the treatment of diabetes. Curr.
Drug Targets Immune, Endocrine & Metab. Dis. 2005; 5: 51–59.
54. Alice Y.Y., Cheng I., Fantus G. Oral antihyperglycemic therapy for
type 2 diabetes mellitus. CMAJ. 2005; 172 (2): 213–226.
55. Long Y.C., Zierath J.R. AMP-activated protein kinase signaling
in metabolic regulation. J. Clin. Invest. 2006; 116: 1776–1783.
56. Meijer L., Flajolet M., Greengard P. Pharmacological inhibitors
of glycogen synthase kinase 3. Trends in Pharmacol. Sci. 2004;
25 (9): 471–480.
57. Woodgett J.R. Physiological roles of glycogen synthase kinase-3:
potential as a therapeutic target for diabetes and other disorders. Curr.
Drug Targets Immune, Endocrine & Metab. Dis. 2003; 3: 275–284.
58. Bergans N., Stalmans W., Goldmann S. et al. Molecular mode
of inhibition of glycogenolysis in rat liver by the dihydropyridine derivative, BAY R3401: inhibition and inactivation of glycogen phosphorylase by an activated metabolite. Diabetes. 2000;
49 (9): 1419–1426.
59. Martin W.H., Hoover D.J., Armento S.J. et al. Discovery of
a human liver glycogen phosphorylase inhibitor that lowers blood
glucose in vivo. PNAS. 1998; 95 (4): 1776–1781.
60. Herling A.W., Burger H.-J., Schwab D. Pharmacodynamic profile
of a novel inhibitor of the hepatic glucose-6-phosphatase system.
Am. J. Physiol. 1998; 274: 1087–1093.
61. Gallagher M.P., Goland R.S., Greenbaum C.J. Making progress:
preserving beta cells in type 1 diabetes. Ann. N.-Y. Acad. Sci. 2011;
1243: 119–134.
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ЭНДОКРИНОЛОГИИ
62. Bhaskar V., Goldfine I.D., Bedinger D.H. et al. A fully
human, allosteric monoclonal antibody that activates the insulin receptor and improves glycemic control. Diabetes. 2012;
61 (5): 1263–1271.
63. Петров В.И., Рогова Н.В., Рязанова А.Ю. и др. сверхмалые дозы антител к С-концевому фрагменту -субъединицы
рецептора инсулина — новый класс сахароснижающих
средств. Бюлл. ВНЦ РАМН. 2009; 3: 19–22.
64. Gu W., Yan H., Winters K. A. et al. Long-term inhibition of the glucagon receptor with a monoclonal antibody in mice causes sustained
improvement in glycemic control, with reversible β-cell hyperplasia
and hyperglucagonemia. J. Pharmacol. Exp. Therapeutics. 2009;
331 (3): 871–881.
65. Jabbour S.A. The importance of reducing hyperglycemia while
preserving insulin secretion — the rationale for sodium-coupled
glucose co-transporter 2 inhibition in diabete. US Endocrinol.
2009; 5: 75–78.
66. Norton L., De Fronzo R.A., Abdul-Ghani M.A. Sodium-glucose
co-transporter 2 inhibition — a novel strategy for glucose control in
type 2 diabetes. US Endocrinol. 2010; 6: 42–47.
67. Chao E.C., Henry R.R. SGLT2 inhibition — a novel strategy for
diabetes treatment. Nat. Rev. Drug Discov. 2010; 9 (7): 551–559.
КОНТАКТНАЯ ИНФОРМАЦИЯ
Спасов Александр Алексеевич, доктор медицинских наук, профессор, академик РАМН, заслуженный деятель науки
РФ, заведующий кафедрой фармакологии ГБОУ ВПО «ВолгГМУ» МЗ РФ
Адрес: 400131, Волгоград, пл. Павших борцов, д. 1; тел.: (8442) 94-24-23; е-mail: aspasov@mail.ru
Петров Владимир Иванович, доктор медицинских наук, профессор, академик РАМН, заслуженный деятель науки
РФ, заслуженный врач РФ, ректор ГБОУ ВПО «ВолгГМУ» МЗ РФ
Адрес: 400131, Волгоград, пл. Павших борцов, д. 1; тел.: (8442) 55-17-70; е-mail: post@volgmed.ru
Чепляева Наталья Ивановна, младший научный сотрудник лаборатории фармакологии антиоксидантных средств
НИИ фармакологии ГБОУ ВПО «ВолгГМУ» МЗ РФ
Адрес: 400131, Волгоград, пл. Павших борцов, д. 1; тел.: (8442) 97-15-34; е-mail: natalja-chepljaeva@rambler.ru
Ленская Карина Владимировна, кандидат биологических наук, докторант кафедры фармакологии ГБОУ ВПО
«ВолгГМУ» МЗ РФ
Адрес: 400131, Волгоград, пл. Павших борцов, д. 1; тел.: (8442) 97-15-34; е -mail: kina81@mail.ru
49
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ФИЗИОЛОГИИ
Г.М. Элбакидзе1, А.Г. Меденцев2
1 Медико-биологический
центр Ассоциации содействия международному центру научной культуры —
«Всемирная лаборатория», Москва, Российская Федерация
2 Институт биохимии и физиологии микроорганизмов им. Г.К. Скрябина РАН, Московская область, Пущино,
Российская Федерация
Внутриорганные и внутритканевые механизмы
регуляторных воздействий клеток Купфера
на гепатоциты
50
Активированные эндотоксином клетки Купфера выделяют в межклеточное пространство медиаторы, действующие на гепатоциты как
прямо, так и опосредованно, при участии звездчатых клеток. В обоих случаях клетки Купфера оказывают свое регуляторное влияние паракринно. Однако регулируемая область паренхимы печени может быть увеличенна путем реализации нескольких механизмов. Одним из них
является выброс вазоконстрикторов из активированных клеток Купфера, стимулирующих сократительную способность звездчатых клеток.
Этот эффект может быть достигнут также путем формирования очагов гиперметаболизма под действием медиаторов клеток Купфера
с последующей активацией гепатоцит-гепатоцитарных взаимодействий, основанных на принципе конкурирования клеток за кислород
в межклеточном пространстве. Регуляторное влияние активированных клеток Купфера может распространяться в паренхиме печени
и с использованием механизма внутритканевых гепатоцит-гепатоцитарных взаимодействий, реализующих реакцию тканевого стресса.
Ключевые слова: эндотоксин, клетки Купфера, гепатоциты, тканевый стресс, гиперметаболизм.
Введение
Резидентные макрофаги — клетки Купфера (КК) —
играют ключевую роль в процессе формирования
воспалительной реакции в печени в условиях
бактериальной инвазии [1–3], а также при повреждении
этого органа ксенобиотиками [4]. В течение последних
десятилетий было показано, что регуляторное влияние
КК на гепатоциты может осуществляться не только
путем прямого воздействия выделяемых ими медиаторов
на эти клетки, но и опосредованно, при участии иных
клеток стромы печени, активируемых КК. Важной
особенностью обоих типов регуляторных механизмов
является паракринный характер действия их медиаторов
[1, 3, 5, 6]. Между тем к настоящему времени накоплены
данные, свидетельствующие о возможности распространения регуляторного влияния КК в паренхиме печени.
Все эти внутриорганные и внутритканевые регуляторные
механизмы рассмотрены в статье.
Особенности регуляторных воздействий клеток
Купфера на гепатоциты
Как известно, КК прикреплены к стенкам синусоидов и выполняют функцию фагоцитоза и инактивации эндотоксинов и бактерий, поступающих в печень
по венозному кровотоку. Фагоцитоз сопровождается ак-
G.M. Elbakidze1, A.G.Medentsev2
1 Association
2 G.K.
for World Laboratory, Biomedical Center, Moscow, Russian Federation
Skryabin Institute of Biochemistry and Physiology of Microorganisms, RAS, Puschino, Moscow Region,
Russian Federation
Intraorganic and intratissue mechanisms of protective action
of activated kupffer cells on hepatocytes
Endotoxine activated Kupffer cells release into the intercellular space several mediators which act directly on hepatocytes as well as via stellet cells.
In both cases Kupffer cells downregulate hepatocytes as a part of paracrine system. However, downregulated part of liver parenchyma might be
extended by several mechanisms. The first one is release of vasoconstrictors from activated Kupffer cells which stimulate stellet cells contraction.
This effect may also be achieved by formation of hypermetabolic focuses by Kupffer cells mediators with further activation of hepatocyte–hepatocyte
interactions based on the principle of cell competition for oxygen in the intercellular space. Regulatory influence of activated Kupffer cells may be
spread in liver parenchyma with participation of the mechanism of intratissue hepatocyte–hepatocyte interactions which also realize tissue stress
reaction.
Key words: endotoxine, Kupffer cells, hepatocytes, tissue stress, hypermetabolism.
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ФИЗИОЛОГИИ
тивацией КК с последующим переходом их в примированное состояние. При этом фагоцитирующая способность КК снижается, но усиливается выброс в синусоиды
медиаторов, посредством которых осуществляется регулирование физиологических функций гепатоцитов [7].
Одной из особенностей данного регулирующего
действия является большое разнообразие медиаторов,
выделяемых активированными КК. К ним относятся
белки (лизосомальные ферменты) [8], пептиды (цитокины)
[9] и трансформирующий фактор роста ТФР 1 [10]. Простагландины [11], тромбоксаны и лейкотриены имеют
липидную природу [1]. КК выделяют также неорганические медиаторы — активные формы кислорода (АФК) [1]
и активные формы азота (АФА) [12].
Другой особенностью рассматриваемого типа механизмов является весьма широкий спектр регулируемых медиаторами КК функций гепатоцитов. Так,
активированные КК ингибируют глюконеогенез [13], вызывают высвобождение аккумулированной в этих клетках глюкозы под действием простагландинов D2 [14],
E2 и F2 [15], а также лейкотриенов C4 и D4 [16]. КК
обладают способностью стимулировать пролиферативную активность гепатоцитов [17, 18] и угнетать апоптоз [17, 19] под влиянием фактора некроза опухолей 
(ФНО ) [17], а также интерлейкина 6 (ИЛ 6) [18]. Показано, что лейкотриены могут препятствовать гибели гепатоцитов по механизму апоптоза и стимулировать таковую
по механизму некроза [20].
Еще одна характерная особенность воздействий, осуществляемых активированными КК, — это возможность
регулирования отдельного физиологического процесса
у гепатоцитов большой совокупностью выделяемых ими
медиаторов, отличающихся по химической природе. Например, способностью вызывать вазоконстрикторный
эффект обладают лейкотриены и другие эйкозаноиды,
цитокины, протеиназы и АФА [21]. Повреждение и гибель
гепатоцитов вызывают медиаторы КК вазоконстрикторного действия [22], а также провоспалительные цитокины, такие как ФНО , ИЛ 1, ИЛ 6 [3, 23, 24]. Кроме
того, повреждающее действие на гепатоциты оказывают
простагландины, протеазы, АФК и АФА [24].
Следует отметить и такую особенность действия отдельных медиаторов КК, как их способность влиять на
гепатоциты противоположным образом. Известны медиаторы КК, которые не только повреждают, но и защищают гепатоциты от повреждающих воздействий. К ним
относятся ФНО α, ИЛ 1β, ИЛ 6, оказывающие протективный эффект на гепатоциты при воздействии на последние
этанола [23]. Обнаружено, что протективное действие
активированных КК на гепатоциты может переходить
в повреждающее [23]. Доказано, что при воздействии
на гепатоциты цитокинами в низких концентрациях
эти медиаторы защищают гепатоциты от клеточной гибели, а также, в некоторых случаях, могут стимулировать
их пролиферацию. Между тем в высоких концентрациях
цитокины повреждают гепатоциты [24]. Таким образом,
активированные КК выполняют функцию модулирования резистентности гепатоцитов, оказывая на последние
как повреждающее, так и протективное действие. Механизмы протективного влияния активированных КК
в отношении гепатоцитов малоизучены. Высказывалось
предположение о том, что оно вызывается в результате усиления медиаторами генерирования в гепатоцитах
АФК и АФА [25]. Протективный эффект приписывали
и простагландину Е, выделяемому активированными КК [26]. Также была высказана гипотеза, что низкие концентрации цитокинов, высвобождаемых из КК,
обладают способностью вызывать образование особого
«сигнала выживания» в гепатоцитах. Еще была выдвинута
гипотеза, согласно которой протективное действие активированных КК на гепатоциты реализуется посредством
активации ими механизма тканевого стресса в паренхиме
печени [27].
Важной особенностью активированных КК является
паракринный характер действия выделяемых ими
медиаторов на гепатоциты. Паракринное действие
доказано для цитокинов [28, 29], эйкозаноидов
(тромбоксана) [22], простагландина Е2 [30] и лейкотриенов, а также для АФА [12, 31]. Паракринное влияние
на гепатоциты оказывает и ТФР1 [10]. Паракринность
действия активированных КК объясняют коротким периодом жизни молекул-медиаторов, выделяемых этими
клетками [3, 5].
