close

Вход

Забыли?

вход по аккаунту

?

BIOLOĢIJA vidusskolai 1

код для вставкиСкачать
Dzintra Porozova, Juris Porozovs, Liga Sausiņa
57(075.3) Po 672 Irēnas Žgutas dizains un vāka noformējums Mākslinieks Aivars Rušmanis Grāmatā izmantoti L. Sausiņas zīmējumi, kā arī A. Seisuma fotoattēli un Apgāda Zvaigzne ABC arhīva materiāli CD. Cēdere, J. Logins "Organiskā ķīmija ar ievirzi bioķīmijā") Dzintra Porozova, Juris Porozovs, Līga Sausiņa BIOLOĢIJA VIDUSSKOLAI 1. DAĻA Grāmata aprobēta Krimuldas vidusskolā Redaktore Agnese Biteniece Māksi, redaktore Irēna Zguta Tehn. redaktore Iveta Kļaviņa Maketētāja Egija Bļinova Apgāds Zvaigzne ABC, SIA, K. Valdemāra ielā 6, Rīgā, LV-1010. Red. nr. B-42. A/s Preses nams Visas šī darba tiesības ir aizsargātas. Izdevumu reproducēt, kopēt vai citādi pavairot aizliegts bez apgāda rakstiskas atļaujas. © Apgāds Zvaigzne ABC, 2005 ISBN 9984-22-887-8 Skolēni un skolotāji! Jūsu rokās ir pirmā grāmata Bioloģija vidusskolai, 1. dala (1.-6. nodaļa), kas pa-
redzēta bioloģijas apgūšanai 10. klasē. Tajā aplūkota šūnu uzbūve, daudzveidība, ķīmiskā sastāva un vielmaiņas norises, kā arī šūnu un organismu vairošanās un iedzimtības likum-
sakarības. Grāmatā iekļauti temati, kuri saistīti ar jauniem un aktuāliem bioloģijas pētī-
jumu virzieniem, piemēram, gēnu inženieriju. Skolotāji var izvēlēties, kurus tematus apgūt detalizētāk, kurus - vispārīgāk. Grāmatā ir plašs ilustratīvais materiāls - zīmējumi, fotoattēli, tabulas un shēmas, kas vizuāli papildina mācību saturu. Informācija, kas pārsniedz programmas ietvarus, iespiesta sīkākā drukā. Katra grāmatas nodaļa sadalīta apakšnodaļās, kuru noslēgumā ir jautājumi un uzdevumi. Jautājumi domāti zināšanu paškontrolei - pēc zināšanu apgūšanas katram uz tiem jāprot atbildēt. Uzdevumi paredzēti zināšanu nostiprināšanai, vispārināšanai, padziļināšanai un radošās darbības rosināšanai. Tiem seko atkārtojamo un jaunapgūstamo jēdzienu uzskaitījums. Uzdevumu izpildi atvieglos piktogrammas, kas norāda uz atsevišķu uzdevumu izpildes specifiku. Uzdevumu ieteicams pildīt rakstiski. Uzdevumam ir augsta grūtības pakāpe. Uzdevuma izpildei jāizmanto papildliteratūra vai citi uzziņas avoti. Ieteicams strādāt grupā. Jaunapgūtie jēdzieni. Grāmatas beigās ievietota jēdzienu skaidrojošā vārdnīca, alfabētiskais rādītājs un zi-
nāšanu dziļākai apguvei izmantojamās papildliteratūras un citu uzziņas avotu saraksts, kā arī interneta adreses. Autori un izdevējs gaidīs jūsu ierosinājumus, labojumus un kritiku, kas palīdzēs grā-
matas pilnveidošanā. Sūtiet tos izdevniecības Apgāds Zvaigzne ABC Dabaszinātņu redak-
cijai (dabaszinibas@zvaigzne.lv). Autori SATURS IEVADS 6 Bioloģijas zinātne 6 1. ORGANISMI UN TO PĒTĪŠANA 9 1.1. Dzīvības pamatpazīmes 9 1.2. Dzīvības organizācijas līmeņi 10 1.3. Bioloģijas pētniecības metodes 12 2. ŠŪNU UZBŪVE UN DAUDZVEIDĪBA .. 14 2.1. Sūnu teorijas rašanās 14 2.2. Mikroskopijas attīstība 15 2.3. Sūnapvalks, šūnas plazmatiskā membrāna 16 2.4. Vielu transports caur šūnas plazmatisko membrānu 17 2.5. Pasīvais transports 18 Difūzija 18 Atvieglotais transports 18 Osmoze 18 Filtrācija 20 2.6. Aktīvais transports 20 Aktīvā pārnese 20 Endocitoze 21 Eksocitoze 22 2.7. Sūnu savienojumi 23 2.8. Sūnas organoīdi 24 Citoplazma... 24 Endoplazmatiskais tīkls 25 Ribosomas 25 Goldži komplekss 26 Lizosomas 26 Mitohondriji 26 Plastīdas 27 Centrosoma (šūnas centrs) un centriolas 28 Vakuolas 28 Peroksisomas 28 Skropstiņas un vicas 28 Sūnu ieslēgumi 30 Kodols 30 2.9. Šūnu kopīgās un atšķirīgās pazīmes 31 2.10. Audi, orgāni, orgānu sistēmas 33 Augu audi 34 Dzīvnieku audi 36 3. ŠŪNU UN ORGANISMU ĶĪMISKAIS SASTĀVS 39 3.1. Organismu ķīmiskais sastāvs 39 3.2. Neorganiskās vielas 39 Ūdens 39 Sāļi 41 3.3. Organiskās vielas 41 Ogļhidrāti 41 Lipīdi 43 Olbaltumvielas 45 Nukleīnskābes. Adenozīntrifosfāts 50 4. VIELU UN ENERĢIJAS MAIŅA 53 4.1. Enerģijas plūsma dabā 53 4.2. Vielmaiņa un enerģijas maiņa organismā 54 4.3. Fermenti 55 4.4. Fotosintēze 57 Fotosintēzes pētījumu vēsture 57 Fotosintēzes procesi 57 Fotosintēzes gaismas stadija 58 Fotosintēzes tumsas stadija 59 4.5. Hemosintēze 60 4.6. Sūnas enerģētiskā vielmaiņa 61 5. ORGANISMU VAIROŠANĀS UN INDIVIDUĀLĀ ATTĪSTĪBA 64 5.1. Sūnu dalīšanās 64 Prokariotu šūnas dzīves cikls 65 Eikariotu šūnas dzīves cikls 65 Mitoze 66 Mejoze 67 5.2. Organismu vairošanās veidi 69 Bezdzimumvairošanās 69 Dzimumvairošanās 69 Augu vairošanās 70 Dzīvnieku vairošanās 72 5.3. Dzīvnieku un cilvēka dzimumšūnu attīstība 73 5.4. Organisma individuālā attīstība 76 Apaugļošanās 76 Dīgļa attīstība 76 Dīgļa apvalki un placenta 78 Dzīvnieku pēcembrionālā attīstība 79 Cilvēka pēcembrionālā attīstība 80 6. IEDZIMTĪBAS MATERIĀLIE PAMATI 82 6.1. Olbaltumvielu sintēze 82 Ģenētiskā informācija un DNS struktūra 82 DNS replikācija 83 Ģenētiskais kods 83 Transkripcija 83 Translācija 84 Gēnu darbības regulācija 85 6.2. Ģenētika 89 Ģenētikas pirmsākumi 89 Monohibrīdiskā krustošana 90 Analizējošā krustošana 92 Krustošanas rezultātu atspoguļošana ..93 Nepilnīgā dominēšana 94 Kodominēšana 94 Dihibrīdiskā krustošana 95 Gēnu mijiedarbība 97 Polimērija 97 Epistāze 98 Komplementaritāte 101 Modificēšana 101 Plejotropija 102 Gēnu un vides mijiedarbība 103 Dzimuma iedzimšana dzīvniekiem 103 Ar dzimumu saistīto pazīmju iedzimšana 104 Dzimumhromosomu skaita pārmaiņas 105 Autosomu skaita un struktūras pārmaiņas 106 Cilvēka ģenētika un tās pētīšanas metodes 107 Hromosomu rekombinācijas, krustmija un hromosomu kartes 109 Mutācijas 111 Vides ietekme uz iedzimtību 113 Audzēji 114 Populāciju ģenētika 114 Gēnu inženierija 116 Klonēšana 119 6.3. Selekcija 122 Augu un dzīvnieku selekcija 122 Selekcijas darbs Latvijā 124 Mikroorganismu selekcija 124 Skaidrojošā vārdnīca 126 Rādītājs 138 Papildliteratūra un citu uzziņas avotu saraksts 142 IEVADS Bioloģijas zinātne Dzīvās dabas pētīšanai vienmēr ir bijusi liela loma cilvēka saimnieciskajā darbībā. Jau senatnē cilvēks centās izzināt, kurus dzīvniekus, augus un sēnes var izmantot pārtikai, kurus - apģērba un mājokļu gatavošanai, kuri ir bīstami vai indīgi. Cilvēkam bija nepieciešams iepazīt arī savu ķer-
meni un dzīvības norises tajā, lai rūpētos par savu veselību. Bioloģija ir zinātne par dzīvību - organismiem un dzīvajām sistēmām. Vārds "bioloģija" cēlies no grieķu valodas (bios - dzīvība un logos - mācība). Kādreiz bioloģiju uzskatīja vienīgi par apraks-
tošu zinātni, taču laika gaitā tika atklātas nozī-
mīgas teorētiskas likumsakarības, kas ļāva labāk izprast dzīvību. Līdz ar to izveidojās dažādas bio-
loģijas nozares un ciešāka kļuva bioloģijas saistība ar citām zinātnēm (ķīmiju, fiziku). Dzīvība uz Zemes ir ļoti daudzveidīga. Vairums zinātnieku visus organismus iedala piecās valstīs: monēras (baktērijas un zilaļģes), protisti (vien-
šūņi, aļģes un gļotsēnes), sēnes, augi un dzīvnieki (sk. 1. att.). Arī cilvēku pieskaita pie dzīvnieku valsts, jo viņa ķermeņa uzbūve ir līdzīga dzīvnieku uzbūvei. Tomēr cilvēks atšķiras no dzīvniekiem ar to, ka spēj abstrakti domāt un radoši darboties. Ir zināms vairāk nekā 400 tūkstoši monēru, 80 tūkstoši protistu, 100 tūkstoši sēņu, 280 tūkstoši augu un 2 miljoni dzīvnieku sugu. Faktiski sugu skaits ir krietni lielāks, jo daudzas sugas vēl nav atklātas. Bioloģijai ir daudz nozaru. Augus pēta biolo-
ģijas nozare, ko sauc par botāniku, dzīvniekus -
zooloģija, mikroorganismus - mikrobioloģija un vīrusus - virusoloģija. Organisma ārējo uzbūvi pēta morfoloģija, bet iekšējo - anatomija. Organisma un tā daļu funk-
cijas noskaidro fizioloģija. Līdz ar šūnu atklā-
šanu (1665) sāka attīstīties citoloģija - mācība par šūnu, savukārt histoloģija pēta audus. Embrioloģija raksturo organismu individuālo at-
tīstību. Dzīvnieku uzvedību pēta etoloģija. Siste-
mātika iedala organismus radniecīgos taksonos (klasificē tos). Bioģeogrāfija pēta dzīvnieku un augu sugu izplatību uz Zemes, bet paleontolo-
ģija ir mācība par izmirušajiem organismiem. Or-
ganismu attīstību uz Zemes noskaidro evolūcija, bet cilvēka izcelšanos un attīstību aplūko antro-
poloģija. Organismu attiecības ar apkārtējo vidi pēta ekoloģija. Mūsdienīgu pētniecības metožu izmantošana bioloģiskajos eksperimentos deva iespēju dzīvības procesus izskaidrot molekulārā līmenī. Tā radās jauna zinātnes nozare - molekulārā bioloģija. Savukārt molekulārās bioloģijas atklājumi sek-
mēja ģenētikas (mācības par iedzimtību un mainību) turpmāku attīstību. Bioloģijai sadarbojoties ar ķīmiju, ir radusies nozare - bioķīmija, kas pēta organismu ķīmisko sastāvu un ķīmiskos procesus tajos, bet, tai sadar-
bojoties ar fiziku, radusies biofizika, kas pēta fizikālos procesus organismos. Bioloģijā gūtās at-
ziņas izmanto medicīnā, veterinārijā, pārtikas rūp-
niecībā, lauksaimniecībā, dabas aizsardzībā, ūdeņu attīrīšanā. Bioloģijas nozaru attīstība Latvijā saistīta ar Latvijas Universitātes (LU) vēsturi. Kad 1919. ga-
dā nodibināja Latvijas Universitāti, dabaszinātnes un medicīnu pirmo reizi varēja studēt latviešu va-
lodā. LU Bioloģijas fakultāte sagatavo jaunos speciālistus dažādās bioloģijas nozarēs un nodar-
bojas ar zinātniskiem pētījumiem. Bioloģijas studiju laikā iespējama specializācija šādās apakšnozarēs: • bioķīmija, šūnu un molekulārā bioloģija, • zooloģija un ģenētika, • botānika un ekoloģija, • cilvēka un dzīvnieku fizioloģija, • augu fizioloģija un mikrobioloģija. Bioloģijas fakultātes zinātniskie pētījumi ir sais-
tīti ar tās katedru (apakšnodaļu) darbu. Augu fizioloģijas katedra pēta augu veģeta-
tīvās pavairošanas fizioloģiju, augu un augēdāju kukaiņu attiecības, ķīmisko un fizikālo faktoru ietekmi uz augu fizioloģiskajiem procesiem, augu audu kultūras. Botānikas un ekoloģijas katedras pētījumu lokā ir augu sistemātika, aizsargājamie augi un biotopi, fitosocioloģija, sauszemes ekosistēmu eko-
loģija, vides kvalitātes bioindikācija, biometrija. Cilvēka un dzīvnieku fizioloģijas katedra specializējusies asinsvadu fizioloģijas un nervu dar-
bības pētījumos. Mikrobioloģijas un biotehnoloģijas kated-
ra nodarbojas ar pētījumiem molekulārajā mikro-
bioloģijā, vides mikrobioloģijā, sēņu biotehnolo-
ģijā. Molekulārās bioloģijas katedras zinātnieki nodarbojas ar olbaltumvielu un gēnu inženieriju, molekulāro imunoloģiju, molekulāro medicīnu un virusoloģiju. Zooloģijas katedras uzmanības lokā ir dzīv-
nieku sistemātika un ekoloģija, īpaši apdraudēto sugu un biotopu aizsardzība, hidroekosistēmu pē-
tījumi. Bioloģijas fakultātes zinātnieki sadarbojas ar ko-
lēģiem no daudzām pasaules valstīm - Igaunijas, Vācijas, Zviedrijas, Somijas, Holandes biologiem. Bioloģijas fakultātes absolventiem ir iespējas turpināt studijas, iegūstot pedagoga izglītību. Bio-
loģijas skolotājus sagatavo arī Rīgas Pedagoģijas un izglītības vadības augstskolā un Daugavpils Universitātē. Mūsdienās bioloģijas pētījumi ievirzījušies jau-
nā gultnē. Straujā zinātniskajiem pētījumiem ne-
pieciešamo tehnisko līdzekļu attīstība veicinājusi to bioloģijas nozaru rašanos, kuras saistītas ar mikrobioloģiju un molekulāro bioloģiju. Bioloģijas nozaru pētījumu loks sniedzas no dažus nanomet-
rus (10~9) mazām molekulu struktūrām līdz ap-
jomīgu ekosistēmu, piemēram, Baltijas jūras, pē-
tījumiem. Šobrīd Latvijā pētniecība dažādās bioloģijas zi-
nātņu nozarēs attīstīstās LU zinātniskajās iestā-
dēs: Augusta Kirhenšteina Mikrobioloģijas un virusoloģijas institūts, Bioloģijas institūts, Mikro-
bioloģijas un biotehnoloģijas institūts, Hidroeko-
loģijas institūts, Biomedicīnas pētījumu un studiju centrs. Bioloģiskie pētījumi notiek arī Latvijas Or-
ganiskās sintēzes institūtā, Latvijas Valsts mežzi-
nātnes institūtā „Silava", Latvijas Nacionālajā bo-
tāniskajā dārzā. 1. Kādās saimniecības nozarēs izmanto bioloģijas atziņas ? 2. Kādi ir nozīmīgākie mūsdienu bioloģijas pētījumu virzieni ? 3. Kur savā ikdienas dzīvē jūs saskaraties ar mūsdienu bioloģijas sasniegumiem ? Piemēram, man mājās ir bulterjers; tā ir suņu šķirne, kas radusies selekcijas rezultātā. 4. Noskaidrojiet un īsumā raksturojiet kādu no pēdējo gadu atklājumiem, sasniegumiem bio-
loģijā vai ar to saistītajās nozarēs! 5. Izveidojiet savu skaidrojošo vārdnīcu! Sameklējiet un uzrakstiet skaidrojumu jēdzieniem morfoloģija, anatomija, fizioloģija, citoloģija, ekoloģija, ģenētika! 1.1. DZĪVĪBAS PAMATPAZĪMES Parasti nav grūti atšķirt organismu no nedzīva objekta, taču precīzi definēt, kas ir dzīvība, ir daudz sarežģītāk. Lai raksturotu organismus, jā-
min vairākas pazīmes. • Visi organismi ir veidoti no šūnām. To sastāvā ir sarežģītas organiskas vielas, piemēram, olbaltumvielas. • Organismiem raksturīga vielu un ener-
ģijas maiņa. Viņi saņem enerģiju no ārējās vides un šo enerģiju izmanto savām dzīvības norisēm. Organismi barojas, elpo, izvada vielmaiņas gala-
produktus utt. Organismi uzņem gatavas organiskās vielas vai saražo tās no neorganiskām vielām (augi, daļa baktēriju). Tās tiek izmantotas organisma uzbūvei vai enerģijas ražošanai. Lielākā daļa organismu enerģijas ražošanai izmanto skābekli. Organismu dzīvības procesiem tiek izmantota gaismas vai ķīmiskā (barības) enerģija. Elpošanā uzņemtais skābeklis oksidē šūnās esošās organis-
kās vielas, galvenokārt glikozi, un atbrīvojas ener-
ģija. To saista adenozīndifosfāts (ADP jeb ADF), un rodas adenozīntrifosfāts (ATP jeb ATF). Tālāk šī ATP saišu veidā uzkrātā enerģija tiek patērēta dzīvības uzturēšanai (nervu impulsu vadīšanai, muskuļu kontrakcijām, makromolekulu sintēzei utt.). Vielmaiņas rezultātā radušies galaprodukti tiek izvadīti no organisma. Šo procesu sauc par ekskrēciju. • Organismi spēj nodrošināt iekšējās vides relatīvu nemainību jeb homeostāzi. Piemēram, siltasiņu dzīvnieki uztur pastāvīgu ķermeņa temperatūru, noteiktu glikozes saturu un vides reakciju (pH) asinīs. Ja kāda viela organismā ir saražota pietiekamā daudzumā, tās sintēze tiek pārtraukta. Liekās vielas uzkrājas un tiek izvadītas no organisma. Homeostāzes nodrošināšanā pieda-
lās sekrēcijas dziedzeri, nieres, aknas, plaušas, āda, īpaši zīdītājiem. • Organismiem piemīt kairināmība - spē-
ja sajust apkārtējās vides kairinājumu un reaģēt uz to. Sī reakcija var būt dažāda. Piemē-
ram, ja pieskaras dzīvniekam, viņš var bēgt pro-
jām, uzbrukt, sarauties kamolā, izdot skaņas vai reaģēt kādā citā veidā, bet augi var, piemēram, at-
vērt un aizvērt ziedu, augt gaismas virzienā. • Organismi aug, attīstās, noveco un iet bojā. Augšana notiek, šūnām daloties. Jaunā orga-
nismā pārsvarā norit sintēzes reakcijas, bet vecā -
noārdīšanās reakcijas. Organismam novecojot, tajā rodas neatgriezeniskas pārmaiņas, kas izraisa or-
ganisma bojāeju. Katras sugas pārstāvju maksimā-
lais mūža ilgums ir ģenētiski noteikts (iedzimts). • Organismi vairojas. Visas dzīvās būtnes ro-
das tikai tādu pašu būtņu - vecākorganismu - vai-
rošanās rezultātā. Jaunie organismi no vecākiem manto noteiktas pazīmes un īpašības. Tās kodētā veidā atrodas hromosomu gēnos, kurus viņi saņem no vecākiem. Tāpēc pēcnācēji vienmēr ir līdzīgi sa-
viem vecākiem, piemēram, no kļavas sēklām vien-
mēr izaug kļava, bet no vistu olām izšķiļas cāļi. 1. Kādas ir raksturīgākās dzīvo būtņu pazīmes ? 2. Kāpēc SŪRU var uzskatīt par organismu uzbūves un dzīvības norišu pamatvienību ? 3. Kas ir homeostāze? Kādi orgāni piedalās tās nodrošināšanā cilvēka organismā? 4. Kāpēc jaunie organismi ir līdzīgi saviem vecākiem ? 5. Pierādiet, kādā veidā jums labi pazīstama dzīvā būtne, piemēram, kaķis, realizē savas dzīvības pamatpazīmes! 6. Pamatojiet, ka uguns (varbūt cita parādība) nav dzīva! 1.2. DZĪVĪBAS ORGANIZĀCIJAS LĪMEŅI Elektronmikroskops un citas mūsdienīgas teh-
noloģijas ļauj pētīt dzīvību, sākot ar molekulām, kas veido šūnas. Līdz ar to ir iespējams labāk iz-
prast organisma darbību un veikt atklājumus da-
žādās zinātnes nozarēs, piemēram, medicīnā. Zi-
nātniekus aizvien vairāk interesē arī Zemes dzīvā apvalka (biosfēras) pētījumi, jo samazinās ozona slānis un iespējamas dažādas citas globālas problē-
mas. Dzīvo būtņu organizāciju nosacīti var iedalīt noteiktos līmeņos (sk. 1.1. att.). Molekulārais līmenis. Vielas sastāv no ato-
miem - mazām elementa daļiņām, kam piemīt vie-
las īpašības. Atomi grupējas, veidojot molekulas. Sarežģītas molekulas, piemēram, ogļhidrāti, lipīdi un olbaltumvielas (proteīni), dabā veidojas vienīgi dzīvajās būtnēs. Organoīdu un šūnu līmenis. Sūna ir orga-
nisma uzbūves un funkcionēšanas pamatvienība. Sūna sastāv no membrānas, citoplazmas, organoī-
diem jeb organellām un kodola, kurā glabājas iedzimtības informācija (DNS). Organoīdi, izman-
tojot DNS informāciju, sintezē organiskās vielas, nodrošina šūnas ar enerģiju un pilda pārējās dzī-
vības funkcijas. Sūnas nodrošina organisma viel-
maiņu (metabolismu), augšanu, kairināmību un vairošanos. Audu līmenis. Sūnas organismā veido grupas. Uzbūves ziņā līdzīgu šūnu grupas, kam ir kopēja izcelšanās un kas organismā veic noteiktas funkci-
jas, sauc par audiem. Zinātnieki ir iemācījušies no meristēmas (augu veidotājaudiem) īsā laikā izau-
dzēt jaunus augus, piemēram, zemeņu, augļkoku stādus. Dažādas pakāpes audu bojājumi var traucēt augu augšanu, attīstību vai pat izsaukt to bojāeju. Medicīnā nepieciešamības gadījumā, piemēram, pēc apdeguma, audu kultūrā audzē cilvēka ādu. Orgānu un orgānu sistēmu līmenis. Orgā-
ni ir veidoti no vairākām audu grupām. Tiem ir 1.1. att. Dzīvības organizācijas līmeņi noteikta forma un funkcijas. Orgāni ir, piemēram, sirds, plaušas, kuņģis, augu lapas. Dzīvniekiem (arī cilvēkam) orgāni veido orgānu sistēmas, kas organismā veic kādu noteiktu funkciju. Cilvēkam ir gremošanas, asinsrites, limfātiskā, nervu, elpo-
šanas, balsta un kustību, dzimumorgānu, endo-
krīnā, segaudu un izvadorgānu sistēma. Ja kāda orgānu sistēma nefunkcionē pietiekami labi, cilvēks nejūtas vesels. Ārsti ar elektroencefalogrāfijas, endoskopijas, ultrasonogrāfijas un citām metodēm pārbauda orgānu sistēmu stāvokli. Piemēram, ar elektroencefalogrāfu reģistrē galvas smadzeņu darbību, bet ar endoskopu pārbauda kuņģi. Organismu līmenis. Visas ķermeņa daļas, ko-
pīgi funkcionējot, veido veselu organismu - dzīvu būtni. Katrai dzīvai būtnei piemīt visas iepriekš minētās (sk. 9. lpp.) īpašības, un vienlaikus tā ir unikāla, jo atšķiras no visām pārējām būtnēm. Populāciju līmenis. Dabā sugas pārstāvji ne-
dzīvo pa vienam. Populācija ir vienas sugas orga-
nismu grupa, kuras īpatņi spēj savā starpā brīvi krustoties un apdzīvo noteiktu teritoriju - areālu. Populācija var eksistēt kādā noteiktā rajonā, ja tur ir sugas prasībām atbilstošs klimats un pietiekami daudz barības. Populācijas nepārtraukti attīstās. So attīstību ir iespējams prognozēt. Retās augu un dzīvnieku sugas ir iespējams saglabāt, saudzējot nevis atsevišķus indivīdus, bet gan to dabiskās po-
pulācijas. Piemēram, Klaucānu ezera liegums ir radīts peldošā ezerrieksta saglabāšanai, bet 1998. gadā izveidotajā Engures ezera dabas parkā būs iespējams aizsargāt Eiropā apdraudētās 44 putnu sugas. Sugu līmenis. Līdzīgi organismi tiek apvienoti sugās. Katrai sugai ir raksturīgas noteiktas uz-
būves un dzīvības norišu īpatnības, noteikta dzī-
vesvieta un izplatība, kā arī spēja vairoties. Sugu līmeni pēta sistemātiķi, etologi, antropologi, ģenē-
tiķi un citu bioloģijas nozaru speciālisti. Ekosistēmu līmenis. Ekosistēmas ir bioloģis-
kas sistēmas, ko veido visi noteiktā teritorijā mī-
tošie organismi kopā ar nedzīvo vidi. Ekosistēmās mīt organisko vielu ražotāji (producenti), patērē-
tāji (konsumenti) un noārdītāji (destruktori). Tajās pastāv dažādas barošanās ķēdes un tīkli. Ja no ekosistēmas izzūd kādas sugas populācija, tajā tiek izjaukts līdzsvars. Bieži vien līdzsvars ekosis-
tēmā tiek izjaukts arī tad, ja tajā ieved kādu sveš-
zemju sugu. Piemēram, 18. gs. beigās Austrālijā no Anglijas ieveda trušus, kuri tā savairojās, ka daudzos apvidos noēda visu zāli. Tikai 20. gs. vidū trušu skaitu izdevās ievērojami samazināt, māk-
slīgi inficējot trušus ar bīstamu slimību - mikso-
matozi. Svešās agresīvās augu sugas, kuras izspiež no augtenēm vietējās sugas, sauc par invazīvajām sugām. Latvijā par tādām ir kļuvis Sosnovska lat-
vānis, melnais plūškoks, krokainā roze. Biosfēras līmenis. Biosfēra ir Zemes dzīvais apvalks - Zemes virsa, augsne, gaiss un ūdens, ko apdzīvo organismi. Biosfērā notiek daudzas glo-
bāla rakstura negatīvas pārmaiņas - zemeslodes sasilšana (siltumnīcefekts), ozona cauruma veido-
šanās, Pasaules okeāna piesārņošana un citas. Biosfēru pēta vairāku zinātņu nozaru speciālisti -
biologi, fiziķi, ķīmiķi, ģeogrāfi. No biosfērā notie-
košajiem procesiem ir atkarīgs visas dzīvās dabas (arī cilvēka) liktenis. Tikai visām pasaules valstīm kopīgi sadarbojoties, var nodrošināt biosfēras aiz-
sardzību un bioloģiskās daudzveidības saglabā-
šanos tajā. Globālo problēmu risināšanai ir izstrādātas da-
žādas konvencijas. Kopš 1995. gada Latvija ir iesaistījusies Riodežaneiro konvencijā "Par biolo-
ģisko daudzveidību", kura paredz ne tikai saglabāt un atjaunot ekosistēmas, sugu, kā arī kultūraugu un dzīvnieku šķirņu daudzveidību, bet arī nodro-
šināt dabas resursu līdzsvarotu un ilgstošu izman-
tošanu. Šos uzdevumus varēs risināt jaunizvei-
dotajās aizsargājamajās teritorijās, piemēram, 1997. gadā izveidotajā Ķemeru nacionālajā parkā un 1998. gadā apstiprinātajā Ziemeļvidzemes bio-
sfēras rezervātā, kas ir iekļauts UNESCO Biosfē-
ras rezervātu sarakstā. Organismi ir sarežģītas sistēmas, kas veidotas no vienkāršākām apakšsistēmām. Visi dzīvības organizācijas līmeņi ir saistīti, bet katrs nākamais līmenis nav iepriekšējā līmeņa elementu mehānis-
ka summa, jo katra līmeņa elementi savā starpā Pētījumi visās dabaszinātņu nozarēs parasti no-
tiek pēc vienota plāna. Pētniecības metožu pamatā ir novērojumi. Kad ir veikti vairāki novērojumi, jāpaziņo hipotēzes. Katra hipotēze ir jāpārbauda ar eksperimentu. Ne-
pieciešami arī kontroleksperimenti, lai nerastos kļūdas. Piemēram, 16. un 17. gs. populāra bija dzīvības pašrašanās teorija. Šīs teorijas piekritēji apgalvoja, ka dzīvās būtnes rodas pašas no sevis, nevis no vecākiem. Viņi neievēroja noteikumu, ka hipotēzes jābalstīta tikai uz rūpīgiem novēroju-
miem. Novērojumi. Tas ir pirmais solis pētnieciskajā darbā. Novērojumus var veikt gan dabā, gan labo-
ratorijā. Tie var būt vienkārši vai sarežģīti. mijiedarbojas. Tāpēc katrs nākamais dzīvības organizācijas līmenis salīdzinājumā ar iepriekšējo iegūst kvalitatīvi jaunas īpašības. Hipotēzes. Novērojumu rezultātā tiek iegūti fakti, uz kuriem balstoties zinātnieki izvirza hipo-
tēzes. Piemēram, pēc pirmo šūnu atklāšanas tika izvirzīta hipotēze, ka visi dzīvie organismi sastāv no šūnām. Radot jaunus medikamentus, arī tiek izvirzīta hipotēze, ka tie palīdz noteiktas slimības ārstēšanā. Hipotēzes vienmēr ir rūpīgi jāpārbauda. Eksperimenti. Izvēlētās hipotēzes pareizību pārbauda ar eksperimentiem, kas to vai nu apstip-
rina, vai arī noraida. Pētnieki pagatavoja ļoti dau-
dzu augu un dzīvnieku mikropreparātus un pār-
liecinājās, ka visos tajos bija redzamas šūnas. Tātad hipotēze, ka visi organismi sastāv no šū-
nām, izrādījās pareiza. Veicot eksperimentus, bieži ir nepieciešams iz-
veidot kontrolgrupu, lai pārliecinātos par ekspe-
rimenta pareizību. Piemēram, ja noskaidro kāda jauna medikamenta ietekmi uz organismu, bez eksperimenta grupas - dzīvniekiem, kuri saņem jauno medikamentu, - ir arī kontroles grupa -
dzīvnieki, kuri dzīvo tādos pašos apstākļos un sa-
ņem to pašu barību kā eksperimenta grupas dzīv-
nieki. Ja eksperimenta grupas dzīvniekiem medi-
kamenta ietekmē novēro kādas pārmaiņas, tad pār-
bauda, vai tādas pašas pārmaiņas ir manāmas arī kontrolgrupas dzīvniekiem, un tikai tad paziņo, ka jaunais medikaments der slimības ārstēšanai. Pēc eksperipentu rezultātu analīzes tiek izda-
rīti secinājumi. 1.3. BIOLOĢIJAS PĒTNIECĪBAS METODES 1. Kādas bioloģijas nozares pēta organismus šūnu līmenī? 2. Kas ir audi ? 3. Ar ko suga atšķiras no populācijas ? 4. Kāpēc retās sugas ir iespējams saglabāt tikai tad, ja tiek aizsargātas ekosistēmas ? 5. Kādus pasākumus ir nepieciešams veikt biosfēras aizsardzībai ? 6. Noskaidrojiet un nosauciet 5 augu un 5 dzīvnieku sugas, kuras Latvijā ir aizsargājamo sugu statusā! Kāda ir to sastopamība Latvijā un pasaulē? 7. Nosauciet kādu augu vai dzīvnieku sugu, kuras nekontrolēta izplatība Latvijā nebūtu vēlama! Paskaidrojiet, kāpēc! 8. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem populācija, areāls, biosfēra! 1. Kas ir nepieciešams, lai varētu izvirzīt hipotēzi ? 2. Kādam nolūkam kalpo eksperimenti ? 3. Kur mūsdienās tiek veikti zinātniskie pētījumi ? 4. Kādi ir nozīmīgākie bioloģijas pētījumu virzieni ? 5. Noskaidrojiet, kādas bioloģijas zinātņu nozares ir attīstītas Latvijā! Kuri Latvijā veikto bioloģisko pētījumu virzieni, jūsuprāt, ir īpaši nozīmīgi ? 6. Noskaidrojiet, kādi ir ievērojamākie pēdējo gadu atklājumi dažādās bioloģijas nozarēs Latvijā un pasaulē! 7. Izvirziet savu hipotēzi varbūtējam pētījumam kādā bioloģijas nozarē, sastādiet programmu šī pētījuma veikšanai! 8. Kādi periodiskie izdevumi Latvijā iepazīstina ar bioloģijas zinātņu pētījumiem un atklā-
jumiem? Kur vēl iespējams iepazīties ar aktualitātēm bioloģijā? Paziņojums par atklājumu. Matiass Šleidens un Teodors Svanns 1838. gadā publicēja rakstu "Sūnu teorija" - vienu no mūsdienu bioloģijas pa-
matteorijām. Arī mūsdienās visi atklājumi ir jā-
publicē. Zinātniskajā rakstā autors ne tikai paziņo par savu atklājumu, bet arī norāda metodi, ar kuru rezultāti iegūti, lai arī citi zinātnieki tos varētu pārbaudīt. Zinātniskie raksti tiek publicēti zināt-
niskajos žurnālos, kā arī paziņoti konferencēs un simpozijos. Mūsdienās vairums zinātnisko pētījumu tiek veikti zinātniski pētnieciskajos institūtos vai cen-
tros, piedaloties veselai zinātnieku grupai. Starp dažādām zinātniski pētnieciskajām iestādēm pa-
stāv cieša sadarbība. Biologi pašlaik risina tādas svarīgas problēmas kā pārtikas krājumu palielināšana, apkārtējās vi-
des kvalitātes uzlabošana, cīņa ar vēzi un AIDS. Ģenētiķi rada organismus ar pārmainītu ģenē-
tisko kodu. Zinātnieki prognozē, ka 21. gadsimtā tiks atklāti daudzi dzīvās dabas noslēpumi. 2.1. ŠŪNU TEORIJAS RAŠANĀS Pirms mikroskopa izgudrošanas pastāvēja uz-
skats, ka dažādas augu un dzīvnieku organisma daļas ļoti atšķiras cita no citas. Tālaika biologi do-
māja, ka augiem un dzīvniekiem nevar būt nekā kopīga. 1665. gadā angļu dabaszinātnieks Roberts Huks, izmantojot primitīvu mikroskopu, aplūkoja plānu korķa griezumu. Viņš konstatēja, ka tas sastāv no nelielām tvertnītēm. R. Huks ieviesa terminu "šū-
na" (lat. čella - istabiņa). Korķa šūnas bija tukšas. Turpmākie R. Huka pētījumi ar augiem parādīja, ka arī tie sastāv no šūnām. Dzīvās augu šūnas bija pildītas ar šūnsulu. Turpmākajos 150 gados tika konstatēts, ka visdažādākie augi sastāv no šūnām. Arī dzīvnie-
kiem tika novēroti līdzīgi veidojumi, taču tos pamanīt bija grūtāk. Tas izskaidrojams ar to, ka dzīvnieka šūnai nav biezā šūnapvalka, kas ļauj saskatīt šūnas robežas. 1680. gadā Antons Lēven-
huks atklāja vienšūnas organismus. Viņš arī pirmoreiz saskatīja dzīvnieku šūnas - eritrocītus un spermatozoīdus. 1839. gadā vācu zoologs Teodors Švanns, bals-
toties uz iepriekšējiem vairāku zinātnieku un it īpaši - vācu botānika Matiasa Šleidena 1838. gada pētījumiem, noformulēja šūnu teoriju. Tai ir divas pamattēzes. 1. Ikviens organisms sastāv no vienas vai vairā-
kām šūnām. 2. Sūna ir organismu funkcionālā pamatvienība (mazākā vienība, kuru var uzskatīt par dzīvu). Vācu zinātnieks Rūdolfs Virhovs 1855. gadā šū-
nu teorijai pievienoja vēl vienu tēzi. 3. Jaunas šūnas rodas, tikai daloties vecajām šūnām. Dažādu augu un dzīvnieku, kā arī viena orga-
nisma-dažādu orgānu šūnas ir visai atšķirīgas gan pēc formas, gan izmēriem, gan uzbūves. Tomēr visām šūnām ir arī kopējas pazīmes. Katru šūnu aptver plazmatiskā membrāna. Sūnas iekšienē ir pusšķidra vide - protoplasts (citoplazma, šūnas kodols un dažādi organoīdi; sk. 2.1. att.). Visi šūnas struktūras elementi nodrošina dzīvības procesus šūnā. Sūnas membrāna atdala citoplazmu un tajā esošos organoīdus no ārējās vides, vienlaikus regulējot vielu apmaiņu starp šūnu un ārējo vidi. Šūnas kodolā esošais ģenētis-
kais materiāls ir datu bāze, kas nodrošina pašas šūnas vairošanos un tai raksturīgo dzīvības pro-
cesu regulāciju. Šūnā esošie organoīdi realizē šos dzīvības procesus. Organoīdos notiek gan dažādu vielu sintēze, gan noārdīšanās, gan nepieciešamās enerģijas ražošana. Protoplasts saista visus šūnas struktūras elementus vienā veselā sistēmā. Šūnas līmenī realizējas visas svarīgākās orga-
nismam raksturīgās dzīvības pazīmes. Ar šūnu pa-
līdzību notiek organisma struktūras veidošana, augšana un attīstība, vielu un enerģijas maiņa, pašatjaunošanās, pašregulācija, iekšējās vides vei-
došana, kairināmība, kā arī kustību nodrošināšana. Šūnas ir ļoti mazas, jo to izmērus ierobežo vai-
rāki faktori. 1. Ģenētiskā materiāla informācijas nodošanu no kodola uz citiem šūnas organoīdiem ierobežo attālums. Ja šūna būtu pārāk liela, tad šis process varētu kļūt neefektīvs. Tiktu traucēta šūnas aug-
šana, vairošanās un attīstība, kā arī regulācija. 2. Barības vielu un šūnas vielmaiņas kaitīgo ga-
laproduktu apmaiņu ar ārējo vidi ierobežo šūnas izmēri. Jo lielāka ir šūna, jo vielu un enerģijas maiņa šūnā kļūst lēnāka. Ja šūna ievērojami pa-
lielinātos, tā nespētu nodrošināt vielu apmaiņu ar ārējo vidi. Daudzšūnu organismu šūnas ir specializējušās noteiktu funkciju veikšanai. Vienšūnu organismos visas dzīvības funkcijas tiek realizētas vienas šūnas ietvaros. 2.2. MIKROSKOPIJAS ATTĪSTĪBA Šūnas atklāšana un tās pētīšana ir cieši saistīta ar mikroskopijas attīstību. Pirmais optiskais instruments, kas bija līdzīgs mūsdienu mikroskopam, tika izgudrots 16. gs. bei-
gās vai 17. gs. sākumā. Mikroskopa izgudrotājs nav īsti zināms. Pēc dažu autoru domām, to ir izda-
rījuši holandiešu optiķi brāļi Janseni, bet citi lite-
ratūras avoti liecina, ka to ir veicis itāļu zinātnieks Galileo Galilejs vai arī vācu astronoms Johannes Keplers. Taču visdrīzāk mikroskopu ir izgudrojuši daudzi zinātnieki neatkarīgi cits no cita. 19. gs. beigās izveidojās patstāvīga nozare cito-
loģija - zinātne par šūnas uzbūvi, funkcijām un attīstību. Tā pēta arī šūnas pašregulācijas, repro-
dukcijas, diferencēšanās un evolūcijas likumsaka-
rības. Ilgu laiku šūnas pētīja tikai ar parasto gaismas mikroskopu. Svarīgākā optisko instrumentu īpa-
šība ir to izšķirtspēja. Cilvēka acs izšķirtspēja ir mazākais attālums, pie kura tā spēj atsevišķi uz-
tvert divus objektus (tas ir apmēram 0,1 mm). Mik-
roskopa izšķirtspēja ir vismazākais attālums starp diviem punktiem, kurus var izšķirt mikro-
skopā. Galvenais faktors, kas ierobežo parastā mikroskopa izšķirtspēju, ir gaismas viļņa garums. Jo īsāks ir viļņa garums, jo augstāka ir izšķirt-
spēja. Optimālos apstākļos gaismas mikroskopa iz-
šķirtspēja ir aptuveni 0,2 ļam, tāpēc nevar saskatīt visas šūnas struktūras. Mikroskopijas turpmākajā attīstībā izšķirtspē-
jas paaugstināšanai tika radītas dažādas papild-
iekārtas un konstruēti jauna veida mikroskopi, piemēram, tumšā lauka, fāžu kontrasta, luminis-
cences, polarizācijas un elektronmikroskops. Sevišķi liela nozīme šūnas vissīkāko struktūru pētīšanā ir elektronmikroskopam. Tas pirmoreiz tika konstruēts 1931. gadā. Elektronmikroskopā gaismas vietā izmanto ātro elektronu plūsmu, bet stikla lēcas aizstāj ar elektromagnētiem, kas fo-
kusē elektronu kūli. Elektroniem, līdzīgi kā gais-
mai, piemīt gan daļiņu, gan viļņu īpašības. Taču elektronu viļņu garumi ir ievērojami īsāki nekā gaismas viļņu garumi (aptuveni 5-10~6 ļum jeb 0,05 Ā). Tas ari nodrošina elektronmikroskopam ievērojami lielāku izšķirtspēju. 1. Raksturojiet šūnu teorijas pamattēzes! 2. Kādas ir daudzšūnu organismu priekšrocības ? Transmisijas elektronmikroskopā elektroni iz-
iet cauri pētāmajam objektam un veido tā attēlu uz speciālas fotoplāksnes. Skenējošajā elektron-
mikroskopā elektroni tiek atstaroti no objekta virsmas un, plūstot pretējā virzienā, rada objekta attēlu. Šādi mikroskopi tika konstruēti 20. gs. piec-
desmitajos gados. Kā gaismas, tā arī elektronmik-
roskopos attēlu iegūst, pateicoties tam, ka vienas pētāmā objekta daļas absorbē vai novirza sānis vairāk gaismas vai elektronu nekā citas daļas. Lai pastiprinātu attēla kontrastainību, pētāmos objektus iekrāso. Gaismas mikroskopijā šim no-
lūkam izmanto dažādas krāsvielas, transmisijas elektronmikroskopijā krāsvielu vietā lieto vielas, kas absorbē elektronus, piemēram, svinu, bet skenējošā elektronmikroskopijā materiālu sasaldē, lai tā virsma pārklātos ar ledu. Ar mikroskopa palīdzību galvenokārt pēta šū-
nas struktūru. Lai izzinātu šūnas dzīvības pro-
cesus, ir nepieciešams iegūt arī bioķīmiskus un fizioloģiskus datus. Šim nolūkam noder citoķīmis-
kās un citofizioloģiskās metodes. Ar citoķīmiska-
jām metodēm pēta ķīmisko sastāvu un vielu sa-
dalījumu šūnā, bet citofizioloģiskās metodes iz-
manto svarīgāko šūnas dzīvības procesu noskaidro-
šanai. Dažādu pētīšanas metožu kombinēšana, kā arī modernās tehnikas izmantošana pētījumos ļauj dziļāk izprast šūnas uzbūvi un tajā notiekošos dzī-
vības procesus. 2.3. ŠŪNAPVALKS, ŠŪNAS PLAZMATISKĀ MEMBRĀNA Ikvienu organisma šūnu no ārpuses aptver šū-
nas plazmatiskā membrāna. Augu, sēņu un bak-
