close

Вход

Забыли?

вход по аккаунту

?

Реферат: Посредник Д. В.

код для вставкиСкачать
БЕЛОРУССКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ
Выпускная работа по
«Основам информационных технологий»
Магистрант
кафедры генетики
Посредник Дмитрий Вячеславович
Руководители:
Доцент Гринев ВасилийВикторович,
Старший преподаватель Шешко Сергей Михайлович
Минск – 2009 г.
Оглавление
Оглавление
.....................................................................................................................................................................
2
Реферат на тему «Применение Интернет-ресурсов в молекулярной генетике».
...................................................
3
Введение.
.................................................................................................................................................................
3
Глава 1. Программный пакет Mfold 3.2.
...............................................................................................................
3
Глава 2. Vienna RNA Package.
................................................................................................................................
4
Глава 3. BD CellQuest Pro Software.
......................................................................................................................
7
Заключение.
...........................................................................................................................................................
10
Список литературы.
....................................................................................................................................................
11
Интернет-ресурсы в предметной области исследования.
.................................................................................
12
Предметный указатель к реферату.
...........................................................................................................................
13
Действующий личный сайт в WWW.
.......................................................................................................................
14
Граф научных интересов.
...........................................................................................................................................
15
Реферат на тему «Применение Интернет-ресурсов в
молекулярной генетике».
Введение.
Молекулярная генетика представляет собой одну из самых больших
частей биологического знания. Продолжая активно развиваться, она
привлекает большие объемы информации из математики, физики, химии,
целого спектра биологических дисциплин. Для успешного и эффективного
использования этого огромного комплекса знаний исследователями-
генетиками необходимо применение всевозможных компьютерных
технологий, важнейшей из которых является Интернет. В настоящее
разработаны различные онлайновые программы, базы данных (так
называемые банки генов), олигокалькуляторы и тому подобные Интернет-
ресурсы. Это не только облегчает работу молекулярных генетиков, делает
эксперименты дешевле, но и открывает новые направления научных
исследований.
Приоритетным направлением наших исследований в молекулярной
генетике является изучение влияния онкогена aml
1-
eto
на прогрессию
острого миелоидного лейкоза. Для выяснения его роли в течении этого
заболевания предполагается полное отключение экспрессии этого гена
посредством малых интерферирующих РНК. Для разработки таких РНК мы
использовали такие Интернет-ресурсы как Mfold
3.2,
Vienna
RNA
Packag
e
, а
также программный пакет BD CellQuest Pro Software
для обработки
результатов, полученных с помощью проточного цитофлуориметра. Глава 1. Программный пакет Mfold 3.2.
В связи с тем, что наша работа была связана с разработкой бицистронной
экспрессионной кассеты, с одной из частей которой считывалась бы анти-
aml
1/
eto
-микроРНК, прежде всего надо было рассмотреть ряд кандидатур среди
имеющихся микроРНК
, способных подавить экспрессию мРНК
онкогена aml
1-
eto
. Произвести такой анализ можно используя программный пакет Mfold
3.2
.
Он доступен по Интернету (http://www.bioinfo.rpi.edu/applications/mfold/cgi-
bin/rna-form1.cgi) и позволяет предсказывать фолдинг
и гибридизацию
нуклеиновых кислот. В данном разделе мы подробнее остановимся на фолдинге
РНК.
Сам по себе фолдинг РНК
довольно сложен и зависит от многих
параметров, основными из которых являются комплиментарность оснований,
минимальная энергия Гиббса
, наличие катионов одновалентных и
двухвалентных металлов, температуры и места положения нуклеотидов
относительно соседей. Кроме этого, есть еще множество дополнительных
параметров, таких как образование неспецифических пар (
G
-
C
) или множество
вариантов образования шпилек на молекуле. Учитывая эти параметры,
программа может предложить нам несколько вариантов предположительной
вторичной структуры РНК, которые могут существовать в клетке.
Для того, чтобы начать работу, необходимо пройти по ссылке
http://www.bioinfo.rpi.edu/applications/mfold/cgi-bin/rna-form1.cgi. и в поле для
сиквенса ввести последовательность РНК. Далее произвести настройку
будущего фолдинга, заполнив предложенную форму на этой же странице, если
это необходимо. После чего нажать на кнопку “
Fold
RNA
”. Программа