Регуляторное влияние активированных
клеток Купфера на гепатоциты в аспекте
межклеточных взаимодействий
Действие активированных КК на гепатоциты
отличается разнообразием и в аспекте инициируемых
этими фиксированными макрофагами межклеточных
взаимодействий. В настоящее время может быть
рассмотрено по меньшей мере 4 типа таких регуляторных
механизмов.
Как известно, медиаторы КК обладают способностью
непосредственно влиять на гепатоциты (первый тип
взаимодействия). Эти воздействия носят паракринный
характер. Однако помимо прямой паракринной
регуляторной связи по схеме КК–гепатоцит регуляторное
воздействие КК может быть опосредовано другими
клетками стромы. Наиболее изученной в настоящее время
является регуляция по схеме КК–звездчатая клетка–
гепатоцит (второй тип взимодействия).
Показано, что выделяемые КК лейкотриены и другие
эйкозаноиды, цитокины, протеиназы и АФА стимулируют сократительную способность звездчатых клеток по
паракринному механизму [21]. В результате происходит
сужение просвета синусоида и уменьшение внутрисинусоидального объема. При этом возникает нарушение
гемодинамики, что сказывается на жизнеспособности
гепатоцитов [21]. Можно предположить, что рассматриваемые внутриорганные межтканевые взаимодействия
имеют еще одно существенное последствие. Ввиду уменьшения внутрисинусоидального объема под влиянием стимулирования сократительной функции звездчатых клеток
следует ожидать локального повышения в синусоидах
концентраций других медиаторов, выделяемых КК. Таким образом, можно полагать, что при прочих равных
условиях уменьшение просвета синусоидов под влиянием вазоконстрикторов будет способствовать повышению
эффективности всех иных регуляторных воздействий КК
на гепатоциты.
Третий тип инициируемых КК регуляторных межклеточных взаимодействий формируется этими фиксированными макрофагами как под действием эндотоксина
[32], так и в результате механических манипуляций с
упомянутым органом [33]. В этом случае межклеточные
взаимодействия протекают по схеме КК–гепатоцит–гепатоцит и осуществляются в результате инициации у гепатоцитов гиперметаболического состояния паракринно
действующими на них медиаторами КК. Установлено,
что метаболическое состояние возникает в гепатоцитах
под действием таких медиаторов, как цитокины [34]
51
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
52
и эйкозаноиды [32]. Как известно, одним из основных
признаков гиперметаболизма в печени является усиленное потребление гепатоцитами кислорода [33, 35]. Между
тем на модели перфузируемой печени было показано,
что гиперметаболическое состояние формируется лишь
у некоторой части гепатоцитов, в то время как остальные
клетки паренхимы испытывают гипоксию [35]. Отсюда
следует, что в рассматриваемых условиях активированные
КК инициируют гепатоцит-гепатоцитарные взаимодействия на принципе конкурирования этих клеток за кислород в межклеточном пространстве. Очевидно, что в конкурирование за кислород могут быть вовлечены не только
гепатоциты, но и клетки стромы печени. Таким образом,
инициированные активированными КК межклеточные
взаимодействия путем формирования гиперметаболического очага в паренхиме носят неспецифический характер. Как видно из вышеизложенного, регуляторное
влияние активированных КК может распространяться
в паренхиме печени вне зоны паракринного действия
их медиаторов и без участия вазоконстрикторов.
Четвертый тип инициируемых активированными
КК межклеточных взаимодействий, так же как и третий, осуществляется по схеме КК–гепатоцит–гепатоцит.
Однако он принципиально отличается от третьего типа
тем, что «инструментом» гепатоцит-гепатоцитарных взаимодействий здесь является тканеспецифический эффектор комутон, избирательно действующий на митохондрии
гепатоцитов. Было обнаружено, что этот эффектор накапливается в печени под влиянием введенного эндотоксина (продигиозана). Показано, что комутон является
регулятором метаболизма ионов Са2+ в митохондриях
печени [36, 37]. На участие активированных КК в этом
процессе указывает тот факт, что предварительное ингибирование фагоцитарной функции КК предотвращало
накопление продигиозан-зависимого комутона (ПЗК)
в цитозоле клеток печени [38]. ПЗК был выделен из
печени и охарактеризован как низкомолекулярное соединение, в состав которого входят производное аденина,
галактоза, серосодержащая аминокислота и один неидентифицированный компонент [39].
В результате исследований метаболизма ПЗК было
выделено 2 ферментативных процесса: окисление этого
регулятора с выделением гидроперекиси [37] и образование ПЗК из предшественника (прокомутона) при
участии комутон-продуцирующего фермента (КПФ) [40].
Эти ферменты были охарактеризованы как белки с молекулярной массой 72 и 42 кДа, соответственно [41, 42].
Показано, что введение животному эндотоксина вызывает активацию КПФ, но не влияет при этом на накопление
прокомутона в клеточном ядре [40]. Высокоочищенный
ПЗК в среде инкубации с ионами Са2+ стимулирует высокоамплитудное набухание митохондрий печени и их
АТФазную активность, а также вызывает уменьшение
их Са2+-емкости и времени удержания ионов Са2+ в матриксе [36]. Приведенные результаты свидетельствуют
о деэнергизующем действии ПЗК на митохондрии.
Было показано, что ПЗК стимулирует выход ионов Са2+
из матрикса митохондрий печени, предварительно нагруженных этими ионами, в наружное пространство как
по механизму мегапоры [43], так и посредством Са2+/Н+обмена («медленный» выход Са2+) [44].
Присутствие ПЗК в цитозоле гомогената печени не
позволяет однозначно судить о его тканевой принадлежности. Однако в настоящее время имеются многочисленные данные, свидетельствующие о гепатоцитарном
происхождении ПЗК. Исследование внутриклеточного
компартмента отдельных компонентов системы продиги-
озан-зависимой регуляции митохондриальных процессов
в печени показало, что все они принадлежат гепатоцитам.
Было установлено, что прокомутон избирательно локализован во фракции высокоочищенных ядер печени [38],
которая содержит всего 4% примесей ядер КК и других
непаренхиматозных клеток (по объему ядер) [45]. Известно, что 98,8% митохондрий, выделенных из гомогената
печени, представлены митохондриями гепатоцитов [46].
Таким образом, ПЗК оказывает деэнергизующее действие
именно на митохондрии печени, а не на митохондрии
клеток стромы печени [36, 43, 44]. На том же основании можно полагать, что гепатоцитарное происхождение имеет и комутон-продуцирующий фермент [40],
т.к. его основная активность локализована в митохондриальной фракции [38]. Было также установлено, что окисляющий ПЗК фермент — комутондиоксигеназа — прочно
связан с мембраной пероксисом [38]. Между тем известно, что 100% пероксисом в печени имеют отношение
к гепатоцитам [46]. Следует отметить, что представления
о гепатоцитарной локализации продигиозан-зависимой
регуляции митохондриальных процессов согласуются
с результатами измерения динамики активности комутона в печени крысы после частичной гепатэктомии.
Оказалось, что упомянутая активность коррелирует с прохождением гепатоцитами отдельных фаз митотического
цикла [43, 47]. Кроме того, было обнаружено, что ПЗК
накапливается в цитозоле из печени крысы не только под
действием эндотоксина, но и в результате повышения
нагрузки на детоксикационную функцию гепатоцитов,
а также в ответ на такие метаболические нагрузки, как
интрагастральная инфузия глюкозы или растительного
масла [48]. С учетом совокупности приведенных выше
данных, продуцирование ПЗК в КК или каких-либо иных
клетках стромы печени представляется маловероятным,
т.к. все они указывают на гепатоциты как источник комутона в печени.
Рассмотренные выше деэнергизующие эффекты
ПЗК наблюдали в митохондриях печени, но они не
были зафиксированы в митохондриях почек крыс, что
указывало на тканевую специфичность его действия
[36, 43, 44]. Установлено, что тканеспецифический эффект стимуляции медленного выхода ионов Са2+ из матрикса митохондрий печени, вызываемый ПЗК из печени крысы,
не обладает видовой специфичностью [44]. Между тем общеизвестно, что тканевая специфичность при отсутствии
видовой специфичности действия является маркерным
свойством эффекторов внутритканевых регуляций [49].
На основании приведенных данных можно сделать заключение о том, что КК обладают функцией активации
внутритканевого регулирования митохондриальных процессов в гепатоцитах [44].
Весьма важным представляется тот факт, что деэнергизующее действие ПЗК реализуется только в предварительно нагруженных ионами Са2+ митохондриях печени
[43, 44]. Интактные гепатоциты отличаются низким содержанием этих ионов в матриксе митохондрий [50].
Ионы Са2+ накапливаются в митохондриях в результате
повреждения клеток [51, 52], а также после активации
интактных гепатоцитов физиологическими стимулами,
т.е. в условиях их высокой функциональной активности
[53]. В связи с этим можно заключить, что ПЗК обладает
не только тканевой, но и популяционной специфичностью действия в отношении поврежденных или интенсивно функционирующих гепатоцитов. Установлено, что
ПЗК является гепатопротектором [54]. Это его свойство,
наряду с тканевой специфичностью действия и неспецифичностью активации механизма накопления в печени
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ФИЗИОЛОГИИ
[48], позволяет рассматривать ПЗК в качестве эффектора неспецифической адаптационной реакции тканевого
уровня — тканевого стресса [55].
Механизмы распространения регуляторных влияний
активированных клеток Купфера в паренхиме печени
При участии КК паракринно действующие медиаторы
оказывают регуляторное воздействие лишь на непосредственно прилегающие к ним клетки [1, 3, 5, 6]. С учетом
того обстоятельства, что средний размер гепатоцита составляет 10–30 мкм [56], можно полагать, что в рассматриваемом случае паракринное влияние активированных
КК на гепатоциты ограничивается таким расстоянием
от их поверхности.
Между тем при опосредованном действии звездчатых клеток активированные КК могут распространять
свое регуляторное влияние и на более удаленные участки паренхимы печени. Расширение зоны регуляторного
действия КК на гепатоциты происходит при участии медиаторов, обладающих вазоконстрикторным действием.
К ним относятся тромбоксан, лейкотриены, простаноиды и АФА, стимулирующие сократительную функцию
звездчатых клеток [31]. На высокую эффективность вазоконстрикторных регуляций указывает 7-кратное повышение давления в системе воротной вены, определяемое
в перфузируемой печени, под действием бактериального
β-глюкана, что сопровождается 40-кратным повышением выработки тромбоксана A2 [57]. Как уже отмечалось
выше, выбрасываемые активированными КК вазоконстрикторы вызывают локальное уменьшение просвета
синусоидов [22]. Очевидно, что это приведет к нарушению микроциркуляции в объеме паренхимы печени, питаемом дистальным участком капилляра. Средняя длина синусоида составляет 250 мкм [58]. Таким образом,
в зависимости от места формирования в нем локального
спазма регуляторное влияние КК может распространяться на расстояние от 125 до 250 мкм, т.е. охватывать объем
паренхимы, в несколько раз превышающий таковой при
прямом паракринном воздействии медиаторов на гепатоциты. Наиболее значительным последствием влияния
вазоконстрикторов на просвет синусоидов является формирование гипоксического очага в паренхиме печени.
В некоторых случаях, как, к примеру, при эндотоксинемии, возникающий диффузный спазм синусоидов рассматривают в качестве основной причины повреждения
и даже гибели гепатоцитов [2, 22].
Не приходится сомневаться в том, что внутриорганные межклеточные взаимодействия, формируемые в печени по схеме КК–гепатоцит–гепатоцит и построенные
на принципе конкурирования гепатоцитов за кислород,
также выходят за пределы зоны непосредственного действия паракринных механизмов активированных КК.
Однако в настоящее время отсутствуют данные, позволяющие количественно оценить объем паренхимы, вовлекаемый под действием КК в гиперметаболический процесс, равно как и число клеток, испытывающих при этом
гипоксию. Не исключено, что в рассматриваемом случае
объем паренхимы, затронутый регуляторным воздействием КК, может превышать таковой в ситуации, когда КК
влияют на гепатоциты при участии звездчатых клеток.
Еще сложнее провести количественную оценку объема паренхимы, на который могут оказывать влияние
активированные эндотоксином КК при участии внутритканевого механизма гепатоцит-гепатоцитарных взаимодействий. Показано, что при интраперитонеальном
введении уже через 20 мин ПЗК проявляет гепатопротекторное действие [54, 55]. Это означает, что он способен быстро распространяться с кровотоком и проникать
внутрь гепатоцитов. С учетом этого обстоятельства можно
предположить, что, накапливаясь в гепатоцитах в результате непосредственного паракринного воздействия КК на
эти клетки, ПЗК может проникать из продуцирующих его
гепатоцитов во внеклеточное пространство, а из него —
в другие гепатоциты. При этом данный эффектор избирательно распространяет регуляторное влияние КК
в паренхиме лишь в отношении поврежденных гепатоцитов или же гепатоцитов с высокой функциональной
активностью. Таким образом, можно полагать, что активированные КК обладают также способностью влиять
на удаленные от них участки паренхимы печени за счет
активируемого ими в паренхиме печени механизма тканевого стресса [55], регулирующего метаболизм ионов Са2+
в митохондриях [44].
Заключение
Приведенные в статье данные свидетельствуют о том,
что механизмы регуляторных воздействий КК на гепатоциты отличаются исключительным разнообразием.