tēriju šūnām virs membrānas atrodas samērā biezs šūnapvalks. Tas aizsargā šūnu, kā arī pilda balsta lomu, piešķirot audiem mehānisko izturību. Augu šūnapvalki sastāv no celulozes un citiem po-
lisaharīdiem, bet sēņu šūnapvalki ir no hitīna. Baktēriju šūnapvalki ir veidoti no hitīnam līdzī-
gām vielām. Šūnas plazmatiskās membrānas biezums ir 0,0065-0,01 ļum jeb 65-100 A, un tā ir saskatāma tikai elektronmikroskopā. Šūnas membrāna atdala protoplastu no ārējās vides un aizsargā to. Tā neļauj nekontrolēti izplūst no šūnas barības vielām, fermentiem jeb enzīmiem, nukleīnskābēm un citām vitāli svarīgām moleku-
lām. Šūnas membrāna regulē dažādu vielu ap-
maiņu starp šūnu un apkārtējo vidi. Membrānā atrodas fermentu molekulas, kas sašķeļ daudzas vielas, tādējādi šīs vielas var vieglāk iekļūt šūnā. Šūnas membrāna uztur jonu koncentrācijas gradientu starp iekššūnas telpu un ārpusšūnas šķidrumu. Koncentrācijas gradients nodrošina uz-
budinājuma vadīšanu. Šūnas membrānai ir svarīga loma informācijas pārvadīšanā starp dažādām šūnām. Tajā atrodas specifiskas olbaltumvielas - receptori, kas nodro-
šina ārēju signālu uztveršanu. Membrānu veido fosfolipīdu molekulu dubult-
slānis. Fosfolipīdu molekulu nepolārā hidrofobā daļa - taukskābju atlikumi, atrodas dubultslāņa iekšpusē un ir vērsti viens pret otru, bet polārā hidrofilā daļa - glicerīna un fosforskābes atlikumi, ir vērsti uz pretējām pusēm - šūnas ārpusi un iekšpusi (sk. 2.2. att.). Fosfolipīdu dubultslānī mozaīkveidā atrodas olbaltumvielu molekulas. Tās var atrasties dubultslāņa iekšpusē vai ārpusē, kā arī iziet tam cauri. Dažāda veida šūnu membrānās ir atšķirīgas olbaltumvielas, kas specifiskā veidā ir saistītas ar fosfolipīdu dubultslāni vai cita ar citu. Šūnas membrānai ir dinamiska struktūra. Vairums membrānā esošo molekulu spēj kustēties. Sevišķi kustīgas ir fosfolipīdu molekulas. Holesterīna molekulas, kas no-
vietotas starp fosfolipīdu molekulām, padara tās mazāk 1. Kāpēc elektronmikroskopam ir lielāka izšķirtspēja neka gaismas mikroskopam ? 2. Kā var pastiprināt attēla kontrastainību pētāmajos objektos ? kustīgas. Lai gan olbaltumvielu molekulas var rotēt un pārvietoties pa membrānu, tās tomēr ir mazkustīgākas par fosfolipīdu molekulām un piešķir membrānai mehānisko izturību. 2.2. att. Šūnas arēja membrānā Dažām olbaltumvielām, kas atrodas šūnas mem-
brānas ārpusē, ir pievienoti ogļhidrāti. Tādas ol-
baltumvielas sauc par glikoproteīniem. Dažādām šūnām lipīdu, olbaltumvielu un gliko-
proteīnu daudzums un sastāvs ir atšķirīgs. Gliko-
proteīniem ir sevišķi svarīga loma šūnu mijiedar-
bībā un to savstarpējā pazīšanā, piemēram, olšūna un spermatozoīds pazīst viens otru pēc šūnas mem-
brānas glikoproteīniem, kas ir savstarpēji atbils-
toši. Līdzīgas šūnas veido audus. Šūnas membrānas funkcijas: • vielu aktīvā transportēšana; • dažādu vielu molekulu un jonu pasīvais trans-
ports; • jonu un vielmaiņas produktu transportēšana šū-
nas iekšienē; • piedalīšanās ATP (adenozīntrifosfāta) veidošanā fotosintētiskās un oksidatīvās fosforilācijas pro-
cesos; • jonu koncentrācijas un nevienmērīga sadalījuma nodrošināšana šūnās attiecībā pret apkārtējo vidi; • biopotenciālu veidošana un to starpības uztu-
rēšana uz membrānu virsmas; • piedalīšanās fizioloģisko procesu regulācijā. Olbaltumvielu funkcijas šūnas membrānā: • stabilizē fosfolipīdu molekulas; • piešķir membrānai mehānisko izturību; • savieno membrānu ar citoskeletu (blīvu pave-
dienu tīklu) un ārpusšūnas struktūrām; • nodrošina vielu transportu cauri membrānai (kanālu olbaltumvielas un pārnesējolbaltumvie-
las); • nodrošina sava organisma šūnu atpazīšanu (kat-
ram organismam ir atšķirīgi šūnu virsmas kom-
pleksi; • pilda receptoru funkcijas - piesaista hormonus un citas bioloģiski aktīvas vielas, kam piemīt signāla nozīme; • piedalās šūnas vielmaiņas procesos, pildot fer-
mentu funkciju. 1. Raksturojiet šūnas plazmatiskās membrānas funkcijas! 2. No kādām vielām sastāv šūnas plazmatiskā membrāna? 2.4. VIELU TRANSPORTS CAUR ŠŪNAS PLAZMATISKO MEMBRĀNU Sūnas iekšējā vide atšķiras no ārējās vides pēc viskozitātes, ķīmiskā sastāva, jonu satura un dau-
dzām citām fizikālām un ķīmiskām īpašībām. Līdz ar to vielu regulēšanā svarīga nozīme ir mehānis-
miem, ar kuru palīdzību vielas pārvietojas caur plazmatisko membrānu. Sūnas membrāna ir puscaurlaidīga jeb selektīvi caurlaidīga. Tas no-
zīmē, ka dažas vielas spēj izkļūt cauri membrānai, bet dažas netiek tai cauri. Membrāna regulē šo vielu iekļūšanu šūnā. Sūnā vielas var iekļūt pasīvā vai aktīvā ceļā. Vienīgi aktīvajos procesos tiek izmantota šūnas enerģija, kas uzkrāta ATP veidā. 2.5. PASĪVAIS TRANSPORTS Difūzija Difūzija ir jonu vai molekulu kustība no vietas ar augstāku šīs vielas koncentrāciju uz vietu ar zemāku tās koncentrāciju (sk. 2.3. A. att.). Šāda kustība turpinās, līdz molekulas ir vienmērīgi iz-
kliedējušās pa visu telpu, kurā tās spēj pārvietoties. Tad iestājas līdzsvars un molekulas kustas haotiski. Starpību starp augstu un zemu vielas koncentrā-
ciju sauc par koncentrācijas gradientu. Difū-
zijas ātrums ir atkarīgs no koncentrācijas gradien-
ta -, jo tas ir lielāks, jo ātrāk pārvietojas daļiņas. Daudzas molekulas izkļūst cauri šūnas membrā-
nai difūzijas ceļā, piemēram, ūdens, izšķīdušas gā-
zes (skābeklis un ogļskābā gāze), kā arī taukos šķīs-
tošo vielu molekulas (A vitamīns). Tomēr visas mo-
lekulas nevar vienlīdz viegli iziet cauri membrānai. Atvieglotais transports Pasīvais transports var notikt arī ar membrānas olbaltumvielu palīdzību. Atsevišķu vielu kustību caur membrānu nodrošina specializēti olbaltum-
vielu kanāli (sk. 2.3. B. att.), kas atvieglo molekulu vai jonu plūsmu koncentrācijas gradienta virzienā. To sauc par atviegloto difūziju. Šis process no-
tiek daudz ātrāk par vienkāršo difūziju. Daudzas mazmolekulāras vielas (joni, glikoze, aminoskābes) tiek transportētas ar speciālu pār-
nesējolbaltumvielu palīdzību (sk. 2.3. C. att.). Trans-
portējamā viela vai jons piesaistās pie pārnesēj-
olbaltumvielas vienā membrānas pusē, izmainot pārnesēja struktūru tā, ka pārnesamā viela tiek pārvietota un atbrīvota otrā membrānas pusē. Tā-
du pasīvā transporta veidu sauc par vielu pār-
nesi; tas neprasa ATP enerģiju, jo molekulas tiek pārvietotas koncentrācijas gradienta virzienā. Osmoze Osmozei dabā ir ļoti liela nozīme. Ar tās palī-
dzību notiek ūdens ieplūšana šūnā vai aizplūšana no tās. Ja vielu koncentrācija šūnas citoplazmā ir lielāka nekā šūnstarpu šķidrumā, šūna uzņem ūdeni. Ja izšķīdušo vielu koncentrācija šūnstarpu šķidrumā palielinās, tad šūna zaudē ūdeni. 2.3. A. att. Difūzija caur šūnas plazmatisko membrānu 2.3. B. att. Atvieglotā difūzija caur šūnas plazmatisko membrānu 2.3. C. att. Vielu pārnese caur šūnas plazmatisko membrānu Osmoze ir ūdens (šķīdinātāja) molekulu pār-
vietošanās caur puscaurlaidīgu membrānu no vietas ar augstāku ūdens koncentrāciju uz vietu ar zemāku koncentrāciju, piemēram, ūdens uz-
sūkšana no cilvēka resnās zarnas, ūdens uzsūk-
šanās no nefrona kanāliņiem asinsvadu kapilāros. Osmozi var novērot šādā eksperimentā. Mai-
siņu, kas izgatavots no puscaurlaidīgas membrā-
nas, piepilda ar cukura šķīdumu. Tajā ir niecīgas poras, pa kurām var izkļūt nelielās ūdens mole-
kulas, bet tām netiek cauri daudz lielākās cukura molekulas. Maisiņa galu aizsien un maisiņu ievieto traukā ar ūdeni. Drīz vien šķidruma daudzums maisiņā palielinās un maisiņš pārplīst. To var iz-
skaidrot šādi. Ūdens molekulu koncentrācija cu-
kura šķīdumā ir zemāka nekā traukā ar ūdeni. Tā kā cukura molekulas nevar iziet cauri porām, bet ūdens molekulas var, tad tās virzās virzienā - no trauka ar ūdeni uz maisiņu ar cukura šķīdumu. Maisiņam piepildoties, tā sieniņas rada pretspie-
dienu cukura šķīdumā ieplūstošo ūdens molekulu radītajam spiedienam. 2.4. att. Osmoze caur puscaurlaidīgu membrānu Ja maisiņš nav pietiekami izturīgs, tas pārplīst (sk. 2.4. att.). Ja citoplazmā un vakuolā ir lielāka sāļu un organisko skābju koncentrācija nekā ārējā vidē, tad tas liek ūdens molekulām intensīvi difun-
dēt šūnas iekšienē. Savukārt, ja ārpus šūnas sāļu koncentrācija ir lielāka, tas izsauc ūdens molekulu difūziju ārā no šūnas. Spiedienu, kas līdzsvaro ūdens daļiņu plūsmu caur puscaurlaidīgu membrānu koncentrācijas gra-
dienta virzienā, sauc par osmotisko spiedienu. Osmotiskā spiediena lielums ir atkarīgs no ūdenī izšķīdušo vielu koncentrācijas starpības abās mem-
brānas pusēs. Jo lielāka ir šī izšķīdušo vielu kon-
centrācijas starpība, jo lielāks ir osmotiskais spie-
diens un ūdens molekulas straujāk pārvietojas cauri membrānai. Osmoze regulē ūdens daudzumu šūnā. Palieli-
noties ūdens daudzumam apkārtējā vidē, ūdens ieplūšana šūnā ir atkarīga no tajā izšķīdušo vielu koncentrācijas. Ja šūnā ir palielināta jonu un iz-
šķīdušo vielu koncentrācija, tad tai ir nepiecie-
šams uzņemt vairāk ūdens. Tas šūnā ieplūst os-
mozes rezultātā. Ja izšķīdušo vielu koncentrācija ir lielāka šūnstarpu šķidrumā, tad ūdens aizplūst no šūnas un tā sačokurojas. Kad ūdens atkal ieplūst šūnās, un to turgors (spriegums, ko rada šūnu šķidrā satura spiediens uz šūnapvalku) palielinās, šūnas atjauno savu iepriekšējo formu. Arī auga saknēs ūdens uzsūcas ar osmozes palīdzību. Dzīvniekiem šūnstarpu šķidrumam parasti ir tāda pati koncentrācija kā šūnas citoplazmai. To sauc par izotonisko šķidrumu. Ja kādas šūnas, piemēram, eritrocītus jeb sarkanos asinsķerme-
nīšus, ievieto dažādas koncentrācijas sāļu šķīdu-
mos, tad to fizioloģiskais stāvoklis ievērojami pār-
mainās. Ja šūnas ievieto hipertoniskā šķīdumā (šķīdums, kurā sāļu koncentrācija ir lielāka nekā citoplazmā), tad ūdens aizplūst no šūnām un tās sačokurojas. Ja turpretim šūnas ievieto hipotoniskā šķīdumā (šķīdums, kurā sāļu koncentrācija ir ze-
māka nekā citoplazmā), tad šūnas piebriest, bet, ja šī koncentrāciju starpība ir liela, tad šūnapvalki pārplīst. Cilvēka šūnām ir nepieciešams aptuveni 0,9 % NaCl šķīdums. Šādu šķīdumu sauc par fizioloģisko šķīdumu, un to izmanto medicīnā, piemēram, injekcijām nelielos asiņu zuduma gadījumos. Filtrācija Filtrācija organismos ir ūdens un tajā izšķī-
dušo vielu plūsma caur puscaurlaidīgu membrānu gravitācijas vai mehāniskā spiediena ietekmē. Šī kustība notiek no vietas ar augstāku spiedienu uz vietu ar zemāku spiedienu un turpinās tik ilgi, ka-
mēr pastāv spiedienu starpība. Filtrācijai ir sva-
rīga loma, piemēram, nierēs pirmurīna veidošanā. 2.6. AKTĪVAIS TRANSPORTS Sūnām ir jāuzņem vielas arī pretēji koncentrā-
cijas gradientam. Tā, piemēram, šūnām ir jāuzņem barības vielas, kuru koncentrācija citoplazmā ir lielāka nekā šūnstarpu šķidrumā. Daudzām šūnām dzīvībai nozīmīgu procesu realizēšanai ir jāuztur dažāds jonu koncentrācijas gradients membrānas abās pusēs. Sūnām ir jāizvada un jāuzņem vielas, piemēram, olbaltumvielas, kuras ir pārāk lielas, lai varētu pasīvi izkļūt cauri ārējai membrānai. Lielmolekulāru vielu vadīšana caur šūnas mem-
brānu notiek, ieslēdzot šīs vielas membrānas pūs-
līšos. Atkarībā no vadīšanas virziena to sauc par endocitozi vai eksocitozi. Šīs darbības realizē aktīvie procesi, kas patērē šūnas enerģiju. Aktīvā pārnese Aktīvā pārnese ir process, kura rezultātā vie-
las tiek pārnestas caur šūnas plazmatisko mem-
brānu pretēji to koncentrācijas gradientam. Aktīvajā pārnesē svarīga loma ir pārnesējolbal-
tumvielām, kuras atrodas lipīdu molekulu dubult-
slānī (sk. 2.5. att.). Šīm olbaltumvielām ir divas specifiskas aktīvās vietas. Viena no šīm aktīvajām vietām ir telpiski atbilstoša transportējamās vielas molekulai. Olbaltumviela atpazīst šo molekulu un saistās ar to. Otra aktīvā vieta piesaista enerģijas piegādātāju - ATP molekulu. Tā atdod olbaltum-
vielas molekulai ATP uzkrāto enerģiju. Rezultātā pārmainās pārnesējolbaltumvielas telpiskā struk-
tūra un pirmajā aktīvajā vietā piesaistītā molekula var izkļūt cauri membrānai. 2.5. att. Aktīva pārnese Fagocitozei ir svarīga nozīme organisma aizsar-
dzībā pret slimībām. Cilvēkam un dzīvniekiem daļu leikocītu jeb baltās asins šūnas sauc par fa-
gocītiem, jo tie aktīvi uzņem un iznīcina or-
ganismam svešu vielu daļiņas. Fagocitozes laikā šūnas membrāna kopā ar svešo daļiņu ieliecas citoplazmā un apņem to. Membrāna virs daļiņas salīp un atdalās no šūnas membrānas, veidojot pūslīti (sk. 2.6. att.). Kad pūslītis šūnā saplūst ar lizosomu, tās fermenti svešās daļiņas sašķeļ. Pinocitozē ("dzerot") šūnā iekļūst ūdenī izšķī-
dušas šūnstarpas vielas. Ūdens piliens kopā ar tajā izšķīdušo vielu, līdzīgi kā fagocitozē, tiek iegrem-
dēts citoplazmā. Pinocitozes ceļā (sk. 2.7. att.) šūna var iegūt tās barības vielas, kuru molekulas ir pārāk lielas, lai izkļūtu cauri membrānas po-
rām. Šādi barības vielas uzņem augu sakņu šūnas, kā arī dzīvnieku asins šūnas, nieru kanāliņu un zarnu sieniņu šūnas. Vielu uzņemšana fagocitozes ceļā ir raksturīga tikai atsevišķiem šūnu veidiem, bet pinocitozē no-
tiek dažādās šūnās. Endocitoze Endocitozes ceļā, plazmatiskai membrānai izveidojot pūslīti, šūnā iekļūst lielas molekulas, vielu daļiņas un šķidru vielu pilieni. Fagocitozē atsevišķas šūnas uzņem ("apēd") daļiņas vai veselus mikroorganismus un pēc tam tos sagremo. Šādā veidā barojas vienšūnu orga-
nismi, piemēram, amēbas. Endocitoze ar receptoru starpniecību ir specializēts process, kura laikā šūna var uzņemt lielas noteiktu vielu molekulas, piemēram, vit-
amīnus, hormonus un citas šūnstarpu šķidrumā esošās vielas. Plazmatiskajā membrānā esošās ol-
baltumvielas - receptori - spēj tās piesaistīt. Re-
ceptora un šūnas savienojuma vieta ieliecas šūnā. Pēc tam viela atdalās no receptora (sk. 2.8. att.). Eksocitoze Eksocitozes ceļā šūnas atbrīvojas no nevēlamiem produktiem, piemēram, gremošanas atkritumvie-
lām, vai arī izdala sekrētus šūnstarpu šķidrumā. Eksocitozes laikā pūslītis ar izdalāmo vielu vir-
zās uz šūnas ārējo plazmatisko membrānu. Pūslīša membrāna saplūst ar šūnas plazmatisko membrā-
nu, un tā saturs izplūst šūnstarpu šķidrumā. 1. Kāda ir svarīgākā pasīvo procesu atšķirība no aktīvajiem procesiem ? 2. Ar ko atšķiras parastā difūzija no atvieglotās difūzijas? 3. Ar kādu vielu palīdzību realizējas aktīvais transports ? 4. Kas notiks ar cilvēka eritrocītiem dažādu koncentrāciju sāls šķīdumos ? Kā sauc procesu, kas izraisa šīs pārmaiņas ? Kādas izmaiņas notiks ar vardes eritrocītiem, kuru citoplazmas koncentrācija ir 0,6 %, 1) 0,9 % NaCl šķīdumā; 2) 0,6% NaCl šķīdumā; 3) tīrā ūdenī; 4) 3 % NaCl šķīdumā? 5. Kādam vielu transporta veidam atbilst dotie piemēri ? Izmantojiet šādu burtu un ciparu kodu: A - pasīvais; 1) osmoze; 2) difūzija; 3) atvieglotā difūzija; 4) vielu pārnese; 5) filtrācija; B - aktīvais; 6) aktīvā pārnese; 7) pinocitoze; 8) fagocitoze; 9) sekrēcija; 10) endocitoze ar receptoru starpniecību! 1) Ja tējā iemet cukura graudiņu, tas izšķīst un vienmērīgi sadalās pa visu trauku. 2) Sarkanie asinsķermenīši eritrocīti, ja tos ievieto 0,3 % sālu šķīdumā, pakāpeniski uzbriest, jo tajos iesūcas ūdens. 3) Skābeklis no asinsvadu kapilāriem, kur tā koncentrācija ir lielāka, virzās uz šūnstarpu šķidrumu, kur tā koncentrācija ir mazāka. 4) Pēc uzbudinājuma pārvades muskuļu šķiedrā notiek atsevišķu jonu pārnešana pretēji to koncentrācijas gradientam, lai atjaunotu membrānas potenciālu. 5) Ja membrānas receptors "atpazīst" slimības ierosinātāju (vīrusu, baktēriju) un savienojas ar to, notiek membrānas pakāpeniska ieliekšanās un gremošanas vakuolas izveidošanās. 6) No iekšējās sekrēcijas dziedzera šūnas, sekretorajiem pūslīšiem saplūstot ar šūnas mem-
brānu, izdalās hormons. 7) Cl' joni cauri specializētiem olbaltumvielu kanāliem no šūnstarpu šķidruma, kur to kon-
centrācija ir lielāka, pārvietojas uz šūnas citoplazmu, kur to koncentrācija ir zemāka. 8) Taukos šķīstošais etilspirts caur membrānas lipīdu slāni no šūnstarpu šķidruma pār-
vietojas koncentrācijas gradienta virzienā - uz šūnas iekšieni. 9) Nieru kapsulas kapilāros ir liels spiediens, kas rada šķidruma plūsmu no kapilāra uz savācēj kapsulu. 10) Ja asinis palielinas glikozes koncentrācija, to piesaista aknu šūnu membrānu pārne-
sējolbaltumvielas, ienesot glikozes molekulas šūnā. 11) Tievajā zarnā daļa barības vielu tiek uzņemta, membrānai ieliecoties ap vielu pilieniem un atdalot tos šūnas iekšpusē. 6. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem koncentrācijas gradients, difūzija, os-
moze, fagocitoze, pinocitozē! 2.7. ŠŪNU SAVIENOJUMI Daudzšūnu organismos starp šūnām un to gru-
pām pastāv savstarpēji kontakti, kas nodrošina šūnu mijiedarbību (sk. 2.9. att.). Daudzi dzīvnieku audi (kuņģa, urīnpūšļa) un orgāni (āda, sirds, gremošanas orgāni u. c.) ir pa-
kļauti dažādām mehāniskām iedarbībām, piemē-
ram, stiepšanai, saspiešanai. Lai šie orgāni nebo-
jātos un nesaplīstu, to šūnām ir jābūt savstarpēji cieši saistītām. Šādos audos ir savienojumi, ko sauc par desmosomām. Tās veido olbaltumvielas un ogļhidrāti. Desmosomu šķiedras no vienas šūnas citoplazmas caur šūnstarpu telpu iesniedzas otrā. Audu šūnas, kuras nedrīkst laist cauri šķidrumu (urīnpūslis, zarnas un citi cauruļveida orgāni), ir savstarpēji saistītas ar blīvajiem savienoju-
miem - tās savienotas tik cieši, ka starp tām ne-
var iekļūt vielu molekulas. Piemēram, zarnu gre-
mošanas sulas nevar iekļūt ķermenī, nierēs urīns paliek nieru kanāliņos. Daudzu dzīvnieku šūnu protoplastus savā starpā savieno olbaltumvielu kanāli. Pa šiem ka-
nāliem, kurus sauc par spraugu savienoju-
miem, var izkļūt barības vielas, hormoni, joni, kā arī elektriskie signāli. Šādi starpšūnu savienojumi palīdz saturēt kopā noteiktas šūnu grupas un saskaņot to darbību. Tie ir sirds muskulī, gludajos muskuļos, smadzeņu šūnās, dziedzeros, kā arī embriju šūnās. Dzīvās augu šūnas visbiežāk savā starpā ir sa-
vienotas ar daudz lielākiem kanāliem, ko sauc par plazmodesmām - caurulītēm, kas veidotas no šūnu membrānas. Tās savieno blakus esošo šūnu protoplastus. Pa šīm caurulītēm var izkļūt barības vielas, ūdens un dažādas bioloģiski aktīvas vielas. Augu šūnās var būt ļoti daudz plazmodesmu. 2.8. ŠŪNAS ORGANOĪD! Citoplazma Sūnā atrodas pusšķidra viela - citoplazma. Tā apņem šūnas kodolu un šūnas organoīdus. Cito-
plazmu kopā ar šūnas kodolu un organoīdiem sauc par protoplastu. Citoplazmā atrodas šūnas or-
ganoīdi, kā arī dažādi ieslēgumi un vakuolas. Citoplazmas sastāvā ietilpst ūdens (aptuveni 75-
85 %), olbaltumvielas (10-12 %), ogļhidrāti (4-
6 %), lipīdi (2-3 %), sāļi (1 %). Citoplazma ir pus-
caurspīdīgs želejveida šķidrums. Citoplazmā at-
rodas citoskelets - olbaltumvielu tīkls, kas sastāv no mikrocaurulītēm un aktīna un miozīna šķiedrām (sk. 2.10. att.). Citoskelets mainās at-
karībā no šūnas funkcionālā stāvokļa. Citoskelets veido šūnas iekšējo balstu un kopā ar plazmatisko membrānu nosaka tās formu. Tas nodrošina šūnas citoplazmas amēbveida kustības fagocitozes un pinocitozes laikā, pārvietošanos un šūnas formas maiņu organismu attīstības laikā. Svarīgākās bioķīmiskās reakcijas norit šū-
nas organoīdos. Sintezētās vielas tiek transpor-
tētas uz tām šūnas daļām, kur tās ir visvairāk nepieciešamas, bet vielmaiņas galaprodukti tiek izvadīti no šūnas. Citoplazma saskaņo organoīdu darbību un nodrošina šūnas dzīvotspēju. 1. Raksturojiet šūnu savienojumu veidus! 2. Kāda nozīme ir spraugu savienojumiem ? Endoplazmatiskais tīkls Endoplazmatiskais tīkls (sk. 2.11. att.) ir sav-
starpēji savienotu kanālu, vakuolu un cisternu sis-
tēma. Tā sienas veido plazmatiskā membrāna, kas ir samērā plāna (apmēram 6-7 nm). Endoplazma-
tisko tīklu 1945. g. atklāja ASV zinātnieks Keits Porters. Endoplazmatiskā tīkla uzbūve dažādās šūnās ir atšķirīga. Tā mainās atkarībā no šūnas funkcio-
nālajām īpatnībām. Lielākajā daļā sēņu, augu un dzīvnieku šūnu ir divu veidu endoplazmatiskie tīkli - gludais jeb agranulārais un graudainais jeb granulārais endoplazmatiskais tīkls. Graudainā endoplaz-
matiskā tīkla membrānas ir klātas ar nelieliem or-
ganoīdiem - ribosomām. Abu veidu endoplazma-
tiskie tīkli var pāriet viens otrā atkarībā no šūnas funkcionālā stāvokļa. Graudainais endoplazmatis-
kais tīkls parasti izveidojas tuvāk kodolam. Dažādas endoplazmatiskā tīkla daļas šūnā veic atšķirīgas funkcijas. Gludajā endoplazmatiskajā tīklā notiek lipīdu sintēze. Tur veidojas membrānu fosfolipīdi, holesterīns un noteiktās šūnu grupās -
arī steroīdie hormoni. Sintezētie lipīdi tiek trans-
portēti uz citām šūnas daļām un citiem organo-
īdiem. Gludajā endoplazmatiskajā tīklā notiek arī ogļhidrātu sintēze. Ribosomās, kas atrodas grau-
dainā endoplazmatiskā tīkla ārpusē, notiek olbal-
tumvielu sintēze. Šīs olbaltumvielas iekļūst endo-
plazmatiskajā tīklā un nonāk citās šūnas daļās. Tādējādi endoplazmatiskais tīkls nodrošina da-
žādu organismam svarīgu vielu sintēzi, to uzkrā-
šanu un transportu uz citām šūnas daļām. En-
doplazmatiskais tīkls pārvieto arī dažas vielas, kas iekļūst citoplazmā no kodola, šūnas organoīdiem un šūnstarpu šķidruma. Ribosomas Ribosomas (sk. 2.12. att.) ir nelieli organoīdi, kas atrodas uz graudainā endoplazmatiskā tīkla membrānām, kodola ārējās virsmas vai arī brīvi citoplazmā. Ribosomas ir no 10 līdz 35 nm lielas lodītes, kas atrodas visās dzīvajās šūnās. Riboso-
mas sastāv no olbaltumvielām un ribonukleīn-
skābēm. Ribosomās notiek olbaltumvielu sintēze no citoplazmā esošajām aminoskābēm. Olbaltum-
vielu sintēze ir sarežģīts process, kuru veic vesela ribosomu grupa - poliribosoma. Tajā ietilpst vai-
rāki desmiti ribosomu. Sintezētās olbaltumvielas uzkrājas endoplazmatiskā tīkla dobumos un tiek aiztransportētas uz Goldži kompleksu. Katra ribosoma sastāv no divām daļām jeb sub-
vienībām. Ribosomu novietojums šūnās var būt dažāds. Vairāk brīvo ribosomu ir šūnās, kurās uz-
krājas sintezētās olbaltumvielas. Ļoti daudz ribo-
somu, kas piestiprinājušās pie endoplazmatiskā tīkla membrānām, ir šūnās, kuras izdala (sekretē) olbaltumvielas, piemēram, aizkuņģa dziedzera šū-
nās, kas producē gremošanas fermentus. Goldži komplekss Goldži kompleksu 1898. gadā atklāja itāļu zi-
nātnieks Kamillo Goldži. Goldži komplekss (sk. 2.13. att.) ir organoīds, kuru veido saplacinātas cisternas, caurulītes un pūslīši. Tas parasti atrodas starp endoplazmatisko tīklu un membrānu. Goldži kompleksa sirpjveida cisternas vidusdaļā ir saplacinātas. Tās bieži vien ir novietotas grupās pa 4 līdz 8. Goldži kompleksā pa endoplazmatiskā tīkla kanāliem nokļūst sinte-
zētās vielas, kuras tur iekļuvušas pārgrupējas. Gol-
dži kompleksā atrodas fermenti, kas, pievienojot cukuru molekulas, pārveido olbaltumvielas un lipī-
dus par glikoproteīniem vai glikolipīdiem. Tie ir ne-
pieciešami membrānu veidošanai, kā arī ārpus šūnas noritošajām reakcijām. No Goldži komplek-
sa atdalās pūslīši ar sintezētajām vielām un virzās uz dažādām šūnas vietām. Daļa pūslīšu pietuvojas plazmatiskajai membrānai un izdala savu saturu. Sevišķi daudz tādu - sekretoro pūslīšu ir dažādu dziedzeru šūnās. Goldži komplekss veido arī lizoso-
mas. Dažkārt glikoproteīnu veidošanās sākas endo-
plazmatiskajā tīklā, bet Goldži kompleksā tiek pa-
beigta. Lizosomas Lizosomas ir nelieli, ieapaļi, ar membrānu ap-
vilkti pūslīši, kas atdalās no Goldži kompleksa. Tās var atrast gan augu, gan dzīvnieku šūnās. Li-
zosomas satur gremošanas fermentus. Lizosomu svarīgākā funkcija ir dažādu barības vielu sašķel-
šana. Tās sašķeļ gan atsevišķas olbaltumvielu mo-
lekulas, gan veselus mikroorganismus, kas šūnā iekļuvuši fagocitozes vai pinocitozes ceļā. Sašķel-
tās barības vielas caur lizosomas membrānu di-
fundē citoplazmā. Līdzīgā veidā lizosomas šūnā iznīcina bojātos un nefunkcionējošos organoīdus un pat veselas šūnas, piemēram, vardes kurkulim aste izzūd, iedarbojoties lizosomu fermentiem. Cil-
vēka embrijam sākotnēji pirkstus saista starp-
pirkstu audi, bet lizosomu fermentu darbības re-
zultātā šie audi noārdās. Parasti lizosomās esošie fermenti nespēj izkļūt cauri to membrānām un noārdīt pašu šūnu, taču, ja šūna ir ievainota vai traumēta, tas var notikt. Šādu šūnas pašiznīcināšanās procesu sauc par autolīzi. Mitohondriji Mitohondriji ir organoīdi, kas apgādā šūnu ar enerģiju. Tie ir visās augu, sēņu un dzīvnieku šūnās. Visvairāk mitohondriju ir aknu šūnās - ap-
tuveni 2500 mitohondriju vienā šūnā. Mitohon-
driji var būt apaļi, ovāli vai nūjiņveida. To dia-
metrs parasti ir no 0,2 līdz 1 \im, bet garums var sasniegt 7 jim. Mitohondrija sieniņa sastāv no divām membrā-
nām. Ārējā membrāna ir gluda, bet iekšējā mem-
brāna veido krokas, kuras sauc par kristām. Uz kristām (sk. 2.14. att.), ir izvietojušies fermenti, kas nodrošina mitohondrijos notiekošās šūnas el-
pošanas reakcijas. Mitohondriju iekšējais dobums -
matrice - ir pildīts ar pusšķidru vielu, kas satur mitohondriju DNS, ribosomas un fermentus. Jauni mitohondriji veidojas, daloties vecajiem. Mitohondrijos notiek ATP sintēze, izmantojot skābekli organisko vielu sašķelšanai (aerobā oksi-
dēšana). Tur notiek ogļhidrātu un citu bezslāpekļa vielu noārdīšana. Organisko vielu šķelšana sākas citoplazmā, taču tajā nav aerobās oksidēšanas pro-
cesam nepieciešamo fermentu. Tur notiek tikai anaerobie (bezskābekļa) procesi, kuru rezultātā veidojas neliela daļa enerģijas. Mitohondrijos no-
risinās aerobie procesi jeb šūnas elpošana, un tās rezultātā ATP saišu veidā uzkrājas aptuveni 19 reižu vairāk enerģijas nekā anaerobajās reakcijās. Mitohondrijos sintezētā ATP brīvi iekļūst citoplaz-
mā, kodolā, membrānās un dažādos organoīdos. Tur ATP ķīmiskā enerģija tiek izmantota šūnas dzīvības procesiem. Plastīdas Plastīdas ir augu šūnu organoīdi. Plastīdas iedala hloroplastos, hromoplastos un leikoplastos. Hloroplasti atrodas augu zaļajās šūnās. Tie piešķir augiem zaļo krāsu, jo satur pigmentu hlo-
rofilu. Hloroplastos notiek fotosintēze - organisko vielu veidošanās no neorganiskajām vielām gais-
mas ietekmē. Hloroplastos bez hlorofila ir arī citi pigmenti. Ziedaugu hloroplastiem parasti ir lēcveida forma. To diametrs vidēji ir 4-6 jum. Ēnā audzētu augu hloroplasti ir lielāki un satur vairāk hlorofila nekā saulē audzēti augi. Hloroplastiem, tāpat kā mitohondrijiem, sieniņa sastāv no divām membrānām, taču tās atrodas cieši viena pie otras. Iekšējā membrāna aptver hloro-
plasta dobumu, kas pildīts ar pusšķidru vielu -
stromu. Tajā atrodas savstarpēji saistītas struk-
tūras - granas, kas sastāv no nelieliem diskveida ķermenīšiem - tilakoīdiem, kuri izvietoti cits uz cita. Granas saista caurulīšu (lamellu) sistēma (sk. 2.15. att.). Dažādu augu un to audu šūnās hloro-
plastu skaits ir atšķirīgs. Augstāko augu šūnās pa-
rasti ir 40-60 hloroplastu. Hromoplasti atrodas dažādās augu daļās un nosaka sarkano, dzelteno un oranžo augļu, sakņu un ziedu vainaglapu krāsu. Hromoplasti satur pigmentus karotinoīdus. Tie pastiprina gaismas viļņu absorbciju fotosintēzes laikā. Leikoplasti ir bezkrāsainas plastīdas, kas at-
rodas stumbros, bumbuļos, saknēs, augļos un citās augu daļās. Leikoplasti uzkrāj rezerves barības vielas, galvenokārt cieti. Noteiktos apstākļos plastīdas spēj pārvērsties cita citā. Tā, piemēram, rudenī hloroplasti pār-
vēršas hromoplastos un lapas iegūst dzeltenīgu vai sārtu nokrāsu. Kartupeļu bumbuļi gaismā kļūst zaļi, jo leikoplasti pārvēršas hloroplastos. Centrosoma (šūnas centrs) un centriolas Centrosoma ir sabiezināta citoplazmas daļa, kas parasti atrodas netālu no kodola. Centrosomā atrodas divi taisnā leņķī viens pret otru novietoti nelieli veidojumi - centriolas, ap kurām ir cito-
plazmas kārta - centrosfēra. Katru centriolu veido deviņi mikrocaurulīšu tripleti (sk. 2.16. att.). Cen-
triolām ir svarīga loma šūnas dalīšanās procesā, jo tās nodrošina hromosomu kustību. Centriolās, tāpat kā mitohondrijos, atrodas ne-
daudz DNS. Vakuolas Vakuolas ir ar membrānu norobežoti pūšļi, ku-
ros atrodas šķidrums. Augu šūnās vakuolas var aizņemt pat vairāk nekā trīs ceturtdaļas no šūnas tilpuma. Augu vakuolas ir pildītas ar šūnsulu -
organisko un neorganisko vielu šķīdumu ūdenī. Šūnsulas mazšķīstošie sāļi var veidot kristālus. Augu vakuolās uzkrājas barības vielas, pigmenti, kā arī toksiskas vielas. Vakuolas regulē šūnas tur-
goru, kā arī ūdens un sāļu maiņu. Dzīvnieku šūnās neveidojas tādas vakuolas kā augu šūnās. No dzīvniekiem vakuolas ir tikai vienšūņiem. Viņiem raksturīgas gremošanas vakuolas, kas sa-
tur gremošanas fermentus uzņemto barības vielu sašķelšanai, un pulsējošās vakuolas, kas regulē os-
motisko spiedienu un izdala vielmaiņas galapro-
duktus. Peroksisomas Gan augu, gan dzīvnieku šūnās sastopamas pe-
roksisomas - nelieli organoīdi, kuros kā vielmai-
ņas blakusprodukts rodas ūdeņraža peroksīds (H202). Tas rodas kā daudzu fermentu darbības blakusprodukts, piemēram, sadalot taukskābes, atsevišķus ogļhidrātus. Peroksisomās daudz ir fermenta katalāzes, kura pārveido organismam kaitīgo ūdeņraža per oksīdu par nekaitīgiem gala-
produktiem - ūdeni un skābekli. katalāze 2H202 > 2H20 + 02 Šo katalāzes īpašību izmanto arī medicīnā, lai attīrītu brūci no netīrumiem. Ja uz nobrāzuma vai citas nelielas brūces uzlej ūdeņraža peroksīda šķīdumu (ūdeņraža pārskābi), šūnās esošā kata-
lāze to sadala, bet radušies skābekļa burbulīši izvada netīrumus un mikroorganismus no brūces. Skropstiņas un vicas Skropstiņas un vicas ir šūnas membrānas iz-
augumi, kas sākas no cilindriska veidojuma jeb ba-
zālā ķermeņa un nodrošina šūnu kustības. Visos augu un dzīvnieku organismos skropstiņu un vicu uzbūve ir vienāda. Tās veidotas no aplī izkārtotiem deviņiem mikrocaurulīšu pāriem un divām mikro-
caurulītēm to centrā (sk. 2.17. att.). Skropstiņu un vicu kustībām tiek izmantota ATP saišu veidā uzkrātā enerģija. Sūnas ar skropstiņām ir sastopamas daudzu dzīvnieku organismos, piemēram, mugurkaulnieku elpceļos. Tās rada šķidruma plūsmu, kas palīdz izvadīt no organisma sīkas daļiņas, piemēram, pu-
tekļus. Sevišķi daudz skropstiņu ir vienšūnu orga-
nismiem, piemēram, infuzorijām var būt 15 tūk-
stoši skropstiņu. Vicas ir garākas par skropstiņām. Visbiežāk katrai šūnai ir viena vica. Tās ir daudziem vien-
šūņiem, kā arī daudzšūnu organismu - sūkļu un zarndobumaiņu - atsevišķām šūnām, dzīvnieku un cilvēka spermatozoīdiem. 1. No kā sastāv citoskelets ? 2. Kādas ir citoskeleta svarīgākās funkcijas ? 3. Kādas vielas sintezējas endoplazmatiskajā tīklā ? 4. Raksturojiet nozīmīgākās Goldži kompleksa funkcijas! 5. Raksturojiet ribosomu funkcijas! 6. Kādas funkcionāli nozīmīgas vielas atrodas lizosomās ? 7. Raksturojiet mitohondriju svarīgāko funkciju! 8. Kāds pigments atrodas hloroplastos? 9. Kur atrodas hloroplasti, hromoplasti un leikoplasti ? 10. Kas ir šūnu kustību organoīdi? 11. Nosauciet audus (šūnas), kuros ir vislabāk attīstītas ribosomas un Goldži komplekss! Taukaudi; vairogdziedzera sekretorās šūnas; piena dziedzeru šūnas; nervu šūnas; kaulu šūnas. 12. Nosauciet audus (šūnas), kuros ir īpaši daudz mitohondriju! Muskuļškiedras; taukaudi; asiņu šūnas; aknu šūnas; spermatozoīdi; kaulu šūnas. 13. Miniet 5 piemērus, kas raksturo plastīdu savstarpējo pārvēršanos! Kādu apstākļu ietekmē notiek šīs pārvērtības ? 14. Norādiet, kuriem šūnas organoīdiem (1) atbilst minētās funkcijas (2): 1) graudainais endoplazmatiskais tīkls; gludais endoplazmatiskais tīkls; ribosomas; Goldži komplekss; lizosomās; mitohondriji; hloroplasti; peroksisomas; centrosoma; kodols; ko-
doliņš; 2) ribosomu veidošana; šūnas darbības regulācija; ogļhidrātu sintēze; lipīdu (tauku) sin-
tēze; olbaltumvielu sintēze; enerģijas ražošana; šūnai kaitīgo produktu noārdīšana; šū-
nas dalīšanās procesa nodrošināšana! Šūnu ieslēgumi Sūnu ieslēgumi atšķirībā no organoīdiem ir nepastāvīgi veidojumi, kas periodiski veidojas un tiek patērēti šūnas dzīvības procesos. Ieslēgumus veido barības vielu rezerves (tauki, ogļhidrāti, ol-
baltumvielas), pigmenti, sekrēti, kā arī dažādi viel-
maiņas produkti (sk. 2.18. att.). Tauki uzkrājas pilienu veidā. Sevišķi daudz tau-
ku pilienu ir saistaudu taukšūnās un augu sēklās. Ogļhidrāti šūnā ir sastopami graudu veidā. Dzīvnieku un baktēriju šūnās ieslēgumu veidā uz-
krājas glikogēns, bet augu šūnās rezerves ogļhid-
rāts ciete uzkrājas īpašos leikoplastos. Visvairāk cietes ir kartupeļu bumbuļos. Olbaltumvielas uzkrājas citoplazmā graudu veidā. Daudz olbaltumvielu ir dzīvnieku olšūnās, piemēram, zivju, putnu, kā arī augu šūnās, pie-
mēram, sēklās. Barības vielu ieslēgumus organismi izmanto enerģijas ieguvei, piemēram, dzīvnieki - badoša-
nās laikā vai augi - dīgšanas laikā. Kodols Kodols ir šūnas lielākā sastāvdaļa. Parasti tas atrodas šūnas centrā, taču specializētās šūnās var būt novirzīts sāņus. Visbiežāk kodols ir apaļš vai ovāls, bet reizēm tas var būt iegarens vai citas for-
mas. Kodola lielums vidēji ir 2-10 ļim. Parasti šūnai ir viens kodols, taču ir arī divko-
dolu (skrimslī) un daudzkodolu (aknās) šūnas. Kodols ir visās eikariotu (protistu, sēņu, augu un dzīvnieku) šūnās, izņemot šauri specializētas šū-
nas, kas nespēj vairoties, piemēram, sarkanie asinsķermenīši jeb eritrocīti. Prokariotu (baktē-
riju un zilaļģu) šūnās nav stingri izveidota kodola -
kodolviela ir izkliedēta pa visu šūnas citoplazmu. Šūnas kodols satur ģenētisko (iedzimtības) ma-
teriālu, kurš tiek saglabāts un nodots nākamajām šūnu paaudzēm nepārmainītā veidā. Kodols regulē šūnas struktūras olbaltumvielu un fermentu sin-
tēzi, kā arī koordinē šūnu darbību. Kodola apvalks atdala kodolu no citoplazmas. Tas sastāv no divām membrānām, starp kurām ir sprauga (sk. 2.19. att.). Caur kodola membrānu porām (100 nm) kodolā viegli var iekļūt olbaltum-
