вход по аккаунту


Single nucleotide polymorphism associated with nonsyndromic cleft palate influences the processing of miR-140.

код для вставкиСкачать
Single Nucleotide Polymorphism Associated With
Nonsyndromic Cleft Palate Influences the
Processing of miR-140
Ling Li,1 Tian Meng,1 Zhonglin Jia,1 Guiquan Zhu,1 and Bing Shi1,2*
State Key Laboratory of Oral Disease, West China College of Stomatology, Sichuan University, Chengdu, PR China
Department of Cleft Lip and Palate Surgery, West China College of Stomatology, Sichuan University, Chengdu, PR China
Received 10 June 2009; Accepted 13 November 2009
Nonsyndromic oral cleft is a common developmental malformation of humans. Embryonic development is regulated by microRNAs. MicroRNA-140-5p (miR-140-5p) was found to regulate
palatal development. As sequence variants in miRNA genes are
likely to affect miRNA expression and/or maturation, we investigated the miRNA-140 gene and identified a SNP (rs7205289:
C>A) located in precursor miRNA-140. We carried out a case–control analysis in 557 patients with nonsyndromic oral clefts
and 306 unaffected controls from west China and found that the
frequency of minor allele (A allele) was significantly increased
(P ¼ 0.003 after Bonferroni correction) in nonsyndromic cleft
palate (NSCP) patients in comparison with that in controls. We
constructed expression vectors of primary miRNA-140 (pri-miR140) with the major and minor alleles of rs7205289. The vectors
were transfected into HEK293 cells, and the mature forms of miR
-140 were detected by Northern blot. Compared to the vector
with the C allele, the vector with the A allele was found to
influence the miR-140 processing, resulting in a significant
decrease of miR-140-5p and an increase of miR-140-3p. These
results suggest that the SNP located in pre-miR-140 contributes
to NSCP susceptibility by influencing the processing of miR-140.
2010 Wiley-Liss, Inc.
Key words: microRNA-140; cleft palate; SNP
Nonsyndromic oral clefts (NSOC) have a prevalence of approximately 1/700 worldwide [Bender, 2000]. There are three main types
of NSOC: nonsyndromic cleft lip (NSCL), nonsyndromic cleft lip
and palate (NSCLP), and nonsyndromic cleft palate (NSCP). The
genesis of NSOC involves numerous cellular and genetic factors
during embryonic development. Vertebrate embryonic development is extensively regulated by microRNAs [Wienholds and
Plasterk, 2005; Wienholds et al., 2005; Darnell et al., 2006; Kloosterman et al., 2006], including craniofacial development [Darnell
et al., 2006].
MicroRNAs (miRNAs) are 22 nucleotide RNAs that regulate
post-transcriptional eukaryotic gene expression. Recently, Eberhart
2010 Wiley-Liss, Inc.
How to Cite this Article:
Li L, Meng T, Jia Z, Zhu G, Shi B. 2010. Single
nucleotide polymorphism associated with
nonsyndromic cleft palate influences the
processing of miR-140.
Am J Med Genet Part A 152A:856–862.
et al. [2008] found that microRNA-140-5p (miR-140-5p) regulated
craniofacial development, because it targeted PDGFRA, and thus
regulated PDGF signaling during neural crest cell migration. In
zebrafish, the reduction of miR-140-5p increased the level of
PDGFRA protein and altered palatal shape and an increased level
of miR-140-5p reduced the PDGFRA protein and caused cleft
palate [Eberhart et al., 2008]. As the interaction of miR-140-5p
and PDGFRA is conserved across species [Eberhart et al., 2008],
human craniofacial development could also be regulated by miR140-5p.