Это обеспечивает эффективность и многовариантность
регуляторного вклада КК в воспалительный процесс, разворачивающийся в печени. Активированные КК стимулируют продукцию глюкозы гепатоцитами [13–15] и тем
самым мобилизуют энергетические резервы гепатоцитов, необходимые для борьбы с бактериальной инвазией.
В то же время они могут повреждать гепатоциты и даже
вызывать их гибель, или же, напротив, защищают эти
клетки от повреждения при участии выделяемых ими
медиаторов [25–27, 54] и даже стимулируют их пролиферацию [17, 18]. Как следствие, возникают условия для
селекции гепатоцитов по критерию неспецифической резистентности, т.к. можно допустить, что активированные
КК способствуют гибели наиболее поврежденных клеток
и стимулируют пролиферацию неповрежденных. Между
тем участие нескольких медиаторов КК в регулировании
одной и той же функции гепатоцитов способствует повышению надежности регуляторного воздействия.
Как было показано в настоящей работе, несмотря
на паракринный механизм действия на клетки-мишени
медиаторов, выделяемых активированными КК, имеются
регуляторные возможности для распространения их влияния и на более удаленные участки паренхимы печени.
Локальные (паракринные) медиаторные эффекты активированных КК — уменьшение просвета синусоидов вазоконстрикторами или стимуляция поглощения кислорода у близлежащих гепатоцитов путем формирования у них
гиперметаболического состояния — могут способствовать
возникновению гипоксических или даже ишемических
очагов в паренхиме печени. Как уже отмечалось, в первом
случае это является результатом нарушения микроциркуляции крови в синусоидах [22], во втором — следствием
конкурирования гепатоцитов за кислород в межклеточном пространстве. При этом активация под действием
КК внутритканевых гепатоцит-гепатоцитарных взаимодействий выполняет адаптационную функцию, защищая
клетки от неблагоприятных внешних воздействий.
На основании приведенных данных, представление
о паракринном действии активированных КК на гепатоциты может быть дополнено таковым о «дистантном»
регуляторном влиянии этих макрофагов на паренхиму
печени. Необходимо отметить, что это влияние ини-
53
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
54
циируется все теми же паракринными механизмами.
К «дистантным» могут быть отнесены все рассмотренные
нами механизмы, позволяющие распространять регуляторное влияние активированных КК вне зоны действия
паракринных механизмов с участием различных типов
межклеточных взаимодействий.
С учетом этих представлений можно предпринять попытку рассмотрения принципов пространственной организации регуляторных влияний активированных КК
в печени. Следует упомянуть, что эти макрофаги распределены в печени неравномерно, в основном они локализуются
в синусоидах перипортальной области [3]. Поэтому все нижесказанное будет относиться в первую очередь к этой области паренхимы печени. Активированные КК могут формировать в ней, по крайней мере, 2 зоны своего регуляторного
влияния. Одна из них состоит из гепатоцитов, находящихся
в непосредственной близости от КК под влиянием паракринных медиаторных механизмов. В паракринной зоне
регуляторные воздействия КК на гепатоциты могут быть
как непосредственными, так и опосредованными звездчатыми клетками, т.е. сформированными при участии внутриорганных межклеточных взаимодействий. Результатом
таких регуляторных воздействий являются локальные эффекты активированных КК: усиленная продукция гепатоцитами глюкозы [13–15], стимулирование их пролиферации
[17, 18], угнетение апоптоза [17, 19, 20]. В этой же зоне медиаторы КК могут также оказывать на гепатоциты паракринное протекторное или повреждающее действие.
Зона «дистантного» действия окружает зону паракринного действия медиаторов КК и превышает по объему зону паракринного действия. Как уже отмечалось, основным «инструментoм» воздействия КК на гепатоциты
здесь является гипоксия, вызванная локальным сужением
просвета синусоидов под влиянием вазоконстрикторов
или же возникшая в результате гиперметаболизма гепатоцитов в паракринной зоне. К подобным «инструментам»
относится и ПЗК — специализированный эффектор внутритканевых гепатоцит-гепатоцитарных взаимодействий,
регулирующий метаболизм ионов Са2+ в митохондриях
этих клеток.
Представляется наиболее вероятным, что в зоне «дистантного» действия регуляторное влияние активированных КК ограничивается защитными или повреждающими
эффектами. «Дистантные» регуляторные механизмы, реализуемые активированными КК на основе паракринных
регуляций, могут выполнять функцию модулирования неспецифической устойчивости гепатоцитов. Было показано
непосредственное адаптационное действие ПЗК на гепатоциты [54]. Что касается вазоконстрикторного эффекта
медиаторов КК, нарушающего газообмен паренхимы, равно
как и гепатоцит-гепатоцитарных взаимодействий, основанных на принципе конкурирования за кислород, то резистентность клеток печени может модулироваться путем
формирования клеточной гипоксии. Известно, что гипоксия не только вызывает повреждение гепатоцитов [59, 60],
но и способна оказывать на них протективное действие [61].
ЛИТЕРАТУРА
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Decker К. Biologically active products of stimulated liver macrophages
(Kupffer cells). Eur. J. Biochem. 1990; 192: 245–261.
Маянский Д.Н. Хроническое воспаление. М.: Медицина.
1991. 272 с.
Kmiec Z. Cooperation of liver cells in health and disease. Adv. Anat.
Embryol. Cell Biol. 2001; 161: III–XIII.
He Q., Kim J., Sharma R.P. Fumonisin B1 hepatotoxicity in mice
is attenuated by depletion of Kupffer cells by gadolinium chloride.
Toxicology. 2005; 207 (1): 137–147.
Кетлинский С.А, Симбирцев А.С, Воробьев А.А. Эндогенные
иммуномодуляторы. С.-Пб.: Медицина. 1992. 187 с.
Фрейдлин И.С. Паракринные и аутокринные механизмы цитокиновой иммунорегуляции. Иммунология. 2001; 5: 4–7.
Meltzer M.S. Macrophage activation for tumor cytotoxicity: characterization of priming and trigger signals during lymphokine activation.
J. Immunol. 1981; 127 (1): 179–183.
Wardle E.N. Kupffer cells and their functions. Liver. 1987; 7 (2):
63–75.
Кетлинский С.А., Симбирцев А.С. Цитокины. С.-Пб.: Фолиант.
2008. 550 с.
Tsukamoto H., Matsuoka M. Release of active TGFβ1 from Kupffer
cells isolated from rats with alcoholic liver fibrosis: a possible paracrine
mechanism of liver fibrogenesis. Cytokine. 1989; 1 (1): 134–134.
Dieter P., Schulze-Specking A., Decker K. Release of lysosomal
enzymes is not correlated with superoxide and prostaglandin production by stimulated rat Kupffer cells in primary culture. J. Hepatology.
1988; 6 (Isse 2): 167–174.
Harbrecht B.G., Billiar T.R. The role of nitric oxide in Kupffer cellhepatocyte interactions. Shock. 1995; 3: 79–87.
McCallum R.E. Hepatocyte-Kupffer cell interactions in the inhibition
of hepatic gluconeogenesis by bacterial endotoxin. Progr. Clin. Biol.
Res.1981; 62: 99–113.
Kuiper J., Zijlstra F.J., Kamps J.A.A.M., Van Berkel Th.J.C. Biochem.
Biophys. Acta. 1988; 959: 143–152.
Ouwendijk R.J.Th., Zijlstra F.J., Broek A.M.W.C. van den,
Brower А., Wilson J.H.P., Vincent J.E. Comparison of the produc-
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
tion of eicosanoids by human and rat peritoneal macrophages and rat
Kupffer cells. Prostaglandins. 1988; 35 (3): 437–446.
Iwai M., Jungermann K. Leukotrienes increase glucose and lactate
output and decrease flow in perfused rat liver. Biochem. Biophys. Res.
Commun. 1988; 151 (1): 283–290.
Rolfe M., James N.H., Roberts R.A. Tumour necrosis factor alpha
(TNF alpha) suppresses apoptosis and induces DNA synthesis
in rodent hepatocytes: a mediator of the hepatocarcinogenicity of peroxisome proliferators. Carcinogenesis. 1997; 18 (11): 2277–2280.
Nazia S., Selzner M., Odermatt B. Tian Y., v. Rooijen N.,
Clavien P.–A. ICAM-1 triggers liver regeneration through leukocyte recruitment and Kupffer cell-dependent release of TNF-α/IL-6
in mice. Gastroenterology. 2003; 124 (3): 692–700.
Holden P.R., Hasmall S.C., James N.H., West D.R., Brindle R.D.,
Gonzalez F.J., Peters J.M., Roberts R.A. Tumour necrosis factor alpha
(TNFalpha): role in suppression of apoptosis by the peroxisome proliferator nafenopin. Cell. Mol. Biol. 2000; 46 (1): 29–39.
Makogon N.V., Korneitchuk A.N., Lushnikova I.V., Alexeyeva I.N.
Effects of exogenous leukotrienes B4 and C4 on the viability of cultured
rat hepatocytes. Acta Physiol. Pharmacol. Bulg. 2000; 25 (3–4): 87–91.
Maher J.J. Interactions between hepatic stellate cells and the immune
system. Semin. Liver Dis. 2001; 21 (3): 417–426.
Yokoyama Y., Nimura Y., Nagino M., Bland K.I., Chaudry I.H. Role
of thromboxane in producing hepatic injury during hepatic stress. Arch.
Surg. 2005; 140 (8): 801–807.
Hoek J. B., Pastorino J. G. Ethanol, oxidative stress, and cytokineinduced liver cell injury. Alcohol. 2002; 27 (1): 63–68.
Roberts R.A., Ganey P.E., Ju C., Kamendulis L.M., Rusyn I.,
Klaunig J. E. Role of the Kupffer cell in mediating hepatic toxicity and
carcinogenesis. Toxicol. Sci. 2007; 96 (1): 2–15.
Winwood P.J., Arthur M.J. Kupffer cells: their activation and role in
animal models of liver injury and human liver disease. Semin. Liver Dis.
1993; 13 (1): 50–59.
Кутина С.И., Зубахин АА. Резистентность печени к повреждению ССI4 при стимуляции макрофагов препаратам и разных
классов. Бюлл. эксперим. биол. мед. 2001; 6: 620–622.
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
АКТУАЛЬНЫЕ ВОПРОСЫ ФИЗИОЛОГИИ
27. Элбакидзе Г.М. Механизмы протекторного действия активированных эндотоксином клеток Купфера на гепатоциты. Вестн.
РАМН. 2012; 6: в печати.
28. Billiar T.R., Curran R.D., Williams D.L., Kispert P.H. Liver nonparenhimal cells are stimulated to provide interleukin-6 for production
of acute phase response in endotoxemia but not in remote localized
inflammation. Arch. Surg. 1992; 127: 31–37.
29. Kmiec Z., Hughes R. D., Moore K.P. Sheron N., Gove D., NouriAria T., Williams R. Effect of supernatants from Kupffer cells stimulated
with galactosamine and endotoxin on the function of isolated rat hepatocytes. Hepatogastroenterology. 1993; 40: 259–261.
30. Callery M.P., Mangino, M.J., Flye M.W. Kupffer cell prostaglandin-E2
production is amplified during hepatic regeneration. Hepatology. 1991;
14 (2): 368–372.
31. Fennekohl A., Schieferdecker H.L., Jungermann K., Puschel G.P.
Differential expression of prostanoid receptors in hepatocytes, Kupffer
cells, sinusoidal endothelial cells and stellate cells of rat liver. J. Hepatol.
1999; 30 (1): 38–47.
32. Rivera C.A., Bradford B.U., Seabra V., Thurman R.G. Role of
endotoxin in the hypermetabolic state after acute ethanol exposure.
Am. J. Physiol. 1998; 275 (6): 1252–1258.
33. Schemmer P., Enomoto N., Bradford B.U., Bunzendahl H.,
Raleigh J.A., Lemasters J.J., Thurman R.G. Activated Kupffer cells
cause a hypermetabolic state after gentle in situ manipulation of liver in
rats. Am. J. Physiol. Gastrointest. Liver Physiol. 2001; 280 (6): 1076–1082.
34. New K.J., Eaton S., Elliott K.R.F., Spitz L., Quant P.A. Effect of
lipopolysaccharide and cytokines on oxidative metabolism in neonatal
rat hepatocytes. J. Pediatr. Surg. 2001; 36: 338–340.
35. Dahn M.S., Lange M.P., Berberoglu E.D. Functional characteristics of
the hypermetabolic isolated perfused liver. Shock. 1996; 6 (1): 52–56.
36. Элбакидзе Г.М., Челидзе М.А., Элбакидзе И.М. Тканеспецифическая регуляция транспорта ионов кальция термостабильным комутоном из печени крысы. Докл. АН СССР. 1990; 313 (2): 474–478.
37. Elbakidze G.M., Chelidze M.A., Elbakidze I.M. The tissuespecific control of calcium ion metabolism in rat liver mitocondria by liver
comuton. IEBEC Short Reports. 1994; 8: 85–85.
38. Элбакидзе Г.М., Меденцев А.Г., Элбакидзе А.Г., Шарышев А.А.
