close

Вход

Забыли?

вход по аккаунту

?

Презентация: Посредник Д. В.

код для вставкиСкачать
 Влияние РНК-интерференции Влияние РНК-интерференции на на экспрессию
экспрессию
гена гена AML1-ETO
AML1-ETO
Д. В. Посредник
Д. В. Посредник
научный руководитель В. В. Гринев
научный руководитель В. В. Гринев
Белорусский государственный университет
Белорусский государственный университет
кафедра генетики
кафедра генетики
Цель:
Цель:
оценка эффективности подавления экспрессии гибридного гена aml
1-
eto с помощью РНК-интерференции в клетках ОМЛ линий Kasumi
-1 и SKNO
-1. Задачи:
Задачи:
Оценить эффективность подавления экспрессии гибридного Оценить эффективность подавления экспрессии гибридного гена гена aml
aml
1-
1-
eto eto в клетках ОМЛ линий в клетках ОМЛ линий Kasumi
Kasumi
-1 и -1 и SKNO
SKNO
-1 с -1 с помощью РНК-интерференции, запускаемой кшРНК.
помощью РНК-интерференции, запускаемой кшРНК.
Синтезировать и клонировать последовательность, Синтезировать и клонировать последовательность, кодирующую искусственные анти-
кодирующую искусственные анти-
AML
AML
1-
1-
ETO ETO микроРНК.
микроРНК.
Разработать челночный плазмидный вектор Разработать челночный плазмидный вектор pDsRed
pDsRed
1/
1/
amiAML
amiAML
1-
1-
ETO
ETO
, кодирующий искусственные
, кодирующий искусственные
анти-
анти-
AML
AML
1-
1-
ETO ETO микроРНК, и изучить его функциональную микроРНК, и изучить его функциональную активность.
активность.
Оценить эффективность подавления экспрессии гибридного Оценить эффективность подавления экспрессии гибридного гена гена aml
aml
1-
1-
eto eto в клетках ОМЛ линий в клетках ОМЛ линий Kasumi
Kasumi
-1 и -1 и SKNO
SKNO
-1 с -1 с помощью РНК-интерференции, запускаемой искусственными помощью РНК-интерференции, запускаемой искусственными анти-
анти-
AML
AML
1-
1-
ETO ETO микроРНК.
микроРНК.
Основные понятия:
Основные понятия:
РНК-интерференция — это механизм подавления РНК-интерференция — это механизм подавления экспрессии гена, то есть проявления данного гена в экспрессии гена, то есть проявления данного гена в организме в форме определенного признака на организме в форме определенного признака на стадии трансляции.
стадии трансляции.
МикроРНК — класс некодирующих РНК, которые МикроРНК — класс некодирующих РНК, которые имеют длину около 22 нуклеотидов. Эти РНК играют имеют длину около 22 нуклеотидов. Эти РНК играют важную роль в регуляции трансляции и деградации важную роль в регуляции трансляции и деградации мРНК.
мРНК.
кшРНК – то же, что и микроРНК, но внеклеточного кшРНК – то же, что и микроРНК, но внеклеточного происхождения, то есть, не кодируются геномом происхождения, то есть, не кодируются геномом клетки и не проходят процессинг в ядре.
клетки и не проходят процессинг в ядре.
wt
5’
LTR
y
RRE
cPPt
P
SFFV
eGFP
WPRE
SIN
3’
LTR
P
H
1
смысловая петля антисмыловая терминатор
нить нить wt
5’
LTR
y
RRE
cPPt
P
SFFV
eGFP
WPRE
SIN
3’
LTR
Схема строения лентивирусных векторов доставки pHR
’
SINcPPT
-
SEW
(А) и
pHR
-
shAML
1/
ETO
(Б).
А)
Б)
Эффективность трансдукции клеток линий Kasumi
-1 (А) и
SKNO
-1 (Б) VSV
-
G
псевдотипированным лентивирусом, основанным на векторе р
HR
-
shAML
1/
ETO
.
Б)
99.94
%
(
9706.17
)
M1
98.21
%
(
7394.08
)
А)
Флуоресценция
Искусственное подавление белка AML
1-
ETO
с помощью anti
-
AML
1-