Generally, miRNAs are initially transcribed as primary miRNAs
(pri-miRNA), which are then processed into a 60 nt hairpin
shaped precursor miRNAs (pre-miRNA) by the Drosha–DGCR8
complex [Lee et al., 2003; Han et al., 2004]. Precursor miRNAs are
cleaved by RNase III, Dicer, to produce a 22 base-pair duplex RNA
[Kim, 2005]. The duplex generates mature miRNAs from each of
the strands with different levels, called miRNA-5p and miRNA-3p
[Landgraf et al., 2007]. Subsequently, miRNA guides RNA-induced
silencing complex (RISC) to specific target sites within mRNAs to
induce immediate cleavage or post-translational repression [Song
Grant sponsor: State Key Laboratory of Oral Diseases; Grant Number:
2008.1–2009.12; Grant sponsor: National Science Funds of China; Grant
Number: 30530730.
*Correspondence to:
Bing Shi, Department of Cleft Lip and Palate Surgery, West China College
of Stomatology, Sichuan University, No. 14, Section 3, RenMinNan Road,
Chengdu 610041, PR China. E-mail:
Published online 23 March 2010 in Wiley InterScience
DOI 10.1002/ajmg.a.33236
et al., 2004]. However, the normal miRNA processing can be
influenced by sequence variants in miRNA genes, because processing requires precise structure of the transcripts [Lee et al., 2003; Han
et al., 2004, 2006; Kim, 2005; Winter et al., 2009].
As it has been shown that sequence variants in miRNA genes
could potentially alter miRNA processing and contribute to human
diseases [Gottwein et al., 2006; Duan et al., 2007; Sethupathy and
Collins, 2008], the aim of our study was to investigate if a SNP
located in miR-140 gene could change the processing of that
miRNA and contribute to NSOC phenotype.
Subjects of Case–Control Analysis
Our sample consisted of 557 patients with NSOC and 306 unaffected controls. The patients were ascertained from the Department
of Cleft Lip and Palate Surgery, West China College of Stomatology,
Sichuan University, and the unaffected controls were ascertained
from the West China Women’s and Children’s Hospital, Sichuan
University. The study was prospectively approved by the Ethics
Committee of Sichuan University. The subjects were recruited
between 2005 and 2008, and self-identified as western Han Chinese.
To assess the nonsyndromic status of the affected patients, all were
screened for the presence of associated anomalies [Calzolari et al.,
2007] or syndromes [Cohen, 1978] by a physician, and only those
determined to have an isolated cleft were included in this study.
None of the unaffected controls had signs of oral clefting or
associated anomalies [Calzolari et al., 2007]. Each participant was
interviewed in person by trained interviewers (if the participant was
a child, his/her parents were interviewed), and the participants with
a family history of oral cleft or associated anomalies in first or
second degree relatives were excluded from this study.
Cell Line and Reagents
ABI PRISM 7900HT Sequence Detection System and SDS 2.2
software (Applied Biosystems). The reaction employed the TaqMan
Universal PCR Master Mix, TaqMan primers and probes, water and
5 ng of DNA. The thermal cycle program included one cycle at 95 C
for 10 min to activate the AmpliTaq Gold enzyme activation,
40 cycles at 92 C for 15 sec to denature the DNA and at 60 C for
1 min for the stage of annealing/extension. The sequences of
primers and probes for this polymorphism were 50 -GCTTGGTGGGCTTCTGGT (forward primer), 50 -CCCGGTATCCTGTCCGTGGT (reverse primer), VIC-50 -TAAAACCACTGGCAGGACAC (reporter 1) and FAM-50 -TAAAACCACTGTCAGGACAC
(reporter 2).
Construction of a Recombinant Expression Vector
We used pSUPER RNAi System. Vectors were constructed in
pSUPER containing the H1 RNA polymerase III promoter according to the manufacturer’s instructions. As Drosha function requires
single-stranded RNA extensions outside the pri-miRNA hairpin
[Zeng and Cullen, 2005], the sequence of the mature miR-140 and
the region including 18 nt upstream of the 50 cleavage site of Drosha
and 20 nt downstream of the 30 cleavage site of Drosha were used as
the minimal pri-miRNA [Han et al., 2004] (Fig. 1). The 100 nt
minimal pri-miRNA-140 linked 30 to the sequence 50 -TTTTT-30 .