Исследование внутриклеточной организации комутонной регуляции митохондриальных процессов в печени крысы. Докл. АН.
2006; 408 (5): 704–707.
39. Каграманов Н.Д., Катруха Г.С., Кутин А.А., Локшин Б.В.,
Лысянская В.Я., Марченков В.В, Муранова Т.А., Элбакидзе Г.М.,
Федотчева Н.И., Лазарева А.В., Меденцев А.Г., Элбакидзе А.Г.,
Колотыгина И.М. Изучение химического состава комутона
из печени крысы. В кн.: Митохондрии в патологии. Мат-лы Всеросс. Раб. совещания. Пущино. 2001. С. 252–254.
40. Элбакидзе Г.М., Меденцев А.Г. Исследование условий аккумуляции in vitro термостабильного комутона из печени крысы. Докл.
АН. 2002; 387 (4): 553–556.
41. Бровко Ф.А., Элбакидзе Г.М., Бохуа Б.Т. Фракционирование комутондиоксигеназы из печени крысы. Докл. АН. 1994;
338 (3): 401–403.
42. Моргунов И.Г., Элбакидзе Г.М., Меденцев А.Г. Выделение
и очистка комутон-продуцирующего фермента из печени крысы.
Докл. АН. 2003; 289 (2): 67–70.
43. Элбакидзе Г.М., Фойгель А.Г., Маевский Е.И., Бохуа Б.Т.,
Челидзе М.А., Элбакидзе И.М., Гордезиани М.Ш. Исследование
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
тканеспецифической Са2+-зависимой регуляции митохондриальных процессов термостабильным комутоном из печени крысы. Докл. АН. 1992; 324 (1): 214–219.
Элбакидзе Г.М., Элбакидзе А.Г., Меденцев А.Г Исследование
влияния продигиозан-зависимого комутона на медленный выход
ионов кальция из матрикса митохондрий различной тканевой
и видовой принадлежности. Докл. АН. 2011; 437 (6): 842–845.
Maggio R., Siekevitz P., Palade G.E. Studies on isolated nuclei. I. isolation and chemical characterization of a nuclear fraction from guinea
pig liver. J. Cell Biol. 1963; 18: 267–291.
Wisse E., Knook D. The investigation of sinusoidal cells: A new
approach to the study of liver function. In: Progress in liver diseases.
H. Popper (ed.). N.-Y.: Raven Рress. 1979. P. 151–176.
Элбакидзе Г.М., Духин А.И., Челидзе М.А. Внутритканевой контроль энергетического метаболизма печени крысы в условиях
голодания в ранние сроки после частичной гепатэктомии. Изв.
АН СССР. Сер. биол. 1984; 4: 529–534.
Элбакидзе Г.М., Элбакидзе И.М. Активация внутритканевого
контроля энергeтического метаболизма в печени при повышении нагрузки на специальные функции и ее повреждение
гепатотоксином. Докл. АН СССР. 1986; 291 (3): 719–723.
Балаж А., Блажек И. Эндогенные ингибиторы клеточной пролиферации. М.: Мир. 1982. 302 с.
Bond M., Vadasz G., Somlyo A.V., Somlyo A.P. Subcellular calcium
and magnesium mobilization in rat liver stimulated in vivo with vasopressin and glucagon. J. Biol. Chem. 1987; 262 (32): 15630–15636.
Farber J.L. The role of calcium in lethal cell injury. Chem. Res. Toxicol.
1990; 3: 503–508.
Orrenius S., McCabe M.J., Nicotera P. Ca2+-dependent mechanisms of cytotoxicity and programmed cell death. Toxicol. Lett. 1992;
64: 357–364.
Poggioli J., Berthon B., Claret M. Calcium movements in in situ mitochondria following activation of alpha-adrenergic receptors in rat liver
cells. FEBS Lett. 1980; 115 (2): 243–246.
Elbakidze G.M., Elbakidze A.G. Tissue stress - the tissuespecific intratissue adaptation mechanism. VIII World Congr. of Int. Soc. for Adapt.
Med., Abstract book. Moscow. 2006. Р. 135–136.
Elbakidze G.M., Elbakidze A.G. Principles of Tissue Growth Intratissue Regulation. Collierville: InstantPublisher. 2009. 163 p.
Kuntz E., Kuntz H.-D. Hepatology. Principles and Practice: History, Morphology, Biochemistry, Diagnostics, Clinic, Therapy. 2th ed.
Springer. 2005. 906 p.
Steib J., Gerbes L., Bystron M. et al. Kupffer cell activation in normal and fibrotic livers increases portal pressure via thromboxane A2.
J. Hepatol. 2007; 47 (2): 228–238.
Vollmar B., Menger M.D. The Hepatic Microcirculation: Mechanistic
Contributions and Therapeutic Targets in. Liver Injury and Repair.
Physiol. Rev. 2009; 89 (4): 1269–1339.
Lemasters J.J., Ji S., Thurman R.G. Centrilobular injury following hypoxia in isolated, perfused rat liver. Science. 1981; 213 (4508):
661–663.
Israel Y., Orrego H. Hypermetabolic state and hypoxic liver damage.
Recent Dev. Alcohol. 1984; 2: 119–133.
Лукьянова Л.Д., Кирова Ю.И. Влияние гипоксического
прекондиционирования на свободно-радикальные процессы
в тканях крыс с различной толерантностью к гипоксии. Бюлл.
эксперим. биол. мед. 2011; 151 (3): 263–268.
КОНТАКТНАЯ ИНФОРМАЦИЯ
Элбакидзе Георгий Михайлович, д.б.н., академик РАЕН, директор Медико-биологического центра Ассоциации
содействия международному центру научной культуры — «Всемирная лаборатория»
Адрес: 125057, Москва, Ленинградский пр-т, д. 71-128; тел.: (499) 198-72-28; е-mail: gmelbakidze@hotmail.com
Меденцев Александр Григорьевич, д.б.н., заведующий лабораторией адаптации микроорганизмов Института биохимии
и физиологии микроорганизмов им. Г.К. Скрябина РАН
Адрес: 142290, Московская область, г. Пущино, пр-т Науки, д. 5; тел.: (495) 956-33-70; е-mail: medentsev-ag@rambler.ru
55
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
НАУЧНЫЕ СООБЩЕНИЯ
В.К. Ильин1, А.Н. Суворов2, Н.В. Кирюхина1, Н.А. Усанова1, Л.В. Старкова1, В.В. Бояринцев3,
А.Б. Карасева2
1 Государственный
научный центр Российской Федерации — Институт медико-биологических проблем РАН, Москва,
Российская Федерация
2 Научно-исследовательский институт экспериментальной медицины, Санкт-Петербург, Российская Федерация
3 Клиническая больница № 1 (Волынская) управления делами Президента РФ, Москва, Российская Федерация
Аутопробиотики как средство профилактики
инфекционно-воспалительных заболеваний
у человека в искусственной среде обитания
56
Изучались дисбиотические сдвиги микрофлоры кишечника и глотки у 22 здоровых добровольцев в 9-, 14-, 105- и 520-суточных экспериментах в герметично замкнутом объекте, моделирующих воздействие факторов космического полета. Для предотвращения дисбактериоза
кишечника и глотки были использованы 2 препарата: пероральный препарат, созданный на основе аутоштаммов кишечных энтерококков,
и местный препарат на основе аутоштаммов кишечных лактобацилл, иммобилизованный на коллагене. Местный препарат аутоштаммов
лактобацилл предотвращал рост условно-патогенной микрофоры глотки в течение эксперимента. Пероральный препарат аутоштаммов
энтерококков способствовал снижению содержания условно-патогенной микрофлоры в течение эксперимента, одновременно поддерживая
высокий уровень защитной микрофлоры кишечника. Генетические исследования показали, что большинство аутоштаммов свободно от
генов, кодирующих факторы патогенности. Тем не менее, наличие небольшого числа штаммов, имеющих эти гены, доказывает целесообразность проведения предварительных генетических тестов.
Ключевые слова: аутоштаммы, аутопробиотики, дисбактериоз, измененные условия обитания, имитация факторов космического полета,
нарушение колонизационной резистентности.
Введение
В настоящее время не вызывает сомнений необходимость исследований состояния естественных барьеров
колонизации человека для выработки стратегии экологического подхода к проблемам профилактики инфекций, возникающих в экстремальных условиях обитания. Экологическая система человек–микроорганизмы
весьма сложна, и взаимоотношения в ней определяются
многочисленными факторами. От понимания процессов
регулирования взаимоотношений в этой системе в главной степени зависит стратегия выбора средств, которые
направлены на коррекцию нарушений барьеров колонизационной резистентности, формируемой организмом
человека на пути возбудителя инфекции.
В современных условиях резко возросло число стрессовых воздействий и неблагоприятных экологических
факторов, сопровождающихся глубокими нарушениями
микробной экологии организма хозяина [1, 2]. Следствие этих влияний — формирование различного вида
V.K. Il’in1, A.N. Suvorov2, N.V. Kiryukhina1, N.A. Usanova1, L.V. Starkova1, V.V. Boyarintsev3, A.B. Karaseva2
1 State
scientific center of Russian Federation — Institute of Biomedical Problems of RAS, Moscow,
Russian Federation
2 Institute
of Experimental Medicine of the North-West Branch of the Russian Academy of Medical Sciences,
St. Petersburg, Russian Federation
3 Clinical Hospital № 1 (Volynskaya), Moscow, Russian Federation
Autochthonous probiotics in prevention of infectious and inflammatory
diseases of a human in the altered habitats
Dysbiotic shifts in intestinal and pharyngeal microflora were studied in 22 normal volunteers in 9-, 14-, 105- and 520-d chamber experiments
simulating some of the spaceflight factors. Two preparations were administered to prevent pharyngeal and intestinal dysbiosis: oral dry probiotic
based on indigenous intestinal Enterococci and topical collagen-immobilized Lactobacterin based on indigenous intestinal Lactobacilli. Topical
autoprobiotic lactobacterin reduced the growth of opportunistic pathogens in the throat during the experiments. Oral autoprobiotic based on
Enterococci reduced the content of intestinal opportunistic pathogens, supporting the high level of protecting microflora. Most of autostrains are free
from pathogenicity factors, nevertheless, implementation of genetic testing of indigenous strains are reasonable.
Key words: autostrains, autoprobiotics, altered habitat, imitation of space flight, disruption of colonization resistance.
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
НАУЧНЫЕ СООБЩЕНИЯ
дисбиозов и вторичных иммунодефицитных состояний,
при которых резко снижается резистентность организма
и к экзогенной инфекции, и к эндогенным ее очагам,
формирующимся на поверхности слизистых оболочек открытых полостей.
Для коррекции дисбактериозов повсеместно используют большой арсенал пробиотических препаратов, основанных на коллекционных штаммах микроорганизмов —
представителей защитных групп. Вместе с тем активность
этих пробиотических препаратов в первую очередь определяется приживляемостью микроорганизмов, находящихся в их составе, в организме хозяина.
Одним из направлений современной профилактики
и терапии дисбактериозов стало использование в качестве
пробиотиков аутологичных штаммов микроорганизмов —
представителей протективной микрофлоры (аутопробиотиков). Развитию данной концепции способствовали
предположения о том, что внедряемые в макроорганизм пробиотические микроорганизмы способны вызывать дисбаланс в аутомикрофлоре хозяина вследствие
антагонизма индигенных и промышленных штаммов [3].
Согласно мнению Б.А. Шендерова [4], еще в период
внутриутробного развития организм ребенка готовится
принять микрофлору матери в качестве «своей», или,
другими словами, у него формируется иммунологическая
толерантность к нормальной микрофлоре.
Очевидно также, что адгезивная способность промышленных и аутохтонных пробиотиков к клеткам
эпителия может различаться и зависит от соответствия
рецепторов данного конкретного штамма рецепторам
клеток. Так, установлено, что лактобациллы вагинального происхождения лучше прикрепляются к клеткам
вагинального эпителия по сравнению со штаммами, выделенными из других источников, например из пищевых
продуктов [5, 6].
В исследовании А.Г. Бойцова и соавт. [7] была оценена
адгезия препаратов лактобактерий к буккальному и вагинальному эпителию. Результаты подтверждают специфический характер адгезии лактобацилл. С практической
точки зрения, этим подтверждается необходимость индивидуального подбора пробиотиков при заместительной
терапии дисбиозов влагалища. В связи с данным фактом
исследователи настаивают на необходимости строго индивидуального выбора пробиотиков с предварительной
оценкой их адгезивных свойств.
Ряд авторов предлагает использование в качестве препаратов нормальных микробиоценозов человека [8, 9],
причем для бесконечно долгой сохранности биологического материала рекомендуется помещать его в жидкий
азот. Биоматериал, хранящийся в подобных криобанках,
в последующем может быть использован для конструирования простых и сложных по составу аутопробиотиков
и продуктов функционального питания [10].
Аутопробиотики на основе лактобацилл были успешно использованы для лечения бактериальных вагинозов [11]. Ван Ликуй было предложено корригировать
нарушения микробиоценоза с помощью аутоштаммов
лактобактерий, выделенных из влагалища пациенток,
причем местный препарат аутоштаммов лактобактерий
в виде суппозиториев назначался после проведения курса
местной антибактериальной терапии. Ввиду того, что во
влагалище непосредственно после антибиотикотерапии
и в достаточном количестве вводились успешно приживляющиеся собственные лактобактерии, риск рецидива
заболевания сводился к минимуму.