генерирует различные варианты фолдинга при заданных условиях. В верхнем
поле представлена введенная последовательность РНК. Далее предлагается
список возможных вариантов фолдинга молекулы. Каждый пункт списка
предполагает отображение конечного результата в ивде рисунков или таблиц.
В качестве примера пользования Mfold
3.2
произведем фолдинг молекулы
РНК, сиквенс
которой представлен на рис. 1 (рис. 2).
CGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCAC
CGGCAAGCUGCCCGUGCCC
UGGCCCACCCUCGUGACCACCCUGACCUACGG
CGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUU
CAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAA
GGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACAC
CCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAA
CAUCCUGGGGCACAAGCUGGAGUACAACUACAAC
Рис. 1. Сиквенс молекулы РНК.
Напомним, что наиболее приемлемым вариантом из предложенных
программой является тот, который обладает минимальной энергией Гиббса.
Глава 2. Vienna RNA Package.
Интернет-ресурс Vienna RNA Package
предназначен для расчетов
различных параметров молекул РНК, таких как фолдинг, минимальная
энергия молекулы, температура плавления
молекулы и др. В наших
исследования этот ресурс использовался в качестве верификатора данных,
полученных с помощью Mfold
3.2. Попасть на страницу ресур
c
а можно пройдя по ссылке
http://rna.tbi.univie.ac.at
. На странице перечислены серверы для расчетов
различных параметров молекул РНК. В наших исследованиях мы использовали
RNAfold server. При работе с ним первый шаг предполагает загрузку сиквенса в
специальное поле и настройку будущих результатов, второй - это просмотр
результатов, рассчитанных сервером. Результаты отображаются в виде
рисунков и графиков (рис. 3 и 4).
Рис. 2. Варианты фолдинга одной и той же молекулы РНК по Mfold
3.2.
Данный ресурс отображает только один из вариантов фолдинга,
обладающий минимальной энергией Гиббса.
Рис. 3. Графическое отображение результатов фолдинга в Vienna RNA
Package
.
Рис. 4. Отображение термодинамических характеристик молекулы,
представленной на рис. 3, в виде графиков.
R1
M1
Глава
3. BD CellQuest Pro Software.
В настоящее
время для результатов модификаций эукариотических
клеток наряду с различными видами микроскопии используют проточную
цитофлуориметрию
. Цитофлуориметры позволяют производить измерения
по сразу нескольким параметрам большого количества клеток за очень
короткие промежутки времени. Для статистической обработки результатов,
полученных посредством этих приборов, используют различные пакеты
программ. В наших исследованиях мы использовали BD CellQuest Pro
Software
. Данный программный пакет предназначен для компьютеров
Macintosh®
с операционной системой не моложе Mac
OS
X
.1
. Результаты
первичных данных отображаются в виде графиков различного типа (рис. 5)
Рис. 5. Варианты вывода данных при измерении с помощью проточного
цитофлуориметра.
Во время проведения измерения графики динамичны и их структура
изменяется в зависимости от снятых с каждой клетки параметров и от
увеличения общего числа измеренных клеток. В дальнейшем для обработки
результатов необходимо ограничить количество анализируемых событий
исходя из целей исследования. Для этого применяется набор различных
инструментов типа Regions
и Gates
, позволяющих отбросить не
интересующие нас события или события, могущие помешать корректной
оценке результатов. Скажем, что под событием здесь подразумеваются
результаты измерения одной клетки. На графике одно событие
представляется в виде точки, совокупность событий отображается как кривая
различного цвета. Группа событий видна на графике в виде облака различной
формы. Так как исследуемые клетки различаются друг от друга по
различным параметрам, то необходимо выделить только ту область облака,
которая будет содержать только те события, которые не приведут к ошибке
при анализе результатов или сделают ее минимальной. Для наглядности
приведем следующий пример. Допустим, клеточная популяция была
котрансдуцирована рекомбинантными лентивирусами
, геномы которых
содержали два репортерных гена, экспрессия которых приводила к наработке
в клетках, двух флуоресцирующих белков, красного и зеленого. Если в
клетку попадает первый лентивирус, то синтезируется красный белок, а если
второй – зеленый. Естественно, что в клеточной популяции будут клетки,
трансдуцированные только первым лентивирусом, только вторым и клетки, в
которые попали сразу оба лентивируса, а также нетрансдуцированные
клетки. Помимо этого, клеточная популяция разделится на живые и мертвые
клетки. При измерении клеток данной популяции проточный
цитофлуориметр даст сведения о каждой измеренной клетке в виде дот-плота
или какого-либо другого варианта графика. На дот-плоте будет облако,
состоящее из точек – событий. Для исследований нам необходимо получить
информацию о клетках, трансдуцированных только одним из лентивирусов
или обоими сразу, но не о мертвых и нетрансдуцированных клетках.
Поэтому, зная параметры живых, трансдуцированных и
нетрансдуцированных клеток на первоначальном графике мы вручную
ограничиваем те части облака, которые будут принадлежать вышеуказанным
группам клеток. Именно эти части и будут обсчитываться в дальнейшем (рис.
6).
Рис. 6. Выделение областей облака при помощи инструментов типа
Regions
и Gates