The oligos were self-annealed in 6 SSC using standard protocols
and ligated on to the BglII and HindIII sites of the vector pSUPER.
The pri-miR-140-C and pri-miR-140-A was generated by introducing a C-A substitution (tctctctctgtgtcctgC/Acagtggttttaccctatggtaggttacgtcatgctgttctaccacagggtagaaccacggacaggataccggggcaccct).
The two kinds of vectors were referred to as pSUPER-miR-140-C
and pSUPER-miR-140-A. We further constructed pSUPER-miR125a which served as a positive control for the miRNA biogenesis
machinery (catgttgccagtctctaggtccctgagaccctttaacctgtgaggacatccagggtcacaggtgaggttcttgggagcctggcgtctggcccaac).
The primers and probes for polymorphism genotyping were purchased from Shanghai Genecore BioTechnologies Co., Ltd
(Shanghai, China). Human HEK293 cells were obtained from State
Key Laboratory of Oral Disease, Sichuan University. The TaqMan
Universal PCR Master Mix was purchased from Applied Biosystems
(Foster City, CA). The pSUPER Vector was purchased from
OligoEngine (Seattle, WA). The oligonucleotides were synthesized
by Takara (Dalian, China). Lipofectamine2000 Reagent was purchased from Invitrogen Corporation (Rockville, MD). DNA probes
complementary to miR-140-5p, miR-140-3p, and miR-125a were
synthesized by Takara Biotechnology Co., Ltd (Dalian, China).
The MEGALABEL Kit (Takara) was used for probe labeling. RNA
size marker was from Ambion (Austin, TX), and positive charged
nylon membrane was from Bio-Rad Laboratories (Hercules, CA).
SNP Genotyping
We drew venous blood samples from participants, and extracted
DNA by a phenol chloroform extraction protocol. The DNA
samples were sequenced by Takara. Genotyping for SNPs was
carried out with 50 nuclease assay (Taqman; Applied Biosystems)
as described [Landi et al., 2008]. Analysis was performed using the
FIG. 1. The SNP is located in pre-miR-140. The stem–loop structure
of pre-miR-140 with major (A) and minor (B) alleles, as predicted
by Mfold [Zuker, 2003], are shown. Mature miRNA nucleotides are
bold highlighted, and the polymorphic nucleotide is underlined.
The free energy calculated by Mfold is indicated on the right. The
arrow indicates the normal cleavage site of Drosha.
Cell Culture and Transfection
Human HEK293 cells were maintained in Dulbecco’s modified
Eagle’s medium (DMEM) supplemented with 10% fetal bovine
serum (FBS) and penicillin/streptomycin. Plasmids were transfected into human HEK293 cells by Lipofectamine 2000 (Invitrogen
Corporation) following the manufacturer’s protocol. After 6 h
of transfection, the medium was replaced by serum-containing
medium and incubated for a further 48 hr.
Case–Control Analysis of SNP
Northern Blot
Total RNA was isolated from the nuclear and cytoplasmic fractions
of cells with Trizol Reagent (Invitrogen Corporation), and separated on 15% TBE urea gel, then transferred at 250 mA. The
transferred RNA was cross-linked to nylon membrane (Bio-Rad
Laboratories) by UV irradiation. Oligonucleotide probes used for
detecting miR-140-5p (50 -CCTACCATAGGGTAAAACCACT),
miR-140-3p (50 -TCCGAGGTTCTACCCTGTGGTA), and miR125a (50 -TCACAGGTTAAAGGGTCTCAC) were labeled according to the manufacturer’s protocol. The membranes were
pre-hybridized at 42 C for 1 hr and hybridized for 12–16 hr at
room temperature (RT). Then, the membranes were washed three
times at RT and once at 42 C with 2 SSC and 0.2 SSC,
respectively, and exposed to X-ray film (Kodak) for 19 hr and
analyzed by densitometer (GS-700; Bio-Rad Laboratories).