vielas un no tā izkļūt ribosomu subvienības. Kodolā ir nukleoplazma jeb kodolplazma. Tā ir pusšķidra viela, kurā atrodas hromatīns un ko-
doliņš. Tajā ir daudz fermentu. Kodola matri-
cu veido olbaltumvielas, kas atrodas ap kodola membrānu, un nukleoplazmā esošās pavedienveida olbaltumvielas. Tās kopā ar hromosomu olbaltum-
vielām blīvi caurauž kodolu. Hromatīns ir šūnas ģenētiskais materiāls. Tas sastāv galvenokārt no DNS un olbaltumvielām. Kodolā esošās DNS molekulas veido smalkus pa-
vedienus. Sūnu dalīšanās sākumā DNS molekulas ir spiralizētas un kondensētas, tās veido hromo-
somas. Katrai sugai ir noteikts hromosomu skaits (sk. tab.) Laikā, kad kodols nedalās, hromosomas nav saskatāmas. Dažu eikariotu diploidalais hromosomu skaits 2.1. tabula Parasti šūnas kodolā ir viens, divi vai vairāki nelieli apaļi vai ovāli kodoliņi bez membrānas. Sūnas dalīšanās laikā kodoliņi izzūd. Tie sastāv galvenokārt no RNS un olbaltumvielām. Sūnām, kurām raksturīga intensīva olbaltumvielu sintēze, ir lieli kodoliņi, piemēram, dziedzeršūnas, nervu šūnas, embrionālās šūnas, olšūnas. Kodoliņos vei-
dojas ribosomu subvienības, kā arī notiek ribo-
somu RNS (rRNS) sintēze. Caur kodola apvalka porām subvienības nokļūst citoplazmā, kur tiek pabeigta ribosomu veidošana. 2.9. ŠŪNU KOPĪGĀS UN ATŠĶIRĪGĀS PAZĪMES t Lai gan vairums aplūkoto šūnas sastāvdaļu ir sastopamas gan augu, gan dzīvnieku šūnās, tomēr pastāv arī atšķirības (sk. 2.20. att.). • Augu šūnu plazmatisko membrānu aptver biezs šūnapvalks, kas ļauj tām saglabāt formu, bet augam piešķir mehānisku izturību. Sūnapvalki ir pietiekami elastīgi, lai augi vējā liektos, bet ne-
lūztu, jo tie sastāv no celulozes un citām šķiedrām. • Augu šūnās ir plastīdas. Sevišķi nozīmīgi ir hloroplasti, kuros notiek fotosintēze. Dzīvnieku šūnās plastīdu nav. • Augu šūnās ir lielas vakuolas, kas pildītas ar šūnsulu. • Sēklaugu šūnās atšķirībā no dzīvnieku šūnām nav centrosomu. • Augu šūnas savā starpā ir savienotas ar plaz-
modesmām, bet dzīvnieku šūnām raksturīgi citi šūnu savienojumu veidi. Atkarībā no šūnu attīstības pakāpes visus or-
ganismus iedala prokariotos un eikariotos. Augi, dzīvnieki, sēnes un protisti (vienšūņi, aļģes) ir eikarioti, jo tiem ir komplicēta šūnas uzbūve, ar membrānu norobežots kodols un citi šūnas orga-
noīdi. Baktērijas ir prokarioti - organismi ar vienkāršu šūnas uzbūvi, kurā nav ar membrānu norobežota kodola un citu šūnas organoīdu. I ! Prokariotu šūnas ir primitīvākas un mazākas nekā eikariotu šūnas. Prokariotu šūnu diametrs ir apmēram 5 jam, turpretī eikariotu šūnām tas pār-
sniedz 10 ļum un var sasniegt pat 100 \im. Proka-
riotu šūnām nav izteikta kodola. Iedzimtības ma-
teriāls tām ir izkliedēts protoplastā un nav atdalīts ar membrānu. Prokariotu šūnām nav daudzu eika-
riotu šūnām raksturīgo organoīdu, piemēram, endo-
plazmatiskā tīkla, Goldži kompleksa, lizosomu. Dažas eikariotu šūnas ir ļoti lielas un redzamas pat bez mikroskopa. Piemēram, arbūzu un apel-
sīna mīkstuma šūnas, putnu olas dzeltenumi. Viena veida audos šūnu izmēri ir samērā nemai-
nīgi, bet dažādiem audiem tie ir atšķirīgi. Sūnas var būt lodveida, daudzstūrainas, iega-
renas, zvaigžņveida. Sūnas formu ietekmē proto-
plazmas īpašības un blakus esošo šūnu iedarbība. Ir arī šūnas ar mainīgu formu (amēbas, leikocīti). Augu valstī vislielākās šūnas ir viendīgļlapjiem, bet dzīvnieku valstī - kukaiņiem un abiniekiem. Tātad šūnu forma un izmēri ir atkarīgi no orga-
nismu bioloģiskajām un vielmaiņas īpatnībām. 1. Ar ko atšķiras augu šūnas no dzīvnieku šūnām ? 2. Raksturojiet prokariotu un eikariotu šūnu atšķirības! 3. Uzzīmējiet un aizpildiet tabulu "Eikariotu šūnu uzbūve"! 4. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem eikarioti, prokarioti! Prokariotu un eikariotu šunu salīdzinājums 2.2. tabula 2.10. AUDI, ORGĀNI, ORGĀNU SISTĒMAS Lai veidotu savu organismu un nodrošinātu tajā dzīvības procesus, visiem organismiem no apkār-
tējās vides jāiegūst izejvielas un enerģija, jānodro-
šina gāzu apmaiņa un jāizvada no organisma atkritumvielas (vielmaiņas galaprodukti), jāveic vielu transports, jāvairojas, jāsaskaņo organisma darbības, kā arī jāaizsargā tas no nelabvēlīgiem apkārtējās vides faktoriem, piemēram, tempera-
tūras svārstībām, parazītiem. Sauszemes organis-
miem jābalsta ķermenis (jāaizsargā tas no gravi-
tācijas spēka iedarbības). Lai visas šīs prasības tiktu apmierinātas, daudzšūnu organismos vēro-
jama šūnu specializācija - pielāgošanās noteiktu funkciju veikšanai. Organismu uzbūves pamatvienība ir šūna. Lī-
dzīgas uzbūves šūnu grupas (sk. 2.21. att.), kam ir kopēja embrionāla izcelsme un kas veic noteiktu lomu organismā, sauc par audiem. No audiem ir izveidoti orgāni. Katrs orgāns sastāv no vairā-
kām audu pamatgrupām. Orgānus, kas veic no-
teiktas funkcijas, apvieno orgānu sistēmās. Or-
gānu sistēmas ir atbildīgas par organisma dzīvības procesiem. Piemēram, gremošanas orgānu sistēma nodrošina barības vielu nokļūšanu organismā, A. Augu šūnas a) veidotājaudu šūna (nediferencēta) b) akmensšūna (balstaudi) c) asimilētājšūna (parenhīma) d) uzkrājējšūna (parenhīma) e) epidermas šūna (segaudi) f) saknes spurgaliņas šūna (segaudi) g) zvaigžņmatiņšūna h) sietstobri ar pavadītājšūnu (vadaudi, kas transportē organiskās vielas) i) šķiedršūna (balstaudi) j) traheīda (vadaudi) k) traheja (vadaudi, kas transportē ūdeni un tajā izšķīdušās neorganiskās vielas) 2.21. att. Augu un dzīvnieku šūnu veidi elpošanas orgānu sistēma - skābekļa piegādi, bet izvadorgānu sistēma - kaitīgo vielmaiņas galapro-
duktu izvadīšanu no organisma. Augu audi Augiem ir piecas audu pamatgrupas: meris-
tēma jeb veidotājaudi, segaudi, parenhīma jeb pa-
B. Dzīvnieku šūnas a) sievišķā dzimumšūna (olšūna) b) epitēlijšūna c) skropstiņepitēlija šūna d) dziedzerepitēlija šūna e) maņas orgānu šūna (pārveidots neirons) f) nervu šūna g) saistaudu šūna h) pigmentšūna i) skrimšļšūna (skrimšļaudi) j) kaulaudu šūna (cietie saistaudi) k) gludā muskuļšūna (muskuļaudi) 1) asins šūnas (šķidrie saistaudi) m) vīrišķā dzimumšūna (spermatozoīds) mataudi, balstaudi jeb mehāniskie audi un vad-
audi. Meristēma jeb veidotājaudi nodrošina augu augšanu un specializētu audu veidošanos. Šie audi sastāv no blīvi sakārtotām šūnām, kuras spēj in-
tensīvi dalīties un pārvērsties par citu audu šū-
nām. Galotņu meristēma, kas atrodas saknes un vasas galotnē, nodrošina auga augšanu garumā. Sānu meristēma (kambijs) nodrošina auga aug-
šanu resnumā. Daļa no meristēmas šūnām nepār-
traukti dalās, bet daļa - pakāpeniski diferencējas un veido citus audus. Mūsdienās plaši izplatītas ir meristēmu kultūras. Tās iegūst laboratorijās, mē-
ģenēs audzējot augu meristēmu šūnas. Tā kā me-
ristēmu šūnas dalās straujāk, nekā spēj savairo-
ties vīrusi, tad iegūst atveseļotus kultūraugus, ku-
riem nav vīrusu slimību. So metodi izmanto ze-
meņu, kartupeļu, neļķu, krizantēmu, gerberu un citu augu audzēšanai. Iestarpinātā meristēma raksturīga graudzālēm. Tā atrodas pie vasas posmu, lapu un ziedkātu pa-
mata. Rētu meristēma veidojas jebkurā auga organis-
ma vietā, kur radies ievainojums. Segaudi pasargā augu no izžūšanas un nodro-
šina vielu apmaiņu ar ārējo vidi. Lapas un zālai-
nus stumbrus klāj primārie segaudi jeb epiderma. To veido viena blīvi sakārtotu, dzīvu šūnu kārta. Epidermā atrodas atvārsnītes, kas nodrošina gāzu maiņu un ūdens iztvaikošanu no auga. Sakņu uzsūkšanas joslā ir epidermas šūnas ar gariem izaugumiem - spurgaliņas, kuras nodrošina ūdens un minerālvielu uz sūkšanu. Epidermu klāj vaska kārtiņa - kutikula vai ma-
tiņi, kas pasargā augu no pārkaršanas. Stumbram un saknēm augot resnumā, epidermas šūnas de-
formējas un atmirst, veidojas sekundārie segaudi jeb korķis. Parenhīma jeb pamataudi ir filoģenētiski visvecākie un arī vismazāk diferencētie audi. Tie atrodas starp citiem audiem. Parenhīma sastāv no daudz stūrainām noapaļotām šūnām ar plānu šūnapvalku. Parenhīmai atkarībā no auga orgāna, kurā tā atrodas, var būt dažādas funkcijas. Lapu un jaunu stumbru mizas parenhīmas šūnās ir hlo-
roplasti un tajās notiek fotosintēze, tāpēc tās sauc par asimilētājaudiem. Sēklu, augļu, vasas pār-
veidņu, kā arī stumbra serdes un sakņu paren-
hīmas šūnās hloroplastu nav, bet tiek uzkrātas ba-
rības vielas, tāpēc tos sauc par uzkrājējaudiem. Peldošajiem ūdensaugiem starp parenhīmas šū-
nām ir ar gaisu pildītas telpas. Tādus audus sauc par aerenhlmu. Sekretorie audi jeb dziedzeraudi uzkrāj vie-
las augā vai izdala uz auga virsmas atkritumvielas vai augu sekrētus (izdalījumi, kas noder augu turpmākajā dzīvē). Pie sekretoriem audiem pieder dziedzermatiņi, dziedzeršūnas, nektārdziedzeri, sagremotājdziedzeri un hidatodes (ūdens atvārsnī-
tes). Skujkoku stumbru un zaru koksnē atrodas sveķu ailes, kas izdala sveķus. Balstaudi jeb mehāniskie audi balsta auga orgānus un nodrošina to mehānisko izturību. Balstaudu šūnām ir biezi šūnapvalki, kas bieži vien pārkoksnējas. Atkarībā no šūnapvalka bie-
zuma izšķir triju veidu balstaudus: kolenhīmu, sklerenhīmu un sklereīdas. Auga augošajās daļās, piemēram, jaunos stumbros, lapu kātos, lapu plāt-
nēs, kā arī ziedos, ir kolenhīma - dzīvas šūnas ar nevienmērīgi uzbiezinātiem šūnapvalkiem. Skle-
renhīmu veido garas, izstieptas šūnas ar vien-
mērīgi uzbiezinātiem šūnapvalkiem. Novecojot sklerenhīmas šūnas atmirst, to šūnapvalks pār-
koksnējas, bet šūnas dobumu piepilda gaiss. Li-
niem un kaņepēm šīs šūnas veido šķiedras, ko iz-
manto tekstilrūpniecībā. Rieksti un zīļu apvalki, kā arī plūmju, ķiršu un citu augļu kauliņi ir ļoti cieti. Tie sastāv no sklereīdām jeb akmensšū-
nām - nedzīvām šūnām ar vienmērīgi uzbiezinā-
tiem šūnapvalkiem, kuros ir kalcija un silīcija sa-
vienojumi. Sklereīdas ir arī bumbieru un cidoniju augļu mīkstumā, koka mizā un citur. Vadaudi nav visiem augiem. Ķērpjos un sūnās vielas pārvietojas difūzijas ceļā, bet papardēs, ko-
sās, staipekņos un sēklaugos vielas tiek transpor-
tētas pa garām caurulītēm - vadaudiem. Tie nodrošina ūdens un minerālvielu transportu no saknēm caur stumbru uz lapām, kā arī organisko vielu pārvietošanos no lapām uz visiem auga or-
gāniem. Augus, kuriem ir vadaudi, sauc par vas-
kulārajiem augiem. Vadaudi ir trahejas, traheīdas, sietstobri un pa-
vadītājšūnas. Pie vadaudiem pieskaita arī tvert-
nes, kas izdala auga piensulu. Trahejas ir līdzīgas posmainām caurulītēm. Tās veidojas no dzīvām šūnām, izzūdot šķērssienām starp tām un atmirstot šūnas saturam. Traheju garums var būt no dažiem centimetriem līdz pat metram un vairāk (liānām 3-5 m). Traheīdas ir īsākas par trahejām - tikai 1-4 mm garas. Tās, tāpat kā trahejas, ir nedzīvas šūnas, kuru šūnapvalks vietām ir uzbiezināts. Traheīdas ir primitīvāki vadaudi nekā trahejas. Tās ir paparžu, kosu, staipekņu un kailsēkļu galvenais vadaudu elements. Augstāk attīstītajiem segsēk-
ļiem to nav. Traheīdas veic arī balsta funkciju. Sietstobri ir dzīvas šūnas, starp kurām ir po-
rainas plātnītes. Līdzās sietstobriem atrodaspava-
dītāj šūnas. Pa trahejām un traheīdām plūst ūdens ar tajā izšķīdušajām minerālvielām, bet pa sietstobriem un pavadītājšūnām - fotosintēzē radušās organis-
kās vielas. Trahejas un traheīdas atrodas koksnē, bet siet-
stobri un pavadītāj šūnas - lūksnē. Lakstaugiem vadaudi parasti ir apvienoti vadaudu kūlīšos. Dzīvnieku audi Dzīvnieku, kā arī cilvēka organismā ir četras audu pamatgrupas: epitēlijaudi, saistaudi, mus-
kuļaudi un nervaudi. Epitēlijaudi jeb epitēlijs pārklāj ķermeni no ārpuses (āda), kā arī izklāj gremošanas traktu, elpceļus, urīnizvadceļus, dzimumceļus, ķermeņa dobumus (gļotāda), kā arī veido dziedzerus. Epi-
tēlija šūnas atrodas tuvu cita pie citas, un starp tām ir ļoti maz šūnstarpu vielas. Epitēlijs regulāri atjaunojas. Epitēlijaudus iedala segepitēlijā un dziedzerepitē-
lijā. Segepitēlijam jeb segaudiem ir aizsargfunkcija un uzsūkšanas funkcija. Tas aizsargā organismu no dažāda veida kairinājumiem, kā arī neļauj tajā iekļūt mikroorganismiem. Piemēram, ādas epitē-
lijam ir raga slānis, bet elpceļu gļotādas epitēlijam ir skropstiņas. Tās attīra gaisu, virzot ārā no orga-
nisma mikrobus un putekļu daļiņas. Savukārt zarnu epitēlija bārkstiņas no zarnu dobuma uzsūc gremošanas traktā sašķeltās uzturvielas, kā arī sāļus, vitamīnus un ūdeni. Dažu dzīvnieku, piemēram, sūkļu kāpuru un planāriju ķermeni klāj skropstiņas (skropstiņepi-
tēlijs), ar kuru palīdzību viņi kustas, bet posm-
kājiem un daļai tārpu epitēlijs izdala kutikulu -
aizsargslāni, kas apņem ķermeni. Dziedzerepitēlijs jeb dziedzeraudi_ izstrādā un izdala specifiskas vielas - sekrētus. Arējās sekrē-
cijas dziedzeri, piemēram, sviedru dziedzeri, sie-
kalu dziedzeri, asaru dziedzeri, sekrētu izdala uz ādas, gļotādas vai ķermeņa dobumos. Pie ārējās sekrēcijas dziedzeriem pieder arī gremošanas dzie-
dzeri, kuri izdala sekrētus gremošanas trakta (kuņģa, zarnu) dobumā. Iekšējās sekrēcijas dzie-
dzeriem, piemēram, hipofīzei, epifīzei, vairogdzie-
dzerim, nav izvadkanālu, un sekrēts (hormoni) nokļūst asinīs. Saistaudi ir uzbūves un funkcionālajā ziņā at-
šķirīgi audi, kas nesaskaras ar ārējo vidi un iek-
šējiem ķermeņa dobumiem. Starp saistaudu šū-
nām ir daudz šūnstarpu vielas, kas var būt cieta, šķidra vai arī šķiedraina. Saistaudi veic barošanas un mehānisko funkciju, kā arī aizsargfunkciju. Saistaudus iedala atkarībā no šūnstarpu vielas konsistences. Šķidrie saistaudi ir saistaudi, kuros šūnas citu no citas atdala šķidrums - šūnstarpu viela. Šķidrie saistaudi ir asinis un limfa. Šķidrie saistaudi or-
ganismā veic daudzas nozīmīgas funkcijas: trans-
portē skābekli, ogļskābo gāzi, barības vielas, hor-
monus, kā arī veido un transportē aizsargvielas. Asinis piedalās arī organisma termoregulācijā. Tās vienmērīgi sadala siltumu pa visu ķermeni. Asinis sastāv no sarkanajām asins šūnām jeb eritro-
cītiem, baltajām asins šūnām jeb leikocītiem, asins plātnītēm jeb trombocītiem un šūnstarpu vielas -
plazmas. Atšķirībā no citu saistaudu šūnstarpu vielas plazma nav veidojusies no šūnām, bet gan no dažādu vielu molekulām, kas asinīm pievienojas dažādās organisma vietās. Plazmā ir ūdens un tajā izšķīdušas vielas: sāļi (Na+, Ca2+, K+, Mg2+, Cl", HCO3-, SO|"), gāzes (02, C02), plazmas olbaltum-
vielas (albumīni, globulīni, fibrinogēns), citas orga-
niskas vielas (glikoze, tauki, aminoskābes, fosfo-
lipīdi), slāpekļa atkritumprodukti (urīnviela, amo-
nijs, urīnskābe), kā arī hormoni un fermenti. Irdenie saistaudi organismā ir plaši izplatīti. Šie audi pilda balsta un barošanas funkciju. Tie sa-
stopami visos orgānos. Irdenie saistaudi labi atjau-
nojas un aizpilda dažādus bojājumus, veidojot rēt-
audus. To šūnstarpu viela sastāv no pamatvielas un šķiedrām. Specializētie irdenie saistaudi, piemē-
ram, taukaudi, nodrošina organismam siltumizo-
lāciju, bet retikulārie audi veido asinsrades orgā-
nus. Tie ir limfmezglos, liesā un kaulu smadzenēs. Blīvajos saistaudos ir vairāk šķiedru un mazāk šūnu nekā irdenajos saistaudos. Pie blīvajiem saistaudiem pieder cīpslas, saites, audi, kas atro-
das artēriju sienās, un citi. Skrimšļaudi veido mugurkaula starpskriemeļu diskus, trahejas un bronhu skeletu, ribu galus, tie pārklāj kaulu locītavu virsmas, veido auss gliemež-
nīcu. Tiem ir izturīga, elastīga šūnstarpu viela. Cietie saistaudi veido skeletu. Tie ir izturīgi un elastīgi. Kaulaudi sastāv no kaula šūnām jeb os-
teocītiem un cietas šūnstarpu vielas, kurā ir daudz minerālsāļu. Kaula šūnas ir izkārtotas gredzenos ap kanāliem, pa kuriem ieiet asinsvadi un nervi. Kaulaudi ir cieti un izturīgi. Tie veido kaulus. Muskuļaudi ir specializēti audi, kas nodrošina organisma kustības un iekšējo orgānu saraušanos (kontrakcijas). Muskuļaudu spēja sarauties ir atka-
rīga no olbaltumvielu pavedieniem - miofibrillām. Muskuļaudus iedala gludajos, šķērssvītrotajos jeb skeleta un sirds muskuļaudos. Gludos muskuļaudus veido vārpstveida šūnas, kurām nav šķērssvītrojuma. Gludie muskuļaudi ir daudziem bezmugurkaulniekiem (tārpiem, gliem-
jiem), kā arī atrodas mugurkaulnieku iekšējo or-
gānu (gremošanas, elpošanas orgānu, izvadorgānu un dzimumorgānu) sienās, asinsvadu, limfvadu sienās un ādā pie matu sīpoliņiem. Gludo muskuļ-
audu darbība nav pakļauta gribai. Gludie muskuļi kontrahējas lēnāk nekā šķērssvītrotie muskuļi, taču tie spēj ilgstoši atrasties kontrakcijas stāvoklī. Šķērssvītrotos jeb skeleta muskuļaudus veido garas, cilindriskas šķiedras, kurās ir daudz ko-
dolu. Katra šķiedra radusies, saplūstot vairākām šūnām. Aplūkojot šķiedras mikroskopā, tajās var redzēt miofibrillas ar gaišākām un tumšākām joslām, tādēļ šo muskuļaudu šķiedras izskatās šķērssvītrotas. Šķērssvītrotie muskuļi ir piestip-
rināti pie skeleta kauliem un saraujoties rada ķer-
meņa kustības. To darbība ir pakļauta gribai. Šķērssvītrotie muskuļi kontrahējas straujāk nekā gludie muskuļi, bet ātrāk nogurst. Šķērssvītrotie muskuļi ir visi posmkāju muskuļi un mugurkaul-
nieku skeleta muskuļi. Sirds muskuļaudi atrodas vienīgi sirdī. Tie no-
drošina sirds sieniņu saraušanos. Atšķirībā no skeleta muskuļiem sirds muskuļiem ir gan šķērs-
svītroto muskuļu, gan gludo muskuļu pazīmes. To šķiedras ir šķērssvītrotas, bet katrā šķiedrā ir tikai viens kodols. Sirds muskulatūra saraujas strauji, bet nav pakļauta gribai. Tai piemīt automātija. Nervaudi ir audi, kas vada uzbudinājumu. Tie atrodas galvas un muguras smadzenēs un veido nervu sistēmu. Tā regulē dažādu orgānu un orgānu sistēmu darbību, kā arī organisma mijiedarbību ar apkārtējo vidi. Nervaudi sastāv no nervu šūnām jeb neironiem un neiroglijas šūnām. Ārpus galvas un muguras smadzenēm garie neironu izaugumi veido nervus, kurus aptver saistaudi. Neironi spēj uztvert kairinājumu, tajos rodas uzbudinājums, un tie pār-
vada nervu impulsus. Mijiedarbība starp neironiem notiek specifiskās kontakta vietās jeb sinapsēs. Neiroglijai piemīt trofiskā jeb barotāj funkcija (no asinīm barības vielas nokļūst neiroglijas šū-
nās, bet no tām - nervu šūnās), balsta funkcija (tās balsta nervu šūnas un to izaugumus), atda-
lītājfunkcija (izolē nervu šūnu izaugumus, ap asinsvadiem veido neiroglijas slāni), sekretorā funkcija (piedalās smadzeņu šķidruma sekrēcijā) un aizsargfunkcija (neiroglija var fagocitēt bojā-
gājušās nervu šūnas un to izaugumus). Neiroglijas šūnas impulsus nepārvada. 1. Ko sauc par audiem ? 2. Raksturojiet augu audu pamatgrupas! 3. Kādas audu pamatgrupas ir dzīvnieku un cilvēka organismā ? Kādas ir to funkcijas ? 4. Kuri no šiem audu veidiem raksturīgi augiem, kuri - dzīvniekiem ? Parenhīma; epiderma; aerenhīma; dziedzerepitēlijs; balstaudi; veidotājaudi; muskuļaudi; epitēlijaudi; vadaudi; neieaudi; cietie saistaudi; trahejas; šķidrie saistaudi; sekretorie audi; irdenie saistaudi; uzkrājējaudi. 5. Atsevišķi dzīvnieku un augu audi pilda līdzīgas funkcijas. Izveidojiet šādu dzīvnieku un augu audu pārus, izmantojot 4. uzd. minētos audu veidus! 6. Kuram augu audu veidam pieder minētie šūnu veidi (audu paveidi)? 1) Pamataudi; 2) balstaudi; 3) veidotājaudi; 4) segaudi; 5) vadaudi; а) trahejas; b) traheīdas; c) sietstobri; d) kolenhīma; e) sklerenhīma; f) sklereīdas; g) aeren-
hīma; h) uzkrājējaudi; i) sekretorie audi; j) meristēmas; k) kambijs; l) epiderma; m) atvārs-
nītes; n) dziedzermatiņi. 7. Kurš no nosauktajiem audu veidiem ir lieks katrā grupā ? Pamatojiet, kāpēc! 1) Balstaudi, muskuļaudi, segaudi, vadaudi; 2) sklereīdas, traheīdas, kolenhīma, parenhīma; 3) trahejas, traheīdas, sietstobri, atvārsnītes; 4) aerenhīma, parenhīma, kolenhīma, sekretorie audi; 5) šķērssvītrotā muskulatūra, asinis, kauli, cīpslas; б) segepitēlijs, dziedzerepitēlijs, skropstiņepitēlijs, dziedzermatiņi. 8. Kuram dzīvnieku audu veidam atbilst nosauktās funkcijas ? 1) Epitēlijaudi; 2) muskuļaudi; 3) saistaudi; 4) nervaudi; a) nodrošina barības vielu uzsākšanu zarnās; b) realizē kustību reakcijas; c) izklāj ķermeņa dobumus un iekšējos orgānus; d) veido kaulus un skrimšļus; e) veido iekšējās sekrēcijas dziedzerus; f) nodrošina imunitātes reakcijas; g) nodrošina vielu transportu organismā; h) piešķir iekšējiem orgāniem elastību; i) koordinē organisma darbību. 9. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem audi, meristēma, parenhīma, epitēlijs, epiderma! 3.1. ORGANISMU ĶĪMISKAIS SASTĀVS Organisms sastāv no ķīmiskiem savienojumiem jeb vielām, savukārt ķīmiskos savienojumus veido dažādu elementu atomi. Četri elementi - skābeklis (O), ogleklis (C), ūdeņradis (H) un slāpeklis (N) veido līdz 98 % no organismu masas. Tāpēc tos sauc par organogēniem elementiem. Organismos vienmēr ir arī kalcijs (Ca), kālijs (K), nātrijs (Na), magnijs (Mg), sērs (S), fosfors (P), hlors (Cl) un dzelzs (Fe). Šos elementus sauc par makroelementiem. Varš (Cu), cinks (Zn), kobalts (Co), mangāns (Mn), molibdēns (Mo), jods (I), fluors (F) un citi elementi šūnā ir vēl niecīgākā daudzumā (procenta tūkstošdaļas vai vēl mazāk). Tos sauc par mikro-
elementiem. Organismu šūnās ir konstatēts vai-
rāk nekā 80 ķīmisko elementu, kas ietilpst ķīmis-
ko elementu periodiskajā tabulā. Šūnās un organismos ir gan neorganiskās vie-
las, gan organiskās vielas. Dzīvība uz Zemes nav iedomājama bez ūdens, jo ir radusies ūdens vidē. Ūdens veido aptuveni divas trešdaļas no organisma masas. Šūnās ir arī sāļi, bāzes, skābes un oksīdi. Organisko vielu sastāvā vienmēr ietilpst oglek-
lis un ūdeņradis, bet var būt arī daudzi citi ele-
menti, piemēram, slāpeklis, sērs. Organismam nozīmīgākās organiskās vielas ir ogļhidrāti, olbal-
tumvielas, lipīdi, nukleīnskābes un adenozīntri-
fosfāts (ATP). 3.2. NEORGANISKĀS VIELAS Ūdens Ūdens (H20) ir viena no parastākajām, bet tajā pašā laikā viena no svarīgākajām neorganiskajām vielām, kas atrodas organismā. * Augu šūnām ir biezi šūnapvalki, kurus veido polisaharīds celuloze, tāpēc augu šūnās procentuāli ir vairāk polisaharīdu. Ūdens īpašības nosaka tā molekulas uzbūve. Ūdeņraža atomi ūdens molekulā ir savienoti ar skābekļa atomu. Iedomāta taisne, kas iet caur šo atomu kodoliem veido aptuveni 105° leņķi. Tā kā skābeklis elektronus pievelk stiprāk nekā ūdeņra-
dis, tad ūdens molekula ir polāra: skābekļa atomam ir daļēji negatīvs lādiņš, bet ūdeņraža atomiem -
daļēji pozitīvs lādiņš. Daļēji negatīvais skābekļa atoms pievelk citu ūdens molekulu daļēji pozitīvos ūdeņraža atomus, veidojot ūdeņraža saites. Ūdens ir labs šķīdinātājs, tādēļ, ka ūdeņraža saites viegli veidojas un viegli sabrūk. Ūdens īpašības • Ūdens ir šķīdinātājs. Vairums neorganisko vielu un arī daļa organisko vielu šūnās atrodas ūdenī izšķīdušā veidā. Visas vielas, kas uzsūcas asinīs no dzīvnieka tievās zarnas, ir ūdenī šķīs-
tošas. Arī augi no augsnes uzņem tikai ūdenī iz-
šķīdušus sāļus. • Ūdens piedalās vielu transportēšanā. Ūdens pārvieto vielas pa šūnu, no šūnas uz šūnu, kā arī pa visu organismu. Ūdens iztvaikošana caur augu lapām (transpirācija) nodrošina tā uzņem-
šanu no augsnes un transportu pa auga vadau-
diem. Tā kā ūdens ir asiņu pamat sastāvdaļa, tas nodrošina vielu transportu pa visu dzīvnieka or-
ganismu ar asinsrites palīdzību. Šķidrās atkritum-
vielas tiek izvadītas no dzīvnieka (arī cilvēka) or-
ganisma kopā ar ūdeni (urīna veidā). • Ūdens regulē spiedienu. Ūdens nodrošina noteiktu spiedienu šūnās un organismā. Ja auga šūnas nonāk hipertoniskā šķīdumā (šķīdumā, kurā sāļu koncentrācija ir lielāka nekā šūnās), tad no-
vēro procesu, ko sauc par plazmolīzi - šūnas zau-
dē daļu ūdens un to citoplazma atraujas no šūnap-
valka (sk. 3.1. att.). Izšķir ieliekto un izliekto plaz-
molīzi. Plazmolīze ir ieliekta, ja citoplazma tikai vietām atiet no šūnapvalka un ieliecas šūnas cen-
tra virzienā. Ja visa šūnas citoplazma atiet no šūnapvalka un koncentrējas šūnas vidū, tad tā ir izliekta plaz-
molīze. Ja plazmolizētas šūnas ievieto tīrā ūdenī (hipo-
tonisks šķīdums - sāļu koncentrācija mazāka nekā šūnās), notiek pretējais process - deplazmolīze, kurā šūnas uzņem ūdeni un citoplazma atgriežas iepriekšējā stāvoklī. Plazmolīze ir vērojama tikai dzīvām auga šūnām. Ja sāļu koncentrācija vidē ir ļoti liela, plazmolīze var būt neatgriezeniska un augs aiziet bojā. Tas dažkārt novērojams tad, kad pārmēslo laukus ar minerālmēsliem, - augi nokalst. Dzīvnieku šūnām ir tikai membrāna, bet nav šūnapvalka. Tām ir novērojama tikai osmoze. Pie-
mēram, ja sarkanās asins šūnas (eritrocīti) nonāk hipertoniskā vidē, tās zaudē ūdeni un sačokurojas (kļūst zvaigžņveida). Ja šūnas ievieto hipotoniskā vidē, ūdens nonāk šūnās; tās piebriest un pārplīst (notiek hemolīze). Šā iemesla dēļ cilvēkam un dzīv-
niekiem medikamentus drīkst injicēt tikai kopā ar fizioloģisko šķīdumu. Tas ir šķīdums, kurā sāļu koncentrācija ir tāda pati kā organisma asins plaz-
mā - vidē, kurā atrodas asins šūnas. • Ūdens piedalās organisma termoregulā-
cijā. Lai ūdeni sasildītu, ir nepieciešams liels sil-
tuma daudzums. Tāds pats siltuma daudzums iz-
dalās, ūdenim atdziestot, tāpēc siltums vienmērīgi izplatās pa visu organismā esošo ūdeni. Ūdens novērš lielas temperatūras svārstības dažādās ķer-
meņa daļās un pasargā tās no pārkaršanas, jo ūdens iztvaikošana no dzīvnieku ķermeņa vai no lapu virsmas ir saistīta ar lielu siltuma patēriņu. Šī ūdens īpašība arī palīdz nodrošināt homeostāzi, saglabāt pastāvīgu ķermeņa temperatūru un pa-
sargāt organismus no pārkaršanas. • Ūdens piedalās organisma ķīmiskajās reakcijās. Šūnās, kurās notiek aktīva vielmaiņa, ūdens ir daudz vairāk nekā mazaktīvās šūnās. Pie-
mēram, galvas smadzeņu šūnās ir 85 % ūdens, bet zobu emaljā - tikai 10-15 %. Tas ir tādēļ, ka ūdens piedalās ķīmiskajās reakcijās, kas notiek orga-
nismā. Ūdens ir nepieciešams arī dažādu bioloģiski aktīvu vielu sintēzei. Šūnās norit arī tādas reak-
cijas, kurās ūdens veidojas, piemēram, polimēru sintēzes reakcijas. Ūdens atšķeļas no aminoskā-
bēm, kad tās piedalās olbaltumvielas veidošanā. Piemēram, kamieļi tuksnesī spēj ilgstoši iztikt bez ūdens dzeršanas tādēļ, ka viņu organisms ūdeni iegūst, oksidējot kuprī uzkrātos taukus. • Ūdens ir gļotu un želejveida vielu sa-
stāvā. Šīs vielas sevišķi nepieciešamas iekšējo orgānu saskares vietās, piemēram, locītavās, sirds somiņā, jo mazina berzi, orgāniem darbojoties. Sāļi Sāļi organismā nodrošina vielmaiņu. Vairums sāļu organismā ir izšķīdušā (jonu) veidā. Izņēmums ir kauli, zobi, gliemju čaulas, kurās sāļi uzkrājas cietā veidā. Nozīmīgākie katjoni (pozitīvi joni) ir Na+; K+; Ca2+; Mg2+, nozīmīgākie anjoni (negatīvi joni) ir Cl"; HCO~; HPOf un H2PO~. Nātrija un hlora jonu visvairāk ir šūnstarpu vielā, bet daudz kālija un fosfātjonu ir šūnu citoplazmā. Organismos ir noteikts vides pH. Piemēram, cilvēka asinīm pH ir 7,36, un tas nekad nemainās vairāk par ±0,05, lai gan cilvēks ar uzturu uzņem dažādas vielas. Nemainīgu pH nodrošina vielu spēja piesaistīt H+ vai OHT jonus. Šādas īpašības piemīt ogļskābei, hidrogēnkarbonātjoniem, fosfā-
tiem, plazmas olbaltumvielām. Skābju-sārmu līdzsvara nodrošināšanā piedalās arī plaušas un nieres, izvadot no organisma liekos jonus un skā-
bes. Savukārt mikroelementu rezerves uzkrājas aknās. 3.3. ORGANISKĀS VIELAS Ogļhidrāti Ogļhidrāti ir organiski savienojumi, ko veido og-
leklis, ūdeņradis un skābeklis. Ogļhidrāti ir nelieli, ūdenī šķīstoši cukuri vai arī garas savā starpā sa-
vienotu cukuru molekulu ķēdes, kuras nešķīst ūdenī. Ogļhidrāti veidojas augos galvenokārt foto-
sintēzē. Dzīvnieki (arī cilvēks) tos uzņem ar barību. Ogļhidrāti ir galvenais enerģijas avots organismā. Šķeļot ogļhidrātus, organisms visvieglāk iegūst enerģiju. Piemēram, organismā noārdoties 1 g ogļ-
hidrātu, cilvēks iegūst 4,2 kcal jeb 17,6 kJ enerģijas. Daļa ogļhidrātu var pārvērsties taukos vai tau-
kiem līdzīgās vielās, bet citi pārvēršas rezerves ogļhidrātos. Piemēram, glikogēns uzkrājas aknās un skeleta muskulatūrā, savukārt ciete - augļos un bumbuļos. 1. Raksturojiet ūdens lomu organismā! 2. Kāpēc plazmolīze notiek augu šūnās, bet nav vērojama dzīvnieku šūnās ? 3. Raksturojiet jonu nozīmi organismos! 4. Noskaidrojiet, kāds ir jūsu svars! Aprēķiniet, kāds ūdens daudzums ir jūsu organismā! 5. Zināms, ka cilvēka smadzeņu masa vidēji ir 1300 g. Aprēķiniet, cik daudz ūdens ir jūsu smadzenēs! 6. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem organogēnie elementi, makroelementi, mikroelementi, plazmolīze, deplazmolīze/ Ogļhidrātus iedala monosaharīdos, oligosaha-
rīdos un polisaharīdos. Monosaharīdi ir vienkāršie cukuri, kuriem ir no trim līdz septiņiem oglekļa atomiem. No oglekļa atomu skaita molekulā tiek atvasināti monosaha-
rīdu nosaukumi: C3 - triozes; C5 - pentozes; C6 -
heksozes. Daudzu monosaharīdu molekulas dzīvās šūnās ir cikliskas (gredzenveida), jo šāda uzbūve atvieglo molekulu mijiedarbību. Sevišķi nozīmīgi monosaharīdi ir pentozes un heksozes. Pentozes (riboze un dezoksiriboze) ietilpst nukleīnskābju sastāvā, bet heksoze (glikoze) ir galvenais ener-
ģijas avots cilvēka organismā. Glikozi sauc arī par vīnogu cukuru. Daudz glikozes ir medū un nek-
tārā. Tā ietilpst arī vairāku disaharīdu un poli-
saharīdu, kā arī glikoproteīdu sastāvā. Heksozes ir arī galaktoze, fruktoze jeb augļu cukurs un ci-
tas. Dabā visbiežāk sastopamie oligosaharīdi ir disaharīdi. To molekula ir veidojusies no divām monosaharīda molekulām, tām zaudējot ūdeni. Pie-
mēram, apvienojoties glikozes un fruktozes mole-
kulām, veidojas saharoze jeb biešu cukurs, bet, ap-
vienojoties glikozes un galaktozes molekulām, ro-
das laktoze jeb piena cukurs. Saharozi kā uztura piedevu cilvēki izmanto kopš 16. gadsimta. Latvijā saharozi iegūst no cukur-
bietēm. Citur pasaulē to iegūst arī no cukurnied-
rēm, cukurpalmām, cukurkļavas, kukurūzas, ka-
mieļērkšķiem un citiem augiem. Polisaharīdi ir ogļhidrāti, kuri sastāv no dau-
dziem savā starpā saistītiem monosaharīdu mo-
lekulu atlikumiem (to skaits var sasniegt simtus un tūkstošus). Svarīgākie polisaharīdi ir glikogēns, ciete un celuloze. Ciete ir augu barības rezerve. Daudz cietes ir saknēs un augļos, bet visvairāk tās ir kartupeļu bumbuļos un graudos. Glikogēns ir dzīvnieku (arī cilvēka) barības re-
zerves viela, kas veidojas no asinīs esošās glikozes un uzkrājas aknās un muskuļos. Viena no izplatītākajām organiskajām vielām dabā ir celuloze, kuras monomēri ir glikozes mo-
lekulas. Glikoze celulozes polimēros ir savienota ar izturīgākām saitēm nekā cietes un glikogēna polimēros. Celuloze ir augu šūnapvalkos. Sevišķi daudz tās ir kokvilnā (vairāk nekā 90 %) un koksnē (50-70 %). Celuloze veido šķiedras, kas piešķir augam izturību. Cilvēka gremošanas sis-
tēmā zarnu mikroflora nespēj sašķelt celulozi, bet tās šķiedras ir noderīgas uztura balastvielas. Organismos ir vēl citi polisaharīdi. Piemēram, krabju, kukaiņu un zirnekļu ārējais cietais apvalks jeb eksoskelets un sēņu šūnapvalki ir no hitīna. Tā monomērs ir glikoze, kurai pievienota amino-
grupa (sk. 3.3. att.). Lipidi Lipīdi ir organiskas hidrofobas (atgrūž ūdens molekulas) vielas ar daudzveidīgu struktūru. Tie nešķīst ūdenī, bet šķīst organiskajos šķīdinātājos, piemēram, benzolā, hloroformā, ēterī. 1. Raksturojiet ogļhidrātu funkcijas organismā! 2. Kāpēc glikogēnu sauc par dzīvnieku rezerves cukuru ? 3. Kādu ogļhidrātu satur kokvilnas apģērbs ? 4. Kartupeļos ir vidēji 20 % cietes un citu ogļhidrātu. Citām to sastāvā esošām vielām nav nozīmīgas enerģētiskās vērtības. Kāds daudzums kartupeļu būtu jāapēd vienā dienā, ja nebūtu pieejams cits uzturs, lai nodrošinātu dienai nepieciešamo enerģiju ? (Jauniešiem ar vidēju fiziskās aktivitātes līmeni tas ir 2800 kcal dienā.) 5. Cilvēka aknās ir vidēji 150 g glikogēna, bet skeleta muskuļos - 200 g glikogēna. Kādu enerģijas daudzumu iespējams iegūt no šīm ogļhidrātu rezervēm? Cik stundām skolēnam pietiktu ar šo enerģijas daudzumu, ja viņš neuzņemtu to ar barību ? (Skolēnam nepiecieša-
mais enerģijas daudzums ir aptuveni 108 kcal!stundā.) 6. Cilvēkam dienā nepieciešami 400-500 g ogļhidrātu. Kādi ir galvenie pārtikas produkti, no kuriem varētu iegūt šādu ogļhidrātu daudzumu ? 7. Sagrupējiet minētos ogļhidrātus monosaharīdos, oligosaharīdos, polisaharīdos! Glikoze; saharoze; laktoze; celuloze; fruktoze; galaktoze; ciete; glikogēns; hitīns; riboze; dezoksi-
riboze. Dažu taukskābju uzbuve un izplatība** 3.2. tabula Vienkāršie lipīdi (tauki, eļļas un vaski) satur oglekli, ūdeņradi un skābekli un parasti neveido gredzenveida struktūras. Tauki un eļļas veidojas no vienas glicerīna molekulas un trim taukskābju molekulām. Taukskābju sastāvs dažādos taukos un eļļās ir atšķirīgs. Lipīdos konstatēti vairāk ne-
kā 200 dažādu taukskābju atlikumi. Taukos pār-
svarā ir piesātināto taukskābju atlikumi (nesatur dubultsaites), bet eļļās - nepiesātināto taukskābju atlikumi (satur dubultsaites). Tāpēc istabas tem-
peratūrā tauki ir cieti, bet eļļas - šķidras. Tauki galvenokārt ir dzīvnieku valsts produktos, bet eļļas - augu valsts produktos. Vaskiem atšķirībā no taukiem un eļļām taukskābes ir saistītas nevis glicerīnam, bet augstākajiem spirtiem. Tauki un eļļas ir enerģētiski visbagātākās uz-
turvielas. Tām noārdoties, atbrīvojas daudz ener-
ģijas - 1 g tauku dod organismam apmēram 9,3 kcal jeb 39 kJ. Organisms taukus uzkrāj rezervei. Dzīvniekiem rezerves tauki nogulsnējas zemādas tauku slānī un tauku plēvēs. Sevišķi daudz tauku uzkrājas siltasiņu dzīvniekiem, kuri dodas ziemas guļā vai dzīvo polārajos apgabalos. Gājputniem pirms aizli-