Исследование В.А. Мельникова, С.В. Стуловой,
О.В. Тюминой и соавт. [12] также было посвящено из-
учению аутотрансплантации вагинальных лактобацилл.
Авторы утверждают, что бактериальные препараты
на основе аллогенных лактобацилл, предназначенные для
восстановления микробиоценоза влагалища, не оправдали надежд в связи с их низкой колонизацией и быстрой
элиминацией из влагалищной среды. Наблюдаемый кратковременный бактериологический эффект при их применении, по мнению авторов, является ложноположительным. Суммируя результаты испытаний аллогенных
штаммов и аутоштаммов лактобацилл, авторы пришли
к заключению, что лактобациллы обладают генетической
гетерогенностью, обусловливающей определенную специфичность по отношению к хозяину.
Несмотря на то, что индигенные микроорганизмы
были с успехом использованы рядом исследователей для
коррекции как дисбиоза влагалища, так и дисбиоза кишечника [8–12], число исследований применения аутоштаммов в качестве индивидуального лечебно-профилактических средств невелико.
Представляется перспективным применение аутоштаммов не только в качестве терапевтического, но и профилактического средства. Увеличение адаптационных
возможностей и неспецифической резистентности организма крайне актуально у лиц экстремальных профессий, чья трудовая деятельность связана с условиями
многолетней сменной работы, пребыванием на высоте,
глубоководными спусками, физическими и эмоциональными перегрузками, высоким риском профессиональных
болезней. Очевидно, что периодическое пополнение дефицита микрофлоры с помощью собственных, предварительно выделенных микроорганизмов позволит избежать развития клинически значимых дисбиозов у данных
групп людей.
В целях коррекции дисбиотических состояний человека в ГНЦ РФ «Институт медико-биологических проблем»
РАН в течение последних 7 лет проводятся исследования активности пробиотических препаратов, созданных
на основе аутологичных штаммов лактобацилл, энтерококков и бифидобактерий в целях коррекции дисбиозов
кишечника и слизистых оболочек у лиц, находящихся
в измененных условиях обитания.
Применение пробиотиков на основе аутоштаммов
для коррекции микробиоценоза глотки испытуемых
в условиях 9-суточной изоляции
в герметично замкнутом объекте
Исследования в гермопомещениях имитируют пребывание операторов в условиях замкнутого пространства
космического корабля. Основные факторы, действующие на них во время эксперимента, — гипокинезия,
пребывание в герметично замкнутом объекте. Изучение
воздействия изоляции в герметично замкнутых объектах
представляет собой актуальную задачу, поскольку фактор
замкнутости наземных обитаемых помещений эксплуатируется многими службами и индустриями. Известно, что
в период 30-суточной изоляции нарастает общее количество микроорганизмов в глотке. Содержание Staphylococcus aureus с течением времени изоляции увеличивается
примерно вдвое, Staphylococcus epidermidis — уменьшается.
Также в период изоляции в глотке появляются грамотрицательные палочки в высоких концентрациях [2].
Была исследована эффективность пробиотических
препаратов, используемых в целях коррекции биоценоза
глотки, у 4 практически здоровых добровольцев в условиях 9-суточной изоляции в герметично замкнутом объекте.
57
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
Пациенты и методы исследования
у испытуемых контрольной группы исследовалась 2 раза:
на 1-е и 7-е сут.
Результаты и обсуждение
На всех этапах исследования у всех лиц опытной группы была выделена только симбиотическая микрофлора
(в основном Streptococcus viridans, в меньшей степени —
S. epidermidis). Условно-патогенная микрофлора, а также
микрофлора, не характерная для биотопа, в глотке испытуемых не определялась. Фарингоскопическая картина на всех
этапах обследования испытуемых соответствовала норме.
При статистической обработке статистически достоверных различий между данными, полученными на 1-е,
7-е и 14-е сут эксперимента, выявлено не было. Обобщенные данные представлены на рис. 1а. В ходе эксперимента
установлено статистически недостоверное повышение
обсемененности глотки симбионтами на 7-е сут эксперимента, не выходящее за пределы нормальных значений.
К 9-м сут обсемененность симбионтами снижалась, стремясь к уровню фоновых показателей.
Динамика микрофлоры испытуемых контрольной
группы отличалась большим разнообразием. У части испытуемых в фоновых данных были зафиксированы представители условно-патогенной микрофлоры в низком
титре. В основном выделялся S. aureus. На 7-е сут эксперимента содержание условно-патогенной микрофлоры
активно возрастало (рис. 1б).
При анализе динамики изменений симбиотической
микрофлоры (S. viridans, S. epidermidis) определялся незначительный рост обсемененности к 7-м сут эксперимента (см. рис. 1б).
Таким образом, можно отметить, что применение
местного пробиотического препарата, созданного на основе аутологичных штаммов лактобацилл, позволило эффективно скорректировать дисбиоз слизистой оболочки
глотки, формирующийся в неблагоприятных условиях
пребывания в герметично замкнутом объекте. Ни на одном из этапов обследований не были выделены предста-
7,0
6,0
6,5
5,5
6,0
5,0
5,5
4,5
5,0
4,5
LOG КОЕ/тампон
LOG КОЕ/тампон
58
Все четверо испытателей, практически здоровых мужчин, получали местный пробиотический препарат Лактобактерин, иммобилизованный на коллагене, созданный
на основе аутоштаммов лактобацилл, по 5 доз (пластин)
2 раза в сут после еды в течение первых 7 сут пребывания
в изоляции.
Препарат Лактобактерин, иммобилизованный на коллагене, был изготовлен совместно с Отделом коллагеновых
препаратов и изделий НИЦ Первого МГМУ им. И.М. Сеченова. Препарат представляет собой пластины коллагена
плавательных пузырей осетровых рыб и альгината натрия
с содержанием жизнеспособных лактобацилл не менее
107 КОЕ на 1 пластину. Взвесь бактериальных клеток
лактобацилл иммобилизовали на простерилизованном
γ-излучением коллагене путем совместной лиофилизации. Аутоштаммы лактобацилл были предварительно выделены из состава микрофлоры кишечника операторов
за 1 мес до эксперимента.
Препарат предназначен для аппликации на слизистую оболочку ротоглотки и является модификацией
стоматологического препарата Пародонтальная повязка
[13], предназначенного для профилактики и лечения
различных форм пародонтитов и гингивитов [14, 15].
После аппликации препарата на слизистую оболочку
ротоглотки пластины коллагена медленно резорбируются
(в течение 10–15 мин), при этом клетки лактобацилл высвобождаются и диффундируют в ротовую жидкость. Достаточно длительное воздействие препарата на слизистую
оболочку может способствовать адгезии пробиотических
микроорганизмов к эпителию и создавать предпосылки
для дальнейшей колонизации биотопа.
Микрофлору глотки у испытуемых исследовали трижды: на 1-е, 7-е и 9-е сут эксперимента.
В качестве контрольной группы были взяты результаты исследования обсемененности глотки 6 испытуемых,
находящихся в герметично замкнутом объекте в течение
14 сут без профилактических мер. Микрофлора глотки
4,0
3,5
3,0
2,5
3,5
3,0
2,5
2,0
2,0
1,5
1,5
1,0
1,0
0,5
0,5
0,0
4,0
Фон
+ 7 суток
0,0
+ 9 суток
Фон УПМ + 7 суток
Сроки отбора проб
Фон СМ + 7 суток СМ
Сроки отбора проб
Среднее
± Стандартная ошибка среднего
± Доверительный интервал стандартной ошибки
Рис. 1 (а). Динамика симбиотической микрофлоры у испытуемых
в 9-суточной изоляции (n =4; p >0,05).
Рис. 1 (б). Динамика условно-патогенной микрофлоры (УПМ)
и симбиотической микрофлоры (СМ) у испытуемых в 14-суточной изоляции (n =6; p <0,05).
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
НАУЧНЫЕ СООБЩЕНИЯ
вители условно-патогенной, а также нехарактерной для
биотопа микрофлоры. Ни один из испытуемых не отмечал дискомфортных явлений со стороны глотки.
Выводы
Полученные данные позволили сделать вывод о том,
что профилактика дисбиоза глотки при применении
местного аутопробиотического препарата была эффективной при воздействии таких экстремальных факторов,
как гипокинезия и изоляция.
недель обоих экспериментов (рис. 2б). Микрофлора кишечника в течение периода приема препарата отличалась
стабильностью и достаточно высокими показателями облигатной микрофлоры — бифидобактерий, лактобацилл,
непатогенных энтерококков (рис. 2а, 3а).
Кроме того, в результате приема препарата значительно снизилось содержание неферментирующих бактерий
и грибов в кишечнике (рис. 3б, 3в). Это происходило
несмотря на значительный уровень контаминации среды
обитания условно-патогенными микроорганизмами.
Выводы
Применение пробиотиков на основе аутоштаммов
для коррекции микробиоценоза кишечника
испытуемых в условиях 105- и 520-суточных
экспериментов по длительной изоляции «МАРС-500»
Как уже было указано выше, длительная изоляция ведет к развитию дисбактериозов, вызванных увеличением доли условно-патогенных микроорганизмов
в составе микрофлоры покровных тканей и слизистых
оболочек, что ведет к перекрестному инфицированию
и спонтанному формированию штаммов с признаками
госпитализма.
Пациенты и методы исследования
Для профилактики дисбактериоза у операторов в условиях экспериментов по длительной изоляции человека
в герметично замкнутом объекте «Марс-500», проведенных в ГНЦ РФ ИМБП РАН, был применен препарат, созданный на основе аутоштаммов энтерококков.
Для коррекции дисбактериоза кишечника у операторов
использовали угольные таблетки, насыщенные аутохтонными культурами Enterococcus faecium в количестве
108 КОЕ на дозу. Аутоштаммы E. faecium были выделены
из состава микрофлоры кишечника испытуемых за 1 мес
до начала эксперимента. Препараты применяли в течение
первых 30 сут эксперимента по 1 таблетке 2 раза в сут
во время еды в условиях 520-суточной изоляции; с 1-х
по 10-е и с 20-х по 30-е сут — по 1 таблетке 2 раза в сут
во время еды в условиях 105-суточной изоляции.
Результаты и обсуждение
Генетическая характеристика аутоштаммов
Enterococcus faecium
Одним из важнейших критериев выбора аутопробиотических бактерий является их безопасность для здоровья
пациентов, с целью доказательства которой был проведен
анализ выделенных аутоштаммов на наличие генов, кодирующих известные факторы патогенности энтерококков.
Исследование проводилось на базе ФГБУ НИИ экспериментальной медицины СЗО РАМН.
В исследование включили 35 изолированных аутоштаммов E. faecium. Наличие факторов патогенности
устанавливали с помощью метода полимеразной цепной
реакции (ПЦР). Детекцию результатов производили методом электрофореза в агарозном геле. Перечень искомых
генов указан в табл. 1 (а) и (б).
Для оценки потенциальных антимикробных свойств
выделенных изолятов аналогичным образом определяли
наличие генов, кодирующих синтез энтероцинов А и В
(entA, entB), регуляторный белок (entK), а также белок
устойчивости к энтероцину В (eniB) и белок иммунитета к
энтероцину А (entI) (табл. 2).
Результаты анализа показали, что большинство аутоштаммов свободно от генов, кодирующих факторы патогенности. Тем не менее, наличие небольшого числа штаммов, имеющих эти гены, доказывает целесообразность
проведения предварительных генетических исследований
(рис. 4а, б).
9
8
8
7
7
6
6
LOG KOE/г
LOG KOE/г
При использовании препаратов на основе аутологичных препаратов из E. faecium удалось избежать количественного роста условно-патогенных микроорганизмов
в период острой адаптации в течение первых нескольких
Таким образом, исследование применения аутоштаммов на основе E. faecium подтвердило их высокую
эффективность в профилактике дисбактериоза кишечника, развивающегося в условиях длительной изоляции
в герметично замкнутом объекте.
5
4
3
5
4
3
2
2
1
1
0
Фон
21-е
60-е
90-е
120-е 210-е
Сроки отбора проб
270-е
510-е
Сут
Бифидобактерии
Клостридии
Лактобациллы
Кишечные палочки
Энтерококки
Рис. 2 (а). Динамика облигатной микрофлоры кишечника
у испытуемых в 520-суточной изоляции (n =6).
0
Фон
21-е
60-е
90-е
120-е 210-е
Сроки отбора проб
270-е
510-е
Сут
Кишечная палочка с изм. биохим
Klebsiella
Proteus
S. aureus
S. epidermidis, S. haemoliticus
Дрожжи
Рис. 2 (б). Динамика факультативной микрофлоры кишечника
у испытуемых в 520-суточной изоляции (n =6).
59
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
9
12
8
7
8
LOG KOE/г
LOG KOE/г
10
6
4
Фон
14-е
35-е
Бифидобактерии
60-е
3
0
73-е 14 сут после
эксперимента
Лактобациллы
E. faecium
Фон
14-е
Сут
Кишечные палочки
Рис. 3 (а). Динамика облигатной микрофлоры кишечника
у испытуемых в 105-суточной изоляции (n =6).