Statistical Analysis
Hardy–Weinberg equilibrium was assessed with alpha threshold of
0.05 among the normal controls as samples of the western Han
Chinese population (Table I). Chi-square statistics were used
to assess significance in case–control comparisons. Two-tailed
P value, odds ratio, and 95% confidence intervals (95% CI) were
calculated with the SAS 8.1 statistical software package (SAS
Institute). Bonferroni correction was used to adjust P values.
Identification of SNP Associated With MiR-140
To identify the SNP associated with miR-140, we began with a
bioinformatic search in a miRNA-SNP database (http://www., and verified it on dbSNP (http://www.ncbi.nlm. As a result, we identified that one SNP (rs7205289)
was located in pre-miR-140 (Fig. 1A). Using Mfold [Zuker, 2003],
TABLE I. Cleft Type and Sex of Controls and Patients
we further found that rs7205289 could introduce a base-pairing
mismatch, alter the free energy value, and create an RNA bulge
around the Drosha cleavage site (Fig. 1B). As the precise structure of
the stem outside pre-miRNA was found to be critical for miRNA
processing and could slightly modify the precise cleavage site of
Drosha [Zeng et al., 2005], we hypothesized that the processing of
miR-140 could be influenced by rs7205289.
NSCL, nonsyndromic cleft lip; NSCLP, nonsyndromic cleft lip and palate; NSCP, nonsyndromic
cleft palate; c2, Chi-square.
To confirm the presence of this SNP in the general population,
20 samples [Zhang et al., 2002] were randomly selected from
306 unaffected controls. Eleven samples were sequenced initially
and a single AA genotype was found. The other nine samples were
not sequenced because the minor allele frequency would be 5%
(1/20) [Unneberg et al., 2005] even if we could not find any more
minor alleles in the other nine samples. We hypothesized that miR140 could modulate craniofacial development [Darnell et al., 2006;
Eberhart et al., 2008] and that rs7205289 might have a different
allelic or/and genotypic frequency in NSOC patients. To test our
hypothesis, a case–control study of rs7205289 was undertaken in
557 patients with NSOC and 306 unaffected controls. The patients
were divided by sex and cleft types (Table I). There was no
significant difference in the sex distribution between the patients
and controls, suggesting that our frequency-matching on sex was
satisfactory. According to Hardy–Weinberg equilibrium, the observed genotypic distribution in controls was not different from the
expected distribution using an alpha level of 0.05 as significant
threshold (Table II). Genotypic and allelic frequencies were shown
in Table III. The CC genotype was compared with a group that
contained the other two genotypes (CA þ AA). The genotypic
frequency comparison showed that the frequency of CC genotype
was significantly lower in NSCP patients than that in controls
(P ¼ 0.027 after Bonferroni correction), with an odds ratio of
0.54 (95% CI, 0.36–0.83). However, the genotypic frequency of
NSCL and NSCLP groups were not different from that of the
control group. The allelic frequency comparison showed that the
C allele frequency was significantly decreased in NSCP patients than
that in controls (P ¼ 0.003 after Bonferroni correction), with an
odds ratio of 0.55 (95% CI, 0.38–0.79). However, the C frequency in
patients with NSCL and NSCLP was not significantly different from
that of controls. These results indicated that, compared with the
controls, patients with NSCP had significantly different genotypic
and allelic frequencies of rs7205289.
Construction of MiR-140 Expression Vector
To explore the function of rs7205289, we generated expression
vectors using the pSUPER system. As Drosha function requires
single-strand RNA extensions outside the pre-miRNA hairpin
[Zeng and Cullen, 2005], the minimal pri-miRNA [Han et al.,
2004] of miR-140 was used (Fig. 1A,B). Human HEK293 cells were
transfected with pSUPER-miR-140-C and empty pSUPER vectors.
The expression of miR-140 was assessed by Northern blot (Fig. 2).