došanas tauki veido pusi no ķermeņa masas. Zem-
ādas tauku slānis kalpo arī kā siltumizolācija. Tas pasargā organismu no atdzišanas, kā arī piešķir ādai elastību. Tauki pasargā iekšējos orgānus no mehāniskiem triecieniem. Taukiem ir liela nozīme daudzos organisma dzīvības procesos, tie šķīdina A, D, E un K vitamīnu. Augiem eļļas uzkrājas galvenokārt sēklās. Sēklu dīgšanas laikā augs tās izmanto kā rezerves barī-
bas vielas. Daudz eļļas ir saulespuķu, sojas, rapšu, linu, kaņepju un citu augu sēklās. Vaski plānā kārtiņā sedz sauszemes augu stum-
bru, lapas un augļus. Tie pasargā augu no mehā-
niskiem bojājumiem, slimību izraisītājiem un pār-
mērīga mitruma, kā arī aizkavē ūdens iztvaiko-
šanu. Vaski ietauko zīdītāju vilnu. Bites no vaska veido šūnas medus uzkrāšanai. Saliktie lipīdi ir fosfolipīdi un lipoproteīni. Fosfolipīdi ietilpst šūnu membrānu sastāvā. Fosfolipīdos divas glicerīna hidroksilgrupas ir saistītas ar taukskābju atlikumiem, bet trešā - ar fosforskābes atlikumu. Fosfolipīdu taukskābju atlikumi ir hidrofobi, bet fosforskābes atlikumi ir hidrofili (pievelk ūdens molekulas). Lipoproteīni atrodas šūnas citoplazmā. Steroīdi ir salikti lipīdi, kuru struktūra atšķi-
ras no pārējiem lipīdiem. Tie sastāv no četriem gredzeniem un dažādām funkcionālām grupām (sk. 3.4. att.). Visizplatītākais steroīds ir holesterīns. Tas ietilpst šūnu membrānu sastāvā. Daudz hole-
sterīna ir taukaudos un nervaudos. Holesterīns ir izejviela daudzu bioloģiski aktīvu vielu, piemēram, 3.4. att. Steroīdi* vitamīnu un hormonu, sintēzei. Paaugstināts hole-
sterīna līmenis asinīs var izraisīt aterosklerozi, tas ir, holesterīna izgulsnēšanos uz asinsvadu sieni-
ņām. Lai izvairītos no šīs slimības, uzturā ieteicams lietot vairāk augu eļļas, nevis dzīvnieku taukus. Olbaltumvielas Olbaltumvielas jeb proteīni ir lielmolekulāri or-
ganiski savienojumi, kas satur oglekli, ūdeņradi, skābekli, slāpekli, reizēm arī fosforu, sēru vai citus elementus. Olbaltumvielas ir polimēri, kuru sastā-
vā var būt 20 dažādas aminoskābes. Katrai amino-
skābei ir karboksilgrupa (-COOH) un aminogrupa Daļa holesterīna organismā veido hormonus, piemēram, dzimumhormonus, kuri nosaka orga-
nisma dzimumpazīmes, un kortikosteroīdus (virs-
nieru garozas hormoni), kuri ietekmē vielmaiņas reakcijas. (-NH2). Savienojoties vienas aminoskābes karbok-
silgrupai ar nākamās aminoskābes aminogrupu, veidojas dipeptīds, kuram ir vienīgi olbaltumvie-
lām raksturīga saite - peptīdsaite (sk. 3.5. att.). Dažādās olbaltumvielās ir atšķirīgs aminoskābju sastāvs un secība. Katram organismam ir speci-
fiskas olbaltumvielas. 1. Kas raksturīgs lipīdiem ? 2. Ar ko tauki atšķiras no eļļām? 3. Raksturojiet tauku funkcijas organismā! 4. Kāda ir holesterīna loma organismā ? 5. Gājputniem pirms aizlidošanas pusi no ķermeņa masas veido tauki. Dzērves vidējais svars ir 5 kg, bet paugurknābja gulbja - 15 kg. Cik smagi būtu šie putni pirms migrācijas, ja to enerģētiskās rezerves būtu uzkrātas nevis tauku, bet ogļhidrātu veidā? 6. Daudzu sporta veidu pārstāvji lieto steroīdos preparātus. Kāda ir to nozīme? Kādi bla-
kusefekti var būt to lietošanai ? 7. Daudzi jaunieši, sevišķi meitenes, ievēro dažādas diētas, lai novājētu. Viens no paņēmieniem ir taukvielām bagātu vielu, kuros ir dažādu veidu lipīdi, izslēgšana no uztura. Bieži vien tam seko organisma vielmaiņas un fizioloģisko procesu (piemēram, dzimumcikla) trau-
cējumi. Izskaidrojiet šo parādību! 8. Daudzas vaļu sugas lielu daļu savas dzīves pavada polārajos ūdeņos. Kādi ir viņu pielā-
gojumi ķermeņa temperatūras uzturēšanai ? Nosauciet citus dzīvniekus, kuriem ir tādi paši vai citādi pielāgojumi! Olbaltumvielu sastava ietilpstošas aminoskabes* Cilvēka organisms lielāko daļu aminoskābju saņem ar uzturu, bet, ja tas nenotiek, amino-
skābes spēj veidoties cita no citas. No 20 olbal-
tumvielu sastāvā esošām aminoskābēm cilvēka organisms spēj sintezēt 12 aminoskābes, bet 8 aminoskābes nespēj sintezēt. Tās sauc par ne-
aizstājamām aminoskābēm (fenilalanīns, izoleicīns, leicīns, lizīns, metionīns, treonīns, triptofāns un valīns). Dzīvnieku olbaltumvielas satur visas neaizstājamās aminoskābes. Tāpēc tās sauc par pilnvērtīgām olbaltumvielām. Augu olbaltumvielas, nesatur visas neaizstā-
jamās aminoskābes. Lai nodrošinātu organismu ar visām nepieciešamajām aminoskābēm, cilvē-
kiem jāuzņem uzturs, kurā ir daudzveidīgas ol-
baltumvielas. Aminoskābes lieto medicīnā, piemēram, ar metionīnu ārstē aknu slimības, pārtikas rūpnie-
cībā, piemēram, glutamīnskābe piešķir produk-
tiem gaļas garšu, lopkopībā, piemēram, lizīns veicina mājputnu un mājlopu augšanu. Aminoskābes piedalās ne tikai olbaltumvielu sintēzē, bet arī hormonu, vitamīnu un pigmentu radīšanā. Tām ir liela nozīme gan augu, gan dzīvnieku vielmaiņas regulācijā. Olbaltumvielu molekulām ir četri organizā-
cijas līmeņi jeb struktūras. • Pirmējā jeb primārā struktūra ir ami-
noskābju sakārtojums taisnā polipeptīdu ķēdē (sk. 3.6. att.). Starp aminoskābju atlikumiem ir peptīdsaite. • Otrējā jeb sekundārā struktūra veidojas ami-
noskābju pavedienam telpiski savijoties spirālē (a spirāle) vai salokoties plākšņveidā ((3 struktūra; sk. 3.7. att.). Otrējo struktūru kopā satur ūdeņraža saites, kas izveidojušās starp aminogrupu ( = NH) ūdeņraža atomiem un karbonilgrupu ( = CO) skā-
bekļa atomiem. • Trešējā jeb terciārā struktūra rodas, vei-
dojoties papildu saitēm starp polipeptīdu ķēdes sān-
virknēm. Un līdz ar to olbaltumvielas otrējā struk-
tūra (a spirāle) noteiktā veidā izliecas un telpiski savijas (sk. 3.8. zīm.). B. (3 struktūra ir, piemeram, zīda olbaltumvielai fibroīnam. 3.7. att. Olbaltumvielu otrējā struktūra • Ceturtējā jeb kvartārā struktūra ir dau-
dzām olbaltumvielām. Tā rodas, vairākām olbal-
tumvielu makromolekulām izveidojot vienotu kompleksu. Ceturtējā struktūra ir, piemēram, hemoglobīnam (sk. 3.9. att.). govs piens vārot maina garšas īpašības. Olbaltum-
vielas dabiskās struktūras izjaukšanu sauc par denaturāciju. Denaturācijas procesā olbaltum-
vielu molekulās noārdās ūdeņraža saites un pa-
pildsaites un polipeptīdvirkne veido haotisku struk-
tūru. Jo augstāks olbaltumvielas organizācijas līmenis, jo vājākas tās saites. Vāja iedarbība izjauc tikai olbaltumvielas ceturtējo struktūru. Stiprāka iedarbība var izraisīt daļēju trešējās struktūras at-
ritināšanos, bet, ja iedarbība ir stipra, olbaltum-
vielas makromolekula var pilnīgi atritināties un palikt pirmējās struktūras veidā. Vairums olbaltumvielu ir bioloģiski aktīvas ti-
kai tad, ja ir noteikta vides temperatūra un pH. Dažādu fizikālo un ķīmisko faktoru ietekmē (aug-
sta temperatūra, ķīmiskas vielas, mehāniskā dar-
bība, ultravioletais starojums, rentgenstarojums) ol-
baltumvielu makromolekulu struktūra mainās un tās zaudē savas dabiskās īpašības. Piemēram, ieveidojot matus un liekot ilgviļņus, mainās matu olbaltumvielu telpiskā struktūra un tie kļūst lo-
kaini, vistas olas baltums vārot kļūst ciets, bet Denaturētas olbaltumvielas nepilda savas funk-
cijas, tāpēc vairums organismu iet bojā 60 °C tem-
peratūrā. Dažos gadījumos denaturācijas process ir at-
griezenisks, t. i., denaturētā olbaltumviela var pār-
iet atpakaļ dabiskā stāvoklī un atgūt bioloģisko aktivitāti. Piemēram, pēc olbaltumvielu izgulsnē-
šanas ar spirtu, pievienojot nogulsnēm ūdeni, tās izšķīst un olbaltumvielas struktūra atjaunojas. Atkarībā no telpiskās struktūras izšķir fibrilā-
rās un globulārās olbaltumvielas. Fibrilārās olbaltumvielas ir pavedienveida. Tās ir stabilas, ūdenī un sāļu šķīdumos nešķīs-
tošas vielas. Tās ir dzīvnieku saistaudu galvenais struktūrelements, piemēram, nagu un matu olbal-
tumviela keratīns, cīpslu olbaltumviela kolagēns, saistaudu olbaltumviela elastīns un citas. Globulārajām olbaltumvielām ir sfēriska struktūra. Tās labi šķīst ūdenī un veic regulācijas funkcijas. Globulārās olbaltumvielas ir vairums fermentu, antivielas, hormoni, albumīns, hemo-
globīns un citas vielas. Dažām olbaltumvielām, piemēram, muskuļu ol-
baltumvielai miozīnam, piemīt gan fibrilāro, gan globulāro olbaltumvielu īpašības. Pēc uzbūves iz-
šķir vienkāršās olbaltumvielas un saliktās olbal-
tumvielas jeb saliktos proteīnus. Vienkāršās olbal-
tumvielas sastāv tikai no aminoskābēm, bet salikto olbaltumvielu sastāvā ir vēl kāda cita viela, piemēram, ogļhidrāti, lipīdi vai skābe. Atkarībā no tā, kāda viela ietilpst salikto olbaltumvielu sastā-
vā, tās sauc par glikoproteīniem, lipoproteīniem vai nukleoproteīniem. Olbaltumvielas ir specifiskas katrai sugai. Cil-
vēka organismā diennaktī veidojas aptuveni 1,3 g olbaltumvielu uz vienu masas kilogramu. Vielmai-
ņas procesos izlietotās olbaltumvielas un liekās aminoskābes, šūnā noārdoties, rada ūdeni (H20), ogļskābo gāzi (C02) un amonjaku (NH3). Amon-
jaks ir organismam kaitīga viela, no kuras atbrī-
vojas, to aknās pārvēršot par urīnvielu. Olbaltumvielu funkcijas • Fermentatīvā jeb enzīmiskā funkcija. Fermentus (enzīmus) sauc par biokatalizato-
riem, jo tie ievērojami paātrina ķīmiskās reakci-
jas, bet savu struktūru tajās nemaina. Fermenti veido 90 % no visām šūnas olbaltumvielām. Dau-
dzu fermentu sastāvā bez olbaltumvielām ir arī vitamīni vai to atvasinājumi un metālu joni, kuri piedalās elektronu, atomu vai atomu grupu pār-
nešanā no viena savienojuma uz citu. Šo fermenta daļu sauc par kofaktoru. Fermenta katalītisko aktivitāti nosaka tikai ne-
liela tā daļa - aktīvais centrs, ar kuru tas pie-
saistās substrāta (pārveidojamās vielas) moleku-
lai. Ferments dažādas molekulas var savienot vai arī sašķelt. Fermentu darbība ir specifiska - katrs ferments spēj katalizēt tikai noteikta veida bio-
ķīmisko reakciju. Piemēram, aizkuņģa dziedzera ferments sašķeļ olbaltumvielas par aminoskābēm. • Uzbūves funkcija. Olbaltumvielas ietilpst gandrīz visās šūnas sastāvdaļās. Kolagēns ir saist-
audu un kaulaudu viela, bet keratīns ir matu, ragu un nagu sastāvā. • Fotoaktīvā funkcija. Atsevišķas olbaltum-
vielas gaismas iedarbībā ierosina nervu impulsa rašanos (rodopsīns) vai fotosintēzes reakcijas (hlorofils). • Receptorā funkcija. Arējās vides signālus uztver acu, deguna, mēles un citu orgānu recep-
toru olbaltumvielas. Piemēram, acs tīklenē ir olbaltumviela rodopsīns (redzes pigments), kas uztver gaismas viļņus. Uz daudzu šūnu virsmas ir olbaltumvielas, kuras spēj saistīties ar hormo-
niem, antigēniem - indēm, baktērijām, vīrusiem, kas ir iekļuvuši organismā. • Kustību funkcija. Muskuļšķiedru olbaltum-
vielas aktīns un miozīns nodrošina muskuļu sa-
raušanos. • Transportfunkcija. Olbaltumvielas spēj pie-
saistīt noteikta veida molekulas. Tā, piemēram, mugurkaulnieku asins plazmas albumīns piesaista brīvās taukskābes, nogādājot tās no taukaudiem uz dažādiem orgāniem. Olbaltumviela hemoglo-
bīns, kas atrodas mugurkaulnieku eritrocītos, ar asins plūsmu pārnes skābekli no plaušām uz dažā-
diem audiem. Šūnas membrānā esošās olbaltum-
vielas spēj transportēt cauri membrānai dažādas lielmolekulāras vielas. • Aizsargfunkcija. Ja mugurkaulnieku asinīs vai audos iekļūst kāda organismam sveša viela, tiek izstrādātas specifiskas olbaltumvielas - antivielas. Tās neitralizē organismā iekļuvušās svešās vielas. Šādas antivielas ir, piemēram, interferons, kas rodas pēc saskares ar vīrusiem un neļauj tiem vai-
roties, un imūnglobulīni, kas iznīcina patogēnās (slimības izraisošās) baktērijas. Cilvēka asinīs ir olbaltumvielas, kas aizsargā organismu no noasiņošanas. Ievainojuma vietā asins plazmas fibrinogēns pārvēršas fibrīna pave-
dienos, kas kopā ar asins šūnām veido kreveli. • Enerģētiskā funkcija. Organisms olbaltum-
vielas izmanto enerģijas ieguvei tikai tad, kad ir izlietotas ogļhidrātu un lipīdu rezerves organismā. Organismā, sašķeļoties 1 g olbaltumvielu, tiek iegūtas 4,1 kcal jeb 17,1 kJ. • Signālfunkcija. Liela daļa hormonu ir olbal-
tumvielas. Piesaistoties pie membrānas recepto-
riem, tās izsauc atbilstošu atbildes reakciju - maina šūnu aktivitāti, ietekmējot visa organisma viel-
maiņas procesus un darbību. Arī nervu šūnas izdala olbaltumvielas ar regulatorefektu. 1. No kā ir veidotas olbaltumvielas? 2. Ko sauc par neaizstājamām aminoskābēm ? 3. Kas ir olbaltumvielu denaturācija? 4. Raksturojiet olbaltumvielu funkcijas organismā! 5. Daudzi cilvēki ir veģetārisma piekritēji - viņi nelieto uzturā dzīvnieku valsts produktus. Vai veģetārisms ir veselīgs ? Pamatojiet savu viedokli! 6. Kad un kā ir cēlies nosaukums "vitamīni''? Kāda ir to vispārējā nozīme organismā? 7. Daudzi fermenti veic dažādu organisko vielu šķelšanu jeb sadalīšanu. So fermentu no-
saukumi tiek atvasināti no attiecīgā substrāta nosaukuma. Piemēram, fermentu, kurš šķeļ piena cukuru laktozi, sauc par laktāzi. Mēģiniet izveidot nosaukumus fermentiem, kuri šķeļ proteīnus, peptīdus, lipīdus, maltozi, nukleīnskābesl 8. Atrodiet katrai olbaltumvielai (1) atbilstošo funkciju (2): 1) katalāze; keratīns; rodopsīns; miozīns; hemoglobīns; imūnoglobulīni; fibrinogēns; kazeīns; hlorofils; pepsīns; insulīns; 2) signālfunkcija; aizsarg funkcija; receptorā funkcija; rezerves olbaltumviela; ferments; uz-
būves olbaltumviela; kustību funkcija; transportfunkcija; gaismas uztveršana! 9. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem denaturācija, fermenti, receptori! Nukleīnskābes. Adenozīntrifosfats Nukleīnskābes 1871. gadā atklāja šveiciešu ārsts Fridrihs Mīšers. Viņš no šūnu kodoliem izdalīja lielmolekulāras vielas, ko nosauca par nukleīn-
skābēm (kodolskābes). Nukleīnskābes ir ģenētiskās informācijas gla-
bātājas (ietilpst hromosomu sastāvā) un olbaltum-
vielu sintēzes nodrošinātājas. Nukleīnskābes ir lielmolekulāri savienojumi, kuru monomēri ir nukleotīdi. Katrs nukleotīds sa-
stāv no slāpekļa bāzes, monosaharīda (riboze vai dezoksiriboze) un fosforskābes atlikuma (sk. 3.10. att.). Šūnā ir divējādas nukleīnskābes: dezoksiri-
bonukleīnskābe (DNS) un ribonukleīnskābe (RNS). DNS un RNS uzbūve ir atšķirīga. Slāpekļa bāzes ir purīna atvasinājumi - adenīns (A) un guanīns (G) un pirimidīna atvasinājumi -
citozīns (C), timīns (T) un uracils (U). Nukleotīdu nosaukumus veido atkarībā no tā sastāvā esošās slāpekļa bāzes. DNS nukleotīdi ir adenilnukleotīds, timidilnukleotīds, citidilnukleo-
tīds un guanilnukleotīds, bet RNS sastāvā ir tie paši nukleotīdi, vienīgi timidilnukleotīda vietā ir uridilnukleotīds. Nukleotīdus, kuru sastāvā ir riboze, sauc par ribonukleotīdiem, bet nukleotīdus, kuru sastāvā ir dezoksiriboze, - par dezoksiribonukleotīdiem jeb dezoksinukleotīdiem. DNS molekula ir dubultspirāle, kas sastāv no divām savā starpā savītām spirālēm. DNS atrodas šūnas kodola hromosomās. Noteiktā secībā sarin-
dotie nukleotīdi nes ģenētisko informāciju. RNS un DNS salīdzinājums 3.11. att. Adenozīntrifosfata uzbūve* RNS molekulu veido nukleotīdu virkne. Tā ir atrodama gan šūnas kodolā, gan citoplazmā. Ir vairāku veidu RNS, piemēram, transporta RNS (tRNS), ribosomu RNS (rRNS) un matricas RNS (mRNS). Nukleotīdi ietilpst ne tikai nukleīnskābju, bet arī citu dabisku vielu sastāvā. Visos organismos atrodas adenozīntrifosfāts jeb adenozīntrifosfor-
skābe (ATP jeb ATF). ATP uzkrāj enerģiju orga-
nismam izmantojamā veidā. ATP molekula sastāv no slāpekļa bāzes adenīna, monosaharīda ribozes un 3 fosforskābes atliku-
miem (sk. 3.11. att.). Fosforskābes atlikumi savā starpā ir saistīti ar makroerģiskām saitēm (satur daudz enerģijas). No ATP atšķeļoties fosfātgrupai, izveidojas adenozīndifosfāta (ADP) molekula un izdalās liels enerģijas daudzums (41 kJ/mol). Šo enerģiju šūnas izmanto dažādiem biosintē-
zes procesiem. Tā noder arī muskuļu, smadzeņu un citu orgānu darbībai. Savukārt no ADP atšķe-
ļot vēl vienu fosforskābes atlikumu, iegūst adeno-
zīnmonofosfātu (AMP) un identisku enerģijas daudzumu, kuru satur otra makroerģiskā saite. Taču šāda reakcija notiek salīdzinoši retāk. Šūnu elpošanas procesā izdalās enerģija, kuru izmanto makroerģisko saišu veidošanā, lai no ADP un AMP, tām no jauna pievienojot fosfātgrupas, veidotu ATP molekulas. Tādā veida iztērētie enerģijas resursi nepār-
traukti tiek atjaunoti. 1. Kur ir sastopamas nukleīnskābes ? 2. No kā sastāv nukleotīdi ? 3. Ar ko atšķiras DNS un RNS? 4. Dots DNS dubultspirāles fragments. Aizpildiet trūkstošos posmus! AGCCTAAGGGTCACTCCTATGGC T A C G 5. Dots RNS fragments. Izlabojiet tajā ieviesušās kļūdas! ACCAATGACATATCC GGG 6. Norādiet, kuru vielu (DNS, RNS, ATP, ADP, AMP) sastāvā var ietilpt šādi nukleotīdi (daži ir lieki)! Apzīmējumi: A - adenīns, T - timīns, G - guanīns, C - citozīns, D - dezoksiriboze, R - riboze, P - fosforskābes atlikums. A- D - P; A- R - P; G - D - P; U - D - P; T - D - P; T - R - P; C - D - P; C - R - P; A-R-P-P;A-T-P 4.1. ENERĢIJAS PLŪSMA DABĀ Dzīvās būtnes atbild uz kairinājumu, kustas, aug, vairojas - tātad veic dažāda veida darbu. Tam visam ir nepieciešama enerģija. Pirmais termodinamikas likums nosaka, ka enerģija nerodas ne no kā un arī neizzūd - tā tikai pāriet no vienas formas citā. Tātad kopējais ener-
ģijas daudzums slēgtā sistēmā nemainās. Sistē-
mas, no kurām enerģija nevar aizplūst un kurām tā netiek arī pievadīta no ārpuses, sauc par slēg-
tām sistēmām. Sistēmas, kurām enerģija var tikt pievadīta no ārpuses vai arī no kurām aizplūst, sauc par atklātām sistēmām. Dzīvās sistēmas (šūna, organisms, ekosistēma u. c.) vienmēr ir at-
klātas sistēmas. Otrais termodinamikas likums nosaka, ka, enerģijai pārejot no viena veida citā, vienmēr ir tās zudumi, galvenokārt - siltuma veidā. Piemēram, ja cilvēks apēd ābolu, tad tikai daļa tajā esošās enerģijas nonāk cilvēka šūnās. Organismi vienmēr uzņem enerģiju no ārpuses. Tāpēc tie jāaplūko vienā sistēmā ar enerģijas avo-
tu. Ja šādi apskata dzīvajā dabā notiekošos pro-
cesus, tad var redzēt, ka tie notiek saskaņā ar ter-
modinamikas likumiem. Divi nozīmīgākie enerģijas avoti dzīvajām būt-
nēm ir saules enerģija un barības vielu ķīmiskā enerģija. Daži mikroorganismi enerģiju var uzņemt arī, oksidējot neorganiskas vielas. Pēc enerģijas iegūšanas un organisko vielu sin-
tēzes veida organismus iedala autotrofos, hetero-
trofos un miksotrofos organismos. Autotrofie organismi no neorganiskām vie-
lām veido organiskās vielas. Piemēram, zaļie augi sintezē organiskās vielas, izmantojot neorganiskās vielas (ogļskābo gāzi, ūdeni) un saules enerģiju (fotosintēze), bet dažas baktērijas -, oksidējot ne-
organiskās vielas (hemosintēze). Piemēram, augs-
nē dzīvo baktērijas, kas oksidē amoniju par nitrā-
tiem, tādējādi iegūstot sev nepieciešamo enerģiju. Heterotrofie organismi enerģiju un izejvie-
las savu organisko vielu sintēzei iegūst no gata-
vām organiskām vielām. Pie tiem pieder dzīvnieki, sēnes, daļa protistu un baktēriju. Piemēram, zāl-
ēdāji, apēdot augus, iegūst enerģiju no augos uz-
krātajām organiskajām vielām. Miksotrofie organismi barojas jaukti. Dabā šādu organismu nav daudz. Piemēram, zaļā eig-
lēna gaismā barojas autotrofi, bet tumsā - hete-
rotrofi. Arī kukaiņēdāji augi, piemēram, rasene, nepente, enerģiju iegūst gan fotosintēzes ceļā (autotrofi), gan arī no notvertajiem dzīvniekiem (heterotrofi). Autotrofie organismi - zaļie augi - pārveido saules enerģiju organisko vielu ķīmiskajā enerģijā, bet heterotrofie organismi šo ķīmisko enerģiju izmanto saviem dzīvības procesiem. Visi organis-
mi pārvērš organisko vielu molekulās ieslēgto ķīmisko enerģiju citā ķīmiskās enerģijas veidā -
ATP makroerģisko saišu enerģijā. Šī enerģijas pār-
veidošana norit mitohondrijos glikolīzes un el-
pošanas ceļā. Pēc tam ATP makroerģisko saišu enerģija tiek izmantota, piemēram, nervu impulsu ģenerēšanai, muskuļu kontrakcijām, biosintēzei un citiem dzīvības procesiem. Enerģijas pārveidošanās ir sarežģīts process, kas notiek pakāpeniski. Evolūcijas gaitā organismiem ir izveidojušies īpaši mehānismi, kas to regulē. 1. Raksturojiet nozīmīgākos enerģijas avotus dzīvajām būtnēm! 2. Kas ir autotrofie organismi ? Kas ir heterotrofie organismi ? Miniet piemērus! 3. Miniet piemērus, kas raksturo, ka enerģijai, pārejot no viena veida citā, ir zudumi! 4. Kas ir miksotrofie organismi ? Miniet piemērus! 5. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem autotrofs, heterotrofs, miksotrofs! 4.2. VIELMAIŅA UN ENERĢIJAS MAIŅA ORGANISMĀ Visu organismā notiekošo ķīmisko reakciju ko-
pumu sauc par vielmaiņu jeb metabolismu. Šīs ķīmiskās reakcijas nodrošina gan vielu veidoša-
nos, gan sadalīšanos. Biosintēzes reakcijas, kurās no vienkāršākām vielām veidojas sarežģītas uzbūves organiskās vie-
las, sauc par plastisko vielmaiņu (anabolismu vai asimilāciju). Lai organisms varētu eksistēt, katrā tā šūnā ne-
pieciešams sintezēt dažādas organiskās vielas: ol-
baltumvielas, lipīdus, ogļhidrātus, nukleīnskābes. Sintezētās vielas tiek izmantotas šūnas struktūru atjaunošanā. Tādējādi šūna var saglabāt savu ķī-
misko sastāvu, uzbūvi un veikt tai paredzētās funk-
cijas. Sintēzes reakcijās tiek izmantota enerģija. Vielmaiņas reakcijas, kurās sarežģītas uzbūves savienojumi noārdās un atbrīvojas enerģija, sauc par enerģētisko vielmaiņu (katabolismu, disi-
milāciju). Noārdīšanās reakcijas ir pretējas sintē-
zes reakcijām. To rezultātā šūnas iegūst enerģiju. Piemēram, dzīvnieku organismā glikogēns sadalās par glikozi, bet no glikozes savukārt daudzu noār-
dīšanās reakciju rezultātā izveidojas ogļskābā gāze un ūdens. Atbrīvotā enerģija tiek uzkrāta ATP saišu veidā un izmantota šūnas dzīvības procesiem. Plastiskā un enerģētiskā vielmaiņa ir cieši sais-
tītas. Ķīmiskās reakcijās enerģija var tikt uzņemta vai izdalīta. Biosintēzes reakcijas ir endotermiskas (patērē enerģiju), bet noārdīšanās reakcijas - eksotermis-
kas (atbrīvo enerģiju). Daudzas bioķīmiskās reakcijas ir atgriezenis-
kas. Noteiktu fermentu klātbūtnē no reakcijas produktiem var atkal veidoties izejvielas. Bioķīmiskās reakcijas organismos notiek pēc termodinamikas likumiem, tikai dzīvajās šūnās tām ir dažas īpatnības: • reakcijas regulē biokatalizatori - fermenti; • šūnā sintezējas molekulas, kas uzkrāj ener-
ģiju; • plastiskā un enerģētiskā vielmaiņa ir savstar-
pēji saistītas. 1. Kas ir plastiskā vielmaiņa (anabolisms)? 2. Kas ir enerģētiskā vielmaiņa (katabolisms)? 3. Kas ir raksturīgs bioķīmiskajām reakcijām organismos ? 4. Kā iedalās bioķīmiskās reakcijas atkarībā no tā, vai enerģija tiek patērēta vai atbrīvota ? Miniet piemērus! 5. Pabeidziet dotos teikumus, ievietojot tajos nepieciešamos terminus! 1) Visu organismā notiekošo reakciju kopums - ... 2) Vielmaiņas reakcijas, kurās, noārdoties sarežģītākas uzbūves savienojumiem, atbrīvojas enerģija - ... 3) Biosintēzes reakcijas, kurās no vienkāršākām vielām veidojas sarežģītākas uzbūves or-
ganiskās vielas - ... 4) Reakcijas, kas notiek ar enerģijas patēriņu - ... 5) Reakcijas, kurās enerģija izdalās - ... 6) Organismi, kuri organiskās vielas sintezē no neorganiskām vielām - ... 7) Organismi, kuri enerģiju un izejvielas savu organisko vielu sintēzei iegūst no gatavām organiskajām vielām - ... 6. Sagrupējiet minētos organismus pēc to enerģijas iegūšanas veida - autotrofs, heterotrofs! Pienene; muša; baravika; trusis; zaļā eiglēna; apaļlapu rasene; vista; pelējums; raugs; egle; tuberkulozes nūjiņa. 7. Atrodiet sinonīmus! Plastiskā vielmaiņa, anabolisms, katabolisms, enerģētiskā vielmaiņa, asimilācija, disimi-
lācija. 8. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem metabolisms, asimilācija, disimilācija! 4.3. FERMENTI Organismos nepārtraukti notiek dažādas ķī-
miskās reakcijas. Taču šīs reakcijas nenotiek pašas no sevis, jo organisko vielu molekulas savstarpēji nereaģē, ja tās nav aktivētas. Laboratorijas apstāk-
ļos molekulu aktivāciju panāk, reaģentus sasildot. Dzīvās šūnas nedrīkst pakļaut augstai tempera-
tūrai, jo tajās rodas neatgriezeniskas pārmaiņas. Organismos reakcijām nepieciešamo aktivācijas enerģiju samazina biokatalizatori - fermenti. Tie atrodas visās dzīvajās šūnas, un bez tiem bioķī-
miskās reakcijas nav iespējamas. Fermentatīvo reakciju izejvielas sauc par sub-
strātu, bet reakcijā radušās vielas - par pro-
duktiem (sk. 4.1. att.). Gandrīz visi fermenti ir olbaltumvielas ar noteiktu telpisko struktūru. Ar substrātu saistās tikai neliela fermenta daļa - tā aktīvais centrs. Aktīvais centrs ar substrātu sader kā atslēga ar slēdzeni. Olbaltumviela parasti ir fermenta nesošā daļa (apoferments), bet tā aktīvo centru visbiežāk veido vitamīni vai metālu joni (koferments). Pievienojot substrāta molekulu, fermenti deformē tā ķīmiskās saites, atvieglojot substrāta sadalīšanos vai pievienošanos citai vielai. Pēc reakcijas norises fermenti atdalās no produktiem un var iesaistīties reakcijās no jauna. Fermenti veic specifiskas funkcijas. Daļa fer-
mentu katalizē tikai viena noteikta veida reakci-
jas, bet citi - vairākas līdzīgas reakcijas. Daži fer-
menti spēj iedarboties uz noteikta veida ķīmiska-
jām saitēm, piemēram, peptidāzes šķeļ olbaltum-
vielu peptīdsaites. Fermenti darbojas pat tad, ja tie šūnā ir visai niecīgā daudzumā. Pastāv vairākas fermentu grupas, piemēram, gremošanas fermenti, elpošanas fermenti. Gremo-
šanas fermenti katalizē barības vielu sadalīšanos vienkāršākos savienojumos. Piemēram, amilāze šķeļ ogļhidrātus līdz disaharīdiem, proteināze no-
ārda olbaltumvielas līdz aminoskābēm, bet lipāzes šķeļ taukus līdz glicerīnam un taukskābēm. Elpošanas fermenti palīdz noārdīt vielas šūnā, atbrīvojot enerģiju. Minētie piemēri raksturo fermentus, kas nodrošina substrāta šķelšanu. Cita fermentu grupa nodrošina vairāku substrāta mo-
lekulu savienošanu vienā reakcijas produktā. Pie-
mēram, RNS polimerāze sasaista garā virknē RNS nukleotīdus. Fermentatīvās reakcijas parasti ir ķēdes reak-
cijas - vienas reakcijas produkts kalpo par sub-
strātu vai fermentu nākamajai reakcijai. Piemē-
ram, glikolīze jeb glikozes noārdīšana ir reakciju virkne, kur katrs reakcijas produkts ir substrāts nākamajai reakcijai. Savukārt asiņu recēšanas process ir reakciju virkne, kurā vienas reakcijas produkts nepieciešams kā ferments nākamās reak-
cijas norisē. Fermentu aktivitāti ietekmē dažādi faktori, pie-
mēram, temperatūra, vides skābums. Temperatūrai paaugstinoties līdz noteiktai ro-
bežai, fermentu aktivitāte pieaug. So robežu pār-
sniedzot, fermentu aktivitāte samazinās, bet, sa-
sniedzot kādu noteiktu temperatūru (apmēram 50-60 °C), tie pārtrauc savu darbību. Tā kā fer-
menti ir olbaltumvielas, tie denaturējas paaugs-
tinātā temperatūrā, piemēram, cilvēkiem saslim-
šanas gadījumā temperatūras paaugstināšanās virs 42 °C ir bīstama dzīvībai. Katram fermentam ir nepieciešams noteikts vi-
des skābums - pH. Piemēram, cilvēka kuņģa sulas ferments pepsīns darbojas skābā vidē (pH = 2), bet siekalu ferments amilāze - sārmainā vidē (pH=8). Fermentu aktivitāti samazina specifiskas vie-
las - inhibitori. Tie var saistīties ar fermentu aktīvajiem centriem un bloķēt tos vai arī dena-
turēt fermentu molekulas. Ir vairāki fermentatīvo reakciju regulācijas me-
hānismi. • Lai samazinātu fermenta daudzumu šūnā, jā-
palēnina tā sintēze. • Daudzi fermenti sintezējas neaktīvā formā un aktivējas nepieciešamības gadījumā. Piemēram, aizkuņģa dziedzerī veidojas gremošanas fermenti, kas šķeļ olbaltumvielas un lipīdus. Sie fermenti aktivējas, tikai nonākot divpadsmitpirkstu zarnā. Ja tā nebūtu, tad tie sagremotu arī aizkuņģa dziedzera šūnu olbaltumvielas un lipīdus. • Fermenta aktivitāti pārtrauc reakcijas gala-
produktu uzkrāšanās šūnā. 1. Kā fermenti palīdz pārvarēt bioķīmisko reakciju aktivācijas enerģijas barjeru ? 2. Kādi faktori ietekmē fermentu aktivitāti ? 3. Gan augu, gan dzīvnieku šūnās ir ferments katalāze, kas sašķeļ ūdeņraža peroksīdu (HJD^ par ūdeni un skābekli. Kāda būs reakcija, ja ūdeņraža peroksīdu (ūdeņraža pārskābi) uzpili-
nās zaļam kartupelim, kāda -,ja vārītam kartupelim ? Izskaidrojiet rezultātus! 4. Mēģenē ieliets nedaudz šķīduma, kurš satur olbaltumvielu gremošanas fermentu pepsīnu, lemetiet mēģenē nelielu gabaliņu vārīta olas baltuma! Kuros gadījumos apstākļi ir piemēroti olbaltumvielu fermentatīvajai šķelšanai, kuros - nav ? Atbildi pamatojiet! 1) Temperatūra 10 °C; vides pH - 2; 2) temperatūra 37 °C; vides pH - 2; 3) temperatūra 37 °C; vides pH - 7; 4) temperatūra 60 °C; vides pH - 2; 5) temperatūra 37 °C; vides pH - 2; šķīdumam pievieno nedaudz NaOH šķīduma. 5. Kāpēc siekalu ferments amilāze kuņģī pārtrauc savu darbību - ogļhidrātu fermentatīvo šķelšanu ? 6. Vīna rūgšanu nodrošina raugu darbība. Tās laikā anaerobos apstākļos (bezskābekļa) 15-30 °C temperatūrā notiek augļu cukuru fermentatīva pārveidošana par etilspirtu. Kā mai-
nīsies rūgšanas procesu aktivitāte (pastiprināsies vai samazināsies) šādos apstākļos: 1) turot sulu 25 °C; 2) pievienojot papildu cukuru; 3) sulu atdzesējot; 4) sulu sakarsējot līdz 60 °C; 5) spirta koncentrācijai sasniedzot 14 %; 6) skābekļa klātbūtnē šķīdumā izveidojoties etiķskābei ? Atbildi pamatojiet! 4.4. FOTOSINTĒZE Dzīvība uz Zemes ir atkarīga no vielu un ener-
ģijas aprites dabā. Šī daudzpakāpju procesa sā-
kumposms ir fotosintēze - augiem, aļģēm un at-
sevišķām baktērijām raksturīgs vielmaiņas veids. Fotosintēzes procesā šie organismi no neorganis-
kajām vielām ražo tiem nepieciešamās organiskās vielas, kā enerģijas avotu izmantojot saules gaismu. Augi un citi fotoautotrofie organismi visas ne-
pieciešamās vielas sintezē paši. No apkārtējās vides tie uzņem tikai ogļskābo gāzi, ūdeni un mine-
rālvielas. Minerālvielas ir vajadzīgas olbaltumvielu, hormonu, hlorofila un citu bioloģiski aktīvu vielu sintēzei. ka augi vienlaikus gan izdala skābekli, gan uzņem ogļskābo gāzi, bet 1804. gadā šveiciešu botāniķis Nikolā Sosīrs pierādīja, ka otra viela, kura nepie-
ciešama fotosintēzei, ir ūdens. 19. gs. beigās krie-
vu augu fiziologs Konstantīns Timirjazevs no-
skaidroja fotosintēzes mehānismu un hlorofila lomu šajā procesā. Tikai 20. gs. vidū zinātnieki at-
klāja, ka augi skābekli veido, sadalot ūdeni, nevis ogļskābo gāzi, kā domāja iepriekš. Fotosintēzes pē-
tījumi turpinās arī mūsdienās. Fotosintēzes procesi Fotosintēzes pētījumu vēsture Fotosintēzes pētījumi sākās 1630. gadā, kad ho-
landiešu dabaszinātnieks Jans Batists van Hel-
monts atklāja, ka augi paši veido organiskās vie-
las. Viņš uzskatīja ūdeni par fotosintēzes izejvielu. Šo uzskatu papildināja Džozefs Prīstlijs, kurš 1771. gadā konstatēja, ka augi gaismā izdala skābekli, bet dzīvnieki - ogļskābo gāzi. Pārējos fotosintēzes vienādojuma locekļus noskaidroja holandiešu dabaspētnieks Jans Ingenhauss (1779). Šveiciešu dabaszinātnieks Žans Senebjē 1783. gadā secināja, Augu šūnas, tāpat kā citu organismu šūnas, ne-
pārtraukti elpo. Tās uzņem skābekli un izdala ogļ-
skābo gāzi. Dienā augos notiek fotosintēze un el-
pošana, bet naktī, tumsā, - tikai elpošana. Ko-
pumā augi skābekli izdala daudz vairāk nekā patērē, un uzņem ogļskābo gāzi daudz vairāk nekā to izdala. Līdz ar to skābeklis uzkrājas atmosfērā. Fotosintēze ir ļoti nozīmīgs process, jo skābeklis un augu sintezētās organiskās vielas ir visu pārējo organismu eksistences pamats. Fotosintēzes reak-
ciju gaitā no neorganiskajām vielām - ūdens un ogļskābās gāzes - veidojas ar enerģiju bagāta orga-
niskā viela - glikoze un skābeklis. Vispārējais reakcijas vienādojums parāda tikai fotosintēzes izejmateriālus un galaproduktus. Pa-
tiesībā fotosintēze ir gara reakciju virkne. Gaisma ir nepieciešama tikai daļai sākotnējo reakciju, tā-
pēc zinātnieki nodala fotosintēzes gaismas sta-
diju un tumsas stadiju, kurā tiek izmantoti gaismā saražotie produkti un enerģija. Gaismas stadijā hloroplastos esošais hlorofils uztver gais-
mas enerģiju un pārvērš to ķīmiskajā enerģijā. Tumsas stadijā šo enerģiju izmanto glikozes sin-
tēzei. Hloroplastus piepilda pusšķidra stroma un gra-
nas. Granas sastāv no atsevišķām, ar membrānu norobežotām telpām - tilakoīdiem (sk. 2.15. att. 27. lpp.). Tilakoīdu membrānā atrodas hlorofils vai citi pigmenti un fermentu kompleksi. Fotosin-
tēzes gaismas reakcijas notiek tilakoīdos, bet tum-
sas reakcijas - stromā. no molekulas un tiek nodoti tālāk pa elektronu pārneses ķēdi, kuru noslēdz īpaša elektronu pār-
nesēja viela - NADP+ (nikotīnamīdadenozīndinuk-
leotīdfosfāts), ar kura palīdzību tie tiek piesaistīti tumsas reakcijās sintezētajiem ogļhidrātiem, vien-
laikus izmantojot elektronu augsto enerģētisko potenciālu (sk. 4.3. att.). Fotosintēzes gaismas stadija Hlorofilam piemīt spēja absorbēt gaismas kvan-
tus. Hlorofils vislabāk absorbē gaismas spektra zilo, violeto un sarkano gaismu. Tā kā zaļā gaisma tiek absorbēta maz, lapas izskatās zaļas. Citi ti-
lakoīdos esošie pigmenti vairāk absorbē citas krā-
sas gaismu, piemēram, karotinoīdi absorbē zilo un zaļo gaismu, bet atstaro dzelteno un sarkano. Rudenī koku lapās noārdās hlorofils, bet to aizstāj karotinoīdi, tāpēc lapas izskatās sarkanas vai dzel-
tenas. Uztverot gaismas kvantus, pieaug hlorofila mo-
lekulas elektronu enerģija. Šādi elektroni atraujas Tilakoīda telpu pilda ūdens. Lai kompensētu hlorofila zaudētos elektronus, tie tiek atrauti no ūdens, izsaucot tā sadalīšanos - fotolīzi, veidojot molekulāro skābekli un H+ jonus: Skābeklis šajā reakcijā rodas kā blakuspro-
dukts. Tas tiek izmantots pašu augu elpošanas procesā vai izdalās atmosfērā, tādējādi nodrošinot organismu elpošanu. Ūdens sadalīšanās rezultātā tilakoīda telpā uzkrājas H+joni, papildinot H+rezervuāru, kurš ir galvenais enerģijas avots sekojošai ATP sintēzei. H+jonu uzkrāšanās tilakoīda iekšienē rada ievē-