8
35-е
73-е
Сроки отбора проб
14 сут после
эксперимента
Сут
Кишечная палочка с изм. биохим
Proteus Streptococcus viridans
S. aureus
S. epidermidis, S. haemoliticus
Дрожжи
Рис. 3 (б). Динамика факультативной микрофлоры кишечника
у испытуемых в 105-суточной изоляции (n =6).
Функция
6
Адгезия и колонизация
5
4
3
Пенетрация, колонизация,
повреждение тканей
2
1
0
60-е
Таблица 1 (а). Некоторые известные факторы патогенности энтерококков
7
LOG KOE/г
4
1
Сроки отбора проб
60
5
2
2
0
6
Фон
14-е
35-е
60-е
Сроки отбора проб
73-е
14 сут после
эксперимента
Сут
Грамотрицательные оксидазоположительные (гем+) палочки
Плесневые грибы
Фактор
Ген(ы)
Адгезин
asa1
Адгезин
esp
Адгезин
efaA
Пили I типа
pilA
Желатиназа
gelE
Сериновая протеиназа
sprE
Fsr-регулятор
fsrB
Гиалуронидаза
hyl
сyl
Цитолизин
Цитолизины
cylA, M
Гемолиз, токсигенность,
бактериоциногенность
Устойчивость к ванкомицину Фермент устойчивости
к ванкомицину
van
Рис. 3 (в). Динамика неферментирующих микроорганизмов
в кишечнике испытуемых в 105-суточной изоляции (n =6).
Таблица 1 (б). ДНК-праймеры для определения генов патогенности энтерококков
Название гена
gelE
esp
sprE
fsrB
asa1
cylA
cylM
efaA
E.faecalis
E.faecium
van
hyl
pilA
Нуклеотидная последовательность праймеров
Прямой
Обратный
ACCCCGTATCATTGGTTT
ACGCATTGCTTTTCCATC
TTGCATAATGCTAGTCCACGACC
GCGTCAATCGGAAGAATCAT
GCGTCAATCGGAAGAATCAT
CGGGGAAAAAGCTACATCAA
TTTATTGGTATGCGCCACAA
TCATCAGACCTTGGATGACG
CCAGCCAACTATGGCGGAATC
CCTGTCGCAAGATCGACTGTA
ACTCGGGGATTGATAGGC
GCTGCTAAAGCTGCGCTT
GATTGGAATGTGGGAATCCTAA
ACTTCCGGCAACCTTTAGTGTA
CGTTAGCTGCTTGCGGGAATC
CCATACTACGTTTATCGACAC
TCAAGTACAGTTAGTCTTTATTAG ACGATTCAAAGCTAACTGAATCAGT
TTGAGGCAGACCAGATTGACG
TATGACAGCGACTCCGATTCC
TTCATGTTCCACGAACCAGAG
CGTTGAACGAACGAATGAAAA
CCGATGCTGATTTGGGATAAT
TCTGGGTCTTTGGCTAGCAGT
TTTTGTGTGACTAATCCAG
ATGGCAATAAATCGGTATGA
Размер ампликона
419
933
233
316
529
688
825
735
941
658
436
359
842
Таблица 2. ДНК-праймеры для определения компонентов энтероцинового оперона энтерококков
Название
гена
entA
entB
entK
eniB
entI
Функция
Нуклеотидная последовательность праймеров
Размер
ампликона
Прямой
Обратный
Энтероцин А
GGGGTGATTAGATTATGAAACATTTAA
TTAGCTTCCCTGGAATTGC
230
Энтероцин В
ATGCAAAATGTAAAAGAATTAAGTACG TTAGTTGCATTTAGAGTATACATTTGCT
223
Гистидинкиназа
GAGGGGATCTCTTGATTAC
CCATACCCTTTTATCCCTTCAA
339
Иммунитет продуцента
AGCAAAAGGAAGAAGAAATATGG
GTGTCATTTTTATATTCTATA
195
к энтероцину В
Белок иммунитета
CTCCACCTACACCACAAGC
GGTGCAGGTTTAGGAACAGC
289
к энтероцину А
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
НАУЧНЫЕ СООБЩЕНИЯ
100
90
80
70
60
50
40
30
20
10
0
Встречаемость,%
Встречаемость,%
100
90
80
70
60
50
40
30
20
10
0
asa1
efaA
sprE
hyl
van
fsrB
gelE
esp
pilA
Рис. 4 (а). Частота встречаемости генов, кодирующих факторы
патогенности в исследованных аутоштаммах E. faecium.
Кроме того, присутствие у некоторых штаммов генов, кодирующих энтероцин А и другие компоненты
энтероцинового регулона, свидетельствует о повышенной антимикробной активности и, соответственно,
о более выраженном пробиотическом эффекте этих
бактерий.
Заключение
Предварительные результаты испытаний аутопробиотиков показали, что они сопоставимы по эффективности
с пробиотиками, изготовленными на основе коллекционных культур. Для данных препаратов не существует
проблем биологической совместимости и приживляемости, поэтому они являются более активными, нежели
их аналоги, изготовленные на основе коллекционных
штаммов.
entA
entB
entL
entK
eniB
Рис. 4 (б). Частота встречаемости генов, кодирующих компоненты энтероцинового регулона энтерококков.
Аутопробиотики должны в первую очередь использоваться для коррекции микрофлоры у определенных
профессиональных групп, в которых сохраняется относительно постоянный состав и которые являются объектами микробиологического риска. Деятельность таких групп связана с длительной эксплуатацией объектов
с искусственной средой обитания (кессонщики, подводники), лиц, чья профессиональная деятельность связана
с частым перемещением в различные географические
зоны (в частности, спортсменов). Перспективно применение аутопробиотиков и в клинической практике,
в т.ч. для профилактики и лечения дисбактериозов у иммуносупрессированных пациентов и детей.
Перечень видов препаратов и культур, из которых
будут создаваться препараты, может быть весьма велик.
В ближайшей перспективе планируется изучение эффективности препаратов на основе вейлонелл, саливарных
стрептококков и коринебактерий.
ЛИТЕРАТУРА
1.
2.
3.
4.
5.
6.
7.
8.
9.
Лизько Н.Н. Дисбактериозы экстремальных состояний. Антибиотики и мед. Биотехнология. 1987; 32 (3): 184–186.
Ильин В.К., Воложин А.И., Виха Г.В. Колонизационная
резистентность организма в измененных условиях обитания.
М.: Наука. 2005.
Глушанова Н.А., Шендеров Б.А. Взаимоотношения пробиотических и индигенных лактобацилл хозяина в условиях
совместного культивирования in vitro. Журн. микробиол., эпидемиол. и иммунол. 2003; 2: 56–61.
Шендеров Б.А. Нормальная микрофлора и ее роль в поддержании здоровья человека. Росс. журн. гастроэнтерол., гепатол., колопроктол. 1998; 8 (1): 61–65.
Kirjavainen P.V., Ouwehand A.C., Isolauri E. Salminen S.J. The
ability of probiotic bacteria to bind to human intestinal mucus
FEMS Microbiol. Lett. 1998; 167 (2): 185–189.
Boris S., Suraez J.E., Vazquez F., Barbes C. Adherence of human
vaginal Lactobacilli to vaginal epithelial cells and interaction with
uropathogens. Infect. Immun. 1998; 66 (5): 1985–1989.
Бойцов А.Г., Рищук С.В., Ильясов Ю.Ю., Гречанинова Т.А.
Адгезия лактобактерий к клеткам вагинального и буккального эпителия. Вестн. Санкт-Петербургской мед. академии
им. И.И. Мечникова. 2004; 4 (5): 191–193.
Шендеров Б.А., Манвелова М.А. Способ получения аутопробиотика, содержащего живые бифидобактерии и лактобациллы. Пат. РФ № 2139070. 1999.
Хачатрян А.П., Хачатрян Р.Г. Способ получения банка аутохтонных штаммов микроорганизмов для восстановления
кишечного микробиоценоза человека. Пат. РФ № 2126043. 1999.
10. Шендеров Б.А. Функциональное питание, криогенные банки
микробиоценозов и их роль в сохранении и восстановлении
здоровья. Вестн. восст. медицины. 2003; 1: 29–31.
11. Ван Ликуй. Использование пробиотиков и аутоштаммов лактобактерий в комплексном лечении бактериального вагиноза.
Автореф. дис. … канд. мед. наук. М. 2006.
12. Мельников В.А., Стулова С.В., Тюмина О.В., Денисова Н.Г.,
Щукин В.Ю. Аутотрансплантация лактобацилл в восстановлении индивидуального биоценоза влагалища женщины.
Фундаментальные исследования. 2012; 1: 64–67.
13. Воложин А.И., Ильин В.K., Максимовский Ю.М., Сидоренко А.Б., Истранов Л.П., Царев В.К., Истранова Е.В.,
Абоянц Р.К., Тюрина Д.А., Соловьева З.О. Патент № ЯИ
2240771 С2 РФ. 7 А 61 К 6/00,35/74,38/39 «Пародонтальная повязка». МГМСУ. Бюлл. «Изобретения, полезные модели».
2004; 33: 154.
14. Воложин А.И., Ильин В.К., Максимовский Ю.М., Истранов Л.П., Истранова Е.В., Абоянц Р.К. Разработка и применение пародонтальной повязки из коллагена и суспензии клеток
Lactobacillus casei 37 в комплексном лечении воспалительных заболеваний пародонта (результаты микробиологических
исследований). Стоматология: двухмесячный научн.-практ.
журн. 2004; 83 (6): 6–8.
15. Сидоренко А.Б. Применение лактобактерина, иммобилизованного на коллагене, для повышения эффективности лечения пародонтита у больных сахарным диабетом 2-го типа
с патологией сердечно-сосудистой системы. Автореф. дис. …
канд. мед. наук. М. 2005.
61
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
КОНТАКТНАЯ ИНФОРМАЦИЯ
Ильин Вячеслав Константинович, доктор медицинских наук, профессор, заведующий отделом санитарно-гигиенической безопасности человека в искусственной среде обитания ФГБУН ГНЦ РФ «Институт медико-биологических
проблем» РАН
Адрес: 123007, Москва, Хорошевское ш., д. 76а; тел.: (499) 195-65-54; е-mail: ilyin@imbp.ru
Суворов Александр Николаевич, доктор медицинских наук, профессор, заведующий отделом молекулярной микробиологии ГУ НИИ экспериментальной медицины СЗО РАМН
Адрес: 197376, Санкт-Петербург, ул. Акад. Павлова, д. 12; тел: (812) 234-93-19; е-mail: alexander_suvorov1@hotmail.
com
Кирюхина Наталия Владимировна, кандидат медицинских наук, научный сотрудник лаборатории микробной экологии человека ФГБУН ГНЦ РФ «Институт медико-биологических проблем» РАН
Адрес: 123007, Москва, Хорошевское ш., д. 76а; тел.: (499) 195-68-36; е-mail: kiryukhina_nataliya@hotmail.com
Усанова Нонна Альбертовна, научный сотрудник лаборатории микробной экологии человека ФГБУН ГНЦ РФ
«Институт медико-биологических проблем» РАН
Адрес: 123007, Москва, Хорошевское ш., д. 76а; тел.: (499) 195-68-36; е-mail: usanova@imbp.ru
Старкова Любовь Валентиновна, кандидат технических наук, научный сотрудник лаборатории микробной экологии
человека ФГБУН ГНЦ РФ «Институт медико-биологических проблем» РАН
Адрес: 123007, Москва, Хорошевское ш., д. 76а; тел.: (499) 195-68-36; е-mail: starkova@imbp.ru
Бояринцев Валерий Владимирович, доктор медицинских наук, профессор, главный врач ФГБУ «Клиническая больница № 1 (Волынская)» управления делами Президента РФ
Адрес: 121352, Москва, ул. Староволынская, д. 10; тел.: (495) 441-80-01; е-mail: wpx@mail.ru
Карасева Алена Борисовна, научный сотрудник отдела молекулярной микробиологии ГУ НИИ экспериментальной
медицины СЗО РАМН
Адрес: 197376, Санкт-Петербург, ул. Акад. Павлова, д. 12; тел.: (812) 234-93-19; е-mail: tarno@list.ru
62
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
НАУЧНЫЕ СООБЩЕНИЯ
М.М. Тарских, М.А. Шумбасов, С.И. Колесников
Научный центр проблем здоровья семьи и репродукции человека, Иркутск, Российская Федерация
Канцерогенность акрилонитрила и оценка
возможностей патогенетической коррекции
токсичности акрилата и противоопухолевого
антрациклина доксорубицина при
химиотерапии опухолей
Статистический анализ за 20-летний период показал, что примерно 49% лиц, работавших в контакте с широко распространенным промышленным ядом акрилонитрилом, впоследствии погибли от злокачественных новообразований различной локализации. Проведенные экспериментальные исследования продемонстрировали, что акрилонитрил при подострой интоксикации животных, противоопухолевый антибиотик доксорубицин, их комбинация, перевитая опухоль, а также опухоль, развившаяся на фоне введения акрилата и последующего лечения
доксорубицином, приводят к запуску свободнорадикальных реакций, что само по себе может стимулировать развитие злокачественных
опухолей. Это свидетельствует о необходимости антиоксидантного сопровождения химиотерапии опухолей в аналогичных клинических
ситуациях.