Both miR-140-5p and miR-140-3p were increased in the cells
transfected with pSUPER-miR-140-C, compared with that in the
TABLE II. Genotype Frequencies of Controls and Patients followed Expected Hardy–Weinberg Equilibrium Distribution
x 2 (P, df ¼ 2)
90 (85.7%)
14 (13.3%)
1 (0.95%)
234 (82.7%)
45 (15.9%)
4 (1.41%)
113 (66.9%)
47 (27.8%)
9 (5.33%)
241 (78.8%)
59 (19.3%)
6 (1.96%)
NSCL, nonsyndromic cleft lip; NSCLP, nonsyndromic cleft lip and palate; NSCP, nonsyndromic cleft palate; c2, Chi-square. The percentages of genotype frequency are in parentheses.
cells transfected with empty vector (Fig. 2). This result suggests that
pSUPER-miR-140 was sufficient for expression.
Pre-miR-140 SNP Influenced the Processing
of MiR-140
In order to test the function of the minor allele, the C allele was
substituted for the A allele in the expression vector. Human
HEK293 cells were transfected with pSUPER-miR-140-C and
pSUPER-miR-140-A, respectively. The empty pSUPER vector was
used as a negative control. Upon pSUPER-miR-140-C transfection,
we detected the mature form of miR-140-5p and miR-140-3p by
Northern blot, and the quantity of miR-140-5p was higher than that
of miR-140-3p (Fig. 3). However, in the cells transfected with
pSUPER-miR-140-A, we detected a reduction of miR-140-5p and
increase of miR-140-3p, compared with that in cells transfected
with pSUPER-miR-140-C (Fig. 3). This phenomenon could be due
to either altered miRNA processing or a defect in miRNA biogenesis
machinery in the transfected cells [Duan et al., 2007]. To exclude the
possibility that the expression of pSUPER-miR-140-A interfered
with the miRNA biogenesis machinery, we used pSUPER-miR125a as a positive control, because human HEK293 cells do not
express miR-125a endogenously [Landgraf et al., 2007]. After
simultaneously transfecting human HEK293 cells with pSUPERmiR-125a and miR-140 expression vectors, we observed comparable miR-125a expression in the cells with either miR-140 expression
vector (Fig. 3). These results suggest that the miRNA-140 SNP did
not alter the biogenesis machinery of miRNA in human HEK293
cells, and that the vector with the A allele generated less miR-140-5p
and more miR-140-3p than that of the vector with the C allele.
Embryonic development can be regulated by miRNAs at the posttranscriptional level. MicroRNA-140 was found to have a conserved
regulatory role in craniofacial development [Eberhart et al., 2008].
TABLE III. Rs7205289 Genotype and Allele Distributions in Controls and Patients
x 2 (P, df ¼ 2)
90 (85.7%)
14 (13.3%)
1 (0.95%)
95% CI
x 2 (P, df ¼ 2)
95% CI
194 (92.4%)
16 (7.6%)
234 (82.7%)
45 (15.9%)
4 (1.41%)
CC vs. CA þ AA
513 (90.6%)
53 (9.4%)
113 (66.9%)
47 (27.8%)
9 (5.33%)
241 (78.8%)
59 (19.3%)
6 (1.96%)
273 (80.8%)
65 (19.2%)
541 (88.4%)
71 (11.6%)
NSCL, nonsyndromic cleft lip; NSCLP, nonsyndromic cleft lip and palate; NSCP, nonsyndromic cleft palate; c2, Chi-square; OR, odds ratio; NS, not significant after Bonferroni correction.
*P values after Bonferroni correction. The percentages of genotype and allele frequency are in parentheses. The P values less than 0.05 are in bold.
FIG. 2. Human HEK293 cells transfected with pSUPER-miR-140-C
expressed more miR-140-5p and miR-140-3p than those
transfected with pSUPER empty vector.