rojamu koncentrācijas gradientu salīdzinājumā ar stromu, tāpēc tie caur speciāliem kanāliem tila-
koīda membrānā plūst uz stromu (sk. 4.3. att.). Šie kanāli ir saistīti ar fermentu (ATP sintetāzi), kurš uztver H+jonu plūsmas radīto enerģiju un to iz-
manto ATP sintēzei no ADP Stromā nonākušos H+jonus piesaista elektronu pārnesējs NADP+: Fotosintēzes tumsas stadija Gaismas stadijā hloroplasta stromā izveidojas NADPxH un ATP Šie savienojumi tiek izmantoti vairākās fermentatīvās reakcijās, kurās, piesaistot ogļskābo gāzi, sintezējas ogļhidrāti. Ogļhidrātu veidošanās hloroplastu stromā foto-
sintēzes tumsas reakcijās ir daudzpakāpju process (sk. 4.4. att.). Vispirms notiek ogļskābās gāzes pie-
saistīšana piecoglekļa atomu ogļhidrātam (ribulo-
zodifosfātam). Pēc tam, izmantojot gaismas stadijā saražotās ATP enerģiju, NADPxH enerģiju, elek-
tronus un H jonus, veidojas glikoze. No tās savu-
kārt rodas polisaharīdi (ciete, celuloze), aminoskā-
bes un lipīdi. Tumsas fāze ir ciklisks process, kurā no viena cikla nākamajā pāriet atjaunots starpprodukts (ri-
bulozodifosfāts). Tas nozīmē, ka reakciju cikla izej-
materiāls tiek izmantots gan galaproduktu vei-
došanai, gan izejvielu atjaunošanai. Tas iespējams tāpēc, ka katrā ciklā iesaistās vairākas ribulozo-
difosfāta molekulas. Šis cikls nosaukts par godu zinātniekam, kurš pirmais atklāja un pierādīja šīs reakcijas - Mel-
vinam Kalvinam. Reakcijās atbrīvojušās ATP un Tādējādi fotosintēzes gaismas stadijā vienlaikus notiek šādas reakcijas: • hlorofila elek-
tronu aktivācija un atraušanās • ūdens fotolīze un skābekļa izdalīšanās • gaismas enerģijas pārvēršana ķīmis-
kajā enerģijā • NADPxH veidošanās, pie-
saistot ar enerģiju bagātus elektro-
nus un H jonus NADP+ molekulas atgriežas tilakoīdos, kur no jau-
na tiek izmantotas gaismas reakcijās. Tātad tumsas stadijā notiek šādas reakcijas: No tā varam secināt, ka fotosintēzes tumsas un gaismas reakcijas ir cieši saistītas, turklāt gaismas reakciju intensitāte tieši ietekmē tumsas reakciju norisi un fotosintēzes kopējo iznākumu. Fotosintēze ir visu organismu eksistences pa-
matā, jo • nodrošina skābekļa uzkrāšanos atmosfērā un apgādā organismus ar elpošanai nepieciešamo skā-
bekli; • augi un aļģes sintezē sev nepieciešamās orga-
niskās vielas, kuras citi organismi izmanto, uz-
ņemot barību; • ir svarīgs posms vielu un enerģijas apritē dabā; • dod iespēju eksistēt augiem, no kuriem iegūst pārtikas produktus, audumus, papīru, degvielu un medikamentus. 1. Kāda enerģija tiek izmantota fotosintēzes procesā ? Par kādu enerģiju tā pārvēršas ? 2. Raksturojiet fotosintēzes stadijas! 3. Kāda nozīme fotosintēzes procesā ir hlorofilam ? 4. Raksturojiet fotosintēzes nozīmi! 5. Kāda gaismas spektra daļa tiek absorbēta koku lapās rudenī, kad hlorofils ir noārdījies un lapas krāsojas dzeltenas un sarkanas ? 6. Kas notiktu, ja atkārtotu Dž. Prīstlija veiktos eksperimentus ? Rezultātu pamatojiet! 1) Zem noslēgta stikla kupola novietojot degošu sveci; 2) Zem noslēgta stikla kupola novietojot peli; 3) Zem noslēgta stikla kupola novietojot peli un augu ar lapām, turot to gaismā; 4) Zem noslēgta stikla kupola novietojot peli un augu ar lapām, turot to tumsā. 7. Tika veikts eksperiments, lai salīdzinātu fotosintēzes aktivitāti dažādas krāsas apgaismo-
jumā. Augu ar zaļām lapām turēja 20 °C temperatūrā optimālā mitrumā: 1) zaļā gaismā; 2) sarkanā gaismā; 3) baltā gaismā. Kurā gadījumā fotosintēze notiek visintensīvākā Atbildi pamatojiet! Kā mainītos ekspe-
rimenta rezultāti, ja auga lapas būtu sarkanas ? 8. Papildiniet savu skaidrojošo vārdnīcu ar jēdzienu fotosintēze! 4.5. HEMOSINTĒZE Organiskās vielas no neorganiskajām vielām spēj sintezēt ne tikai zaļie augi, bet arī dažas baktē-
rijas, kurām nav hlorofila. Tās organisko vielu sin-
tezēšanai izmanto īpašus fermentus un ķīmisko enerģiju, ko iegūst, oksidējot neorganiskas vielas. Šādu sintēzes procesu sauc par hemosintēzi. Hemosintezējošās baktērijas ir nitrificētājbak-
tērijas, dzelzs baktērijas un sēra baktērijas. Nitrificētājbaktērijām ir liela nozīme dabā. Tās oksidē amonjaku, kas lielākā daudzumā dzīvajām būtnēm ir toksisks, un pārvērš to par augiem iz-
mantojamiem slāpekļskābes sāļiem - nitrītiem un nitrātiem. Dzelzs baktērijas oksidē divvērtīgās dzelzs oksīdu • ogļskābās gāzes fiksācija • ATP sadalīšana un enerģijas pārvēršana ķīmisko saišu enerģijā • NADPxH elektronu, enerģijas un H+jonu iesaistīšana ogļhidrāta molekulā • Kalvina cikla izej-
vielas - ribulozodi-
fosfāta atjaunošana par trīsvērtīgās dzelzs hidroksīdu. No dzelzs hidr-
oksīda sakopojumiem veidojas dzelzsrūda. Sēra baktērijas oksidē sērūdeņradi un citus sēru saturošus savienojumus par sulfātiem. Daļa sēra baktēriju uzkrāj šūnās sēru, bet citas (tiobaktē-
rijas) to neuzkrāj. Daļa hemosintezējošo baktēriju, mainoties vi-
des apstākļiem, var pāriet uz heterotrofu dzīves-
veidu - uzņemt gatavas organiskās vielas. Šādi miksotrofi organismi ir, piemēram, metānoksidē-
tājas baktērijas. 1. Ka baktērijas, kuram nav hlorofila, iegūst enerģiju, lai sintezētu organiskās vielas ? 2. Papildiniet savu skaidrojošo vārdnīcu ar jēdzienu hemosintēze! 4.6. ŠŪNAS ENERĢĒTISKĀ VIELMAIŅA f Šūnām nepārtraukti ir nepieciešama enerģija, ko tās iegūst no ATP makroerģiskajām saitēm. Visi organismi - gan tie, kuru šūnās norit fotosintēze, gan tie, kuri fotosintēzē nepiedalās, - sašķeļot olbaltumvielas, uzkrāj enerģiju ATP veidā. Šūnā nav lielu ATP rezervju, un ATP visu laiku atjaunojas. Šūnu enerģētiskās vielmaiņas laikā, oksidējoties organiskajām vielām, rodas enerģija, kas uzkrājas ATP saišu veidā. Lielākā daļa šūnu kā enerģijas avotu galvenokārt izmanto ogļhidrā-
tus, bet, ja to nepietiek, tad - rezerves taukus. Olbaltumvielas organisms noārda vienīgi ilgstošas badošanās laikā, kad ogļhidrātu un tauku rezerves jau ir izsmeltas. Šūnas enerģētisko vielmaiņu var iedalīt 3 pos-
mos. • Sagatavošanās posmā (sk. 4.5. att.) lielmo-
lekulārās organiskās vielas noārdās līdz monomē-
riem savienojumiem. No polisaharīdiem rodas mo-
nosaharīdi, no taukiem - glicerīns un taukskābes, no olbaltumvielām - aminoskābes, bet no nukleīn-
skābēm - nukleotīdi. Šajās reakcijās rodas maz enerģijas un tā izdalās siltuma veidā. • Glikolīzei jeb anaerobajam (bezskābek-
ļa) posmam skābeklis nav nepieciešams. Gliko-
līzē šūnas citoplazmā esošo fermentu ietekmē no vienas glikozes molekulas veidojas divas pirovīnog-
skābes molekulas un rodas divas ATP molekulas. Pirovīnogskābe ir svarīgs vielmaiņas starppro-
dukts. Anaerobos apstākļos pirovīnogskābe tiek pārvērsta pienskābē vai etanolā atkarībā no tā, kādā organismā tas notiek. Organismus, kuru dzīvības procesiem nav nepie-
ciešams skābeklis, sauc par anaerobiem organis-
miem. Pie tiem pieder daudzi mikroorganismi. Pienskābās baktērijas veic glikozes noārdīšanos par pienskābi. Šo procesu sauc par pienskābo rūg-
šanu. Pienskābo baktēriju darbības rezultātā rodas tādi produkti kā rūgušpiens, skābais krē-
jums. Pienskābā rūgšana ir pārtikas produktu dabiskais konservēšanas veids. To izmanto pārti-
kas rūpniecībā, mājsaimniecībā, kā arī lauksaim-
niecībā - skābsiena ražošanā. Rauga šūnās anaerobos apstākļos notiek gliko-
zes noārdīšanās un rodas galaprodukts etanols jeb etilspirts. Šo procesu sauc par spirta rūgšanu. Ja alkohola koncentrācija kļūst augstāka par 16 %, tad rauga sēnes iet bojā. Pienskābes veidošanās notiek cilvēka un dzīv-
nieku muskuļaudos intensīva fiziska darba laikā, ja organisms nespēj uzņemt pietiekami daudz skā-
bekļa. Lielās koncentrācijās pienskābe ir toksiska, un, tai uzkrājoties, muskuļos iestājas nogurums un rodas sāpju sajūta. Atpūtas laikā, kad skābekļa daudzums muskuļos normalizējas, no pienskābes atkal veidojas pirovīnogskābe. • Šūnas elpošana jeb aerobais posms notiek mitohondrijos. Organismus, kuriem enerģijas iegūšanai no or-
ganiskām vielām ir nepieciešams skābeklis, sauc par aerobiem organismiem. Aerobos apstākļos augu un dzīvnieku šūnās no pirovīnogskābes veidojas acetilkoferments A, kas tālāk iesaistās citronskābes jeb Krebsa ciklā (sk. 4.5. att.). Citronskābes ciklu veido daudzas fermentatīvas reakcijas, kuru rezultātā no citron-
skābes rodas ogļskābā gāze un organiskās skābes (dzintarskābe, fumārskābe, ābolskābe). Šūnas elpošanas fermenti atrodas galvenokārt uz mitohondriju iekšējās membrānas. Enerģijas atbrīvošana un uzkrāšana organismam pieejamā ATP saišu veidā ir saistīta ar elektronu pārnešanu pa elektronu transporta ķēdi, kurā norit oksidē-
šanās-reducēšanās reakcijas. Elektronu transporta ķēdes beigās skābeklis uztver elektronus, pievieno sev ūdeņraža jonus un veido ūdeni. Tā rezultātā elektronu transporta ķēde atbrīvojas un var no jauna pārnest elektro-
nus. Ja skābekļa trūkst, elektroni uzkrājas trans-
porta ķēdē. Šūnas elpošanā atbrīvojas daudz lielāks ener-
ģijas daudzums nekā glikolīzē. Konstatēts, ka, sa-
brūkot divām pirovīnogskābes molekulām, veido-
jas 36 ATP molekulas, bet pārējā enerģija izklie-
dējas siltuma veidā. Glikozes noārdīšanās summārais vienādojums: Vispirms taukos hidrolizējas saites starp glicerīnu un taukskābēm, bet pēc tam notiek anaerobā un aerobā noārdīšanās. Ilgstošas badošanās gadījumā vai arī tad, ja ar uzturu tiek uzņemtas gandrīz vienīgi olbaltum-
vielas, par enerģijas avotu var tikt izmantotas arī aminoskābes. Tās var noārdīties līdz pirovīnogskā-
bei vai pārvērsties par citronskābes cikla produk-
tiem. Ogļhidrātu rezerves tiek uzkrātas aknās un mus-
kuļos glikogēna veidā vai tiek pārvērstas taukos. Parasti organismā barības uzņemšana, enerģi-
jas izmantošana un tauku uzkrāšanās ir sabalan-
sēta. Daļai cilvēku ir augsta metabolisma inten-
sitāte. Citiem tā var pieaugt, lai kompensētu pār-
mērīgu barības uzņemšanu. Ir arī cilvēki ar zemu metabolismu, kuriem pastiprināti uzkrājas liekie tauki. Tauku uzkrāšanos veicina arī mazkustīgs dzīvesveids. Aptuveni 45 % no atbrīvotās enerģijas uzkrājas ATP saišu veidā, bet 55 % izkliedējas siltuma veidā. Sabrūkot glikozes molekulai, summāri veidojas 38 ATP molekulas (2 glikolīzes laikā un 36 šūnas elpo-
šanas laikā). Cilvēks un dzīvnieki ar uzturu uzņem ne ti-
kai ogļhidrātus, bet arī citas barības vielas. Ne-
pieciešamības gadījumā organismā uzkrātos tau-
kus var izmantot kā enerģijas avotu (sk. 4.5. att.). 1. Kāda enerģija tiek izmantota ATP sintēzei ? 2. Raksturojiet šūnas enerģētiskās vielmaiņas posmus! 3. Kādas organiskās vielas enerģijas ieguvei izmanto cilvēka organisma šūnas ? 4. Viena ATP makroerģiskā saite satur 7,3 kcallmol. Anaerobās glikolīzes un tai sekojošās aerobās oksidēšanas rezultātā no ADP rodas 38 ATP molekulas. Vienas glikozes molekulas enerģētiskā ietilpība ir 686 kcallmol. Cik procentu glikozes enerģijas pāriet ATP saišu enerģijā ? Cik procentu enerģijas izplatās šūnā siltuma veidā ? 5. Intensīvam muskuļu darbam nepieciešamā enerģija ir 6 kcallmin. Cik molu ATP jāpatērē (sk. 4. uzd.), lai nodrošinātu 5 min fiziska darba? (Lietderīgi tiek izmantoti aptuveni 30 % enerģijas, pārējā pārvēršas siltumenerģijā.) 6. Kuras no minētajām pazīmēm piemīt anaerobajai glikolīzei, kuras - aerobajai oksidācijai? 1) Notiek šūnas citoplazmā; 2) notiek mitohondrijos; 3) oksidēšanās galaprodukti ir ogļskābā gāze un ūdens; 4) glikoze tiek noārdīta līdz pienskābei; 5) rodas 2 ATP molekulas; 6) rodas 34 ATP molekulas; 7) oksidēšanās procesiem nepieciešams skābeklis; 8) oksidēšanās notiek bez skābekļa; 9) kā starpprodukts rodas pirovīnogskābe (piruvāts); 10) kā starpprodukts rodas citronskābe; 11) procesu norisei nepieciešami fermenti. 7. Izmantojot šūnu enerģētiskās vielmaiņas shēmas, sakārtojiet vielu nosaukumus tādā secībā, kā tās rodas enerģētiskās vielmaiņas reakcijās (sākot ar sagatavošanās posmu)! 1) Ciete; pirovīnogskābe; ūdens un ogļskābā gāze; citronskābe; glikoze; pienskābe; acetilkofer-
ments. 2) Tauki; acetilkoferments; taukskābes; ūdens un ogļskābā gāze; citronskābe. 3) Olbaltumvielas; ketonskābes; aminoskābes; citronskābe; pirovīnogskābe; acetilko ferments; ūdens un ogļskābā gāze. Izdariet secinājumus par dažādu organisko vielu iekļaušanos šūnu enerģētiskajā vielmaiņā! 8. Kādu pārtikas produktu ražošanā tiek izmantota spirta rūgšana un kādu - pienskābā rūg-
šana? 9. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem aerobs, anaerobs, glikolīze! 5.1. ŠŪNU DALĪŠANĀS Vācu zinātnieks Rūdolfs Virhovs 19. gs. vidū no-
skaidroja, ka visas šūnas rodas citu šūnu dalīšanās rezultātā. Tātad šūnu dalīšanās procesam ir ļoti nozīmīga loma organismu dzīvē. Dalīšanās nodro-
šina organisma augšanu, attīstību, atjaunošanos un vairošanos. Sūnu dalīšanās ir viens no pamat-
nosacījumiem dzīvības eksistencei uz Zemes. Šūnu dalīšanās rezultātā jaunās šūnas iegūst precīzu iedzimtības informāciju, kas atrodas DNS. Gēns ir nukleīnskābes fragments, kurš DNS molekulā nosaka kādu organismam specifisku īpašību. Tas satur informāciju par vienas olbal-
tumvielas biosintēzi. Vienu gēnu veido no dažiem simtiem līdz vairākiem tūkstošiem nukleotīdu. No gēniem savukārt sastāv šūnu kodola pavedien-
veida struktūras - hromosomas (sk. 5.1. att.). Katras sugas indivīdiem šūnā ir pastāvīgs hromo-
somu skaits. Somatiskajās (ķermeņa) šūnās ir divkāršs jeb diploidāls hromosomu skaits (2n), bet dzimumšūnās - vienkāršs jeb haploidāls hromo-
somu skaits (n). Piemēram, cilvēkam somatiska-
jās šūnās ir 46 hromosomas, bet dzimumšūnās -
23 hromosomas, kaķim šis skaits ir attiecīgi 2n= = 38 un n=19, bet odam - 2n=6 un n=3. Diploi-
dālā hromosomu komplektā visas hromosomas ir pa pāriem. Katrā pārī viena hromosoma ir sa-
ņemta no sievišķās, bet otra - no vīrišķās dzimum-
šūnās. Šīs pāru hromosomas sauc par homolo-
gām hromosomām. Hromosomu pāri savā starpā atšķiras. Hromosomu komplekta īpašību (skaita un morfoloģisko pazīmju) kopumu sauc par kariotipu (sk. 5.2. att.). Ikvienai hromosomai ir centromēra - neliels hromosomas rajons, kas regulē hromosomu kus-
tību šūnas dalīšanās laikā. Hromosomas ir saska-
tāmas tikai šūnu dalīšanās laikā, kad tās atrodas spiralizētā un kondensētā stāvoklī. Lai nodotu iedzimtības informāciju jaunajām šūnu paaudzēm, pirms šūnu dalīšanās notiek to DNS molekulu dubultošanās jeb replikācija. Tās laikā katrai hromosomai izveidojas divas iden-
tiskas pusītes jeb hromatīdas (sk. 5.1. att.). Katra jaunā šūna jeb meitšūna saņem pilnu mātšūnas hromosomu komplektu. Šūnai ir nepieciešami arī materiāli, kas nodrošinātu šūnu struktūru veido-
šanos un funkcionēšanu. Jaunizveidotā šūna vai-
rumu izejmateriālu saņem no apkārtējās vides, sintezē no tiem savus struktūrelementus un aug. Prokarioti vairojas bezdzimumiski, šūnai dalo-
ties. Pirms šūnas dalīšanās hromosomā esošā DNS replicējas (dubultojas). Tā rodas divas hro-
mosomas, kuras ir piestiprinātas pie plazmatiskās membrānas. Šūnai stiepjoties garumā, hromoso-
mas atdalās viena no otras. Starp abām hromo-
somām ieliecas plazmatiskā membrāna, un izvei-
dojas jauns šūnapvalks (sk. 5.3. att.). Šādu šūnu dalīšanos sauc par bināro dalīša-
nos. Tās rezultātā izveidojas divas (bināras) meit-
šūnas, kuras ir ģenētiski identiskas mātšūnai. Laika sprīdi starp divām dalīšanās reizēm sauc par ģenerācijas laiku. Dažādām baktērijām ģenerā-
cijas laiks ir atšķirīgs. Tas var ilgt no 20 minūtēm, kā tas ir baktērijai Escherichia coli, kas dzīvo cil-
vēka zarnās, līdz pat 24 stundām un ilgāk. Vairu-
mam baktēriju ģenerācijas laiks ir no vienas līdz četrām stundām. Mitoze ir dabā visplašāk izplatītais dalīšanās veids. Mitozes rezultātā katra meitšūna iegūst tieši tādas pašas hromosomas, kādas bija mātšūnai. Mejoze notiek dzimumšūnu veidošanās laikā. Mejozes rezultātā hromosomu skaits šūnās sama-
zinās uz pusi. Katra jaunā šūna iegūst pa vienai hromosomai no katra mātšūnas hromosomu pāra. Amitoze ir sastopama samērā reti. Tā neno-
drošina iedzimtās informācijas līdzvērtīgu sadali starp meitšūnām. Amitoze parasti norit speciali-
zētos audos, kas funkcionē īslaicīgi, piemēram, dzīvnieku dīgļapvalkos, placentā, augu sēklotnes sieniņā, kā arī audzējos. Amitozes laikā kodols pārdalās bez hromosomu spiralizācijas un precīzas sadalīšanās pa meitšūnām. Amitozes rezultātā ra-
dušās šūnas vairs nav spējīgas mitotiski dalīties. Prokariotu šūnas dzīves cikls Prokariotu (baktēriju) šūnām nav tāda kodola kā eikariotu šūnām. To ģenētiskais materiāls at-
rodas gredzenveida hromosomā, kas saistīta ar da-
žām olbaltumvielām. Vairumā gadījumu prokariotu hromosoma ir ļoti gara, tādēļ tā veido mudžekli. Šūnas daļu, kurā atrodas hromosoma, sauc par nukleoīdu. Nukleoīdu neapņem membrāna. Eikariotu šūnas dzīves cikls Eikariotu somatisko šūnu dzīves cikls sastāv no interfāzes un dalīšanās jeb mitozes. Eikariotu šū-
nas dzīves cikla ilgums ir atkarīgs no sugas, šūnu veida un vides apstākļiem. Tas visbiežāk ilgst no pusstundas līdz trim diennaktīm. Eikariotu šūnas dzīves cikla lielāko daļu aizņem interfāze. Tās laikā šūna uzņem barības vielas, aug, kā arī veic sev raksturīgās funkcijas. Daudzšūnu organismu šūnu interfāze ilgst no astoņām stun-
dām līdz vairākām diennaktīm. Interfāzi iedala periodos jeb apakšfāzēs (sk. 5.4. att.). Interfāze Mitoze Gi M S • Pirmssintēzes periodā (Gx) šūna aug, at-
jaunojas iepriekšējais organoīdu daudzums un uz-
krājas dažādas DNS sintēzei nepieciešamās vielas. Katrā hromosomā ir viens DNS dubultspirāles pavediens. • Sintēzes periodā (S) notiek DNS replikācija. • Pēcsintēzes periodā (G2) šūna gatavojas jaunam dalīšanās procesam un uzkrāj enerģiju, kas nodrošina šūnas dalīšanos. Pēc interfāzes seko šūnas dalīšanās jeb mitoze (M). Mitoze Mitozi iedala četrās fāzēs. • Profāze ilgst 30-60 minūtes. Tajā notiek hro-
mosomu spiralizācija. Hromatīna pavedieni kon-
densējas, un izveidojas hromosomas. Sākumā hro-
mosomas ir izstieptas, bet pēc tam tās saīsinās un kļūst resnākas. Redzams, ka katru hromosomu veido divas hromatīdas. Tās turas kopā centromē-
ras jeb primārās iežmaugas rajonā (sk. 5.5. att.). Profāzē kodolā esošie kodoliņi izzūd. Sākumā dalās centriolas, un pēc tam tās pārvietojas uz šū-
nas pretējiem poliem. Izveidojas divi centriolu pāri. No katras centriolas staru veidā atiet mikrocau-
rulītes, kas sastāv no tieviem olbaltumvielu pa-
vedieniem un veido dalīšanās vārpstu (sk. 5.6. att.). Profāzes beigās kodola apvalks sairst. Reizēm šo procesu izdala kā atsevišķu fāzi - prometafāzi. • Metafāze ilgst 2-6 minūtes. Hromosomas ir maksimāli spiralizētas un izvietojas šūnas giem šūnu dalīšanās cikliem, kuru rezultātā dzi-
mumšūnas iegūst haploidālu hromosomu kom-
plektu, tāpēc to sauc par reduktīvo dalīšanos. Abus ciklus iedala fāzēs (līdzīgi mitozei). Pirmā cikla fāzes papildus apzīmē ar romiešu ciparu I, bet otrā cikla fāzes - ar II (sk. 5.7. att.). ekvatoriālajā plaknē. Centromēru rajonā tās piestiprinās pie dalīšanās vārpstas olbaltumvielu pavedieniem. Daļa pavedienu ir bez hromosomām. • Anafāze ilgst 3-15 minūtes. Sākumā hromo-
somu centromēras dalās un hromatīdas pārvēršas par divām vienādām meithromosomām, kas virzās uz šūnas pretējiem poliem. Tādējādi katra jaunā šūna saņem to pašu iedzimtības informāciju, kas bija māt šūnā. • Telofāze ilgst 30-60 minūtes. Hromosomas sasniedz šūnas polus un koncentrējas ap centrio-
lām. Telofāzē notiek hromosomu despiralizācija -
tās pārvēršas par tieviem, gariem pavedieniem un savijas savā starpā. Šūnas polos ap hromosomām no jauna veidojas kodola apvalks un kodoliņi, kā arī noārdās dalīšanās vārpsta. Pēc mitozes jeb kariokinēzes (kodola dalīša-
nās) seko citoplazmas dalīšanās jeb citokinēze. Daloties dzīvnieku šūnām, to ekvatoriālajā plaknē parādās iežmauga, kas pakāpeniski padzi-
ļinās un pārdala citoplazmu divās daļās. Izveidojas divas meitšūnas. Katrā no tām ir kodols un šūnas organoīdi. Augu šūnu ekvatoriālajā plaknē izvei-
dojas šķērssiena, kas pārdala citoplazmu divās da-
ļās. Šķērssienas abās pusēs izveidojas celulozes šūnapvalks, un tādējādi veidojas divas augu šūnas. Ja mitozei neseko citokinēze, rodas šūna ar daudziem kodoliem. Daudzšūnu organismos ir arī specializētas šūnas, kas nedalās, piemēram, nervu šūnas jeb neironi. Mitozē katra meitšūna iegūst tādu pašu hro-
mosomu komplektu, kāds bija mātšūnā. Dzīvnieku šūnās mitoze ilgst 30-60 minūtes, bet augu šūnās -
2-3 stundas. Mejoze Dzimumšūnu veidošanās laikā notiek šūnu me-
jotiskā dalīšanās. Mejoze sastāv no diviem secī-
• Atšķirībā no mitozes mejozes profāze I sā-
kas ar homologo hromosomu krustmiju jeb kro-
singoveru. Tā laikā homologo hromosomu pāri satuvinās, pārkrustojas un apmainās ar iecirk-
ņiem, tā izveidojot četras atšķirīgas hromatīdas. Pēc tam, tāpat kā mitozē, izzūd kodoliņi un kodola apvalks, satuvinātās hromosomas atgrūžas. Tās ir kondensētas un viegli saskatāmas. • Metafāzē I satuvinātās hromosomas ar cen-
tromērām izvietojas šūnas ekvatoriālajā plaknē. Pie katras centromēras piestiprinās pa vienam da-
līšanās vārpstas pavedienam. • Anafāzē I notiek homologo hromosomu attā-
lināšanās uz pretējiem šūnas poliem (atšķirībā no mitozes, kur attālinās hromatīdas). • Telofāzē I pie katras šūnas pola nonāk puse no mātšūnas hromosomu komplekta. Hromoso-
mas despiralizējas, izveidojas abu meitkodolu ap-
valki. Telofāzei seko interkinēze, kuras laikā atšķi-
rībā no mitozes interfāzes nenotiek DNS sintēze un hromosomu reduplikācija. Otrā mejotiskā dalī-
šanās norisinās līdzīgi mitozei. Rezultātā no di-
vām diploidālām šūnām izveidojas četras haploi-
dālas šūnas. • Profāzē II notiek hromosomu spiralizācija, tās beigās izzūd abu kodolu apvalki. • Metafāzē II hromosomas ar centromērām iz-
vietojas abu šūnu ekvatoriālajās plaknēs. Ja šūna nav pārdalījusies, tad vienā šūnā redz divas pa-
ralēlas dalīšanās vārpstas. • Anafāzē II sadalās centromēras. Hromatīdas kļūst par atsevišķām hromosomām, kas virzās uz šūnas poliem. Profāzē I notikušās krustmijas dēļ jaunās hromosomas pēc gēnu satura nav vienādas. • Telofāzē II hromosomas sasniedz šūnu po-
lus, izveidojas meitkodolu apvalki, sākas citoki-
nēze. 1. Kāda nozīme ir šūnu dalīšanās procesam? 2. Kas ir iedzimtības informācijas nesējs dzīvajās šūnās ? 3. Salīdziniet prokariotu un eikariotu šūnas ciklu! 4. Kas ir hromosomas, un no kā tās sastāv ? 5. Ar ko atšķiras mitoze no amitozes? 6. Raksturojiet mitozi! 7. Ar ko mejoze atšķiras no mitozes ? 8. Kukurūzas somatisko šūnu diploidālais hromosomu komplekts ir 20. Kāds ir hromosomu komplekts to šūnās pirms mitotiskās dalīšanās un vīrišķajās dzimumšūnās (spermijos) pēc mejozes ? 9. Lai iegūtu lielākus dārzeņus (kartupeļus, bietes), selekcijā mēdz izveidot poliploīdus augus ar daudzkāršotu hromosomu komplektu (4n, 8n). Kāds būs selekcijas gaitā iegūtais hromo-
somu skaits tetraploīda (4n) kartupeļa somatiskajā šūnā, olšūnā (pirms apaugļošanās) un dīgļa šūnās (pēc apaugļošanās), ja pirms selekcijas kartupeļu somatiskajās šūnās ir 48 hromosomas ? 10. Izveidojiet vārdu pārus no svešvārdiem (1) un to skaidrojumiem (2)! 1) Mitoze; mejoze; citokinēze; kariokinēze; amitoze; hromatīda; centromēra; centriola; inter-
fāze; krosingovers; 2) tiešā dalīšanās; netiešā dalīšanās; reduktīvā dalīšanās; citoplazmas dalīšanās; kodola dalīšanās; hromosomu iežmauga; dalīšanās vārpstu veidojošais organoīds; starpfāze no vienas dalīšanās līdz nākamajai; hromosomu krustmija; dubultotās hromosomas identiskā puse. 11. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem hromosoma, hromatīda, mitoze, me-
joze, amitoze, interfāze, kariokinēze, citokinēze, haploidāls, diploidāls! 5.2. ORGANISMU VAIROŠANĀS VEIDI Viena no organismu galvenajām īpašībām ir to spēja vairoties jeb pašreproducēties. Ar vairošanos tiek nodrošināta katras sugas eksistence. Orga-
nismiem ir novērojama vai nu bezdzimumvairo-
šanās, vai dzimumvairošanās, vai arī abi vairo-
šanās veidi. Bezdzimumvairošanās dabā ir samērā plaši iz-
platīta. Tā vairojas vienšūnas organismi, sēnes, daudzas augu un dažas dzīvnieku sugas. Vienšūnas organismi (baktērijas, vienšūņi, vienšūnas aļģes) vairojas mitotiski, daloties uz pusēm. Sēnes, kā arī sūnas, staipekņi, kosas un papardes vairojas ar sporām. Katra spora ir viena šūna, kas spējīga mi-
totiski dalīties un attīstīties par jaunu organismu. Dzimumvairošanās Dzimumvairošanās dabā ir plašāk izplatīta nekā bezdzimumvairošanās. Dzimumvairošanās notiek, saplūstot divām dzimumšūnām jeb gametām. Katrā gametā ir puse no sugai raksturīgā hromo-
somu skaita. Šādā veidā vairojoties, jaunie orga-
nismi ir ģenētiski atšķirīgi no vecākorganismiem un suga spēj labāk pielāgoties mainīgajiem vides apstākļiem. Dzīvniekiem dzimumšūnās (spermatozoīdi un olšūnas) attīstās dzimumdziedzeros. Ziedaugiem gametas veidojas ziedā. Vīrišķās dzimumšūnās (spermiji) attīstās putekšņlapās, bet sievišķās dzi-
mumšūnās (olšūnas) attīstās sēklotnē. Dzimum-
šūnās ir haploidāls hromosomu skaits. Gametām saplūstot, apaugļošanās procesā veidojas zigota -
apaugļota olšūna ar diploidālu hromosomu skaitu. No zigotas attīstās jauns organisms. Bezdzimumvairošanās Bezdzimumvairošanās gadījumā jaunie orga-
nismi veidojas no somatiskajām šūnām vai atse-
višķām organisma daļām. Šajā procesā piedalās ti-
kai viens vecākorganisms. Jaunizveidojušies orga-
nismi saņem tādu pašu ģenētisko informāciju, kāda ir vecākorganismam. Augu vairošanās Augiem plaši izplatīta ir veģetatīvā vairošanās, kurā no vecākorganisma atdalās vesela šūnu grupa un izveidojas jauns augs. Veģetatīvā vairošanās var būt dažāda. Plaši izplatīta ir vairošanās ar paze-
mes daļām - sakneņiem, gurniem, bumbuļiem, sī-
poliem, kā arī ar virszemes daļām, piemēram, ar stīgām. Cilvēki veģetatīvi pavairo augus ar sprau-
deņiem, noliektņiem un potējot. Ķērpji un atse-
višķas sūnas var vairoties fragmentējoties - ķērp-
jiem un aknu sūnām veidojas īpaši vairķermenīši, bet lapu sūnas spēj vairoties ar zaru fragmentiem (īpaši - sfagni). Augiem dzimumvairošanās procesā ir rakstu-
rīga paaudžu maiņa. Dzīves ciklā tiem veidojas gan sporas, gan arī gametas. Augu attīstībā izšķir divas paaudzes: bezdzi-
mumpaaudzi jeb sporofītu un dzimumpaau-
dzi jeb gametofītu. Sporofīta paaudze mainās ar gametofita paaudzi (sk. 5.8. att.). Sporofīts ir diploidālā paaudze (2n). Veidojoties sporām, no-
tiek reduktīvā dalīšanās jeb mejoze (2n->n), un sporām jau ir haploidāls (n) hromosomu kom-
plekts. No sporām veidojas gametofīts. Gametofīts ir paaudze, kurai attīstās gametas. Gametofītam un gametām ir haploidāls hromosomu skaits. Gametas veidojas īpašās vienšūnas vai daudz-
šūnu tvertnēs - gametangijos, šūnām mitotiski daloties. Kad gametas ir pilnīgi attīstījušās, var notikt to saplūšana jeb apaugļošanās. Veidojas zigota, kam ir diploidāls hromosomu skaits. No zigotas attīstās jaunais organisms (sporofīts). Dažiem augiem, piemēram, sūnām, dzīves ciklā pārsvarā ir gametofīts, bet citiem, piemēram, pa-
pardēm, kosām, staipekņiem un sēklaugiem, -
sporofīts. Raksturīgi, ka augstāku attīstības pa-
kāpi sasniegušajiem augiem salīdzinājumā ar ze-
māk attīstītiem augiem notiek haploidālās dzi-
mumpaaudzes (gametofita) reducēšanās un par dominējošo kļūst diploidālā paaudze (sporofīts). Sūnas, papardes, kosas un staipekņi vairojas ar sporām. Šo augu dzīves ciklā ir izteikta paaudžu maiņa. Segsēkļi jeb ziedaugi un kailsēkļi vairojas ar sēk-
lām. Sēklas un augļi segsēkļiem nodrošina dīgļa barošanos un aizsardzību, kā arī veicina augu iz-
platību. Segsēkļu dominējošā paaudze ir sporofīts, bet dzimumpaaudze jeb gametofīts ir reducējies. Ga-
metofita pazīmes un funkcijas piemīt putekšņiem un dīgļsomai. Segsēkļu sievišķie vairošanās orgāni ir gine-
cejs jeb augļlapu kopa. Augļlapai saaugot ar ma-
lām vai arī vairākām augļlapām saaugot kopā, iz-
veidojas auglenīca. Auglenīcas paplašinātā daļa ir sēklotne. Tajā ir viens vai vairāki sēklaizmetņi. To galvenā sastāvdaļa ir dīgļsoma, kurā atrodas olšūna. Auglenīcas augšējā daļa, kas uztver putekš-
ņus, ir drīksna. Drīksnu ar sēklotni savieno viens vai vairāki irbuļi. Auglenīca ir tikai ziedaugiem. Segsēkļu vīrišķie vairošanās orgāni ir putekšņ-
lapas - uz kātiņa novietotas putekšnīcas, kurās attīstās putekšņi. Katrā puteksnī atrodas ve-
ģetatīvā šūna, kurai daloties veidojas dīgļstobrs, un ģeneratīvā šūna, no kuras veidojas spermiji. Ziedus, kuriem ir tikai viena veida, t. i., vīriš-
ķie vai sievišķie ģeneratīvie orgāni, sauc par vien-
dzimuma ziediem, piemēram, lazdām. Augus, kuriem vīrišķie un sievišķie ziedi atrodas uz viena auga, sauc par vienmājas augiem jeb vienmāj-
niekiem, piemēram, gurķi. Augus, kuriem vīriš-
ķie un sievišķie ziedi atrodas uz dažādiem augiem, sauc par divmāju augiem jeb divmājniekiem, piemēram, vītoli. Lai smiltsērkšķim veidotos vita-
mīniem bagātie augļi, dārzā ir jāstāda vismaz viens vīrišķais un viens sievišķais augs. Ja augiem vienā ziedā atrodas gan vīrišķie, gan sievišķie orgāni, tad šādus ziedus sauc par divdzi-
mumu ziediem, piemēram, ķirša ziediem ir gan auglenīca, gan putekšņlapas. Pēc apputeksnēšanās, kad putekšņi ir nokļuvuši uz drīksnas, tie dīgst (sk. 5.10. att.). Putekšņu dīg-
šanu sekmē cukuriem bagātas vielas, ko izdala drīksna. Putekšņa veģetatīvā šūna izspiežas no putekšņa apvalka un veido dīgļstobru, kas ieaug drīksnas audos. Pēc tam tas pa irbuli aug sēklotnes virzienā. Dīgļstobrā pārvietojas arī ģeneratīvā 1. Dīgļstobrā atrodas divi spermiji, kas izveidojušies no ģeneratīvās šūnas. 2. Spermiju šūnas iekļūst dīgļsomā. 3. Viena spermija kodols iekļūst olšūnā, veidojot zigotu -
dīgļa pirmo šūnu. 4. Otrs spermijs saplūst ar dīgļsomas sekundāro kodolu, veidojot triploidālu endospermas pirmo šūnu. šūna. Tā dalās, un izveidojas divi spermiji - vī-
rišķās dzimumšūnās, kas nonāk dīgļsomā. Abi spermiji bioķīmiski atšķiras. Katram no tiem ir sava funkcija. Viens spermijs apaugļo olšūnu, bet otrs - sekundāro kodolu. No apaugļotās olšū-
nas jeb zigotas attīstās sēklas dīglis, bet no sekun-
dārā kodola - sēklas endosperma ar triploidālu hromosomu skaitu. Tā ir barības vielu rezerve dīgļa attīstībai. Šādu apaugļošanos, kurā tiek apaugļo-
tas divas šūnas, sauc par divkāršo apaugļoša-
nos (sk. 5.9. un 5.10. att.). To 1898. gadā atklāja krievu zinātnieks Sergejs Navašins. Pēc apaugļo-
šanās no auglenīcas rodas auglis (sk. 5.10. att.), kurš satur vienu vai vairākas sēklas. Dažkārt augļa veidošanā piedalās arī citas zieda daļas, pie-
mēram, apziednis vai ziedgultne. Divkāršā apaugļošanās notiek tikai segsēkļiem. Kailsēkļiem tiek apaugļota tikai olšūna, no kuras pēc apaugļošanās attīstās sēklas dīglis, bet sēklas endosperma veidojas no primārās endospermas bez apaugļošanās. Dzīvnieku vairošanās Tāpat kā augiem arī dzīvniekiem iespējama fragmentācija. Tādi adatādaiņi kā jūraszvaigznes spēj sadalīties vairākās daļās, un no katras daļas izaug jauns dzīvnieks. Nevajadzētu fragmentāciju jaukt ar reģenerāciju - zaudēto ķermeņa daļu atjaunošanu (zarndobumaiņiem, posmtārpiem). Daudzām medūzām attīstības ciklā ir strobils, kuram fragmentējoties veidojas jaunas medūzas. Zarndobumaiņi, piemēram, hidras, koraļļi, aktī-
nijas, vairojas pumpurojoties. Daži plakantārpi, piemēram, planārijas, var pārdalīties uz pusēm. Atšķirībā no bezdzimumvairošanās dzimumvai-
rošanās dzīvniekiem notiek ar specializētām dzi-
mumšūnām - olšūnām un spermatozoīdiem, kas veidojas dzimumdziedzeros jeb gonādās. Olšūnas veidojas olnīcās, bet spermatozoīdi - sēk-
liniekos. Vairums dzīvnieku ir šķirtdzimumu -
viņiem olnīcas un sēklinieki attīstās atsevišķos or-
ganismos. Šķirtdzimumu dzīvniekiem, piemēram, veltņtārpiem, posmkājiem, lielākai daļai mugur-
kaulnieku, ir gan mātītes, gan tēviņi. Kopdzimuma organismiem jeb hermafrodītiem vienā organismā attīstās gan vīrišķie, gan sieviš-
ķie dzimumdziedzeri un attiecīgās dzimumšūnās. Pārošanās laikā viņi vienlaikus funkcionē kā mā-
tītes un tēviņi - notiek savstarpēja apaugļošanās. Tādi dzīvnieki ir sliekas, gliemeži, plakantārpi. At-
šķirībā no citiem hermafrodītiem tādiem parazī-
tiskajiem tārpiem kā lenteņiem spermatozoīdi apaugļo paši sava organisma olšūnas. Līdzīgi kā augiem arī daudziem dzīvniekiem ir dzimumpaaudzes un bezdzimumpaaudzes maiņa, piemēram, medūzām, sūcējtārpiem. Partenoģenēze ir dzīvnieka attīstība no ne-
apaugļotas olšūnas. Tā ir raksturīga daudzām ku-
kaiņu un vēžu sugām. Jaunajam organismam at-
karībā no partenoģenēzes veida un sugas īpatnī-
bām var būt haploidāls hromosomu skaits, piemē-
ram, traniem, vai arī diploidāls hromosomu skaits, piemēram, dafnijām. Partenoģenēzi var izraisīt arī mākslīgi. Šajā gadījumā ar dažādu ķīmisku vielu, vides izmaiņu (temperatūra, pH, vides sāļums) vai mehānisku iedarbību tiek radīti apstākļi, kas aktivē olšūnu un veicina tās attīstību. Mākslīgi ir pa-
nākta varžu, tritonu, tītaru un citu dzīvnieku partenoģe-
nēze. Izdevies stimulēt pat truša olšūnas attīstību. 1. Ar ko atšķiras dzimumvairošanās no bezdzimumvairošanās? 2. Kas ir hermafrodīti ? 3. Kas ir partenoģenēze? 4. Kuras no nosauktajām pazīmēm raksturīgas dzimumuairošanās, kuras - bezdzimumvai-
rošanās procesam ? 1) Pēcnācēji ir ģenētiski identiski vecākiem; 2) pēcnācēji ģenētiski atšķiras no vecākiem (viņiem ir abu vecāku pazīmes); 3) tā vairojoties, ir iespējams iegūt lielāku pēcnācēju skaitu; 4) pēcnācēji ir labāk pielāgoti dažādiem izdzīvošanas apstākļiem; 5) vairošanās procesā ir iesaistītas dzimumšūnas un apaugļošanās; 6) attīstība notiek ar paaudžu maiņu; 7) dominē zemāk attīstītiem organismiem; 8) dominē augstāk attīstītiem organismiem. 5. Kādos gadījumos cilvēki pavairo augus vai dzīvniekus bezdzimumvairošanas ceļā ? 6. Kuriem ar vairošanos saistītajiem jēdzieniem (1) atbilst minētie skaidrojumi (2)? 1) Gametas; gonādas; zigota; olšūna; apaugļošanās; spermatozoīds (spermijs); dzimumvai-