ETO коротких интерферирующих РНК в клетках острого миелоидного лейкоза линий Kasumi
-1 (А) и SKNO
-1 (Б).
AML
1-
ETO
®
GAPDH
®
Контроль
pHR’SINcPP
T-SEW
pHR
-
shAML
1/
ETO
130
95
43
A
AML
1-
ETO
®
GAPDH
®
Контроль
pHR’SINcPP
T-SEW
pHR
-
shAML
1/
ETO
130
95
43
Б
F
_
AML
1-
ETO
é
BamH
I
ù
é
перекрывающаяся область
ù
5’-
AT
GGATCC
AGTGAGCGCACCTCGAAATCGAATACTGAGA
AGGGTGAAGCCACAGATG
-
3’
R
_
AML
1-
ETO
é
SalI
ù
é
перекрывающаяся область
ù
5'-
GTC
GTCGAC
AGTAGGCAAACCTCGAAATCGTACTGAGAAGA
CATCTGTGGCTTCACCCT
-3'
Сиквенс олигонуклеотидов
и их вторичная структура, рассчитанная с помощью программного пакета Mfold
3.2 ([
Na
+
] = 60 mM
, [
Mg
2+
] = 1.5 mM
и +37
o
C
).
Карта челночного плазмидного вектора pDsRed
1-С1.
А)
Б)
Вторичные структуры DsRed1 mRNA
(А) и DsRed1/AML1-ETO mRNA
(Б), рассчитанные с помощью программного пакета Mfold
pre-
mir
-
30
a
/
AML
1-
ETO
Б)
pEGFP-C1 pDsRed1-C1 pDsRed1/amiAML1-ETO
0.5
1.0
1.5
0
20
40
60
80
100
120
Тип челночного плазмидного
вектора
Положитель
ные по репо
ртерному бе
лку клетки, %
Результаты котрансфекции челночными плазмидными векторами
pDsRed
1-
C
1, pDsRed
1/
amiAML
1-
ETO
и
pEGFP
-
C
1 клеток линии 293Т НЕК A)
Б
)
Свет
Зеленая флуоресценция
Красная флуоресценция
В
)
A)
Б
)
wt
5’
LTR
y
RRE
cPPt
P
CMV
DsRed
1
IRES
eGFP WPRE
SIN
3’
LTR
wt
5’
LTR
y
RRE
cPPt
P
CMV
IRES
eGFP
WPRE
DsRed
1/
amiAML
1-
ETO
SIN
3’
LTR
Схема строения лентивирусных векторов доставки
pHR-CMV-DRep (A) и
pHR-CMV-DRep/amiAML1-ETO
(
Б
)
Эффективность трансдукции клеток линий Kasumi
-1 и SKNO
-1 DRep
/
Control
/
v
.01 и
pHR
-
DRep
/
amiAML
1-
ETO
/
v
.01
VSV
-
G
-псевдотипированными лентивирусами. Стабильность наследования лентивирусных векторов DRep
/
Control
/
v
.01 и
pHR
-
DRep
/
amiAML
1-
ETO
/
v
.01 в клетках линий Kasumi
-1 и SKNO
-1, интегрировавшихся в геном.
AML1-ETO
®
GAPDH ®
Mock
DRep/Con
trol/v.01
, нативный
pHR-DRep
/amiAML1
-ETO/v.01
, нативынй
DRep
/
Control
/
v
.01
10- кратно
сконцентри
рованный
pHR
-
DRep
/
amiAML
1-
ETO
/
v
.01
10- кратно
сконцентри
рованный
DRep
/
Control
/
v
.01
, суперинф
екция
pHR
-
DRep
/
amiAML
1-
ETO
/
v
.01
, суперинф
екция
130
95
43
Выводы были озвучены по ходу доклада.
Выводы были озвучены по ходу доклада.
автор благодарен
автор благодарен
С.В. Глушену за помощь в проведении С.В. Глушену за помощь в проведении микроскопических исследований
микроскопических исследований
И.Н. Северину за помощь в проведении И.Н. Северину за помощь в проведении цитометрических исследований
цитометрических исследований
D
D
. . Trono
Trono
за предоставленные вектора за предоставленные вектора pCMV
pCMV
_
_
dR
dR
8.91 и 8.91 и pMD
pMD
2.
2.
G
G
M
M
. . Scherr
Scherr
за базовый лентивирусный вектор доставки за базовый лентивирусный вектор доставки pHR-SINcPPT-SIEW
pHR-SINcPPT-SIEW
O
O
. . Heidenreich
Heidenreich
за векторы за векторы pHR
pHR
’
’
SINcPPT
SINcPPT
-
-
SEW
SEW
и и pHR
pHR
-
-
shAML
shAML
1/
1/
ETO
ETO
сотрудникам лаборатории клеточной и молекулярной сотрудникам лаборатории клеточной и молекулярной биологии лейкозов за помощь в проведениях биологии лейкозов за помощь в проведениях исследований
исследований
Спасибо за внимание.
Спасибо за внимание.
вернуться к началу презентации
Автор
dostelon
Документ
Категория
Презентации
Просмотров
139
Размер файла
1 678 Кб
Теги
посредники, презентация
1/--страниц
Пожаловаться на содержимое документа