In the present study, we performed a case–control study and found
that rs7205289, located in pre-miR-140, was associated with an
increased risk of NSCP. In subsequent in vitro analysis, pSUPERmiR-140-A was found to increase miR-140-3p expression and
decrease miR-140-5p expression, compared to pSUPER-miR-140-C.
These data suggest that rs7205289 may contribute to NSCP
susceptibility and the A allele at rs7205289 could influence the
processing of miR-140.
In this study, we found that rs7205289 was associated with NSCP.
After Bonferroni correction, the CC genotypic frequency of patients
with NSCP was significantly lower than that of the unaffected
controls, indicating that, compared with CA and AA genotypes,
the CC genotype has a protective effect on NSCP. There was no
difference in the allelic and genotypic frequencies between patients
with NSCL or NSCLP and controls, indicating that NSCL and
NSCLP may not share a common causal variant with NSCP on miR140 gene. This result is in accordance with previous studies that
NSCL and NSCLP are considered etiologically distinct from NSCP
[Harville et al., 2007; Weinberg et al., 2008]. However, the modest
sample size and Chinese Han ethnic are limitations of this
study. Alarger sample size of patients with NSOC from other ethnic
origins should be performed to confirm the allelic and genotypic
Eberhart et al. [2008] found in zebrafish that an increase of miR140-5p caused cleft palate. On the contrary, we found that the
A allele generated less miR-140-5p, and that the A allele frequency
was increased in patients with NSCP. This discrepancy could be
understood when we take the etiology of NSCP into consideration.
FIG. 3. Human HEK293 cells were transfected with miR-140
expression vector and pSUPER-miR-125a (as a positive control).
Total RNAs isolated from transfected cells was used for Northern
blots as shown. The expression vector of pri-miR-140-A (pSUPERmiR-140-A) produced more miR-140-3p, but less miR-140-5p than
that of pri-miR-140-C (pSUPER-miR-140-C). We used 5S RNA as a
loading control.
NSCP is a multifactorial disease with strong genetic background
[Murray, 2002; Weinberg et al., 2008]. It has been demonstrated
that reduced PDGF signaling during neural crest migration
could lead to the failure of palatal precursors to reach the oral
ectoderm, whereas elevated PDGF signaling could reduce the
number of rostrally migrating crest cells that reach the oral ectoderm and alter palatal shape [Eberhart et al., 2008]. Both of the cases
result in abnormal development of the palate. Therefore, the A allele
probably contributes to NSCP susceptibility as one of its genetic
factors, which could regulate PDGF signaling and may interact with
other factors. In addition, we found that miR-140-3p is increased by
the A allele. However, as the function of miR-140-3p remains
unclear, further studies of miR-140-3p may provide new insights
into the function of rs7205289.
As the amount of common SNPs in miRNA genes is less than that
in miRNA target sites [Saunders et al., 2007], most recent studies
focused on the SNPs in miRNA target sites. However, polymorphisms in miRNA genes, including pri-miRNA, pre-miRNA and
mature miRNA, could impact various biological processing
[Gottwein et al., 2006; Duan et al., 2007; Georges et al., 2007;
Saunders et al., 2007; Yu et al., 2007; Sethupathy and Collins, 2008].
In this study, we found that the A allele generated a bulge on the
stem, altered the free energy value at the cleavage site of Drosha, and
thus probably influenced miRNA processing. This is consistent
with previous studies suggesting that variations around the Drosha
cleavage site could fine-tune the actual cleavage sites [Zeng and
Cullen, 2003; Zeng et al., 2005]. Therefore, our result demonstrates
the function of SNPs, especially those located at the Drosha cleavage
site in pre-miRNA genes, is important for miRNA processing.