rošanās; bezdzimumvairošanās; anterīdiji; arhegoniji; sporofīts; gametofīts; 2) dzimumšūnas, 9 dzimumšūna, dt dzimumšūna, dzimumdziedzeri, ģenētiski identisku pēcnācēju veidošanās no somatiskajām šūnām; jauna organisma attīstīšanās no saplūdušām dzimumšūnām; apaugļota olšūna; dzimumšūnu saplūšana; augu bezdzimumpaaudze (sporu veidotāja); augu dzimumpaaudze (dzimumšūnu veidotāja); vīrišķo dzimumšūnu tvertnes augiem; sievišķo dzimumšūnu tvertnes augiem. 7. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem gametas, gonādas, apaugļošanās, zigota, hermafrodīts, šķirtdzimumu dzīvnieks, spora, sporofīts, gametofīts, sievišķais zieds, vien-
dzimuma zieds, divdzimumu zieds, vienmājnieks, divmājnieks! 5.3. DZĪVNIEKU UN CILVĒKA DZIMUMŠŪNU ATTĪSTĪBA Dzimumšūnu attīstība jeb gametoģeneze dzīv-
niekiem notiek dzimumdziedzeros. Spermatoģenēze ir vīrišķo dzimumšūnu at-
tīstība (sk. 5.11. att.). Tā notiek sēklinieku izlo-
cītajos kanālos. Kanālu sienās veidojas primārās dzimumšūnas jeb spermatogoniji. Tiem ir sa-
mērā liels kodols un nedaudz citoplazmas. Spermatoģenēzē izšķir vairošanās, augšanas un nobriešanas periodus. Vairošanās periodā spermatogoniji vairākkārt mitotiski dalās. Daļa no tiem saglabājas kā sper-
matogoniji, bet daļa uzsāk augšanu un attīstību. Augšanas periodā spermatogonijs sāk augt. Tas nedaudz palielinās izmēros un pārvietojas no ka-
nāliņa perifērijas uz centru. Nobriešanas periods sākas ar mejotisko dalīša-
nos. Tās rezultātā izveidojas 4 dzimumšūnās ar haploidālu hromosomu komplektu. Cilvēka dzi-
mumšūnās ir 23 hromosomas atšķirībā no soma-
tiskajām šūnām, kurās ir 46 hromosomas. Lai vīrišķās dzimumšūnās spētu veikt apaugļošanu, pēc mejozes tajās notiek virkne pārmaiņu: • šūnai izveidojas astīte, kas nodrošina kustī-
gumu; • šūnas kakliņā sakoncentrējas daudz mitohon-
driju, kuri apgādā astīti ar enerģiju; • šūna zaudē lielāko daļu organoīdu (endoplaz-
matisko tīklu, Goldži kompleksu u. c.), lai maksi-
māli samazinātu izmērus, tā atvieglojot kustī-
gumu; • šūnas priekšgalā izveidojas liela lizosoma -
akrosoma, kura satur olšūnas apvalku šķīdināša-
nai nepieciešamos fermentus. Šūnas, kurās ir notikušas minētās pārmaiņas, sauc par pilnībā nobriedušiem spermatozoīdiem. Tie ir kustīgi un daudz mazāki nekā olšūnas. No-
brieduši zīdītāju spermatozoīdi ir līdzīgi garam pavedienam. Tie sastāv no galviņas, kurā atro-
das kodols ar ģenētisko informāciju, akrosomas, kakliņa, kura galvenā sastāvdaļa ir mitohondriji, un astītes (sk. 5.12. att.). Cilvēka spermatozoīdu nobriešanai nepieciešamas vidēji 72 dienas. Ne-
pilnīgi nobrieduši spermatozoīdi nav spējīgi apaug-
ļot. Spermatozoīdu mūža ilgums un kustīgums pa-
lielinās sārmainā vidē, bet samazinās skābā vidē. Cilvēkiem spermatoģenēze sēkliniekos notiek no pubertātes (13-15 gadu vecuma) līdz sirmam vecu-
mam. Ooģenēze (ovoģenēze) ir sievišķo dzimumšūnu attīstība olnīcās. Tā sākas embrionālās attīstības laikā un, tāpat kā spermatoģenēze, ietver vairo-
šanās, augšanas un nobriešanas periodu. Ooģenēzes vairošanās periodā vairākkārt dalās primārās dzimumšūnās - oogoniji (sk. 5.13. att.). Zīdītāju sievišķo dzimumšūnu vairošanās notiek tikai embrionālās attīstības laikā. Ap sievišķajām dzimumšūnām izveidojas apvalks no mazākām šū-
nām. Šīs šūnu grupas kopā ar dzimumšūnu veido folikulu. Pēc tam dzimumšūnu un folikulu attīs-
tība uz ilgāku laiku pārtraucas un atsākas, tikai sasniedzot dzimumbriedumu (11-15 gadus). Augšanu uzsāk vairākas sievietes dzimumšū-
nās, bet pabeidz tikai viena (citiem zīdītājiem var būt vairākas). Šajā laikā tā būtiski mainās, lai pie-
lāgotos pēc apaugļošanas sekojošai dīgļa attīstībai: • šūnai izveidojas biezs olbaltumvielu un pa-
vadošo šūnu apvalks; • šūnā ir spēcīgi attīstīts endoplazmatiskais tīkls, Goldži komplekss un ieslēgumi, kas nodro-
šina rezerves vielu ražošanu un uzkrāšanu; • dzimumšūnu pavadošās folikula šūnas nodro-
šina tai papildu barošanu un lielu rezerves vielu uzkrāšanos, kas būs nepieciešamas sākotnējai dīgļa attīstībai; • dzimumšūna daudzkārt palielinās izmēros, jo tajā uzkrājas rezerves barības vielas - dzelte-
nums. Vienlaikus ar dzimumšūnas augšanu norisinās arī folikula augšana, līdz tas pārplīst, un olšūna vispirms nokļūst vēdera dobumā, tur to satver olvada bārkstis un aizvada tālāk olvadā. Tikai tad sākas dzimumšūnas nobriešana par olšūnu. Tas notiek mejotiskās dalīšanās laikā. Taču sievišķajām dzimumšūnām abas mejotiskās dalīšanās nenotiek vienmērīgi, jo katras dalīšanās laikā viena meitšūna saņem atbilstošo daudzumu hromosomu un visu citoplazmu, bet otra - tikai kodolu ar hromosomām (sk. 5.13. att.). Šādu nepil-
nīgu šūnu sauc par polāro ķermenīti, un pēc dalīšanās tas aiziet bojā. Tādas mejozes rezultātā rodas viena olšūna, kura saņem visu sākotnējo ba-
rības vielu un šūnas organoīdu daudzumu, bet hromosomu komplekts ir noreducēts līdz vienkār-
šam (haploīdam). Ooģenēze tiek pabeigta tikai tad, ja olšūnu ap-
augļo spermatozoīds, no tās izveidojas zigota un sākas dīgļa attīstība. Neapaugļotas olšūnas aiziet bojā. Vairumam zīdītāju olšūnas ir nelielas, tomēr sa-
tur daudz dzeltenuma. Vislielākās olšūnas ir putniem (sk. 5.14. att.), jo tām ir vislielākais dzeltenums. Turklāt apaug-
ļotu olšūnu ietver vairāki apvalki, jo ola attīstās ārējā vidē. Dzīvniekiem ir atšķirīgs dzimumšūnu skaits. Piemēram, zīdītāju mātītēm rodas samērā neliels olšūnu skaits un gandrīz visi pēcnācēji sasniedz dzimumgatavību. Turpretim daudzām zivīm mā-
tītes nērš miljoniem olšūnu (ikru), bet tikai ne-
daudzi izdzīvo un vēlāk no tiem izaug zivtiņas. Dzimumšūnu attīstības gaitā no katra sperma-
togonija veidojas četri spermatozoīdi, bet no katra oogonija - tikai viena olšūna. 1. Kur dzīvniekiem norit gametuattīstība? 2. Raksturojiet dzimumšūrtu attīstības periodus! 3. Raksturojiet spermatoģenēzes un ooģenēzes atšķirības! 4. Nosauciet, kuras paJīmes raksturīgas zīdītāju ooģenēzei, kuras - spermatoģenēzei! 1) Šūnai nobriestot,i tās izmēri ievērojami samazinās; 2) šūnai nobriestot, tās izmēri ievērojami palielinās; 3) šūnā ir visi organoīdi; 4) šūnā saglabājušies tikai atsevišķi organoīdi; 5) nobriedusi šūna ir aktīva, kustīga; 6) šūnu aptver olbaltumvielu un pavadītājšūnu apvalki; 7) šūnu vairošanās turpinās lielāko mūža daļu; 8) šūnu vairošanās notiek embrionālās attīstības laikā; 9) šūnu nobriešana sākas, iestājoties dzimumbriedumam; 10) vienlaikus aug un nobriest daudzas šūnas; 11) vienlaikus aug un nobriest viena vai nedaudzas šūnas; 12) nobriedusi dzimumšūna satur vienkāršu (haploīdu) hromosomu komplektu. 5. Minētajos jēdzienos par augu un dzīvnieku vairošanos atrodiet tos vārdu pārus, kuru biolo-
ģiskā nozīme ir vienāda vai ļoti līdzīga! Augu vairošanās. Sēklotne; olšūna; dīgļsoma; divdzimumu zieds; viendzimuma ziedi; sper-
mijs; veģetatīvā vairošanās; apputeksnēšanās; putekšnīca; ola. Dzīvnieku vairošanās. Spermatozoīds; škirtdzimumu dzīvnieki; folikuls; olnīca; hermafro-
dīts; sēkla; olšūna; pumpurošanās; sēklinieks; pārošanās. 5-4. ORGANISMA INDIVIDUĀLĀ ATTĪSTĪBA Apaugļošanās Apaugļošanās ir gametu jeb dzimumšūnu sa-
plūšana, kuras rezultātā veidojas apaugļota olšū-
na - zigota. Ārējā apaugļošanās raksturīga daudziem ūdensdzīvniekiem. Vairums šo dzīvnieku, piemē-
ram, zivis, dzimumšūnās izdala ūdenī, kur, vīriš-
ķajām un sievišķajām dzimumšūnām sastopoties, notiek apaugļošanās. Dzīvniekiem, kuriem raksturīga iekšējā ap-
augļošanās, ir attīstījušies ārējie dzimumorgāni. Ar to palīdzību spermatozoīdi tiek pārnesti no tē-
viņa uz mātītes organismu. Daudzu sugu dzīvnie-
kiem ir izveidojusies sarežģīta uzvedība, kas no-
drošina tēviņu un mātīšu tuvināšanos. Ir dzīvnieku sugas, kas vairojas tikai vienreiz mūžā. Piemēram, zilmuguras laši iepeld upju augštecēs, kur nārsto un iet bojā. Dažu sugu zir-
nekļu mātītes pēc kopulācijas apēd tēviņus. Taču visos gadījumos atsevišķu indivīdu bojāeja nodro-
šina sugas saglabāšanos. Zīdītāju mātītēm apaugļošanās notiek olvadā. Spermatozoīdi aktīvi kustas olvada virzienā, jo ol-
šūnas izdala vielas ar vāji sārmainu reakciju. Ol-
šūnu uz dzemdes pusi virza olvada skropstiņepi-
tēlija kustības. Spermatozoīdi ar īpašu fermentu palīdzību iz-
šķīdina olšūnas apvalkus. Pēc tam viens no sper-
matozoīdiem iekļūst olšūnā. Ap olšūnu izveidojas apvalks, kas aizkavē citu spermatozoīdu iekļūšanu tajā. Olšūna izdala arī speciālas vielas - agluti-
nīnus, kas salipina olšūnā neiekļuvušos sperma-
tozoīdus. Tad notiek spermatozoīda un olšūnas ko-
dola saplūšana. Zigotā atjaunojas diploidāls hro-
mosomu komplekts. Pēc apaugļošanās ievērojami aktivizējas zigotas vielmaiņa un sākas tā mitotiskā dalīšanās. Dīgļa attīstība Pēc apaugļošanās sākas apaugļotās olšūnas jeb zigotas mitotiskā dalīšanās, ko sauc par drosta-
lošanos. Drostalošanās laikā starp atsevišķām mitozēm interfāze ir īsa, tāpēc šūnu augšana gandrīz ne-
notiek. Dažādiem dzīvniekiem atšķiras olšūnā uzkrāto rezerves vielu (dzeltenuma) daudzums, piemēram, abiniekiem un zīdītājiem dzeltenums ir neliels, bet rāpuļiem un putniem tas ir lielāks. Dzeltenuma daudzums ietekmē olšūnas drostalošanos. Drostalošanās norit daudzšūnu dzīvniekiem. Mugurkaulniekiem raksturīga radiālā drostaloša-
nās - blastomēri izvietojas simetriski attiecībā pret visām blastulas plaknēm. Sākumā dīglim ir blīva pūslīša forma. Šādu stadiju sauc par morulu. Dīglis morulas stadijā ir līdzīgs avenei. Dīglim attīstoties, morulas centrā dažas šūnas sairst un iet bojā. Tā rezultātā dīgļa centrālajā daļā iz-
veidojas dobums - blastocels, kura izmēri pakā-
peniski palielinās. Šādu dīgli sauc par blastulu (sk. 5.15. att.). Blastulas (dīgļa) ārējo sienu veido sīkas šūnas - blastomēri. No tiem var veidoties viss organisms. Dažādiem dzīvniekiem blastulas forma var atšķirties. Ja olšūnā dzeltenuma ir nedauz, tad parasti no-
tiek pilnīga drostalošanās, bet, ja dzeltenuma ir daudz, tad notiek nepilnīga drostalošanās un dzel-
tenums nepārdalās uz pusēm. Cilvēkam apmēram piektajā attīstības dienā blastula sasniedz dzemdes dobumu. 6.-7. embrio-
nālās attīstības dienā notiek ieligzdošanās jeb im-
plantācija dzemdes sienā. Pēc drostalošanās un blastulas izveidošanās seko gastrulācija - process, kurā veidojas trīs šūnu slāņi - entoderma, ektoderma un mezoderma. Šos slāņus sauc par dīgļlapām. Tās ir līdzīgas visiem mugurkaulniekiem. Gastrulas ārējo kārtu sauc par ektodermu, bet iekšējo kārtu - par entodermu. Gastrulācijas beigās starp ektodermu un entodermu izveidojas vidējā kārta - mezoderma. Pēc gastrulācijas notiek organoģenēze (dīgļa orgānu veidošanās). Dīgļlapu šūnas savā starpā atšķiras ne tikai ar atrašanās vietu, bet arī ar da-
žādām citoloģiskām īpatnībām. Orgāni veidojas no noteiktām dīgļlapām. Mugurkaulniekiem no ekto-
dermas attīstās ādas epiderma, ādas dziedzeri, zobu virsējā kārta, maņu orgānu uztverošā daļa, deguna dobums, mutes un zarnu epitēlijs, nervu sistēma. No entodermas veidojas zarnu un elpceļu epi-
tēlijs, gremošanas sistēmas dziedzeri un urīnpūšļa epitēlijs. No mezodermas veidojas muskulatūra, kauli, skrimšļi, asinsrites sistēma, zemāda un saistaudi starp iekšējiem orgāniem, kā arī daļēji - izvador-
gāni, olnīcas un sēklinieki. Daudzi orgāni veidojas no divām vai pat visām trim dīgļlapām. Sūnā aktīvi funkcionē tikai daļa gēnu, bet citi ir neak-
tīvā stāvoklī. Gēnu vai gēnu grupu darbību regulē ķīmiskā vide, kas atrodas ap tiem. Olšūnas citoplazmā atrodas vie-
las, kas gēnus regulē pirmajās dīgļa attīstības stadijās. Turp-
mākajā attīstības gaitā šūnas ražo ķīmiskas vielas, kas ak-
tivē noteiktus gēnus. Aktivējušies gēni mijiedarbojas ar citoplazmu un rada tajā noteiktu ķīmisku vidi, kas savu-
kārt izraisa gēnu aktivāciju blakus esošajās šūnās. Lai gan šūnām ir vienāds ģenētiskais materiāls, to gēni nedarbojas vienādi un rodas atšķirības starp dažādām šūnu grupām. Turpmākajā attīstības gaitā šūnas, kurās radušās šīs pār-
maiņas, ietekmē blakus esošās šūnas un liek tām noteiktā veidā attīstīties. Sūnu diferencēšanos ietekmē arī signāli no citām šūnām. Ir pierādīts, ka vienas šūnu grupas pār-
vietošanās var ietekmēt kādas citas šūnu grupas pārvieto-
šanos. Tādējādi noteiktas ķīmiskas vielas vai audi spēj ietekmēt citu audu attīstību. Cilvēkam un citiem mugurkaulniekiem vispirms veidojas nervu caurulīte. Šo procesu sauc par nei-
rulāciju. Pēc tam brīvās entodermas malas tu-
vinās un saaug kopā, izveidojot zarnu kanālu. Cilvēka dīglim no 21. līdz 32. attīstības dienai ir izveidojusies sirds un vienvirziena asinsrite caur to. Dīglim ir attīstījušies roku un kāju aizmetņi, kā arī acāboli un dzirdes pūslīši. Līdz 8. nedēļas beigām cilvēka dīglim turpinās orgānu sistēmu di-
ferenciācija. Dzimumsistēma attīstās pēdējā, tādēļ ultrasonogrammā bērna dzimumu var noteikt tikai pēc 8. nedēļas. Pirmos divus grūtniecības mēnešus (8 nedēļas) cilvēka dīgli dēvē par embriju, bet pēc tam - par augli. Atšķirībā no embrija auglim ir izveidojušies visi orgāni un viņš izskatās pēc maza cilvēka. Dīgļa apvalki un placenta Tiem dzīvniekiem, kuru attīstība notiek ūdenī (zivīm, abiniekiem), ūdens piegādā dīglim skābekli un aizvada atkritumvielas, turklāt ūdenī dīglim nedraud izžūšana. Rāpuļiem, putniem un zīdītā-
jiem ap dīgli veidojas apvalki, kuri to aizsargā no mehāniskas iedarbības un no izžūšanas; caur tiem piekļūst barības vielas un skābeklis. Kad dīglis sasniedzis blastulas stadiju, daļa tā šūnu veido embriju, bet daļa - apvalkus (sk. 5.17. att.). Ārējais apvalks ir horijs. Putniem un rā-
puļiem tas atrodas tieši zem olas čaulas un no-
drošina gāzu maiņu. Zīdītājiem gāzu maiņu nodro-
šina placenta - ārpusdīgļa orgāns, kas saista māti ar augli. Placentai izšķir augļa daļu un mātes (intoksikācija). Piemēram, ja infekcija iekļūst dīglī 5. attīstības nedēļā, var rasties sirds slimības, 6. nedēļā, - aklums, bet 9. nedēļā, - kurlums. Dzīvnieku pēcembrionālā attīstība Organisms, kas ir attīstījies un jau spēj patstā-
vīgi eksistēt, pārrauj apvalkus un izkļūst ārpusē. Līdz ar šo momentu arī beidzas attīstības embrio-
nālais periods un sākas pēcembrionālais attīstības periods. Pēcembrionālā attīstība var būt tieša, kad piedzimušais organisms ir līdzīgs pieaugušajam, piemēram, putnu un zīdītāju mazuļi ir līdzīgi sa-
viem vecākiem. Attīstība ir netieša, ja embrionālās attīstības rezultātā veidojas kāpuri (nimfas), kas pakāpeniski pārvēršas par pieaugušu organismu. Tā attīstās, piemēram, abinieki un kukaiņi (sk. 5.18. att.). Šo pārvēršanos, kuras laikā attīstās pie-
augušam dzīvniekam raksturīgie orgāni, sauc par metamorfozi. Pilnīgas metomorfozes gadījumā kāpuri ir pielāgojušies dzīvei citos apstākļos nekā daļu. Augļa daļu veido horija bārkstiņas, bet mātes daļu - dzemdes audi. Cilvēka auglim placenta pil-
nībā izveidojas 10. attīstības nedēļā. Horijam iekšpusē pieguļ amnijs - apvalks, kas satur šķidrumu, kurā atrodas dīglis attīstības laikā. Amnija šķidrumu izdala amnija apvalks un em-
brijs. Šis šķidrums pasargā embriju no izžūšanas, pielipšanas pie apvalka, amortizē sitienus un grū-
dienus. Amnija apvalka izveidošanās deva iespēju rāpuļu olām attīstīties uz sauszemes. Starp dīgļa ārējo apvalku (horiju) un iekšējo ap-
valku (amniju) zināmu telpu aizņem alantojs -
pūslis, kurš savāc slāpekļa atkritumvielas. Zīdī-
tāju dīglim to vēlāk aizstāj nabas saites asinsvadi. Zivju, abinieku, rāpuļu un putnu embriji saņem barības vielas no dzeltenuma maisa. Zīdītājiem šajā maisā dzeltenuma nav, tā dobums ir pildīts ar šķidrumu. Dzeltenuma maisā veidojas pirmās asins šūnas. Zīdītājiem dīgļa apvalku funkcijas ir mazinā-
jušās, jo viņu attīstība notiek mātes organismā, kur daudzas apvalku funkcijas ir pārņēmusi pla-
centa. Tā • nodrošina augļa gāzu maiņu; • piegādā barības vielas; • aizvada vielmaiņas galaproduktus; • pasargā augli no mikroorganismu un kaitīgu vielu iekļūšanas tajā; • nodrošina dīgļa attīstību, izdalot hormonus, kurus var noteikt ar īpašu testu. Placentu ar augli savieno nabas saite, kas veido-
jas, alantojā un dzeltenuma maisā ieaugot asins-
vadiem. Osmozes un difūzijas ceļā caur placentu notiek vielu maiņa starp augļa un mātes asinīm. Cilvēka embrionālajā attīstībā ir vairāki kritiski periodi. Pirmais kritiskais periods ir dīgļa ieligz-
došanās laikā, otrais -, kad notiek svarīgāko or-
gānu aizmetņu veidošanās, bet trešais - placentas veidošanās laikā. Šajā laikā dažādi nelabvēlīgi ārē-
jās vides faktori var izraisīt dīgļa attīstības traucē-
jumus. Cauri placentai var iekļūt medikamenti un citas ķīmiskas vielas, piemēram, alkohols un ni-
kotīns. Arī mātes slimības var ietekmēt dīgļa at-
tīstību. Piemēram, ja māte slimo ar masaliņām, bērnam var rasties garīga atpalicība, sirds slimī-
bas vai citi traucējumi. Attīstības traucējumu veids ir atkarīgs no tā, kurā dīgļa attīstības laikā no-
tiek organisma saindēšanās ar toksiskām vielām pieaugušie īpatņi jeb imago un tāpēc nekonkurē savā starpā vietas un barības dēļ. Bieži vien dzīv-
nieki kāpura stadijā aktīvāk uzņem barību un in-
tensīvāk aug nekā pieauguši īpatņi. Citi kukaiņi, piemēram, sienāži, attīstās ar nepilnīgu metamor-
fozi, un nimfas ēd to pašu barību, ko pieauguši kukaiņi. Mazkustīgiem dzīvniekiem vai arī tiem dzīvniekiem, kas piestiprinājušies pie substrāta, kāpuri brīvi pārvietojas un veicina sugas izplatī-
šanos, piemēram, koraļļi. Cilvēka pēcembrionālā attīstība Atšķirībā no dzīvniekiem, kuri pēcembrionālās attīstības laikā spēj eksistēt patstāvīgi (izņemot nelielu daļu putnu un zīdītāju), cilvēka mazulis pēc piedzimšanas ir atkarīgs no vecāku rūpēm. Cilvēka pēcembrionālajā attīstībā izšķir vairākus posmus. Pirmajā dzīves mēnesī cilvēka mazuli sauc par jaundzimušo. Šajā laikā mazulim nepieciešama īpaši rūpīga un uzmanīga kopšana, jo notiek viņa pielāgošanās dzīvei ārpus mātes organisma - vi-
ņam tikai tagad sāk funkcionēt elpošanas sistēma, gremošanas sistēma sāk uzņemt un pārstrādāt ba-
rības vielas, izmainās asiņu cirkulācija, jo pārstāj funkcionēt nabas saites asinsvadi. Viņš vēl nespēj turēt galviņu, nekoordinē kustības, nefokusē ska-
tienu. Viņam nav saaugušas galvaskausa šuves un starp tām ir vairākas atveres - avotiņi. Vislabākais un vispiemērotākais jaundzimušā uzturlīdzeklis ir mātes piens, jo • tas ir viegli uzņemams un pārstrādājams; • tajā ir antivielas, kas pasargā bērnu no infek-
cijas slimībām, kuras pārslimojusi māte; • tas nesatur mikroorganismus (ja mātei krūtis ir veselas); • pienā ir hormoni, kas nodrošina bērna aug-
šanu un attīstību; • veidojas emocionālā saikne starp bērnu un māti, kas veicina viņa garīgo attīstību; • barošana ar krūti ir veselīga mātei, jo veicina dzemdes saraušanos un tās iepriekšējās formas at-
gūšanu pēc dzemdībām. Lai sekmētu mazuļa augšanu un attīstību, ba-
rošanu ar krūti ieteicams turpināt līdz gada vecu-
mam - šajā laikā posmā bērnu sauc par zīdaini. Ar mātes pienu zīdainim pilnībā pietiek līdz 3 mē-
nešu vecumam, pēc tam papildus jāsāk viņu pie-
barot ar augļu un dārzeņu biezeņiem, putrām u.c. atbilstošu barību. Ja mātei piens neveidojas nepie-
ciešamajā daudzumā, zīdaini ēdina ar mākslīga-
jiem piena aizstājējiem. Pirmā gada laikā zīdainis ļoti strauji aug un at-
tīstās. 3 mēnešu vecumā viņš izdod neartikulētas skaņas, bet gada vecumā jau izrunā sev nozīmī-
gākos vārdus. Pusgada vecumā zīdainis sāk sēdēt, mācās rāpot, viņam sāk augt pirmie zobi (piena zobi). 8 mēnešu vecumā zīdainis māk patstāvīgi piecelties, apsēsties, pieturoties stāvēt. Patstāvīgi staigāt bērns iemācās ap gada vecumu. No gada līdz 3 gadu vecumam cilvēka mazuli sauc par mazbērnu. Šajā vecuma posmā viņš iemācās patstāvīgi ēst, saprast viņam teikto, runāt vienkāršos teikumos, rotaļāties, prasīties uz po-
diņa. No 3 gadu vecuma mazuli sāk saukt par bērnu. īpaši svarīgs periods cilvēka attīstībā ir pus-
audža vecums (10-16 gadi), kad viņš ļoti strauji aug, izmainās iekšējo sekrēcijas dziedzeru darbība -
iestājas dzimumgatavība, izveidojas sekundārās dzimumpazīmes. Šīs izmaiņas cilvēka organismā sauc par pubertāti. Pusaudža vecumam seko jaunības periods (16-21 gadi), kad cilvēks pamazām sasniedz garīgo un fizisko briedumu. 1. Kas ir apaugļošanās ? 2. Ar ko drostalošanās atšķiras no parastās šūnu dalīšanās ? 3. Kas ir gastrulācija? 4. Kādi orgāni mugurkaulniekiem attīstās no ektodermas, kādi - no entodermas un kādi - no mezodermas ? 5. Kāda nozīme augļa attīstībā ir placentai ? 6. Ar ko atšķiras tiešā attīstība no attīstības ar metamorfozi ? 7. Sakārtojiet pareizā secībā dzīvnieku attīstības stadiju nosaukumus! Auglis; zigota; gastrula; blastula; embrijs; morula. 8. Sakārtojiet pareizā secībā dzīvnieku dīgļa attīstības galveno procesu nosaukumus! Gastrulācija; organoģenēze; apaugļošanās; drostalošanās; gametoģenēze. 9. Sagrupējiet doto orgānu nosaukumus pēc to embrionālās izcelsmes - veidošanās no ekto-
dermas, entodermas, mezodermas! Ada; maņu orgāni; muskuļi; skelets; asinsrites orgāni; zarnu epitēlijs; dzimumdziedzeri; nervu sistēma. 10. Atrodiet dīgļa apvalku un embrionālo orgānu (1) funkcijas (2)! 1) Horijs; alantojs; amnijs; dzeltenuma maiss; placenta; nabas saite. 2) Gāzu maiņa; barības vielu nodrošināšana; atkritumvielu uzkrāšana; ūdens vides nodro-
šināšana; augļa un placentas savienošana; augļa aizsardzība. 11. Cik dienu ilgst grūsnība (grūtniecība) šādiem dzīvniekiem un cilvēkam ? Govs; kaķene; ziloņmāte; trusene; sieviete. Dienu skaits: 30; 58; 100; 280; 630; 200. 12. Kādā veidā attīstās minētie dzīvnieki ? 1) tiešā attīstība; 2) attīstība ar metamorfozi a) zvirbulis; b) varde; c) čūska; d) zilonis; e) tritons; f) asaris; g) upesvēzis; h) astoņkājis; i) šimpanze 13. Kādā veidā attīstās minētie kukaiņi ? 1) Attīstība ar pilnīgu metamorfozi; 2) attīstība ar nepilnīgu metamorfozi; a) maijvabole; b) spāre; c) muša; d) bite; e) blusa; f) taurenis; g) sienāzis; h) uts. 14. Kādā veidā bez ginekoloģiskās apskates ir iespējams noteikt grūtniecības iestāšanos ? Iz-
skaidrojiet šī testa bioloģisko pamatu! 15. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem gametoģenēze, spermatoģenēze, ooģe-
nēze, organoģenēze, embrijs, auglis, metamorfoze! 6.1. OLBALTUMVIELU SINTĒZE Ģenētiskā informācija un DNS struktūra DNS struktūras noskaidrošana pavēra ceļu iedzimtības molekulāro pamatu pētījumiem. Ra-
dās jauna bioloģijas nozare - molekulārā bioloģija. Bakterologs F. Grifits 1928. gadā pirmais izteica domu, ka ģenētiskā informācija ir ietverta DNS molekulās. Tomēr tikai daudzu turpmāko gadu pē-
tījumi pierādīja, ka tieši DNS ir ģenētiskās infor-
mācijas materiāls. 1953. gadā amerikāņu bioķīmiķis Džeimss Vot-
sons un angļu biofiziķis Frānsiss Kriks noskaid-
roja DNS dubultspirāles uzbūvi. Par šo atklājumu 1962. gadā viņi saņēma Nobela prēmiju. Saskaņā ar abu zinātnieku izstrādāto modeli DNS mole-
kula sastāv no divām spirālē savītām nukleotīdu virknēm (molekulām). DNS dubultspirāle atgā-
dina savītas kāpnes, kuru malas veido ogļhidrāti -
dezoksiribozes un fosforskābju atlikumi, bet pakā-
pienus veido slāpekļa bāzes (sk. 6.1. att.). Katrs šāds pakāpiens sastāv no divām bāzēm. Pretī vie-
nas virknes slāpekļa bāzei adenīnam vienmēr at-
rodas otras virknes bāze timīns (pretī timīnam -
adenīns) un pretī slāpekļa bāzei guanīnam - cito-
zīns (pretī citozīnam - guanīns). Sādu atbilstību sauc par komplementaritātes principu. Slā-
pekļa bāzes saīsināti apzīmē ar lielajiem burtiem (A, T, G, C). Slāpekļa bāzes ir savienotas ar ūdeņ-
raža saitēm. Starp adenīnu un timīnu ir divas ūdeņraža saites, bet starp guanīnu un citozīnu ir trīs ūdeņraža saites. To, ka abas nukleotīdu virk-
nes ir savītas spirālē, Dž. Votsons un F. Kriks pie-
rādīja ar rentgenstruktūras analīzi. DNS replikācija Eikariotu šūnās DNS replikācija jeb dubul-
tošanās notiek interfāzes laikā. Replikācijas re-
zultātā izveidojas divas jaunas DNS virknes, un katra no tām ir komplementāra vienai no vecajām virknēm. Vispirms DNS dubultspirāle replikācijas gaitā attinas, un katra virkne ir matrica jaunas DNS molekulas sintēzei. Tādējādi vienlaikus vei-
dojas divas virknes, kas ir identiskas sākotnējai DNS spirālei (sk. 6.2. att.). DNS sintēzi katalizē ferments DNS polimerāze, un tā notiek Mg2+ jonu klātbūtnē. Sintēzes gaitā pretī katram DNS virknes nukleotīdam piesaistās tam komplementārais nukleotīds (A-T, G-C). Pēc sintēzes procesa jaunā virkne atkal savijas dubult-
spirālē. Ģenētiskais kods / Ģenētisko informāciju jeb ģenētisko kodu nosaka nukleotīdu secība DNS molekulās. Lai šī ģenētiskā informācija izpaustos organisma pazī-
mēs, tā ir "jāpārtulko olbaltumvielu valodā". Lai gan katrā šūnā ir pilns ģenētiskās informācijas materiāls, tomēr dažādām organisma šūnām ir at-
šķirīga uzbūve un funkcijas. Sūnās daļa gēnu aktīvi funkcionē, bet citi ir neaktīvi. Gēnu darbību regulē īpaši regulatorgēni, kā arī to ietekmē ap-
kārtējā vide. DNS un RNS molekulas sastāv no četrām slā-
pekļa bāzēm, bet olbaltumvielās ir 20 dažādas aminoskābes. Trīs secīgas bāzes kodē aminoskābi, tāpēc ir iespējamas 64 dažādas bāzu kombinācijas (43 = 64). Tripletu, kas kodē vienu aminoskābi, sauc par kodonu. 1965. gadā bija ^atšifrēts viss ģenētiskais kods. Ir konstatēts, ka 61 tripets kodē aminoskābju secību olbaltumvielu molekulās, bet trīs matricas RNS tripeti (UAA, UAG, UGA) pārtrauc olbaltum-
vielu biosintēzi. Vienu un to pašu aminoskābi var kodēt vairāki tripleti (sk. 6.1. tabulu). Ģenētiskais kods ir universāls. Tas ir vienāds visiem organis-
miem. Transkripcija DNS ar tajā ieslēgto ģenētisko informāciju at-
rodas šūnas kodolā, bet olbaltumvielu biosintēze norit ribosomās. Informācijas pārraide par sinte-
zējamo olbaltumvielu struktūru no DNS uz ribo-
somām notiek ar RNS palīdzību. Pastāv trīs da-
žāda tipa RNS: matricas jeb informācijas ribo-
nukleīnskābe (mRNS), transporta ribonukleīn-
skābe (tRNS) un ribosomālā ribonukleīnskābe (rRNS). Katrai no šīm nukleīnskābēm ir noteikta loma olbaltumvielu biosintēzē. RNS, tāpat kā DNS, sastāv no nukleotīdiem, taču tām ir būtiskas atšķirības: • RNS sastāvā ietilpst ogļhidrāts - riboze, bet DNS sastāvā - ogļhidrāts - dezoksiriboze. • Lai gan trīs slāpekļa bāzes abos nukleīnskābju veidos ir vienādas (A, G, C), ceturtā atšķiras. DNS sastāvā ietilpst timīns (T), bet RNS sastāvā - ura-
cils (U). • RNS sastāv no vienas nukleotīdu virknes, bet DNS - no divām. Matricas RNS ģenētiskais kods DNS ģenētiskā informācija no kodola uz cito-
plazmu tiek pārnesta ar matricas RNS (mRNS) palīdzību. Transporta RNS (tRNS) piegādā ami-
noskābes uz olbaltumvielu sintēzes vietu. Ribo-
somālā RNS (rRNS) ietilpst ribosomu sastāvā (sk. 25. lpp.). Procesu, kurā informācija tiek pārrakstīta no DNS uz RNS, sauc par transkripciju (pārraks-
tīšanu). Transkripcijas laikā daļa DNS dubultspirāles atvijas un no kodolā esošajiem nukleotīdiem ar fermenta RNS polimerāzes palīdzību šūnā sinte-
zējas mRNS. Sintēzes procesā ir spēkā komple-
mentaritātes princips, tikai pretim adenīnam (A) ir uracils (U), nevis timīns (T). Transkripcija ne-
notiek visas DNS molekulas garumā, bet tiek no-
kopēts tikai viens vai nedaudzi gēni. Pēc transkrip-
cijas RNS molekula atdalās no DNS (sk. 6.3. att.). Translācija Olbaltumvielas sintēzi pēc informācijas, kas ir ierakstīta mRNS nukleotīdu secības veidā, sauc par translāciju (pārtulkošanu). Informācija no nukleīnskābju valodas tiek pārtulkota olbaltum-
vielu valodā. Translācija notiek ribosomās. No kodola caur membrānas porām mRNS no-
kļūst citoplazmā un saistās ar ribosomām. Katra ribosoma sastāv no divām subvienībām - lielās un mazās (sk. 6.4. att.). Ribosomas veidotas no ribo-
somālās RNS un olbaltumvielu kompleksa. Trans-
porta RNS molekulas piesaista aminoskābes un nogādā tās ribosomās. Transporta RNS molekulas ir līdzīgas āboliņa lapai (sk. 6.5. att.). Tās ir nelie-
las un sastāv tikai no 70 līdz 80 nukleotīdiem. Brī-
vajam tRNS molekulas galam spēj pievienoties aminoskābe, bet otrā galā (āboliņa lapas galotnē) esošais triplets ir antikodons, kas pievienojas mRNS. Katrai aminoskābei ir sava tRNS. Olbaltumvielu sintēze sākas ar starta kodonu AUG (uz mRNS), tRNS piegādā nākamajam kodo-
nam atbilstošo aminoskābi. Līdzās novietotās ami-
noskābes ar fermenta palīdzību tiek savienotas savā starpā, bet tRNS molekula atbrīvojas no ribo-
somas. Ribosoma pārvietojas pa mRNS molekulu un saista nākamo tRNS piegādāto aminoskābi. Tā šis process turpinās, un pagarinās jaunsintezētā A. Ferments RNS polimeraze piesaistas noteiktam DNS rajonam. C. RNS polimeraze turpina katalizēt RNS sintēzi līdz gēna beigām. D. Gēnam beidzoties, RNS polimerāze atdalās no DNS. RNS molekula atšķeļas no DNS. DNS dubultspirāle satinas. peptīda virkne. Ribosomai nokļūstot līdz "stop" kodonam (UAA, UAG vai UGA) uz mRNS mole-
kulas, sintēze pārtraucas (sk. 6.6. att.). Tātad tRNS piegādā ribosomām aminoskābes, mRNS ko-
pē DNS informāciju, bet rRNS savirknē tās poli-
peptīdā. Pie vienas mRNS molekulas parasti vien-
laikus pievienojas vairākas ribosomas, tāpēc vienā un tajā pašā laikā notiek vairāku vienādu olbal-
tumvielu sintēze. Gēnu darbības regulācija Lai gan šūnas kodolā esošā DNS satur infor-
māciju par ļoti dažādu olbaltumvielu biosintēzi, katrā konkrētajā momentā šūna sintezē tikai tās olbaltumvielas, kas tai ir nepieciešamas. Ģenētis-
kās informācijas izmantošana šūnā ir sarežģīts process, kas ietver gan DNS replikāciju, transkrip-
ciju un translāciju, gan dažādu fermentu aktivi-
A. Ribosomas mazā subvienība pievienojas diviem mRNS kodoniem. Pirmais no tiem ir starta kodons AUG. B. Transporta RNS molekula kopā ar aminoskābi saistās ar mRNS molekulas starta kodonu. C. Starta tRNS molekulas-aminoskābes komplekss pievienojas pie lielās subvienības P piesaistīšanās vietas (sk. 6.4. att.). Ribosomas lielā subvienība saistās ar mazo subvienību. D. Nākamais mRNS molekulas kodons saistās ar nākamo tRNS molekulas - aminoskābes kompleksu. Tas pievienojas pie lielās subvienības A piesaistīšanās vietas (sk. 6.4. att.). E. Ribosomas lielajā subvienībā starp abām blakus nonākušajām aminoskābēm veidojas peptīdsaite. F. Starta tRNS molekula atdalās no ribosomas. Ribosoma pārvietojas vienu kodonu pa labi. Transporta RNS molekula ar jaunizveidotajām aminoskābēm (dipeptīdu) pārvietojas uz ribosomas lielās subvienības P piesaistes vietu. A piesaistes vieta paliek brīva. G. Nākamais tRNS molekulas aminoskābes komplekss pievienojas trešajam mRNS molekulas kodonam. Tas saistās ar ribosomas lielās subvienības A piesaistes vietu. H. Starp divām piesaistītajām aminoskābēm un trešo aminoskābi veidojas peptīdsaite. I. Olbaltumvielas sintēzes process turpinās līdz "stop" kodonam. Sintezētā aminoskābju virkne (peptīds) atdalās no ribosomas. Ribosomas subvienības atdalās viena no otras. tātes izmaiņu. Līdz ar to olbaltumvielu sintēzes regulācija var notikt jebkurā biosintēzes posmā. 1961. gadā Fransuā Žakobs un Žaks Mono veica pē-
tījumus par olbaltumvielu sintēzes regulāciju baktēri-
jām - zarnu nūjiņām (E. coli). Par šo darbu viņi saņēma Nobela prēmiju. Zinātnieki konstatēja, ka vieni gēni regulē citu gēnu aktivitāti. Šādu funkcionāli saistītu gēnu grupu sauc par operonu (sk. 6.7. att.). Ja zarnu nūjiņām nav jāpārstrādā laktoze, tad laktozes operons tiek izslēgts jeb represēts. Ar laktozes operona regu-
lējošā gēna palīdzību tiek veikta olbaltumvielas - re-
presora sintēze. Represors piesaistās operatoram, un RNS polimerāze nevar uzsākt transkripciju. Rezultātā laktoze netiek noārdīta. Ja zarnu nūjiņas nokļūst vidē, kurā ir laktoze, laktozes molekulas saistās ar represoru, izmainot tā struktūru. Šāds strukturāli izmainīts re-
presors nevar piesaistīties operonam, un var sākties laktozi noārdošo fermentu sintēze. Pēc transkripcijas sintezētā mRNS molekula pārvei-
dojas un tad atstāj kodolu. Sākumā tiek pārveidoti mRNS molekulas gali, bet pēc tam daļa no mRNS mo-
lekulas (introni) tiek izgriezta. Matricas RNS atlikusī daļa (ekstroni) kodē olbaltumvielu sintēzi. Iespējams, ka introni sadala nukleīnskābes rajonos, kas šūnās var dažādi kombinēties. Tādējādi var sinte-
zēties nedaudz atšķirīgas olbaltumvielas. Piemēram, vai-
rogdziedzera un hipofīzes šūnās no vienas primārās mRNS molekulas tiek sintezēti dažādi hormoni. Eikariotu šūnās olbaltumvielu sintēzes regulā-
cija ir sarežģītāka un mazāk izpētīta nekā proka-
riotiem. Eikariotiem dažādi gēni tiek regulēti atšķirīgi. Eikariotu šūnās ir četri gēnu aktivitātes kontroles līmeņi. 1. Transkripcijas līmenis Kodolā ir vairāki mehānismi, kas nosaka, kuri struktūrgēni un ar kādu ātrumu tiks pārrakstīti no DNS uz RNS. Piemēram, gēna aktivitāti var regulēt transkripcijas faktori - olbaltumvielas, kas piestiprinās pie noteiktiem gēniem un speci-
fiskā veidā izraisa transkripciju. 2. Pēctranskripcijas līmenis Sintezētās olbaltumvielas daudzumu ietekmē, piemēram, ātrums, ar kādu mRNS tiek transpor-
tēta no kodola citoplazmā. 3. Translācijas līmenis Translācija regulācija notiek citoplazmā pēc tam, kad mRNS ir atstājusi kodolu. Jo ilgāk aktīva mRNS atrodas citoplazmā, jo vairāk gēna pro-
dukta tiek sintezēts. Matricas RNS aktivitātes C. Laktoze saistās ar represoru. Laktozes represora komplekss nevar piesaistīties operatoram. RNS po-