Ключевые слова: онкологические заболевания, акрилонитрил, профилактика, доксорубицин, антиоксиданты, витамин Е.
Введение
нетической терапии, химиопрофилактики их токсических
эффектов при данном воздействии на организм человека.
Акрилонитрил (АН) широко используют для производства полимеров, синтетических каучуков во многих
странах. Сотни тысяч людей подвержены воздействию
АН в производственных условиях и в быту [1]. АН — алкилирующий ксенобиотик с прооксидантным механизмом действия. Существуют данные, свидетельствующие
о канцерогенном, гемато- и иммунотоксическом действии
акрилата [1–4]. Исходя из этого, становится понятной необходимость изучения комбинированного действия АН и
цитостатиков в терапии опухолей, развившихся предположительно под влиянием АН, что явилось основной целью
исследования, а также поиск адекватных средств патоге-
Материалы и методы
Участники исследования
Эксперимент проведен на 180 белых беспородных
крысах-самцах, 120 из которых перевивалась лимфосаркома Плисса.
Методы исследования
Экспериментальные животные подвергались предварительной затравке АН в течение 28 дней путем ежеднев-
M.M. Tarskikh, M.A. Shumbasov, S.I. Kolesnikov
Scientific Center of the Health Family Problems and Reproduction of Man, Irkutsk, the Russian Federation
Carcinogenicity of acrylonitrile and evaluation of approaches
to pathogenetic correction of acrylate toxicity and antitumorigenic
anthracycline doxorubicin toxicity during chemotherapy
Statistical analysis within the 20-year period showed that approximately 49% of workers who were exposed to widespread industrial poison acrylonitrile subsequently died from malignancy of different localization. The conducted experimental investigations demonstrated that acrylonitrile
with the subacute intoxication of animals, the anti-tumor antibiotic doxorubicin, their combination, interwoven tumor and tumor developed
against the background the introduction of acrylate and subsequent treatment doxorubicin led to onset of free-radical reactions. These reactions by
themselves might stimulate development of malignancy. This fact confirms the need for antioxidant tracking of chemotherapy of tumors in the similar
clinical cases.
Key words: oncology, acrylonitrile, prevention, doxorubicin, аntioxidants, vitamin Е.
63
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
ного однократного подкожного введения в дозе 20 мг/кг.
На 19-й день затравки проводили перевивку лимфосаркомы Плисса стерильной гомогенной 30% взвесью
клеток опухоли в среде 199, вводимой крысам подкожно
в область правого бока в объеме 0,4 мл. Спустя 9 дней
после перевивки опухоли 1 раз в день внутрибрюшинно
вводили антрациклиновый противоопухолевый антибиотик доксорубицин (Дрб) в дозе 0,5 мг/кг (1/10 ЛД50, ЛД —
летальная доза; 1/10 МПД, максимально переносимая
доза) [5] в течение 10 дней. Контрольные животные получали растворитель в эквивалентных раствору ксенобиотика количествах. Материал для исследования забирали на
29-й, 35-й, 41-й, 47-й дни от начала эксперимента. Активность перекисного окисления липидов (ПОЛ) биомембран определяли по накоплению малонового диальдегида
(МДА) [6] в плазме крови и эритроцитах и выражали в
нмоль МДА на 1 мл плазмы и нмоль на 1 мг гемоглобина
эритроцитов.
Статистическая обработка данных
64
Статистический анализ смертности среди сотрудников вредных цехов Красноярского завода синтетического
каучука за 20-летний период проводился по больничным
листам, картам учета движения сотрудников по заводу, предоставленным кадровым аппаратом предприятия,
и данным паспортного стола (свидетельства о смерти).
Всего было проанализировано 5400 карт сотрудников завода. Результаты исследований подвергались математической обработке для вычисления средней арифметической
величины (М) и стандартной ошибки средней арифметической (m). Достоверность различий сравниваемых
параметров рассчитывали с использованием t-критерия
Стьюдента. Различия считались статистически значимыми при p<0,05. Математический расчет выполнялся
с помощью программы «Microsoft Excel».
Результаты и обсуждение
Анализ причин смерти сотрудников вредных цехов
Красноярского завода синтетического каучука за 20-летний
период (1980–2000 гг.) показал, что из 150 сотрудников, работавших на заводе во вредных цехах, 72 человека умерли от
злокачественных новообразований (табл. 1), что составило
около 49%, а это в совокупности с другими проведенными
нами исследованиями [7] свидетельствует о высоком канцерогенном риске акрилонитрильного производства.
Таблица 1. Причины смерти сотрудников вредных цехов
Красноярского завода синтетического каучука за период с 1980
по 2000 гг.
Локализация опухолевого процесса
Рак легких
Рак желудка
Рак толстого кишечника
Рак прямой кишки
Рак печени
Рак поджелудочной железы
Рак молочной железы
Лимфопролиферативные заболевания:
• хронический лимфолейкоз
• злокачественные лимфомы
Рак яичника
Рак матки
Рак почки
Рак простаты
Рак гортани
Рак языка
Число заболевших
25
9
3
4
3
2
7
5
4
1
2
3
2
3
1
1
Далее нами были проведены экспериментальные
исследования по изучению изолированного и комбинированного действия АН, перевитой опухоли Плисса
и противоопухолевого антрациклина Дрб. Результаты
продемонстрировали, что подострое отравление крыс АН
сопровождалось накоплением МДА в эритроцитах спустя
14 дней с момента начала введения АН (рис. 1А) и в плазме
крови — через 28 дней от начала опыта (рис. 1Б), что подтверждает известные факты, свидетельствующие о прооксидантном действии АН вследствие острой интоксикации
[2]. Стимуляция ПОЛ биомембран в эритроцитах, судя по
литературным данным, возникает и при введении животным противоопухолевых антрациклиновых антибиотиков [5], что подтверждается результатами наших опытов:
стимуляцией накопления МДА в мембранах эритроцитов
через 6 и 10 дней после начала введения Дрб интактным
животным (рис. 2д, 3д). У животных-опухоленосителей
с 10-, 16- и 22-дневной опухолью Плисса также наблюдалось усиление накопления МДА как в плазме крови, так и
в эритроцитах (рис. 1а, 2а, 3а). Эти данные соответствуют
литературным, свидетельствующим о том, что рост злокачественных новообразований сопровождается увеличением интенсивности реакций ПОЛ [8]. Аналогичные
результаты были получены и в том случае, когда опухоль
перевивали животным, предварительно подверженным
воздействию АН: наблюдали усиление накопления МДА
в крови крыс с 10-, 16- и 22-дневной лимфосаркомой
Плисса (рис. 1б, 2б, 3б). Увеличение интенсивности накопления МДА в плазме крови опытных животных также
отмечалось при введении Дрб крысам с 16-дневной опухолью в течение 6 дней, но данного эффекта не наблюдалось
в эритроцитах (рис. 2г). Однако при более длительном
введении Дрб (в течение 10 дней) крысам с 22-дневной
опухолью достоверного увеличения накопления МДА
в плазме крови этих животных не зафиксировано, однако
имело место значительное увеличение накопления МДА
в эритроцитах (рис. 3г). Этот факт, по всей вероятности,
обусловлен противоопухолевым действием Дрб, который
сам по себе стимулирующего действия на ПОЛ в плазме крови не оказывал, однако, как было сказано выше,
увеличивал интенсивность накопления МДА в эритроцитах (рис. 2д, 3д). В то же время вводимый животнымопухоленосителям, предварительно подверженным
воздействию АН, Дрб не уменьшал накопления МДА
в плазме крови этих животных (рис. 2в, 3в). По всей вероятности, стимулирующий эффект на ПОЛ в этих опытах
сохранялся за счет прооксидантного действия АН, отмечавшегося при изолированном воздействии этого яда.
Кроме того, этот факт может быть связан с нарушением
перехода Дрб в активную форму вследствие повреждающего действия акрилата на микросомальную метаболизирующую систему [2, 5], а следовательно, снижением
антибластомного действия антрациклина.
Таким образом, результаты исследования свидетельствуют о том, что АН, Дрб и их комбинация стимулируют процессы ПОЛ, что выражается в увеличении
накопления МДА в крови опытных животных, а гематотоксические эффекты АН, Дрб и перевитой опухоли, продемонстрированные нами ранее [9], обусловлены
стимуляцией ПОЛ.
Исходя из полученных данных, очевидно, что при
возникновении клинической ситуации, близкой к той,
которая была воссоздана в эксперименте (т.е. когда химиотерапия злокачественного новообразования будет
осуществляться больному, имевшему длительный профессиональный контакт с АН), в целях уменьшения
нежелательного влияния акрилата, самой опухоли и про-
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
НАУЧНЫЕ СООБЩЕНИЯ
10+дневная перевитая
лимфосаркома Плисса
*
*
*
10
5
К
0
А
К
Эритроциты
Б
А
а
Б
б
а
0,5
тивоопухолевого препарата на кроветворную, иммунную
систему и организм опухоленосителя в целом, для повышения антибластомного действия антрациклина необходимо назначение антиоксидантов в качестве патогенетической коррекции вышеуказанных нарушений. Так,
сотрудники нашей лаборатории в период с 1978 по 1990 гг.
в результате добавления по разработанной схеме витамина Е ко второму (мясному) блюду рабочих из расчета 2,5 г
на количество подлива, рассчитанного на 100 человек
(25–30 мг витамина Е в сут), добились снижения заболеваемости с временной утратой трудоспособности на акрилонитрильном производстве уже через 1 год [2]. Через
3 года число случаев нетрудоспособности было ниже
исходного уровня на 17% по заводу в целом (на 35% —
среди рабочих основных профессий). По дням нетрудоспособности эти величины были равны 14 и 37%,
соответственно. В дальнейшем показатели заболеваемости с временной утратой трудоспособности
на заводе сохраняли тенденцию к снижению, и по данным показателям завод перешел из категории с заболеваемостью выше среднего и высокой к средним величинам
по случаям и дням нетрудоспособности, соответственно.
Существуют также исследования, свидетельствующие
о высокой протекторной эффективности витамина Е в
профилактике токсического действия антрациклинов
[10]. Автор одной из работ показал, что гематотоксическое действие противоопухолевого антибиотика в условиях комбинированного его введения с комплексом
естественных антиоксидантов животным с перевитой
опухолью — лимфосаркомой Плисса — менее выражено
по сравнению с действием одного только антибиотика и
не сопровождается уменьшением антибластомного действия антрациклина [10]. В связи с этим интересно также отметить появившиеся в недавнем прошлом работы,
доказывающие протективное действие антиоксидантов
для коррекции токсических эффектов противоопухолевых препаратов, обладающих прооксидантной и алки-
*
10
*
*
*
*
*
5
К
0
а
К
б
а
в
б
г
д
в
е
г
д
е
Плазма
Эритроциты
Плазма
Примечание. К — контроль; А — животные, подвергавшиеся
затравке акрилонитрилом в течение 14 дней; Б — животные,
подвергавшиеся затравке акрилонитрилом в течение 28 дней;
а — животные с 10-дневной опухолью; б — животные с 10-дневной опухолью, подвергавшиеся воздействию акрилонитрилом
в течение 28 дней; * — здесь и на рис. 2, 3 обозначена достоверность различий по сравнению с контрольной группой.
*
*
15
0
б
Рис. 1. Влияние подострого отравления акрилонитрилом
(в течение 28 дней) на содержание малонового диальдегида (МДА)
в плазме крови и эритроцитах интактных крыс и с перевитой
лимфосаркомой Плисса с ростом опухоли в течение 10 дней.
*
20
Рис. 2. Влияние изолированного и комбинированного воздействия акрилонитрила (в течение 28 дней) и доксорубицина
(в течение 6 дней) на содержание малонового диальдегида (МДА)
в плазме крови и эритроцитах интактных крыс и с перевитой
лимфосаркомой Плисса с ростом опухоли в течение 16 дней.
Примечание (здесь и на рис. 3). К — контроль; а — крысы, имевшие
только опухоль; б — имевшие опухоль и подверженные воздействию
акрилонитрилом; в — имевшие опухоль, подверженные воздействию акрилонитрилом и получавшие доксорубицин; г — имевшие опухоль и получавшие доксорубицин; д — получавшие
доксорубицин; е — получавшие акрилонитрил и доксорубицин.
22+дневная перевитая
лимфосаркома Плисса
1
20
0,5
Содержание МДА нмоль /мл плазмы
0
10+дневная перевитая
лимфосаркома Плисса
1
Содержание МДА нмоль /мг Нв эритроцитов
15
0,5
*
Содержание МДА нмоль / мл плазмы
*
20
Содержание МДА нмоль /мл плазмы
Содержание МДА нмоль /мг Нв эритроцитов
*
Содержание МДА нмоль /мг Нв эритроцитов
1
*
*
*
15
*
10
*
*
*
*
5
0
К
0
а
К
Эритроциты
б
а
в
б
г
в
д
г
е
д
е
Плазма
Рис. 3. Влияние изолированного и комбинированного воздействия акрилонитрила (в течение 28 дней) и доксорубицина
(в течение 10 дней) на содержание малонового диальдегида
(МДА) в плазме и эритроцитах интактных крыс и крыс с перевитой лимфосаркомой Плисса с ростом опухоли в течение 22 дней.