Our results suggest that the A allele might induce cleavage site
shift and thereby influence the processing of miR-140. There are
two possible explanations for this phenomenon. First, as both primiR-140-C and pri-miR-140-A could effectively generate miR-140
-5p and miR-140-3p, the SNP may not disturb the biogenesis
machinery of miR-140. Second, although miRNA processing includes cleavage by Drosha and Dicer, Drosha actually selects its
cleavage site, dictates where Dicer will cleave and hence, which
strand of the miRNA duplex enters RISC [Lee et al., 2003; Bartel,
2004]. In our study, RISC favored miR-140-5p from pri-miR-140C and miR-140-3p from pri-miR-140-A, respectively. Given the
fact that RISC favors the strand with relatively unstable 50 -end in the
duplex [Schwarz et al., 2003], we suggest that miRNA duplexes
generated by pri-miR-140-C and pri-miR-140-A may have different 50 -ends with different stabilities. This difference might come
from the shift of Drosha cleavage site because of rs7205289.
However, further studies should be conducted to confirm our
In summary, our findings show that rs7205289 in pre-miR-140
may contribute to NSCP susceptibility by influencing the processing of miR-140. We suggest a pathogenic correlation among
the SNP, miRNA, and NSCP. Further exploration of these
miRNA-associated SNPs would improve our understanding of the
potential contribution of these SNPs to the pathogenesis of human
This study was supported by the State Key Laboratory of Oral
Diseases (2008.1–2009.12) and the National Science Funds of
China (30530730). We thank the participants who donated samples
to this study.
Eberhart JK, He XJ, Swartz ME, Yan YL, Song H, Boling TC, Kunerth AK,
Walker MB, Kimmel CB, Postlethwait JH. 2008. MicroRNA Mirn140
modulates Pdgf signaling during palatogenesis. Nat Genet 40:290–298.
Georges M, Coppieters W, Charlier C. 2007. Polymorphic miRNA-mediated gene regulation: Contribution to phenotypic variation and disease.
Curr Opin Genet Dev 17:166–176.
Gottwein E, Cai XZ, Cullen BR. 2006. A novel assay for viral microRNA
function identifies a single nucleotide polymorphism that affects Drosha
processing. J Virol 80:5321–5326.
Han JJ, Lee Y, Yeom KH, Kim YK, Jin H, Kim VN. 2004. The DroshaDGCR8 complex in primary microRNA processing. Genes Dev
Han JJ, Lee Y, Yeom KH, Nam JW, Heo I, Rhee JK, Sohn SY, Cho YJ, Zhang
BT, Kim VN. 2006. Molecular basis for the recognition of primary
microRNAs by the Drosha-DGCR8 complex. Cell 125:887–901.
Harville EW, Wilcox AJ, Lie RT, Abyholm F, Vindenes H. 2007. Epidemiology of cleft palate alone and cleft palate with accompanying defects. Eur
J Epidemiol 22:389–395.
Kim VN. 2005. MicroRNA biogenesis: Coordinated cropping and dicing.
Nat Rev Mol Cell Biol 6:376–385.
Kloosterman WP, Wienholds E, de Bruijn E, Kauppinen S, Plasterk RH.
2006. In situ detection of miRNAs in animal embryos using LNAmodified oligonucleotide probes. Nat Methods 3:27–29.
Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S,
Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci
V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU,
Schermer B, Bissels U, Inman J, Phan Q, Chien MC, Weir DB, Choksi R,
De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G,
Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju
JY, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio
A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. 2007. A
mammalian microRNA expression atlas based on small RNA library
sequencing. Cell 129:1401–1414.
Landi D, Gemignani F, Naccarati A, Pardini B, Vodicka P, Vodickova L,
Novotny J, Forsti A, Hemminki K, Canzian F, Landi S. 2008. Polymorphisms within micro-RNA-binding sites and risk of sporadic colorectal cancer. Carcinogenesis 29:579–584.
Lee Y, Ahn C, Han JJ, Choi H, Kim J, Yim J, Lee J, Provost P, Radmark O,
Kim S, Kim VN. 2003. The nuclear RNase III Drosha initiates microRNA
processing. Nature 425:415–419.
Murray JC. 2002. Gene/environment causes of cleft lip and/or palate. Clin
Genet 61:248–256.