limerāze piesaistās promoteram, un notiek to struktūras gēnu, kas atbild par laktozes metabolisma fermentu sin-
tēzi, transkripcija. Šīs reakcijas dēļ zarnu nūjiņa kā enerģijas avotu var izmantot laktozi. B. Laktozes trūkuma gadījumā represors saistās ar operonu un aizņem arī promotera vietu. RNS polimerāze nevar piesaistīties promoteram, un līdz ar to nevar notikt struktūras gēnu transkripcija. A. Gēns regulators atbild par olbaltumvielas represora sintēzi, kas noteiktos apstākļos var piesaistīties ope-
ratoram. stabilitāti var veicināt hormoni. Piemēram, hor-
mons prolaktīns ietekmē translācijas ilgumu un veicina piena sekrēciju piena dziedzeros. 4. Pēctranslācijas līmenis Pēctranslācijas kontrole notiek pēc olbaltum-
vielu sintēzes citoplazmā. Sintezētā olbaltumviela var būt bioloģiski neaktīva. To var aktivizēt no-
teiktas vielas, piemēram, specifiski fermenti. Svarīga loma ģenētiskās darbības regulācijā ir arī hormoniem (sk. 6.8. att.). Hormons piesaistās specifiskām olbaltumvielām - receptoriem, kas at-
rodas šūnu membrānās. Receptori nogādā hor-
monu uz šūnas kodolu, kur hormons stimulē gēna vai gēnu grupas aktivitāti. Visām šūnām nav šādu receptoru. Hormonu darbība ir specifiska, piemē-
ram, dzimumhormoni spēj ietekmēt dzimum-
šūnās. 1. Steroīdais hormons caur šūnas membrānu nokļūst citoplazmā un piesaistās receptoram. 2. Hormona receptora komplekss nokļūst šūnas kodolā un piesaistās DNS molekulai. 3. RNS polimerāze veic albumīna gēna transkripciju. 4. mRNS molekula nokļūst citoplazmā, kur notiek albumīna molekulas sintēze. 1. Kuri zinātnieki ir izstrādājuši DNS dubultspirāles modeli ? 2. Kādā veidā notiek DNS molekulas replikācija ? 3. Kas ir ģenētiskais kods ? 4. Kādi ir ribonukleīnskābju veidi ? Kādas ir to funkcijas ? 5. Kas ir translācija ? 6. Kas uzsāk translācijas procesu ? Kādā veidā tiek pārtraukta translācija ? 7. Kā sauc funkcionāli saistītu gēnu grupu prokariotu šūnās ? 8. Kāda mRNS veidosies uz dotā DNS fragmenta ? CRNS polimērāg) -^TACAAGCTAAAACGTTGCTTA ATC ACGCCTGGC AAGTCAC TGCGGACCG TTCAGTG ATGTTCGAT TT TGCAACGAATTAG 9. Kāda būs aminoskābju secība peptīdā, kas sintezēsies uz 8. uzd. izveidotās mRNS bāzes ? 10. Kāda mRNS nepieciešama, lai sintezētos šādspeptīda fragments? Met - Thr - Arg - Gly - Ser - Pro - Arg - Leu 11. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem replikācija, transkripcija, translācija, triplets, kodons, antikodons! 6.2. ĢENĒTIKA Ģenētika ir bioloģijas nozare, kas pēta orga-
nismu iedzimtību un mainību. Šīs zinātnes nosau-
kums atvasināts no latīņu vārda gēnus - "cilts". Iedzimtība un mainība ir visu dzīvības formu pa-
matīpašība. Ģenētikas teorētiskais uzdevums ir pētīt • gēnu pārmaiņas mehānismu, • gēnu darbību un tās regulāciju, • kā arī iedzimtības, mainības un izlases mij-
iedarbību organismu evolūcijas procesā. Nozīmīgākās ģenētikas pētīšanas metodes: • hibridoloģiskā metode - tās pamatā ir tādu indivīdu krustošana, kas atšķiras pēc kādas pa-
zīmes, un viņu pēcnācēju novērošana vairākās pa-
audzēs. Viens no hibridoloģiskās metodes pavei-
diem ir ģenealoģiskā metode (ciltskoku sastādīša-
nas metode), kuru lieto pazīmju pētīšanai vienā dzimtā vairākās paaudzēs; • citoģenētiskā metode - šūnas ģenētisko sis-
tēmu pētīšanas metode (apvienojot hibridoloģisko un citoloģisko izpēti); • ontoģenētiskā metode - ar to noskaidro at-
sevišķu gēnu darbību organisma dzīves laikā. Šim nolūkam izmanto fizikālos, bioķīmiskos, fiziolo-
ģiskos un molekulāros izpētes paņēmienus. Ģenētikas pirmsākumi Iedzimtība ir organismu spēja nodot savas pa-
zīmes un attīstības īpatnības pēcnācējiem. Līdzās iedzimtībai pastāv arī mainība - organismiem piemītošā spēja atšķirties no citiem savas sugas pārstāvjiem. Jau senatnē cilvēki bija novērojuši, ka organismiem piemīt gan iedzimtība, gan mai-
nība. Atlasot krustošanai labākos īpatņus, viņi izaudzēja pirmos kultūraugus un mājdzīvniekus. Tomēr zinātniskus pamatus selekcija ieguva tikai 20. gs. sākumā. Jau Senajā Grieķijā tika izteikti daži minējumi par iedzimtības cēloņiem. Hipokrats (5. gs. p.m.ē.) uzskatīja, ka dīglis attīstās, sajaucoties vīrieša un sievietes sēklai. Viņš domāja, ka bērniem piemīt ve-
cāku īpašības tādēļ, ka sēklā ir sakopoti vecāku ķer-
meņa daļu vissīkākie elementi. Šie uzskati lika pa-
matus performisma teorijai (dīglis ir izveidojies neliels organisms, kam nepieciešams tikai augt). Apmēram pēc simts gadiem Aristotelis pārvei-
doja Hipokrata teoriju, norādot, ka nākamajām paaudzēm tiek nodoti nevis gatavi ķermeņa daļu elementi, bet shēma, pēc kuras veidojas dīglis. Aris-
totelis radīja pirmsākumus epiģenēzes teorijai (embrionālā attīstība ir process, kurā dīglim pakā-
peniski veidojas jaunas īpašības). Līdz 18. gs. dominēja performisma teorija, bet šajā laikā attīstījās uzskati, ka dīglim jaunas īpa-
šības veidojas pakāpeniski. 18. gs. un 19. gs. pirmajā pusē pamazām uzkrā-
jās zināšanas par dažādu pazīmju nodošanu pēc-
nācējiem no vecākiem. Jaunu pieeju iedzimtības pētīšanā izstrādāja čehu dabaszinātnieks Gregors Mendelis. Viņš pētīja atsevišķu pazīmju iedzim-
šanu un tās analīzei izmantoja matemātiskās me-
todes. 1865. gadā G. Mendelis publicēja darbu "Pē-
tījumi par augu hibrīdiem", kas sākumā netika pienācīgi novērtēts. Tikai 1900. gadā trīs zināt-
nieki Hugo de Frīzs (Holandē), Karls Korenss (Vācijā) un Ēriks Čermaks (Austrijā) vienlaikus otrreiz aprakstīja atklātos iedzimtības likumus. Tas bija jaunas zinātnes nozares - ģenētikas ra-
šanās sākums. Ģenētikas attīstības periodi aplūkoti 6.2. tabulā. Ģenētikas attīstības periodi Periods, laiks Svarīgākie notikumi 1. periods (1900-1910) • Noskaidro, ka G. Mendeļa likumi ir universāli. • Mācība par iedzimtību pilnīgi izveidojās par patstāvīgu bioloģijas nozari. Angļu zinātnieks V Betsons to ieteica nosaukt par ģenētiku. • V Johansens (Dānija) ieviesa terminus gēns, genotips, fenotips. • Citologi V Setsons, E. Vilsons (ASV) un T. Boveri (Vācija) izvirzīja hipotēzi, ka iedzimtības faktors atrodas hromosomās. • 1901. gadā radās H. de Frīža mācība par mutācijām. Periods, laiks Svarīgākie notikumi • Parādījās pirmie ziņojumi par pazīmju saistīto iedzimšanu (V Betsons, R. Pennets) un par pazīmēm, kas iedzimst saistībā ar dzimumu (D. Don-
kesters). 2. periods (1911-1925) • ASV zinātnieki T. Morgans, A. Stertevants, K. Bridžess un H. Mellers pie-
rādīja, ka gēni hromosomās ir izvietoti lineārā secībā. • A. Stertevants sastādīja pirmo hromosomas ģenētisko karti augļmušai. • Sākās pētījumi par kvantitatīvo pazīmju iedzimšanu, heterozi, kultūraugu salīdzinošo ģenētiku. • N. Vavilova vadībā tika nodibināta Vissavienības Augkopības institūta ģenē-
tikas nodaļa, kā arī Centrālā dzīvnieku ģenētikas izmēģinājumu stacija. 3. periods (1925-1940) Veica plašus pētījumus par mutaģenēzi. Radās evolucionārās ģenētikas pirmsākumi. 4. periods (1940-1953) • Turpināja attīstīties populāciju ģenētikas pētījumi (ASV ģenētika T. Dob-
žanska darbi). • Selekcijā sāk izmantot heterozes efektu, poliploīdiju, inducētās gēnu mu-
tācijas. • Ģenētiķi pēta mikroorganismu un vīrusu iedzimtību un mainību. • Ģenētiskos pētījumus sāk veikt molekulārā līmenī. 5. periods (1954-mūsdienas) • Atklāj fermentus, kas ļauj attīstīties gēnu inženierijai. • Sāk pētīt šūnās ievadīto svešo gēnu darbības izpausmi. • Iegūst cilvēka gēnu, kas atbildīgs par interferona sintēzi. • Noskaidro, ka plazmīdās ir piemēroti vektori svešu gēnu pārnešanai. • Klonē dzīvniekus. • Pētī iespējas pārstādīt pacientam klonētus audus. Monohibrīdiskā krustošana Gregors Mendelis savus eksperimentus veica ar sējas zirņiem (Pisum sativum). Viņš izvēlējās zir-
ņus, kuri atšķīrās ar vienu vai vairākiem pazīmju pāriem. Tādas, piemēram, bija šķirnes ar dzelte-
nām vai zaļām, gludām vai grumbuļainām sēklām, ar baltiem vai purpurkrāsas ziediem, ar garvasu vai īsvaru. Pirms krustošanas G. Mendelis divu gadu laikā pārliecinājās, ka šīs pazīmes stabili iedzimst, un atlasīja tīras šķirnes ar alternatīvām pazīmēm. Zirņi ir pašapputes augs. To ziedā at-
rodas gan putekšņlapas ar putekšņiem, gan augle-
nīca. Apaugļošanās notiek, putekšņiem nokļūstot uz tā paša zieda drīksnas. Eksperimentos G. Men-
delis veica svešapputi. Pirms apputeksnēšanas viņš ziedu atvēra, izknieba putekšņlapas, lai ne-
notiktu pašappute, un uz drīksnas uznesa putek-
šņus no krustošanai izvēlētā auga. Viņš saskaitīja, cik hibrīdu bija ar katru pētāmo pazīmi, un veica rezultātu matemātisko apstrādi. Krustošana, kurā analizē vienas pazīmes iedzim-
šanu, sauc par monohibrīdisko krustošanu. G. Mendelis izaudzēja zirņus no gludām sēklām un to drīksnas apputeksnēja ar putekšņiem, kas bija ņemti no zirņiem ar grumbuļainām sēklām. Viņš izaudzēja arī zirņus no grumbuļainām sēk-
lām un to drīksnas apputeksnēja ar putekšņiem, kas bija ņemti no zirņiem ar gludām sēklām. Abos gadījumos visi pirmās paaudzes zirņi bija ar gludām sēklām. G. Mendelis šo parādību nosauca par pirmās paaudzes vienveidības likumu. Katru pazīmi zirņiem nosaka divas alēles (vie-
na gēna alternatīvas formas). Šajā gadījumā tās nosaka sēklu formu. Shematiskajā pierakstā alēles apzīmē ar burtiem. Pazīmi, kura spēj nomākt otru pazīmi (šajā gadījumā - gludas sēklas), sauc par dominanto pazīmi un apzīmē ar lielo burtu (A). Pazīmi, kura neparādās, jo tiek nomākta (šajā ga-
dījumā - grumbuļainas sēklas), sauc par recesīvo pazīmi un apzīmē ar tādu pašu mazo burtu (a). Krustošanas gaitu pieņemts attēlot shematiski (sk. 6.9. att.). Piemēram, garvasas augu attiecība pret īsvasas augiem bija 3,01:1. Pavisam G. Mendelis izpētīja septiņus pazīmju pārus un konstatēja, ka biežāk sastopamās pazīmes attiecība pret retāk sastopa-
mo ir 2,98:1, tātad ļoti tuva attiecībai 3:1. Otrās paaudzes dominantās pazīmes attiecību pret re-
cesīvo pazīmi kā 3:1 G. Mendelis nosauca par ot-
rās paaudzes hibrīdu skaldīšanās likumu. Turpinot pētījumus, G. Mendelis noskaidroja, ka recesīvās pazīmes īpatņi tālāk vairs neskaldās ne trešajā, ne turpmākajās paaudzēs. Izskaidrojot eksperimenta rezultātus, G. Men-
delis pieņēma, ka iedzimst nevis pašas pazīmes, bet iedzimtības faktori jeb alēles. Dāņu zinātnieks V Johansens 1909. gadā šos iedzimtības faktorus, no kuriem atkarīga noteiktu pazīmju attīstība, nosauca par gēniem. Katrs hibrīds saņem divus iedzimtības faktorus: vienu - no tēva, otru - no mātes. Ja viens no šiem faktoriem ir dominants, tad izpaužas tikai dominantā faktora ietekme. Dzimumšūnās nokļūst tikai viens iedzimtības faktors. Apaugļošanās notiek pēc nejaušības prin-
cipa, savienojoties vīrišķajai dzimumšūnai ar sie-
višķo dzimumšūnu. Vienas pazīmes izpausmi kon-
trolē abas homologo hromosomu gēnu alēles. Tās var būt vienādas vai dažādas. Angļu ģenētiķis R. Pennets dažādas gametu kombinācijas ieteica attēlot tabulā, ko nosauca par Penneta režģi. Vienā virzienā tabulā ieraksta mā-
tes gametas, bet otrā - tēva gametas (sk. 6.10. att.). Nākamajā gadā G. Mendelis iestādīja izaudzētos gludos zirņus un ļāva to ziediem pašapputek-
snēties. No 7324 iegūtajām otrās paaudzes zirņu sēklām 5474 bija gludas, bet 1850 - grumbuļainas. Attiecība starp gludajām un grumbuļainajām sēk-
lām bija 2,96:1 jeb aptuveni 3:1. Līdzīga attiecība tika iegūta arī, analizējot pārējos pazīmju pārus. Organismu, kuram kādā hromosomu pārī abas gēna alēles ir vienādas, sauc par homozigotisku organismu jeb homozigotu. Organismu, kuram kādā hromosomu pārī abas gēna alēles ir dažādas, sauc par heterozigotisku organismu jeb hete-
rozigotu. Alēles atrodas homoloģisko hromosomu pāros noteiktā vietā. Šo alēļu atrašanās vietu sauc par lokusu. Aplūkotajā monohibrīdiskās krustošanās gadī-
jumā vecāki atšķiras pēc viena pazīmju pāra. Pir-
majā hibrīdu paaudzē visi indivīdi ir heterozigo-
tiski, bet otrajā paaudzē puse ir homozigotiski (AA un aa) un puse - heterozigotiski (Aa). Par genotipu sauc organisma gēnu kopumu. Visu organismu ārējo un iekšējo pazīmju, funkciju un īpašību kopumu sauc par fenotipu. 1. Kā izpaužas pirmās paaudzes hibrīdu vienveidības likums ? 2. Kā izpaužas otrās hibrīdu paaudzes skaldīšanās likums ? 3. Kad ir spēkā gēnu neatkarīgās kombinēšanās likums ? 4. Ar ko homozigotiski organismi atšķiras no heterozigotiskiem organismiem ? 5. Cilvēkiem lūpu formu nosaka viena gēna alēles. Dominantā alēle (A) nosaka biezu lūpu veidošanos, bet recesīvā alēle (a) - plānu lūpu veidošanos. Uzrakstiet genotipus 1) homozigotiskam dominantam īpatnim; 2) homozigotiskam recesīvam īpatnim; 3) heterozigotiskam īpatnim; 4) cilvēkam ar plānām lūpām; 5) cilvēkam ar biezām lūpām (homozigotisks genotips); 6) cilvēkam ar biezām lūpām (heterozigotisks genotips)! 6. 5. uzd. ir raksturotas lūpu formas iedzimšanas likumsakarības. Kāda lūpu forma iespējama bērniem, ja 1) tēvam ir homozigotisks dominants genotips, bet mātei - homozigotisks recesīvs genotips; 2) abi vecāki ir heterozigotiski? 7. Kāds ir eiropiešu rasei raksturīgais fenotips un genotips attiecībā uz lūpu formu (sk. 5. uzd. noteikumus)? Vai var piedzimt bērns ar biezām lūpām, ja abiem vecākiem ir plānas lūpas ? 8. Zirgiem gēna dominantā alēle M nosaka melnu apmatojuma krāsu, bet tā recesīvā alēle m -
brūnu apmatojuma krāsu. Kāda var būt kumeļu apmatojuma krāsa, ja 1) krusto melnu homozigotisku ērzeli ar brūnu ķēvi; 2) krusto melnu heterozigotisku ērzeli ar brūnu ķēvi ? 9. Izveidojiet savu ārējo pazīmju sarakstu! Kopā ar skolotāju, nosakiet šo pazīmju iedzimšanas raksturu (dominanta vai recesīvā pazīme)! 10. Papildiniet skaidrojošo vārdnīcu ar jēdzieniem genotips, fenotips, alēle, dominants, re-
cesīvs, homozigotisks, heterozigotisks! Analizējošā krustošana Ja ir nepieciešams noskaidrot, vai īpatnis ar do-
minanto pazīmi ir homozigotisks vai heterozi-
gotisks, veic tā krustošanu ar recesīvu īpatni. To sauc par analizējošo krustošanu. Eksperimenti ar zirņiem pierādīja, ka vienādiem fenotipiem var būt dažādi genotipi. Piemēram, gludu sēklu zirņi var būt homozigotiski vai arī he-
terozigotiski pēc šīs pazīmes. Krustojot pārbau-
dāmo īpatni ar recesīvās vecākformas īpatni -
grumbuļainu sēklu zirni, var noskaidrot, vai ana-
lizējamais gludu sēklu zirnis ir homozigotisks (AA) vai heterozigotisks (Aa). Tātad, ja analizējamais īpatnis ir homozigotisks pēc dominantās pazīmes (sk. 6.11. A att.), tad visi pirmās paaudzes īpatņi ir ar dominanto pazīmi, bet, ja tas ir heterozigotisks (sk. 6.11. B att.), tad puse pēcnācēju ir ar dominanto pazīmi un puse -
ar recesīvo pazīmi. 1. Ko var noteikt ar analizējošo krustošanu ? 2. Cilvēkiem ir dominantais gēns (N), kurš nosaka parastu ausu ļipiņu veidošanos, tā recesīvā alēle (n) nosaka ausu ļipiņu pieaugšanu. Kādas var būt ausu ļipiņas bērniem, ja 1) mātei ir pieaugušas ausu ļipiņas, tēvam - parastas (homozigotisks genotips); 2) mātei ir parastas ausu ļipiņas (heterozigotisks genotips), tēvam - pieaugušas? 3. Cilvēkiem ir iespējamas dažādas matu līnijas pieres daļā: dominantais gēns (H) nosaka matu ķīļa veidošanos pieres daļā, bet tā recesīvā alēle (h) - vienlaidu matu līnijas veidošanos. Kāda ir varbūtība, ka bērniem būs matu ķīlis, ja 1) tēvam ir matu ķīlis (homozigotisks genotips), bet mātei - vienlaidu matu līnija; 2) tēvam ir matu ķīlis (heterozigotisks genotips), bet mātei - vienlaidu matu līnija; 3) abi vecāki ir heterozigotiski pēc šīs pazīmes ? Krustošanas rezultātu atspoguļošana Risinot ģenētikas uzdevumus, bieži nepiecie-
šams norādīt iespējamo pēcnācēju pazīmju varbū-
tību. Piemēram, ja abi vecāki ir homozigotiski, tad ir 100 % varbūtība, ka pirmās paaudzes (Fx) pēcnācēji būs vienveidīgi (sk. 6.9. att. un 6.11. A att.). Ja pēcnācēji nav genotipiski vienveidīgi un notiek skaldīšanās, varbūtības ir iespējams atspo-
guļot dažādi: 1) varbūtību norādot procentuāli, piemēram, 6.11. B att. aplūkotajā gadījumā, notiek skaldīša-
nās 1:1. Tātad šajā gadījumā ir 50 % varbūtība, ka zirņi būs gludi un 50 %, ka zirņi būs grumbuļaini; 2) varbūtību norādot kā daļskaitli. Ja skaldīt šanās ir 1:1, tad varbūtība gludām sēklām ir 1/2 un grumbuļainām sēklām - 1/2. 6.9. att. atspoguļots krustošanas gadījums, kur otrajā pēcnācēju paaudzē (F2) notiek skaldīšanās 3 (gludas sēklas):1 (grumbuļainas sēklas). Šajā gadījumā var teikt, ka gludu sēklu varbūtība ir 75 %, bet grumbuļainu - 25 %; vai arī ka gludu sēklu varbūtība ir 3/4, bet grumbuļainu - 1/4. Nepilnīgā dominēšana G. Mendelis veica eksperimentus ar zirņiem, kuri atšķīrās ar skaidri izteiktām alternatīvām pa-
zīmēm - viena bija dominantā, bet otra - recesīvā. Taču dabā ir pazīmes, kuru gēniem raksturīga ne-
pilnīga dominēšana. Šajā gadījumā heterozigo-
tiskie īpatņi atšķiras no homozigotiskajiem īpat-
ņiem. Nepilnīgā dominēšana novērojama, piemē-
ram, sakrustojot sarkanziedu lauvmutīti ar balt-
ziedu lauvmutīti (sk. 6.12. att.). Visi pirmās paaudzes īpatņi ir ar rozā ziediem. Otrajā paaudzē tie iegūst attiecību 1:2:1 (1 lauvmutīte ar sarka-
niem ziediem : 2 lauvmutītes ar rozā ziediem : 1 lauvmutīte ar baltiem ziediem). Dabā nepilnīgā dominēšana ir samērā bieži sa-
stopama parādība. Piemēram, krustojot zemenes, kam ir sarkani augļi, ar zemenēm, kam ir balti augļi, iegūst zemenes ar sārtiem augļiem. Krus-
tojot melnus gaiļus ar baltām vistām, iegūst cāļus ar zilganpelēkām spalvām. 1. Kā izpaužas nepilnīgā dominēšana ? 2. Kādos veidos var atspoguļot pazīmju iedzimšanas varbūtību ? 3. Redīsu saknes gareno formu nosaka dominantā homozigota (GG), recesīvā homozigota (gg) nosaka apaļu saknes formu, heterozigota (Gg) nosaka ovālu saknes formu. Kāda būs pēcnā-
cēju skaldīšanās, ja sakrustos heterozigotiskus īpatņus ? 4. Kādas tropu orhidejas ziedu plankumainību nosaka nepilnīgi dominējošs gēns (A). Sakrustojot orhidejas ar daļēji plankumainiem ziediem (Aa) un izsējot iegūtās sēklas, izauga 852 augi. Aprēķiniet, kādam skaitam jaunās paaudzes augu būs izteikti plankumaini ziedi (AA), cik augu būs ar daļēji plankumainiem ziediem (Aa), cik augiem būs ziedi bez plankumiem (aa)! 5. Zirgiem gēna dominantā alēle (R) nosaka, ka tas ir rikšotājs, bet recesīvā alēle (r), - soļotājs. Kāda ir varbūtība, ka kumeļš būs soļotājs, ja sakrustoja ērzeli - rikšotāju ar ķēvi - soļotāju ? Uzrakstiet visus iespējamos variantus! Kodominēšana Dabā ir novērojama tāda iedzimtības forma kā kodominēšana, kad vienas pazīmes veidoša-
nā vienlaikus dominē un izpaužas vairāki gēni. Visraksturīgākais piemērs šai iedzimtības formai ir asinsgrupu veidošanās. Cilvēku asinsgrupa ir atkarīga no A un B tipa antigēnu klātbūtnes erit-
rocītos. Antigēnu sintēzi nosaka attiecīgi gēni: A asinsgrupu - gēns A, B asinsgrupu - gēns B. Cilvēkam ar AB asinsgrupu vienlaicīgi darbojas abi gēni - A un B, izraisot abu veidu antigēnu veidošanos eritrocītos. Cilvēkiem ar 0 asinsgrupu eritrocīti ir "tukši", jo viņu genotipā nav neviena dominējošā gēna. Asinsgrupu iedzimšanas likumsakarības parā-
dītas 6.3. tabulā. Asinsgrupu iedzimšanas likumsakarības 6.3. tabula 1. Ar ko kodominēšana atšķiras no pilnīgās dominēšanas un nepilnīgās dominēšanas ? 2. Kādu pazīmju iedzimšana saistīta ar kodominēšanu? 3. Noskaidrojiet savu vecāku asinsgrupu! Izrēķiniet, kāda varētu būt jūsu asinsgrupa! 4. Mātei ir B asinsgrupa. Kādai jābūt tēva asinsgrupai, ja viņu bērniem ir 0, A un AB asins-
grupa ? 5. Mātei ir 0 asinsgrupa, tēvam - AB, bet viņu bērniem - Aun B grupa. "Gudrā" kaimiņtante cenšas iestāstīt tēvam, ka tie nav viņa bērni, bet viņš tam nepiekrīt. Kuram taisnība? Atbildi pamatojiet ar risinājumu! 6. Jāatrisina strīdīgs paternitātes jautājums: Annai ir A asinsgrupa, viņas dēliņam Kārlītim -
B. Kurš ir bērna tēvs - Pēteris, kuram ir AB asinsgrupa, vai Uldis, kuram ir A grupas asinis ? Dihibrīdiskā krustošana Krustošanu, kura analizē divu alternatīvo pa-
zīmju pāru iedzimšanu, sauc par dihibrīdisko krustošanu. Pēc tam kad bija izanalizētas iedzim-
tības likumsakarības zirņiem, kas atšķīrās ar vie-
nu pazīmi, G. Mendelis krustoja tādas zirņu šķir-
nes, kuras atšķīrās ar divām pazīmēm. G. Mendelis krustoja zirņus, kuriem bija glu-
das, dzeltenas sēklas (dominantās pazīmes), ar zirņiem, kuriem bija grumbuļainas, zaļas sēklas (recesīvās pazīmes; sk. 6.13. A att.). Visi pirmās paaudzes indivīdi bija līdzīgi - ar gludām, dzel-
tenām sēklām. Tātad dominēšana katrā alternatī-
vajā pazīmju pārī notika līdzīgi kā monohibrīdis-
kās krustošanas gadījumā. Otrajā paaudzē tika novērotas 4 dažādas pazīmju kombinācijas: 9/16 zirņu bija ar gludām, dzeltenām sēklām (abas do-
minantās pazīmes), 3/16 bija ar grumbuļainām, dzeltenām sēklām, 3/16 - ar gludām, zaļām sēklām (viena dominantā un viena recesīvā pazīme), bet 1/16 bija ar grumbuļainām, zaļām sēklām (abas recesīvās pazīmes). Tātad skaldīšanās notika attie-
cībās 9:3:3:1 (sk. 6.13. B att.). Aplūkojot katru pazīmju pāri atsevišķi, re-
dzams, ka 3/4 zirņu bija ar gludām sēklām un 1/4 -
ar grumbuļainām sēklām; 3/4 zirņu bija ar dzel-
tenām sēklām un 1/4 - ar zaļām sēklām. Tātad dominantās pazīmes attiecība pret recesīvo pazīmi bija 3:1 abiem pazīmju pāriem. Šie rezultāti ļāva G. Mendelim formulēt pazīmju neatkarīgās iedzimšanas likumu. Dažādas pazīmes pāriet pēcnācējos neatkarīgi cita no citas tad, ja gēni at-
rodas dažādos homologo hromosomu pāros. Ja gēni A - alēle nosaka melna apmatojuma veidošanos a - alēle nosaka brūna apmatojuma veidošanos B - alēle nosaka īsa apmatojuma veidošanos b - alēle nosaka gara apmatojuma veidošanos atrodas vienā homologo hromosomu pārī, tad pazī-
mes iedzimst saistītā veidā. Dihibrīdiskajā krustošanā ir iespējami 9 dažādi genotipu veidi: AABB; AABb; AaBB; AaBb; Aabb; aaBb; aaBB; AAbb; aabb. Dihibrīdiskajā krustošanā, tāpat kā monohib-
rīdiskajā, var veikt analizējošo krustošanu, lai no-
teiktu, kāds genotips ir indivīdam, kuram izpau-
žas abas dominantās pazīmes. Piemēram, trušiem dominējošās pazīmes ir melns un īss apmatojums, bet recesīvās pazīmes attiecīgi ir brūns un garš apmatojums. Ja pēc fenotipa trusim ir melns un īss apmatojums, tā genotipa iespējamās variācijas ir AaBb, AABB, AABb, AaBB. Daudzkārt, piemē-
ram, selekcionējot šķirnes, ir svarīgi noteikt in-
divīda genotipu. To var izdarīt ar analizējošo krus-
tošanu - sapārojot šādu trusi ar tādu, kurš pēc abām pazīmēm ir homozigotisks recesīvs, ar brūnu garvilnas trusi (sk. 6.14. att.). Ja indivīda genotips ir heterozigotisks pēc abām pazīmēm, pēcnācējos novērojama skaldīšanās: 1/4 pēcnācēju ir melni īsvilnas; 1/4 - melni garvilnas; 1/4 - brūni īsvilnas; 1/4 - brūni garvilnas. Ja analizējamam indivīdam genotips ir homo-
zigotisks (AABB), pēcnācējos skaldīšanās neno-
tiek - visi ir vienveidīgi, melni īsvilnas. Tādā veidā ar analizējošās krustošanas palīdzību, zinot pa-
zīmju iedzimšanas likumsakarības, var izskaitļot arī citus genotipu variantus. Krustošanos, kurā vecāku organismi atšķiras ar daudzām alternatīvajām pazīmēm, sauc par po-
lihibrīdisko krustošanos. Arī polihibrīdiskajā krustošanā katrs pazīmju pāris iedzimst neatka-
rīgi no citiem, ja gēni, kuri nosaka pazīmes, atro-
das dažādos homologo hromosomu pāros. Polihibrīdiskās krustošanās gadījumā, kad ana-
lizē n pazīmes, fenotipu skaitu otrajā paaudzē var aprēķināt kā 2n, bet genotipu skaitu - kā 3n. Dihib-
rīdiskās krustošanas shēmā redzams, ka otrajā pa-
audzē ir 4 fenotipi (22 = 4) un 9 genotipi (32 = 9). Trihibrīdiskajā krustošanā var veidoties 23 = 8 fe-
notipi un 33 = 27 genotipi. 1. Kāda skaldīšanās vērojama pēcnācējos, ja sakrusto divus pēc abām pazīmēm heterozigotiskus īpatņus ? 2. Kādas ir iespējamās genotipu variācijas dihibrīdiskajā krustošanā ? Uzrakstiet iespējamos genotipus un tiem atbilstošās gametu variācijas! 3. Flokšiem baltu ziedu krāsu nosaka dominantais gēns W, iedzeltenu - tā recesīvā alēle w. Plakanu ziedu formu nosaka dominants gēns S, piltuvveida - tā recesīvā alēle s. Uzrakstiet visus iespējamos genotipus flokšiem ar 1) baltiem plakaniem ziediem; 2) baltiem piltuvveida ziediem; 3) iedzelteniem plakaniem ziediem; 4) iedzelteniem piltuvveida ziediem! 4. Tomātiem sarkana augļu krāsa (A) dominē pār dzeltenu (a), bet garš stumbrs (B) dominē pār zemu (b). Kādi būs pēcnācēji, ja krustos vecāku formas ar šādiem genotipiem: 1) AAbb x aaBB; 2) AABb x Aabb; 3) AaBb x aabb ? 5. Cilvēkiem matu krāsu un struktūru nosaka divi neatkarīgi gēnu pāri. Dominantais gēns T nosaka tumšu matu krāsu, bet tā recesīvā alēle t - gaišus matus; dominantais gēns S nosaka sprogainu matu veidošanos, bet recesīvā alēle s - taisnus matus. Kādi mati būs bērniem, ja 1) mātei ir gaiši, taisni mati, tēvam - tumši, sprogaini (homozigotisks pēc abiem pazīmju pāriem); 2) mātei ir gaiši, sprogaini mati, tēvam - tumši, taisni (abiem vecākiem viens no pazīmju pāriem ir heterozigotisks)? 6. Kāda ir varbūtība, ka vecākiem ar tumšiem, sprogainiem matiem piedzims bērns ar gaišiem, taisniem matiem, ja abi vecāki ir heterozigotiski pēc abām pazīmēm ? Vai ir iespējams, ka vecākiem ar gaišiem, taisniem matiem piedzimst bērns ar tumšiem, sprogainiem matiem ? Gēnu mijiedarbība Pēcnācēju skaldīšanās ne vienmēr notiek pēc aplūkotajiem G. Mendeļa likumiem. Ir pazīmes, kuru iedzimšanu nosaka vairāki gēnu pāri. Rei-
zēm gēni, kas neatrodas vienā alēlē, savā star-
pā mijiedarbojas un ietekmē cits cita izpausmi. Rezultātā rodas jauni fenotipi, kas ir atkarīgi no vairākiem gēnu pāriem. Raksturīgākie ne-
alēlisko gēnu mijiedarbības veidi ir polimērija, epistāze, komplementaritāte, modificēšana un plejotropija. Polimērija Polimērija ir daudzu gēnu iedarbība uz vienu kvantitatīvu pazīmi. Tādas pazīmes, kas atkarīgas no vairāku gēnu ietekmes, ir, piemēram, cilvēka garums, ķermeņa uzbūve, ādas krāsa, augļu lie-
lums dažādiem augiem, vistu dējība un citas. Pētot ādas krāsas iedzimšanu, konstatēts, ka to nosaka vismaz divi gēnu pāri. Ja vīrietis ar melnu ādas krāsu (AABB) apprecas ar baltādainu sievieti (aabb), tad viņu pēcnācēji ir mulati. Tiem ir vidēji tumša ādas krāsa. Savukārt pēcnācējiem, kas ra-
dušies laulībā starp diviem mulatiem, ādas krāsa var variēt plašās robežās - no melnas līdz baltai (AABB; AABb; AaBB; AaBb; aaBB; aaBb; Aabb; AAbb; aabb). Ādas tumšuma intensitāte ir atka-
rīga no dominanto gēnu kopskaita genotipā. Cilvēka garums ir atkarīgs no vēl lielāka gēnu pāru skaita (sk. 6.15. att.). Šo gēnu darbību ievē-
rojami ietekmē vides apstākļi un uzturs. Tāpēc cil-
vēku augums variē samērā plašās robežās. Lauksaimniecības dzīvnieku un kultūraugu īpašības, piemēram, govju pienīgums, kultūraugu ražība, vistu dējība, lielākoties ir atkarīgas no vairākiem gēniem. Tāpēc polimērijas pētījumiem ir svarīga saimnieciskā nozīme. 1. Cilvēku auguma garumu nosaka četri polimēri gēnu pāri (sk. 6.15. att.). Auguma garums ir atkarīgs no dominanto gēnu kopskaita visā genotipā. Maksimālais dominanto gēnu skaits genotipā (A^^^A^^AJ nosaka gara auguma veidošanos, bet to trūkums (a]a1a2a2a3a3 a4a4) - neliela auguma veidošanos. Izveidojiet auguma garuma gradācijas rindu, katrai auguma pakāpei norādot iespējamās genotipa variācijas, variējot dominanto gēnu izkārtojumu pa gēnu pāriem un to kopskaitu! 2. Cilvēku ādas krāsas tumšuma pakāpi nosaka divu gēnu pāru dominanto alēļu kopskaits. Melna ādas krāsa veidojas, ja visas alēles ir dominantas (AABB), balta - ,ja visas alēles ir recesīvas (aabb). Kāda ir varbūtība, ka mulatiem ar šādiem genotipiem piedzims bērns ar pilnīgi melnu vai pilnīgi baltu ādas krāsu: 1) AaBb X AaBb; 2) aaBB x AAbb; 3) AaBB x AABb? Epistaze Epistāze ir gēnu mijiedarbības veids, kad viens gēns nomāc cita nealēliska gēna fenotipisko iz-
pausmi. Izšķir divus epistāzes veidus - dominanto un recesīvo. Dominantās epistāzes gadījumā viena gēnu pāra dominantā alēle nomāc otra gēnu pāra izpausmi neatkarīgi no tā, vai šis nomācošais gēnu pāris ir homozigotiskā vai heterozigotiskā stā-
voklī. Piemēram, ķirbjiem augļu krāsu nosaka divu gēnu pāru (B un D) mijiedarbība. Gēna D dominantā alēle nosaka dzeltenas krāsas veido-
šanos, bet recesīvā homozigota dd - zaļas krāsas veidošanos. Otra gēna dominantā alēle B nomāc jebkuras krāsas pigmenta rašanos augļos, kā re-
zultātā tie ir balti, šī gēna recesīvajai homozigotai bb nav iedarbības uz krāsas veidošanos. Tāpēc, krustojot divus baltus, pēc abiem gēnu pāriem he-
terozigotiskus ķirbjus, iegūst dažādas krāsas pēc-
nācējus. 12/16 augu ir ar baltiem ķirbjiem (visi augi, kas ir saņēmuši dominanto gēnu B, ir ar baltiem aug-
ļiem). 3/16 ir augi ar dzelteniem ķirbjiem (D bez B epistātiskās iedarbības - nosaka dzelteno krāsu), bet 1/16 - ar zaļiem ķirbjiem (d - homozigotiskā stāvoklī bez B epistātiskās iedarbības nosaka zaļo krāsu). Recesīvās epistāzes gadījumā nomācošais gēns kavē otra gēnu pāra izpausmi tikai recesīvā ho-
mozigotiskā stāvoklī. Piemēram, puķzirnīšiem ir divi gēni, kuru dominantās alēles nosaka purpur-
sarkanu ziedu veidošanos (sk. 6.17. A att.). Ja kāds no šiem gēniem ir homozigotiskā recesīvā stāvoklī, tas nomāc otra gēnu pāra darbību un pig-
ments ziedos neveidojas - tie ir balti. Krustojot divas neradniecīgas, balti ziedošas puķzirnīšu šķirnes, pirmajā paaudzē visiem augiem būs pur-
pursarkani ziedi, bet otrajā paaudzē 9/16 būs pur-
pursarkani, bet 7/16 - balti ziedi (sk. 6.17. B att.). Līdzīgs cēlonis ir zīdītāju apmatojuma pigmen-
tācijas traucējumiem. Ja indivīdam pigmentu noteicošais gēns ir recesīvās homozigotas stāvoklī, tas rada pigmenta melanīna sintēzes traucējumus un dzīvnieks ir albīns - tam neveidojas matu un acs varavīksnenes pigmentācija. 6.17. A att. Recesīvā epistaze. Ziedu krasas iedzimšana puķzirnīšiem (pirmajā paaudzē) 1. Kādi ir iespējamie epistāzes veidi ? 2. Puķzirnīšu ziedu pigmentu veidošanos nosaka divi gēni (A un B), abu dominanto gēnu klātbūtne nosaka purpursarkanu ziedu krāsu. Ja kāds no gēniem ir homozigotiskā recesīvā stāvoklī (aa vai bb), tas nomāc otra gēnu pāra darbību un pigments ziedos neveidojas - tie ir balti. Uzrakstiet iespējamos genotipus 1) pukzirnīšiem ar baltiem ziediem; 2) pukzirnīšiem ar purpursarkaniem ziediem! 3. 2. uzd. aprakstītas puķzirnīšu ziedu krāsas iedzimšanas likumsakarības. Kāda ir varbūtība, ka, sakrustojot heterozigotisku purpursarkanu pukzirnīti ar baltu recesīvi homozigotisku (aabb) pukzirnīti, pēcnācējiem būs balti ziedi ? 4. Vistām gēns C nosaka pigmentētu (krāsainu) apspalvojumu, bet tā recesīvās alēles homo-
zigota cc pigmentu neveido - vistas ir baltas. Gēnam C ir epistātisks gēns I, kurš nomāc jebkādu pigmentu veidošanos spalvās - arī šajā gadījumā vistas ir baltas. Tā recesīvās alēles homozigota ii ļauj attīstīties spalvu pigmentācijai. Uzrakstiet visus iespējamos genotipus 1) vistām ar krāsainām spalvām; 2) baltām vistām! 5. Vai, vadoties pēc vistu apspalvojuma krāsas iedzimšanas likumsakarībām (4. uzd.), ir iespē-
jams, ka, krustojot baltu vistu ar baltu gaili, pēcnācējiem būs krāsainas spalvas ? Kādiem jābūt vecāku genotipiem, lai šāda varbūtība pastāvētu ? Komplementaritāte Komplementaritāte ir divu vai vairāku gēnu mijiedarbība, kuras rezultātā organismam attīstās tāda jauna pazīme, kas nav raksturīga nevienam no gēniem. Piemēram, suņiem apmatojuma rudo krāsu no-
saka viena gēna dominantā alēle, otra gēna domi-
nantā alēle - brūnu krāsu, bet abas dominantās alēles mijiedarbojoties kopā izraisa melnas krāsas rašanos. Abu gēnu recesīvo alēļu homozigotu mij-
iedarbība nosaka dzeltenas pigmentācijas veido-
šanos. 1. Suņiem apmatojuma krāsu nosaka divi komplementāri gēni: gēna B dominantā alēle nosaka rudas krāsas veidošanos, gēna E dominantā alēle nosaka brūnas krāsas veidošanos; abas dominantās alēles mijiedarbojoties izraisa melnas apmatojuma krāsas rašanos. Abu gēnu recesīvo alēļu bb un ee homozigotu mijiedarbība nosaka dzeltenas pigmentācijas veidošanos. Kādā krāsā būs kucēnu apmatojums, ja sapāros 1) dzeltenu kucīti ar brūnu homozigotisku suni; 2) melnu heterozigotisku kucīti ar rudu homozigotisku suni ? 2. Vistām sekstes formu nosaka divu komplementāru gēnu pāri: dominantais gēns A nosaka rožveida seksti, dominantais gēns B nosaka zvīņveida sekstes veidošanos; abiem dominan-
tajiem gēniem mijiedarbojoties, vistām veidojas riekstveida sekste; abu recesīvo alēļu homo-
zigotu (aa bb) mijiedarbība nosaka lapveida sekstes veidošanos. Kādas sekstes būs pēcnā-
cējiem, ja sapāros 1) vistu ar lapveida seksti un homozigotisku gaili ar zvīņveida seksti; 2) pēc abiem gēnu pāriem heterozigotisku vistu un homozigotisku gaili ar rožveida seksti ? 3. Vadoties pēc vistu sekstes formas iedzimšanas likumsakarībām (2. uzd.), nosakiet, kāda ir varbūtība, ka pēcnācējiem būs riekstveida sekste, ja sapāros 1) homozigotisku vistu ar rožveida seksti un homozigotisku gaili ar zvīņveida seksti; 2) vistu ar riekstveida seksti (abi gēnu pāri heterozigotiski) un gaili ar lapveida seksti! Modificēšana Modificēšana ir tādu gēnu darbība, kuri pa-
zīmes attīstību tieši neietekmē, bet pārveido citu gēnu darbības izpausmi. Daudziem zīdītājiem, pie-
mēram, pelēm un trušiem, apmatojuma veidoša-
nos nosaka gēnu pāris. Viena pāra dominantais gēns nosaka melnā pigmenta melanīna veidošanos matā, bet otra pāra dominantais gēns nosaka šī pigmenta nevienmērīgu sadalījumu matā, kā re-
zultātā dzīvnieks izskatās sirms. Tādējādi otrais gēns modificē jeb maina pirmā gēna radīto efektu. Līdzīgu parādību var novērot arī augiem, pie-
mēram, pupām, veidojoties augļu krāsai. Modificējošie gēni var noteikt arī kādas pazīmes stiprāku vai vājāku izpausmi. Piemēram, melnrai-
bām govīm plankumainību nosaka plankumainī-
bas gēns. Modificētājgēni maina plankumu lielu-