лирующей активностью (циклофосфана и 5-фторурацила) в условиях экспериментальной неоплазии [11, 12].
В этих работах показано, что антиоксиданты Эмоксипин
и Мексидол по сравнению с -Токоферола ацетатом
в изомолярных концентрациях в большей степени снижают уровень эндогенной интоксикации, стимулируют
антиоксидантную защиту ткани печени, почек и сердца
опухоленосителя. Комбинированное применение Эмоксипина и Мексидола при моделировании противоопухолевой химиотерапии циклофосфаном на фоне роста
холангиоцеллюлярного рака РС-1 приводит к более выраженному снижению показателей интоксикации, ограничению активности процессов ПОЛ в тканях печени и почек
65
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
и степени лейкопении, а также к снижению интенсивности роста содержания МДА и угнетения антиокислительной активности ткани опухоли, чем при комбинированном применении циклофосфана и -токоферола
в изомолярных дозах. Более того, Эмоксипин демонстрировал противоопухолевый эффект в условиях роста холангиоцеллюлярного рака РС-1 в эксперименте и повышал индекс торможения роста опухоли циклофосфаном
при комбинированном применении. Подобные результаты отмечали при использовании данных антиоксидантов в условиях экспериментальной неоплазии и лечении опухолевого процесса антрациклином Рубомицином
и 5-фторурацилом [11, 12].
Заключение
Исходя из вышесказанного, мы считаем правомочным и патогенетически обоснованным применение
в клинической практике комплекса антиоксидантов
в качестве химиопрофилактики токсических эффектов
АН и Дрб и рекомендуем использование вышеперечисленных антиоксидантных препаратов при лечении
злокачественных новообразований антрациклинами
у людей, профессионально подвергавшихся длительному
воздействию АН. Кроме того, представляется целесообразным применение с целью профилактики токсических эффектов яда в условиях производства и для
предотвращения отрицательных эффектов на организм
людей при химиотерапии опухолей комбированного
антиоксидантного препарата Веторон-Е, содержащего
водорастворимые (и, соответственно, быстродействующие) фракции витамина Е и других антиоксидантов,
а также препаратов Трансфер Фактор и Трансфер Фактор+, являющихся биологически активными добавками
к пище и обладающими мембраностабилизирующей, антиоксидантной и иммуномодулирующей активностью.
В частности, Трансфер Фактор и Трансфер Фактор+,
рекомендованы для применения в онкологической
практике [13].
ЛИТЕРАТУРА
1.
66
2.
3.
4.
5.
6.
7.
8.
Акрилонитрил. Гигиенические критерии состояния окружающей среды. Женева: ВОЗ. 1987; 28: 113.
Иванов В.В., Котловский Ю.В., Климацкая Л.Г., Ставицкая Е.Ю., Тарских М.М. Молекулярно-клеточные механизмы токсичности ксенобиотиков, профессионально обусловленных и экологических заболеваний. Новосибирск:
Наука. 2004. 224 с.
Канцерогенные вещества: Справочник. Мат-лы Междунар. агенства по изучению рака. Под ред. В.С. Турусова.
М. 1987. 143 с.
Устинович Л.П., Эренбург Б.Е., Николаева Г.А. Влияние акрилонитрила на первичный иммунный ответ и функциональную
активность клеток костного мозга. Метаболические аспекты
действия на организм индустриальных химических соединений. Красноярск. 1982. С. 56–58.
Гольдберг Е.Д., Новицкий В.В Противоопухолевые антибиотики антрациклинового ряда и система крови. Томск. 1986.
С. 74–80.
Стальная И.Д., Гаришвили Т.Г. Метод определения малонового диальдегида с помощью тиобарбитуровой кислоты. Современные методы в биохимии. М. 1977. С. 63–64.
Тарских М.М., Климацкая Л.Г. Исследование загрязнения
окружающей среды акрилонитрилом и вероятных механизмов
его онкогенного действия с использованием методов экои биомониторинга. Сибирь–Восток. 2005; 9: 8–11.
Свистунов А.А., Чеснокова М.П., Барсуков В.Ю., Селезнева Т.Д., Зяблов Е.В. Активация липопероксидации — типовой
9.
10.
11.
12.
13.
процесс дестабилизации биомембран клеток при неоплазиях различной локализации. Саратовский научно-медицинский
журнал. 2010; 6 (2): 267–270.
Нестерова Е.В., Тарских М.М., Иванов В.В. Исследование
терапевтической эффективности и гематотоксичности комбинированного действия противоопухолевого антибиотика
рубомицина с промышленным мономером акрилонитрилом
в эксперименте. Фармакология и токсикология. Деп. в ВИНИТИ от 09.10.1992. № 2935-В92. 1993.
Бармина С.Э. Характеристика эритрона и активность ПОЛ
у крыс с лимфосаркомой Плисса при введении антиоксидантов. Актуальн. пробл. фармакологии и поиска новых лекарственных препаратов. Томск. 1990. С. 148–151.
Скопин П.И. Влияние комбинированного применения
циклофосфана и эмоксипина на степень эндотоксикоза
и рост холангиоцеллюлярного рака РС-1 и меланомы В-16
в эксперименте. Автореф. дис … канд. мед. наук. Саранск.
2005. 149 с.
Скопина Ю.А. Влияние комбинированного применения 5-фторурацила и мексидола на степень эндотоксикоза
в условиях экспериментальной неоплазии (экспериментальное исследование). Автореф. дис ... канд. мед. наук. Саранск.
2005. 144 с.
Суханов Б.П. Трансфер Факторы как элемент питания человека. В сб. научн.-практ. конф. с междунар. участием: Иммунореабилитация при инфекционно-воспалительных заболеваниях. Барнаул. 2003. С. 27–28.
КОНТАКТНАЯ ИНФОРМАЦИЯ
Тарских Михаил Михайлович, кандидат медицинских наук, доцент кафедры физиологии и методики обучения биологии Красноярского государственного педагогического университета им. В.П. Астафьева
Адрес: 660049, Красноярск, ул. Ады Лебедевой, д. 89; тел.: (391) 217-17-23; е-mail: mtarskih@mail.ru
Шумбасов Максим Александрович, врач-онколог, заведующий дневным стационаром Красноярского краевого онкодиспансера им. А.И. Крыжановского
Адрес: 660333, Красноярск, ул. Первая Смоленская, д. 16; тел.: (391) 264-68-21, (391) 299-20-06;
е-mail: shumbasov.max@rambler.ru
Колесников Сергей Иванович, академик РАМН, советник Президиума РАМН, Заслуженный деятель науки РФ
E-mail: sikolesnikov2012@gmail.com
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ЮБИЛЕИ, ПОЗДРАВЛЕНИЯ
Борис Дмитриевич Комаров
20 февраля 2013 г. исполняется 85 лет со дня рождения
и 60 лет практической работы в здравоохранении г. Москвы главного научного сотрудника клинико-диагностического отделения ЦНИИ гастроэнтерологии Комитета
здравоохранения Москвы, заслуженного деятеля науки
Российской Федерации, члена-корреспондента Российской академии медицинских наук, доктора медицинских
наук, профессора Бориса Дмитриевича Комарова.
Б.Д. Комаров родился в Тамбовской области. После
окончания 2-го Московского медицинского института
им. Н.И. Пирогова (1953) работал ординатором, затем
ассистентом и доцентом на кафедре факультетской хирургии (заведующий кафедрой — академик А.Н. Бакулев).
В 1957 г. защитил кандидатскую, в 1967 г. — докторскую
диссертацию. В год присвоения ему звания профессора
(1968) Б.Д. Комаров был назначен директором НИИ скорой помощи им. Н.В. Склифосовского. Оставаясь на этом
посту, с 1970 г. он параллельно занимал должности главного хирурга медицинской службы ГОМО СССР и генерального директора Московского научно-практического
объединения «Скорая медицинская помощь». Выйдя на
международный уровень, Борис Дмитриевич занял пост
директора семинара ВОЗ СМП и координатора англо-советского сотрудничества (1976).
Научные интересы Б.Д. Комарова сосредоточены
на изучении широкого круга актуальных проблем хирургии. Значительный объем исследований посвящен
изучению патофизиологических состояний сердечно-сосудистой системы при различных заболеваниях, в частности гемодинамическим нарушениям и сократительной
функции миокарда при врожденных и приобретенных пороках сердца с целью определения показаний и противопоказаний к операциям на сердце.
Особое внимание было уделено аневризмам аорты, их
расслоениям, тромбозам и эмболиям, а также неврологическим осложнениям и реакциям на хирургическое вмешательство измененной атеросклерозом, специфической
инфекцией и травмой аорты.
Его работы послужили научным патофизиологическим обоснованием и подтверждением необходимости
хирургического лечения патологии аневризмы аорты.
С участием Б.Д. Комарова были выполнены первые в нашей стране операции при аневризмах грудной и брюшной
аорты с аллопластическим замещением сегментов.
Особое внимание Б.Д. Комаров уделял вопросам детоксикации в клинике неотложных состояний при за-
болеваниях органов пищеварения, гнойно-септических
заболеваниях и осложнениях, деструктивном перитоните,
медиастинитах, флегмонах, различных видах сочетанных травм; с его участием проводится детальное изучение экстракорпоральной детоксикации, гемо- и лимфосорбции в комплексе реанимационных мероприятий; им
изучаются различные методы диализа, метаболические
расстройства, гипербарическая оксигенация, трансплантация гепатоцитов в лечении печеночно-почечной недостаточности при эндо- и экзотоксикозах.
Серьезный вклад Бориса Дмитриевича в изучение
системы планирования и расчетной потребности сети
специализированных учреждений скорой медицинской
помощи страны обобщен в специальном руководстве по
организации и практике скорой помощи в 3 томах.
На основании этих исследований были созданы специализированные центры в Москве и других регионах
страны; Президиумом АМН СССР и Ученым советом
Минздрава СССР была учреждена самостоятельная проблема «Неотложные состояния», создано научное направление «Медицина катастроф», введена профессия врача
скорой помощи. В 1995 г. он избран действительным
членом Российской академии медико-технических наук.
В последние годы научные интересы Б.Д. Комарова сосредоточены на изучении проблемы осложненного
течения послеоперационного периода после различных
хирургических вмешательств на органах пищеварения,
в том числе при язвенной болезни желудка и двенадцатиперстной кишки.
Б.Д. Комаров проявил себя как крупный организатор
здравоохранения на базе НИИ скорой помощи, он создал
сеть новых специализированных клинических отделений,
научных лабораторных отделов и специализированных
центров, работающих в режиме экстремальной медицины. Был выстроен комплекс новых клинических зданий
с прекрасным оснащением, что способствовало решению
крупных многофакторных научных проблем народнохозяйственного и заказного значения.
Научные труды юбиляра представляют значительный
вклад в медицинскую науку и имеют большое значение
для практического здравоохранения. Им опубликовано
более 400 научных работ, в том числе 25 монографий,
руководств, учебник по скорой медицинской помощи,
главы тематических сборников. Его работы, учебник
и справочник хирургической сестры неоднократно переиздавались на французском и английском языках.
67
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ВЕСТНИК РАМН /2013/ № 2
Под редакцией Бориса Дмитриевича организовано издание и выпущено более 60 томов трудов НИИ скорой помощи, посвященных актуальным проблемам
экстремальной медицины; он является автором 22 авторских свидетельств, рационализаторских предложений и опытно-конструкторских разработок. Под его
руководством подготовлено 39 докторов и кандидатов
медицинских наук.
Многогранна общественная деятельность Б.Д. Комарова. Он был членом Ученого совета Минздрава РСФСР
и СССР, членом президиума и членом правления Всероссийского общества хирургов и кардиологов, Общества
хирургов и врачей скорой помощи Москвы и Московской
области, а в настоящее время входит в состав ряда редколлегий научных журналов, является членом Правления
Общества «Знание» РФ.
68
Избирался депутатом и членом Исполкома Моссовета, председателем комиссии здравоохранения Моссовета,
членом коллегии ГМУЗ Моссовета.
Труды Бориса Дмитриевича получили высокую оценку: он награжден орденом Трудового Красного Знамени, юбилейными медалями в ознаменование победы в
Великой Отечественной войне 1941–1945 гг., золотыми
и серебряными медалями ВДНХ, удостоен звания «Ветеран Великой Отечественной войны 1941–1945 гг.», награжден почетными грамотами различных ведомств.
Отдавая должное большому вкладу Бориса Дмитриевича Комарова в развитие отечественного здравоохранения,
друзья, коллеги и ученики, а также редколлегия журнала
«Вестник РАМН» и его читатели желают юбиляру долгих
лет жизни, здоровья и дальнейших творческих успехов на
благо медицинской науки.
Документ
Категория
Без категории
Просмотров
138
Размер файла
1 273 Кб
Теги
208
1/--страниц
Пожаловаться на содержимое документа