.
Выделять различные части облака можно и автоматически при помощи
инструмента Snap
-
To
(захват) рис 7.
Этот инструмент также можно настраивать, но мы не будем на этом
останавливаться.
Возможности данного программного пакета таковы, что можно
редактировать уже полученные данные меняя размеры огранниченых
участков на первоначально полученных графиках. Это довольно удобно, так
как с одного замера клеточной популяции можно получать дополнительные
результаты по мере возникновения необходимости в них.
После получения первоначальных данных и выбора спектра
необходимых событий проводится статистическая обработка. BD CellQuest
Pro Software позволяет провести:
1)
статистическую обработку каждого графика событий или группы
таких графиков;
1)
тест Колмогорова-Смирнова;
2)
статистику для участков, ограниченных инструментами Regions
и
Gates
как для каждого участка в отдельности, так и общую;
3)
статистику графика с квадрантами для всех квадрантов и для
каждого в отдельности.
Рис. 7. Автоматический захват с помощью инструмента Snap
-
To
.
Конечный результат обработки данных имеет вид таблицы (рис. 8).
Рис. 8. Конечный вид результатов после их обработки.
Заключение.
В заключение отметим, что каждый шаг в исследованиях по
молекулярной генетике не обходится без использования широкого спектра
Интернет-ресурсов, а также большого множества различных приложений.
Сейчас уже можно говорить о том, что компьютер стал не просто
помощником, а полноценным инструментом в руках ученых, причем
развитие специальных программ и программных пакетов с каждым годом все
быстрее из-за увеличения на них спроса.
Список литературы
.
1.
BD CellQuest Pro Software User’s Guide – Part No 349226 Rev. A – July
2002
2.
Molecular Biology – © Virtual Text/ www. ergito.com
3.
Molecular Biology of the Gene. J.D. Wotson et al. – Fifth edition, CSHL
Press
Интернет-ресурсы в предметной области
исследования.
http://www.bioinfo.rpi.edu/applications/mfold/cgi-bin/rna-form1.cgi
- ресурс,
позволяющий рассчитать трехмерную структуру сложных биомолекул с
одновременным расчетом термодинамических параметров;
http://rna.tbi.univie.ac.at
. – ресур аналогичный первому, но вместо целого
набора вероятных структур одной молекулы предсталяет лишь наиболее
термодинамическивероятную;
Предметный указатель к реферату.
BD CellQuest Pro Software
.......................................
7
Mac OS X.1
................................................................
7
Mfold 3.2
....................................................................
3
Regions и Gates
..........................................................
7
Snap-To
......................................................................
8
Vienna RNA Package
.................................................
4
микроРНК
..................................................................
3
мРНК
..........................................................................
3
проточного цитофлуориметра.
................................
7
проточную цитофлуориметрию
..............................
7
рекомбинантными лентивирусами
.........................
7
РНК
............................................................................
3
сиквенс
.......................................................................
4
температура плавления
............................................
4
фолдинг
.....................................................................
3
энергия Гиббса
..........................................................
3
Действующий личный сайт в WWW
.
http
://
www
.
Paganelius
.
narod
.
ru
Граф научных интересов.
магистранта Посредника Д.В. биологический факультет
Специальность биология
Смежные специальности
03.00.15 – генетика
1.
Медицинская генетика.
Наследование признаков
человека. Хромосомные
мутации и наследственные
болезни человека.
Генетические аспекты
канцерогенеза. Методы
диагностики
предрасположенности к
наследственным
заболеваниям.
Генотерапия.
Экологическая генетика
человека.
Основная специальность
03.00.26 – молекулярная
генетика
1.
Молекулярная организация
ядерного генома и
структура гена.
2.
Экспрессия генов и ее
регуляция.
3.
Гены и регуляторные
структуры, определяющие
процессы транскрипции и
трансляции.
4.
Методы локализации и
клонирования генов.
5.
Секвенирование ДНК,
генов, геномов.
6.
Конструирование
рекомбинантных молекул
ДНК, синтез генов.
7.
Механизмы генетической
трансформации
организмов.
8.
Молекулярные методы
идентификации трансгенов,
их экспрессия в
генетически
модифицированных
организмах.
Сопутствующие специальности
03.00.06 – вирусология
1.
Генетика вирусов,
структурная организация
генома вирусов,
картирование вирусного
генома, разработка способов
увеличения информационной
емкости вирусного генома,
исследование процессов,
контролирующих
наследственность и
изменчивость вирусов,
изучение генетических и
негенетических
взаимодействий между
вирусами. 2.
Генная инженерия,
использование вирусов как
векторов для доставки
ксеногенного и
дополнительного
генетического материала в
восприимчивую клетку,
исследования генетических и
негенетических
взаимодействий клетки и
вируса.
Автор
dostelon
Документ
Категория
Без категории
Просмотров
99
Размер файла
371 Кб
Теги
посредники, рефераты
1/--страниц
Пожаловаться на содержимое документа