Bartel DP. 2004. MicroRNAs: Genomics, biogenesis, mechanism, and
function. Cell 116:281–297.
Bender PL. 2000. Genetics of cleft lip and palate. J Pediatr Nurs 15:242–249.
Calzolari E, Pierini A, Astolfi G, Bianchi F, Neville AJ, Rivieri F. 2007.
Associated anomalies in multi-malformed infants with cleft lip and
palate: An epidemiologic study of nearly 6 million births in 23 EUROCAT
registries. Am J Med Genet Part A 143A:528–537.
Saunders MA, Liang H, Li WH. 2007. Human polymorphism at microRNAs and microRNA target sites. Proc Natl Acad Sci USA
Schwarz DS, Hutvagner G, Du T, Xu ZS, Aronin N, Zamore PD. 2003.
RISC—Asymmetry in the assembly of the RNAi enzyme complex. Cell
Sethupathy P, Collins FS. 2008. MicroRNA target site polymorphisms and
human disease. Trends Genet 24:489–497.
Cohen MM Jr. 1978. Syndromes with cleft lip and cleft palate. Cleft Palate J
Song JJ, Smith SK, Hannon GJ, Joshua-Tor L. 2004. Crystal structure of
argonaute and its implications for RISC slicer activity. Science
Darnell DK, Kaur S, Stanislaw S, Konieczka JK, Yatskievych TA, Antin PB.
2006. MicroRNA expression during chick embryo development. Dev
Dyn 235:3156–3165.
Unneberg P, Stromberg M, Sterky F. 2005. SNP discovery using advanced
algorithms and neural networks. Bioinformatics 21:2528–2530.
Duan RH, Pak CH, Jin P. 2007. Single nucleotide polymorphism associated
with mature miR-125a alters the processing of pri-miRNA. Hum Mol
Genet 16:1124–1131.
Weinberg SM, Brandon CA, McHenry TH, Neiswanger K, Deleyiannis FW,
de Salamanca JE, Castilla EE, Czeizel AE, Vieira AR, Marazita ML. 2008.
Rethinking isolated cleft palate: Evidence of occult lip defects in a subset
of cases. Am J Med Genet Part A 146A:1670–1675.
Wienholds E, Plasterk RH. 2005. MicroRNA function in animal development. FEBS Lett 579:5911–5922.
Zeng Y, Cullen BR. 2003. Sequence requirements for micro RNA processing
and function in human cells. RNA 9:112–123.
Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E,
de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RHA. 2005. MicroRNA
expression in zebrafish embryonic development. Science 309:310–
Zeng Y, Cullen BR. 2005. Efficient processing of primary microRNA
hairpins by drosha requires flanking nonstructured RNA sequences.
J Biol Chem 280:27595–27603.
Winter J, Jung S, Keller S, Gregory RI, Diederichs S. 2009. Many roads to
maturity: microRNA biogenesis pathways and their regulation. Nat Cell
Biol 11:228–234.
Yu ZB, Li Z, Jolicoeur N, Zhang LH, Fortin Y, Wang E, Wu MQ, Shen SH.
2007. Aberrant allele frequencies of the SNPs located in microRNA target
sites are potentially associated with human cancers. Nucleic Acids Res
Zeng Y, Yi R, Cullen BR. 2005. Recognition and cleavage of primary
microRNA precursors by the nuclear processing enzyme Drosha. EMBO
J 24:138–148.
Zhang K, Calabrese P, Nordborg M, Sun F. 2002. Haplotype block structure
and its applications to association studies: Power and study designs. Am J
Hum Genet 71:1386–1394.
Zuker M. 2003. Mfold web server for nucleic acid folding and hybridization
prediction. Nucleic Acids Res 31:3406–3415.
Без категории
Размер файла
142 Кб
mir, nonsyndromic, associates, polymorphism, nucleotide, single, cleft, 140, palate, influence, processing
Пожаловаться на содержимое документа