mu govīm. Dominanti modificētājgēni plankumus palielina, bet recesīvi gēni homozigotiskā stāvoklī -
tos samazina. Melnraibās govis var saņemt modi-
ficētājgēnus arī no vienkrāsainām govīm, kurām šo gēnu darbība neparādās, jo viņām nav planku-
mainības gēna. 1. Pelēm apmatojuma krāsu nosaka divu gēnu (M un S) mijiedarbība: gēns M nosaka melnu apmatojumu, gēns S sadala gēna M radīto pigmentu tā, ka mats izskatās pelēks. Recesīvā homozigota mm pigmentu neveido, bet otra gēna recesīvajai homozigotai ss nav nekādas iedarbības uz pigmenta sadalījumu. Kādi būs pēcnācēju fenotipi un genotipi, ja 1) vecāku genotipi ir MmSS un mmSs; 2) veic analizējošo krustošanu pēc abām pazīmēm heterozigotiskam īpatnim; 3) sakrusto pēc abām pazīmēm heterozigotiskas peles ? 2. Lauku pupām sēklu krāsa var būt balta, sarkanīga vai dzeltena. Sarkanā pigmenta vei-
došanos nosaka gēna A dominantā alēle, tā recesīvā homozigota aa izraisa baltu sēklu ra-
šanos, jo pigmentu neveido. Gēna B dominantā alēle sarkano pigmentu pārvērš dzeltenā, bet tā recesīvā homozigota bb neietekmē pigmentu veidošanos. Kādi ir vecāku genotipi, ja 1) no ievāktajām pirmās paaudzes sēklām 9/16 ir dzeltenas; 3/16 - sarkanas; 4/16 - baltas; 2) krustojot augu, kas izaudzēts no sarkanas sēklas, ar augu, kas izaudzēts no baltas sēklas, visi pirmās paaudzes pēcnācēji ir vienveidīgi - dzelteni; 3) veicot analizējošo krustošanu, 25 % pirmās paaudzes sēklu bija sarkanas; 50 % - baltas; 25 % - dzeltenas ? Plejotropija Plejotropija ir viena gēna izpausme, kas ietek-
mē vairākas organisma pazīmes. Šīs parādības pa-
matā ir īpatnība, ka gēna radītais produkts var iesaistīties dažādos bioķīmiskos ciklos vai arī tikt nogādāts vairākos orgānos. Plejotropija var radīt dažādas organismam ne-
vēlamas parādības, piemēram, slimības. Tās rodas kādas bioķīmiski aktīvas vielas nefunkcionēšanas vai nepareizas funkcionēšanas rezultātā un ietek-
mē vairākas organisma pazīmes. Ja cilvēkiem ne-
sintezējas olbaltumviela fibrilīns, viņiem attīstās Marfāna sindroms, kuram raksturīgs garš augums, gari pirksti un ekstremitātes, tuvredzība un patoloģiski plāna aortas siena, kas var būt nāves cēlonis. Plejotropija reizēm izsauc organisma bojāeju. Piemēram, gēna alēle, kas nosaka īsas kājas vistām, vienlaikus nosaka arī īsu knābi. Heterozigotiskas īskājainas vistas ir noderīgas mazdārziņos, jo neiz-
kašņā stādus. Homozigotisku vistu pēc šīs alēles vispār nav, jo cāļiem ir tik īss knābis, ka tie nespēj pāršķelt olas čaumalu un aiziet bojā neizšķīlušies. Nosacīti letāli gēni izraisa organisma bojāeju tikai noteiktos apstākļos (piemēram, noteiktā tem-
peratūrā). Subletāli gēni samazina organisma dzī-
votspēju, bet ne vienmēr izraisa tā bojāeju. Šādi gēni var radīt pundur augumu dažādiem augiem vai kādus citus organisma defektus. 1. Kas ir gēnu plejotropija? Kādas nelabvēlīgas izpausmes formas atsevišķos gadījumos rakstu-
rīgas šim iedzimtības veidam ? 2. Vistām ir gēns C, kura dominantā alēle vienlaikus nosaka īsas kājas un īsu knābi. Taču šis gēns homozigotiskā stāvoklī ir letāls (cāli iet bojā neizškīlušies). Šī gēna recesīvā alēle nosaka normāla garuma knābja un kāju veidošanos. Kādi būs pēcnācēji, ja sapāros 1) vistu ar īsām kājām un gaili ar normāla garuma kājām; 2) heterozigotisku vistu ar heterozigotisku gaili ? 3. Vadoties pēc 2. uzd. noteikumiem, nosakiet, kāda skaldīšanās būs vērojama pēcnācējos, ja heterozigotiska vista pēc vairākkārtējas pārošanās ar heterozigotisku gaili izdēja un izperēja 16 olas! 4. Karakulaitām sirms (pelēks) apmatojums (P) dominē pār melnu (p). Dominanti homozigo-
tiski īpatņi iet bojā jau embrionālās attīstības laikā. Kādi pēcnācēji iespējami, ja sapāros 1) melnu aitu ar sirmu aunu; 2) sirmu aitu ar sirmu aunu ? 5. Lapsām platīna krāsa (P) dominē pār sudraboto (p). Dominanti homozigotiski īpatņi nav dzīvotspējīgi un iet bojā jau embrionālās attīstības laikā. Pārojot platīnkrāsas lapsu māti ar platīnkrāsas lapsu tēvu, gada laikā piedzima 30 lapsēni. Kādi ir varbūtējie lapsēnu genotipi un fenotipi ? Gēnu un vides mijiedarbība Organisma fenotipu veido gan genotips, gan ārē-
jās vides apstākļi. Mainības formu, kas nav saistīta ar genotipa maiņu, sauc par modificējošo mai-
nību. Vides apstākļi dažas pazīmes ietekmē ļoti stipri, bet citas - tikai nedaudz. Tie ievērojami ietekmē daudzas lauksaimniecības dzīvnieku un kultūraugu pazīmes. Piemēram, govju izslaukums lielā mērā ir atkarīgs no to barošanas un kopša-
nas, bet kultūraugu raža - no augsnes un mēs-
lojuma. Dzīvnieku apmatojuma krāsu daudz ma-
zāk ietekmē apkārtējā vide. Atsevišķos gadījumos to var ietekmēt temperatūra. Piemēram, Himalaju trušiem melnu apmatojumu nosaka genotips. Ferments, kas piedalās melnā pigmenta sintēzē, ir aktīvs līdz 34 °C. Tāpēc dzīvniekiem melnas ir tikai ausis un ķepu gali, jo šajās ķermeņa daļās temperatūra ir zemāka par 34 °C. Noteiktas robežas, kurās mainās kāda pazīme, sauc par tās reakcijas normu. Dažām pazīmēm reakcijas norma ir plaša, bet citām - šaura. Tā, piemēram, govju izslaukumam ir ievērojami pla-
šāka reakcijas norma nekā tauku saturam pienā. Reakcijas normas galējās robežas nosaka genotips. 1. Kādi ir nealēlisko gēnu mijiedarbības veidi ? Raksturojiet tos! 2. Kas ir reakcijas norma ? Dzimuma iedzimšana dzīvniekiem Vairumam organismu dzimums tiek ģenētiski noteikts. Dzīvniekiem un arī cilvēkam sievišķais un vī-
rišķais dzimums atšķiras pēc viena hromosomu pāra. Šīs hromosomas, pēc kurām atšķiras dzi-
mumi, sauc par dzimumhromosomām. Pārējās hromosomas, kas abiem dzimumiem ir vienādas, sauc par autosomām. Dzimumhromosomas apzīmē ar burtiem X un Y. Cilvēkam ir 22 pāri autosomu un viens pāris dzimumhromosomu. Sievietei abas dzimumhro-
mosomas ir vienādas - X un X, bet vīrietim tās ir atšķirīgas - X un Y. Y hromosoma pēc izmēriem ir mazāka par X hromosomu. Lielākajai daļai zīdī-
tāju tēviņi pēc dzimumhromosomām ir heterozi-
gotiski, bet mātītes - homozigotiskas. Citādi tas ir putniem, kam heterozigotiskas ir mātītes, bet homozigotiski - tēviņi. Ir arī dzīvnieki (zirnekļi, nematodes, daudzas kukaiņu sugas), kuru mātī-
tēm ir divas dzimumhromosomas (XX), bet tēvi-
ņiem ir tikai viena dzimumhromosoma (X). Lielā-
kajai daļai dzīvnieku dzimums tiek noteikts apaugļošanās brīdī, saplūstot gametu kodoliem. Vīrieša organismā attīstītas divu tipu dzimumšū-
nas - puse no tām ir ar X hromosomu, bet otra puse - ar Y hromosomu. Sievietes organismā visās olšūnās ir viena X hromosoma. Ja olšūnu apaugļo spermatozoīds, kas satur X hromosomu, tad at-
tīstās sievišķais organisms, bet, ja to apaugļo sper-
matozoīds, kas satur Y hromosomu, tad attīstās vīrišķais organisms (sk. 6.18. att.). Teorētiski zēniem un meitenēm vajadzētu būt vienādā skaitā, tomēr ir konstatēts, ka zēnu dzimst nedaudz vairāk nekā meiteņu. Uz 100 meitenēm piedzimst apmēram 103-110 zēnu. Pusaudža ve-
cumā zēnu un meiteņu attiecība ir apmēram vie-
nāda, bet vecumā no 65 līdz 75 gadiem sieviešu ir par 20 % vairāk nekā vīriešu. Pastāv dažādi šo attiecību noviržu izskaidro-
jumi. Pēc vienas no hipotēzēm spermatozoīdi ar Y hromosomu ir vieglāki nekā spermatozoīdi ar X hromosomu, un tādēļ tie ātrāk sasniedz olšūnu. Ir konstatēts, ka lielāka varbūtība piedzimt meitenei rodas tad, ja spermatozoīdi sievietes dzimumceļos nokļūst pirms ovulācijas, bet, ja tas notiek ovulā-
cijas laikā, tad lielāka varbūtība ir piedzimt zēnam. Gēni, kas ietekmē dzimumpazīmes, atrodas ne tikai dzimumhromosomās, bet arī autosomās. No dzimuma atkarīgo pazīmju attīstībā liela nozīme ir dzimumhormoniem, kurus ražo ne tikai dzi-
mumdziedzeri, bet arī hipofīze. Tie var kavēt vai veicināt noteiktu gēnu aktivitāti. tikai viena X hromosoma, tāpēc, ja tajā atrodas gēns, kas nosaka daltonismu, šī pazīme izpaužas. Ja krāsu akluma gēns ir abās X hromosomās, tad arī sieviete var būt daltoniķe. Sievietēm šis defekts sastopams 10-20 reižu retāk nekā vīriešiem. Ja māte ir krāsu akluma gēna nēsātāja un tēvs nav daltoniķis, tad visas meitas ir veselas, taču puse no tām var būt krāsu akluma gēna nēsātājas. Pastāv 50 % varbūtība, ka dēli būs daltoniķi (sk. 6.19. att.). Ar dzimumu saistīto pazīmju iedzimšana Dzimumhromosomās satur gan tādus gēnus, kas nosaka dzimuma veidošanos, gan tādus, kas nosaka citu pazīmju attīstību. Sīs pazīmes iedzimst saistībā ar dzimumu. Salīdzinot X un Y hromosomas, var konstatēt, ka tajās ir rajoni, kas abām hromosomām ir homologi, bet ir arī tādi rajoni, kas raksturīgi tikai Y hromosomai vai tikai X hromosomai. Pazīmes, kas saistītas ar gēniem, kuri atrodas tikai Y hromosomā, var parādīties vienīgi vīrie-
šiem, bet pazīmes, kas saistītas ar gēniem, kuri atrodas tikai X hromosomās, var izpausties gan vīriešiem, gan sievietēm, tomēr vīriešiem tās sa-
stopamas biežāk. Gēnu, kas atrodas tikai X hro-
mosomā, ir daudz vairāk nekā gēnu, kas atrodas tikai Y hromosomā. Ar X hromosomu iedzimst gēni, kas nosaka daltonismu, hemofiliju, plikpau-
rainību, kā arī citas pazīmes. Daltonisms ir iedzimts krāsu aklums, kad cil-
vēks neatšķir zaļās un sarkanās krāsas toņus. Šis gēns ir recesīvs un atrodas X hromosomās. Sie-
vietēm, kas ir heterozigotiskas pēc šīs alēles, dal-
tonisms neizpaužas, jo otrajā X hromosomā esošā alēle nodrošina normālu krāsu uztveri. Vīrietim ir Ja māte ir vesela (nav krāsu akluma gēna), bet tēvs ir daltoniķis, tad visiem bērniem būs normāla redze, taču meitas būs krāsu akluma gēna nēsā-
tājas (sk. 6.20. att.). Ja māte ir vesela, bet viņai ir krāsu akluma gēns, un tēvs ir daltoniķis, tad pusei meitu būs normāla redze (krāsu akluma gēna nēsātājas), bet otra puse būs daltoniķes, un ari puse delu būs ar normālu redzi un otra puse - daltoniķi (sk. 6.21. att.). Līdzīgi iedzimst arī hemofilija jeb asins nesare-
cēšana. Hemofilijas slimniekiem neveidojas speci-
fiska olbaltumviela, kas nepieciešama asins sare-
cēšanai. Zināms, ka karaliene Viktorija bija hemo-
filijas gēna nēsātāja. No viņas meitām Alises un Beatrises, kas bija šīs slimības gēna nēsātājas, un dēla Leopolda, kas bija slims ar hemofiliju, šī sli-
mība nokļuva Krievijas, Prūsijas un Spānijas galmā. Ir arī slimības, kuras izraisa gēni, kas atrodas Y hromosomā. Tā, piemēram, 18. gs. Anglijā ap-
rakstīta slimība, kura izpaudās kā zvīņaina āda vīriešiem. So slimību no tēva mantoja dēli, bet mei-
tas vienmēr bija veselas. Dzimumhromosomu skaita pārmaiņas Reizēm cilvēkiem sastopamas dzimumhromo-
somu skaita novirzes, ko parasti izraisa mejozes traucējumi dzimumšūnu veidošanās laikā. Dzi-
mumhromosomu skaita vai arī struktūras pārmai-
ņas rada dzimuma attīstības traucējumus. Vīriešiem X hromosomu skaita palielināšanās izpau-
žas kā Klainfeltera sindroms. Šajā gadījumā dzimum-
hromosomu pārī ir viena vai vairākas liekas X hromo-
somas. Vīriešiem ar Klainfeltera sindromu ir neattīstīti sē-
klinieki, kas dzimuma nobriešanas laikā kavē fizisko attīstību. Rodas nepareizas ķermeņa proporcijas. Ir sa-
stopamas arī skeleta anomālijas, reizēm izveidojas palielināts apakšžoklis. Līdz dzimumgatavības sasnieg-
šanai Klainfeltera sindromu bieži vien nediagnosticē, jo nav pamanāmas atšķirības starp slimiem un veseliem zēniem. Reizēm līdz ar X hromosomu skaita palielinā-
šanos novērojama garīga atpalicība. Arī sievietēm dažreiz ir sastopams palielināts X hro-
mosomu skaits. Apmēram 1/3 daļa no viņām dzemdē normālus bērnus. Šādām sievietēm var būt neregulāras menstruācijas un agra menopauze. Dažkārt novērojama neliela garīgā atpalicība un biežāk sastopama šizofrē-
nija. Vienas X hromosomas trūkums sievietēm rada Še-
reševska-Ternera sindromu. Viņām novērojami augša-
nas un dzimumattīstības traucējumi. Šīs sievietes ir ne-
liela auguma, ar normāliem ārējiem, bet neattīstītiem iekšējiem dzimumorgāniem. Viņām nenotiek apaugļo-
šanās un nav iespējams iznēsāt bērnu. Intelektuālā atpalicība šīm sievietēm nav novērojama. Lieka Y hromosoma vīriešiem (XYY) rada Jakoba sindromu. Šie vīrieši ir liela auguma, un viņu āda ir klāta ar pūtītēm. Agrāk uzskatīja, ka viņi ir agresīvāki par citiem cilvēkiem, tomēr pētījumi to neapstiprina. Dzimumanomāliju iemesls var būt arī hromo-
somu struktūras pārmaiņas. Dažkārt, kaut arī hromosomu skaits ir normāls, vīrieša vai sievietes genotipam atbilst pretējā dzimuma fenotips vai arī izpaužas dažādas hermafrodītisma formas. īstais hermafrodītisms ir tāds interseksuāls stā-
voklis, kad indivīdam vienlaikus ir abi dzimum-
dziedzeri - kā olnīcas, tā sēklinieki. Fenotipiskā izpausme var būt dažāda - atkarībā no abu dzi-
mumdziedzeru kombinācijas un attīstības pakā-
pes. Neīstie vīrišķie hermafrodīti ir personas, kuru dzimumdziedzeri ir sēklinieki, bet ārējie dzimum-
orgāni lielākā vai mazākā mērā ir līdzīgi sieviš-
ķajiem dzimumorgāniem. Neīstā sieviešu herma-
frodītisma gadījumā dzimumdziedzeri ir olnīcas, bet dzimumorgānos raksturīgas novirzes no nor-
mas. Lai novērstu dzimuma attīstības traucējumus, svarīgi ir noteikt šo traucējumu cēloņus. Laikus nosakot diagnozi, dzimumu vēlamajā virzienā ir iespējams mainīt, izmantojot dzimumhormonu te-
rapiju. Autosomu skaita un struktūras pārmaiņas Autosomu skaita un struktūras pārmaiņas iz-
raisa smagas iedzimtas slimības (sk. 6.22. att.), C. Vīrieša kariotips, kuram ir iedzimta slimība (Dauna sindroms - trisomija pēc 21. hromosomas) kuru cēlonis var būt hromosomu skaita palielinā-
šanās vai samazināšanās, kā arī hromosomu struk-
tūras pārmaiņas. Hromosomu izmaiņas var izraisīt dažādi fak-
tori, piemēram, radiācija, ķīmiskas vielas, vīrusi. Autosomu skaita pārmaiņas var rasties tādēļ, ka neatvirzās hromosomas (tas ir, homoloģisko hro-
mosomu neatdalīšanās vienai no otras mejozē I vai arī meithromosomu neatdalīšanās mejozē II). Hro-
mosomu neatvirzīšanās gadījumā veidojas dzimum-
šūnās ar palielinātu vai samazinātu hromosomu skaitu. Šādai dzimumšūnai saplūstot ar dzimum-
šūnu, kam ir normāls hromosomu skaits, veidojas organisms, kam šūnās ir izmainīts hromosomu skaits. Ja hromosomu skaits šūnās ir par vienu mazāks nekā normā (2n - 1), tad to sauc par mo-
nosomiju; ja hromosomu skaits ir par vienu lie-
lāks nekā normā (2n + 1), tad to sauc par triso-
miju. Vairums organismu ar izmainītu hromosomu skaitu šūnās, sevišķi - monosomijas gadījumā, iet bojā jau augļa stadijā. Visizplatītākā autosomu tri-
somija ir Dauna slimība (Dauna sindroms). Dauna slimība ir sastopama vienam bērnam no 800 jaun-
dzimušajiem. Noskaidrots, ka Dauna slimības sa-
stopamības biežums jaundzimušajiem ir saistīts ar mātes vecumu: jo vecāka māte, jo lielāka varbū-
tība, ka bērns saslims ar Dauna slimību, bet tas nav atkarīgs no tēva vecuma. Dauna slimības iemesls ir 21. hromosomas trisomija (šūnās ir lieka 21. hromosoma). Mātēm, kurām pie-
dzimst bērns ar Dauna sindromu, grūtniecība parasti norit normāli. Bērniem Dauna sindromu ir iespējams atklāt pirms bērna dzimšanas. Dauna slimniekus ir viegli atšķirt no veseliem bērniem, jo viņiem ir sapla-
cināta seja, īss deguns un citas pazīmes. A.Veselas sievietes kariotips (44 autosomas un XX) B. Vesela vīrieša kariotips (44 autosomas un XY) Dauna slimniekiem ir raksturīgi dažādu orgānu sis-
tēmu darbības traucējumi (sirds slimības, endokrīno dziedzeru darbības traucējumi), kā arī garīga atpali-
cība, bet tās pakāpe var stipri variēt. Ar medicīniskiem un pedagoģiskiem pasākumiem var samazināt Dauna sindroma izpausmi un iesaistīt Dauna slimniekus sa-
biedriskajā dzīvē. Ievērojami retāk nekā Dauna sindroms ir sastopama hromosomu skaita pārmaiņu slimība - Edvarda sin-
droms (18. hromosomas trisomija) un Patau sindroms (13. hromosomas trisomija). Ar Edvarda un Patau sin-
dromu slimo bērnu vidējais dzīves ilgums ir mazāks par vienu gadu, jo viņiem ir dažādas progresējošas pato-
loģijas. Arī jebkuras citas pārmaiņas autosomās var radīt smagus attīstības traucējumus. Jo lielāki ir bojātie hromosomu rajoni, jo smagākas ir sekas. Daudzi slimnieki ar autosomu struktūras pārmai-
ņām nomirst jau pirmajos dzīves mēnešos. dzimumu. Daudzas pazīmes viskrasāk izpaužas tuvradnieciskās laulībās. Iegūtos datus atspoguļo ģenealoģiju jeb cilts-
koku veidā, kurus sastāda, lai izpētītu konkrētas pazīmes iedzimšanu kādā dzimtā. Ciltskokos lieto šādus apzīmējumus: Cilvēka ģenetika un tās pētīšanas metodes Cilvēka ģenētika pēta iedzimtību. Šī zinātnes nozare palīdz noskaidrot dažādu cilvēka pazīmju iedzimšanu un to regulāciju. Tā meklē iespējas, kā novērst iedzimtas slimības vai mazināt to sekas. Salīdzinājumā ar citiem organismiem cilvēka ģenētiskos pētījumus apgrūtina šādi apstākļi: 1) nav iespējams eksperimentāli veikt krustošanu; 2) cilvēkam ir daudz hromosomu, tāpēc ir grūti noteikt gēnu lokalizāciju hromosomās; 3) ģimenē ir neliels pēcnācēju skaits; 4) vēlu iestājas dzi-
mumbriedums; 5) pēcnācējiem nav iespējams radīt vienādus dzīves apstākļus. Cilvēka pētīšanai ir arī zināmas priekšrocības: 1) labāk izpētīta cilvēka anatomija, fizioloģija un bio-
ķīmija salīdzinājumā ar daudziem citiem organis-
miem; 2) daudz cilvēku tiek medicīniski izmeklēti, kas dod materiālu populāciju pētījumiem; 3) cil-
vēku skaits ir tik liels, ka var atrast laulības, kuru partneriem ir pētniekus interesējošās pazīmes. Svarīgākās cilvēka iedzimtības pētīšanas meto-
des: ģenealoģiskā, dvīņu, citoģenētiskā, populā-
ciju, bioķīmiskā, prenatālā diagnostika, kā arī gēnu inženierija. Ģenealoģiskā metode ir iedzimtas pazīmes izsekošana vienas dzimtas vairākās paaudzēs. Salīdzinot dažādus ciltskokus, var secināt, kuras pazīmes ir dominantas, recesīvās vai saistītas ar Lai ciltskoka analīzi varētu veikt pilnvērtīgi, nepieciešams izsekot pētāmās pazīmes iedzimša-
nai vismaz 3 paaudzēs. Ar ģenealoģisko metodi iespējams noteikt • pētāmās pazīmes iedzimšanas raksturu - do-
minanta vai recesīvā; • atbilstošā gēna lokalizācijas vietu - autosomā vai dzimumhromosomā; • varbūtējo pazīmes iedzimšanu nākamajās pa-
audzēs. Ģenealoģiskā metode tiek plaši izmantota, lai prognozētu iedzimto slimību varbūtējo parādī-
šanos pēcnācējiem. Ja pazīme ir dominanta autosomāla (to no-
saka gēna dominantā alēle, kas atrodas autosomā), ciltskokiem raksturīgas šādas pazīmes: 1) pazīme izpaužas katrā paaudzē; 2) pazīme izpaužas ne-
atkarīgi no dzimuma - gan vīriešiem, gan sievie-
tēm; 3) veseliem vecākiem nevar būt slims bērns; 4) slimiem vecākiem, ja viņi abi ir heterozigotiski, var būt vesels bērns. Šādā veidā iedzimst Hauting-
tona slimība un neirofibromatoze. Ja pazīme ir recesīvā autosomāla (to nosaka gēna recesīvā alēle, kas izpaužas tikai homozigo-
tiskā stāvoklī un atrodas autosomā), ciltskokiem raksturīgas šādas pazīmes: 1) pazīme neizpaužas katrā paaudzē, bet kādu izlaižot; 2) pazīme izpau-
žas neatkarīgi no dzimuma - gan vīriešiem, gan sievietēm; 3) slimiem vecākiem visi bērni ir slimi; 4) veseliem vecākiem, ja viņi ir heterozigotiski, var piedzimt slims bērns. Šādā veidā iedzimst tādas slimības kā fenilketonūrija, cistiskā fibroze, Teja-
Saksa slimība. Ja pazīmi noteicošais gēns atrodas kādā no dzi-
mumhromosomām, tad tā biežāk izpaužas viena dzimuma pārstāvjiem (sk. 103. lpp.). Ar dvīņu metodi salīdzina monozigotiskos dvīņus, jo tie ir ģenētiski pilnīgi identiski. Ja šie dvīņi aug dažādos apstākļos, ir iespējams novērtēt iedzimtības un ārējās vides nozīmi dažādu pazīmju attīstībā. Citoģenētiskā metode pēta cilvēka iedzim-
tības materiālu. Tā ļauj noteikt indivīda hromo-
somu skaitu, izmērus un struktūru, gēnu lokali-
zāciju hromosomās, hromosomu pārmaiņu nozīmi iedzimto slimību attīstībā, kā arī dažādu nelab-
vēlīgo faktoru ietekmi uz gēniem. Populāciju metode ļauj izpētīt atsevišķu gēnu mutāciju un hromosomu anomāliju izplatību cil-
vēku populācijās. Piemēram, noteiktā pētāmā gru-
pā cilvēkus sadala pēc to fenotipiskām klasēm. Pēc fenotipu biežuma aprēķina gēnu biežumu. Atse-
višķām tautām var būt palielināts dažādas slimī-
bas vai defektus izraisošo gēnu daudzums. Ar bioķīmiskajām metodēm pēta organisma vielmaiņas procesus veseliem un slimiem cilvē-
kiem. Šī metode ļauj atklāt kaitīgās mutācijas un konstatēt iedzimtās slimības vēl pirms klīnisko simptomu parādīšanās. Līdz ar to var laikus uz-
sākt ārstēšanu un novērst patoloģiju. Ar prenatālās diagnostikas metodēm atklāj dažādus iedzimtus defektus jau embrionālās attīs-
tības laikā. Lai noteiktu ģenētiskās patoloģijas, izmanto am-
niocentēzi. Ar šīs metodes palīdzību iegūst augļa šķidrumu un augļa šūnas. Augļa šūnas ievieto īpašā barojošā vidē, kur tās sāk dalīties. Pēc tam šūnas speciāli apstrādā, veido preparātus un mikroskopā pēta, vai nav hromosomu anomāliju. Viena no jaunākajām ir gēnu inženierijas me-
tode, ar kuras palīdzību var pārmainīt genotipu. Cerams, ka nākotnē šo metodi varēs izmantot cil-
vēka iedzimto slimību ārstēšanai. 1. Kas ir dzimumhromosomas? Kas ir autosomas ? 2. Kāpēc dažas pazīmes iedzimst saistībā ar dzimumu ? 3. Kas ir Klainfeltera sindroms ? 4. Kādas raksturīgākās novirzes no normas ir novērojamas Dauna slimības gadījumā ? 5. Kādas problēmas rodas cilvēka ģenētikas pētniekiem ? 6. Kādas ir nozīmīgākās cilvēka ģenētikas pētīšanas metodes ? 7. Kaķiem melnā un rudā krāsa iedzimst saistībā ar X hromosomu. Gēna M dominantā alēle nosaka melnas krāsas apmatojumu, tās recesīvā alēle m nosaka rudas krāsas veidošanos, heterozigota Mm nosaka raibu apmatojumu. Kāda ir varbūtība iegūt raibu apmatojumu kakenītēm un runcīšiem, ja sapāros 1) melnu kaķeni ar rudu runci; 2) rudu kaķeni ar melnu runci ? 8. Augļmušām drozofilām vīrišķo dzimumu (tāpat kā cilvēkiem) nosaka XY hromosomas, bet sievišķo - XX. Mušu acu krāsa iedzimst saistībā ar X hromosomu: dominantais gēns S nosaka sarkanas acis, bet tā recesīvā alēle s - baltas acis. 1) Sapārojot baltacainu mātīti ar sarkanacainu tēviņu, ieguva 568 pēcnācējus. Kāds būs procentuālais acu krāsas sadalījums, pieņemot, ka tēviņi un mātītes ir vienādā skaitā ? 2) Kā mainīsies šī attiecība, ja sapāros sarkanacainu heterozigotisku mātīti ar sarkan-
acainu tēviņu ? 9. Cilvēkiem saistībā ar X hromosomu iedzimst arī recesīvā mutācija - sviedru dziedzeru trūkums. Kāda ir varbūtība, ka dēliem un meitām iedzims šī mutācija, ja 1) mātei sviedru dziedzeri ir attīstīti normāli, bet tēvam sviedru dziedzeru nav; 2) tēvam un mātei sviedru dziedzeri ir attīstīti normāli, bet viņas tēvam bijusi šī mutācija ? 10. Vecāki vēlas prognozēt hemofilijas iedzimšanu bērniem, jo mātes dzimtā bijuši vairāki hemofilijas gadījumi: māte pati ir vesela, bet viņas brālim ir hemofilija, hemofilija ir arī viņas māsas dēlam, taču viņas tēvs un māte bija veseli. Uzzīmējiet šīs dzimtas ciltskoku un prognozējiet bērnu veselības stāvokli! 11. Apprecējušies vīrietis un sieviete, kuru dzimtās palaikam parādās hemofilija. Uzzīmējiet šo dzimtu ciltskokus, izsekojiet hemofilijas iedzimšanai un izdariet prognozes iespējamam bērnu veselības stāvoklim, ja zināms, ka 1) sieviete ir vesela, bet viņai ir slims brālis, viņu vecāki ir veseli, bet vecmāmiņai (mātes mātei) bijusi šī slimība; 2) vīrietis ir vesels, bet viņam ir slims brālis un slims vectētiņš (mātes tēvs), kaut gan vecāki ar hemofiliju neslimo! 12. Izvēlieties kādu no savai dzimtai raksturīgām, bet dzimtas robežās mainīgām pazīmēm, piemēram, cirtainus matus! Uzzīmējiet savas dzimtas ciltskoku un izsekojiet pazīmes pār-
mantošanai! 13. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem autosomas, dzimumhromosomas! Hromosomu rekombinācijas, krustmija un hromosomu kartes G. Mendeļa atklātā pazīmju neatkarīgās skal-
dīšanās likuma pamatā ir hromosomu rekombi-
nācijas - hromosomu pārgrupēšanās jaunos va-
riantos. Veidojoties gametām, mejozes laikā no katra homoloģisko hromosomu pāra dzimumšū-
nās ar vienādu varbūtību iekļūst viena vai otra hromosoma. Arī atvirzīšanās uz vienu vai otru meitšūnu katram hromosomu pārim notiek sav-
starpēji neatkarīgi. Dzimumšūnās ir haploidāls hromosomu skaits. Apaugļošanās procesā zigotā atkal atjaunojas diploidālais hromosomu skaits. Katrā homologo hromosomu pārī viena hromo-
soma ir no mātes, bet otra - no tēva organisma. Mejozes laikā var veidoties daudz dažāda veida gametu (2 , kur n ir hromosomu pāru skaits). Ir tik daudz neatkarīgo pazīmju pāru, cik dzimum-
šūnā ir hromosomu jeb kāds ir haploidālais hro-
mosomu skaits (cilvēkam tas ir 23). Tie gēni, kuri atrodas vienā hromosomā, parasti iedzimst saistīti. Izņēmums var notikt, ja mejozes laikā starp homologajām hromosomām krustmijas rezultātā notiek apmaiņa ar gēnu iecirkņiem. Hromosomu sakarību ar iedzimtību 1910. gadā pierādīja Tomass Morgans ar līdzstrādniekiem. Viņi konstatēja, ka gēni, kas atrodas vienā hro-
mosomā, iedzimst saistīti. Nelielas novirzes no šīs likumsakarības tika izskaidrotas ar saistīto gēnu apmaiņu starp homologajām hromosomām. Šo procesu T. Morgans nosauca par krustmiju jeb krosingoveru (sk. 6.25. att.). Krustmija notiek pirmās mejotiskās dalīšanās profāzē. Tā var notikt jebkurā hromosomas vietā. 1. Homologās hromosomas pirms mejozes ir dubultojušās. 2. Homologo hromosomu atšķirīgo pāru hromatīdas pārkrustojas. 3. Hromatīdas ir apmainījušas identiskos iecirkņus. 4. Katra meithromosoma (hromatīda) satur atšķirīgu gēnu kombināciju. morganoīdas, starp alēlēm, kas nosaka baltu acu krāsu un šķeltus spārnus, ir 3,5 morganoīdas, bet starp alēlēm, kas nosaka dzeltenu acu krāsu un šķeltus spārnus, ir 4,7 morganoīdas. Hromosomu karšu sastādīšana ir ilgstošs un sarežģīts process. Hromosomas kartēs attēlo kā taisnes, uz kurām ir atzīmētas gēnu atrašanās vietas. Blakus gēna atrašanās vietai ir norādīts, kādu pazīmi šis gēns nosaka, kā arī attālums no viena hromosomas gala (ko pieņem par 0 punktu) līdz gēnam. Hromosomu kartes ir sastādītas cilvēkam, drozofilai, pelei un vairākiem kultūr-
augiem (sk. 6.26. att.). Gēni hromosomā ir izvietoti lineāri. Katram gē-
nam ir noteikta atrašanās vieta (lokuss). Jo lielāks ir attālums starp gēniem, jo lielāka varbūtība, ka krustmijas laikā tie nonāks citā hromosomā. Krustmijas biežumu raksturo to īpatņu skaita, kuriem notikusi krustmija, attiecība pret visu īpatņu skaitu šajā paaudzē pēc krustošanās. Izpētot krustmiju biežumu, var noteikt gēnu izvietojumu hromosomās un sastādīt hromosomu kartes. Eksperimentāli noskaidro, cik procentiem pēcnācēju ir notikusi rekombinācija. Starp krust-
mijas biežumu un rekombinēto fenotipu dau-
dzumu ir tieša sakarība. Piemēram, drozofilai gēns d nosaka dzeltenu ķermeņa krāsu, b - baltu acu krāsu un š - šķeltus spārnus. Šo gēnu savstarpējās pārkrustošanās bie-
žums ir: d - b (1,2 %); b - š (3,5 %); bet d - š (4,7 %). No tā var secināt, ka gēnu savstarpējais izvieto-
jums ir šāds: A. Zarnu nūjiņas gredzenveida hromosomas ģenetiska karte B. Drozofilas X hromosomas ģenētiska karte Attālums starp alēlēm, kas nosaka dzeltenu ķermeņa un baltu acu krāsu, ir 1,2 vienības jeb 1988. gadā tika uzsākts cilvēka genoma projekts, kura mērķis ir noskaidrot visu nukleotīdu secību cilvēka DNS. Darbu veic vairāk nekā 20 zinātnis-
kajos centros visā pasaulē. To koordinē Cilvēka genoma organizācija (HUGO). 2000. gada jūnijā zinātnieki pabeidza darbu pie cilvēka genoma (gēnu kopuma) atšifrēšanas. Tika konstatēts, ka cilvēka DNS sastāv apmēram no 3 miljardiem nukleotīdu. Zinātnieki uzskata, ka cilvēkam ir 60-140 tūkstoši gēnu. 99,8-99,9 % no gēniem visiem cilvēkiem ir vienādi, bet 0,1-0,2 % -
atšķirīgi. Šie 0,1-0,2 % gēnu rada atšķirības cil-
vēku izskatā, acu krāsā, uzvedībā, uzņēmībā pret slimībām utt. Lielākā daļa no cilvēka DNS sastāva ir identiska šimpanzes DNS (aptuveni 98 %). 1997. gadā tika noteikts gēns, kas izraisa iedzimtu kurlumu. Jādomā, ka turpmākajos gados atradīs gēnus, kam ir svarīga loma sirdsdarbības traucējumu (pētījumi notiek arī Latvijā), astmas, depresijas un citu slimību attīstībā. Cilvēka ge-
noma noteikšanu uzskata par ļoti nozīmīgu zināt-
nisku atklājumu. 1. Kas ir krustmija? 2. Kā sastāda hromosomu kartes ? 3. Zinātnieki veica pētījumus ar augļmušām un noskaidroja, ka trīs gēni - a, b un c - atrodas vienā hromosomā. Izsekojot to sadalījumam pēcnācējos, noskaidrojās, ka gēni aunb pārkom-
binējās 25 % gadījumu, a un c - 7 %, bet b un c - 18 %. Uzzīmējiet shematisku šo gēnu izkārtojumu hromosomā! 4. Augļmušām vienā hromosomā atrodas gēni, kas nosaka ķermeņa krāsu, acu krāsu un spārnu formu. Pētītajā populācijā mušām ar melnu ķermeni bija purpursarkanas acis un taisni spārni, bet mušām ar pelēku ķermeni bija sarkanas acis un izliekti spārni. Kādā secībā un attālumā cits no cita izkārtoti šie gēni, ja 6 % pēcnācēju bija mainījusies acu krāsa (melnām mušām - sarkanas, bet pelēkām - purpursarkanas), bet 18,5 % bija mainījusies spārnu forma (melnām - izliekti spārni, pelēkām - taisni)? 5. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem krustmija (krosingovers), genoms! Mutācijas Lai gan gēni ir nemainīgi un nākamajām pa-
audzēm tiek nodoti neizmainītā veidā, tomēr atse-
višķos gadījumos rodas pārmaiņas to DNS mole-
kulās. Šādas pārmaiņas sauc par mutācijām. Mutācijas var mainīt šūnu funkcijas, kā arī to audu darbību, kuros šūnas atrodas. Ja mutācijas rodas dzimumšūnās, tad tās tiek nodotas pēcnācējiem. Terminu "mutācija" pirmais ieviesa holandiešu botāniķis H. de Frīzs. Viņš atklāja un formulēja mutāciju teoriju: • mutācijas rodas pēkšņi, bez jebkādām pārejas stadijām; • jaunās formas ir stabilas; • mutācijas ir kvalitatīvas pārmaiņas; • mutācijas var būt gan derīgas, gan kaitīgas; • iespēja konstatēt mutācijas ir atkarīga no izana-
lizēto īpatņu skaita; • vienas un tās pašas mutācijās var rasties atkār-
toti. Atkarībā no ģenētiskā aparāta pārmaiņu rak-
stura mutācijas iedala 1) gēnu mutācijās; 2) hromosomu mutācijās; 3) genoma mutācijās. Mutācijas, kas skar atsevišķu gēnu struktūru, sauc par gēnu jeb punktveida mutācijām. Gēnu mutācijas parasti rada pārmaiņas DNS molekulas nukleotīdu secībā. Visbiežāk viens nukleotīds tiek aizvietots ar citu. Šādas mutācijas parasti izraisa kādas citas aminoskābes iekodēšana olbaltumvie-
las struktūrā. Šī aminoskābe var būt funkcionāli līdzvērtīga oriģinālajai aminoskābei un maz ietek-
mēt sintezētās olbaltumvielas īpašības, bet var būt arī funkcionāli atšķirīga un ievērojami mainīt sin-
tezētas olbaltumvielas īpašības. Tā, piemēram, ja hemoglobīna molekulas triplets CTC tiek izmai-
nīts uz CAC un glutamīnskābes vietā sintezējas valīns, tad rodas sirpjveida anēmija. Šīs slimības gadījumā hemoglobīna molekulas salīp un izkropļo eritrocītu formu, kā rezultātā cilvēks var nomirt. Mutācijas bieži izraisa iedzimtus vielmaiņas traucējumus. Ir zināmi aminoskābju, ogļhidrātu, lipīdu, sāļu un olbaltumvielu, piemēram, fer-
mentu, vielmaiņas traucējumi. Viena no izplatītā-
kajām aminoskābju vielmaiņas slimībām ir fenil-
ketonūrija. Eiropā tā sastopama aptuveni vienam bērnam no 15 000 jaundzimušo. Gēnu defekta dēļ slimniekam trūkst fermenta, kas katalizē amino-
skābes fenilalanīna pārveidošanos par tirozīnu. Tāpēc organismā uzkrājas toksiskas vielas, kas kaitīgi ietekmē nervu sistēmu, izraisot bērna ga-
rīgu atpalicību. Agrīna diagnoze un īpašas diētas ievērošana palīdz no tā izvairīties. Vairumā gadījumu mutācijas nelabvēlīgi ietekmē organisma funkcijas. Taču reizēm tās var būt ne-
kaitīgas vai pat radīt derīgas pārmaiņas, kuru re-
zultātā organisms iegūst zināmas priekšrocības. Tas sekmē evolūcijas procesu. Pēc kāda pazīmju pāra heterozigotiskā organismā parasti viena alēle dominē pār otru un recesīvās alēles īpašības ne-
parādās. Piemēram, ja abas alēles atbild par kāda fermenta sintēzi, tad parasti dominējošā alēle no-
saka šā fermenta sintēzi, bet recesīvā alēle vis-
biežāk ir mutācijas rezultāts. Organisms ar vienu dominanto alēli parasti funkcionē normāli, tāpat kā ar divām dominantajām alēlēm un tajā veidojas pietiekami daudz fermenta. Tāpēc hromosomu izvietojums pa pāriem nodrošina organisma aiz-
sardzību pret nelabvēlīgo mutāciju sekām. Gēnu mutācijas ir sastopamas visos organis-
mos. Katrai sugai ir noteikts mutāciju biežums. Mutācijas, kas rada redzamas pārmaiņas hro-
mosomās, sauc par hromosomu mutācijām (sk. 6.27. att.). Atkarībā no pārmaiņu rakstura tās iedala šādi: • delēcija (pazūd hromosomas iekšējais segments); • duplikācija (dubultojas hromosomu iecirknis)^ • inversija (hromosomu iecirknis apgriežas par 180 ); • translokācija (segmenti apmaiņas starp nehomo-
logām hromosomām); • tanspozīcija (hromosomu segments pārvietojas uz jaunu vietu). Hromosomu mutācijas parasti rada būtiskas pārmaiņas organisma attīstībā un funkcionēšanā. Bieži vien pēc šādām mutācijām indivīds nav spē-
jīgs attīstīties un iet bojā. Sevišķi bīstamas ir mu-
tācijas, kuru rezultātā ir pārmainīts ģenētiskā ma-
teriāla daudzums šūnā. Mazāk bīstamas ir tās mutācijas, kas izmaina atsevišķu segmentu atrašanās vietu. Taču šīs pār-
maiņas var radīt mejozes traucējumus un līdz ar to patoloģijas pēcnācēju attīstībā. Genoma mutācijas ir hromosomu skaita pār-
maiņas šūnā. Poliploīdija ir hromosomu komplektu skaita palielināšanās. Poliploīdijas gadījumā hromosomu skaits var būt triploīds (3n), tetraploīds (4n) vai arī vēl lielāks. Poliploīdijas rašanās parasti ir sais-
tīta ar pārmaiņām mitozes vai mejozes norisē. Poliploīdija samērā bieži ir novērojama augiem, bet dzīvniekiem tā nav sastopama. Poliploīdi augi ir lieli; tiem ir lielas sēklas un augļi. Lielākā daļa kultūraugu ir poliploīdi. Cilvēka un dzīvnieku em-
briji poliploīdijas gadījumā iet bojā. Faktorus, kas izraisa mutācijas, sauc par muta-
gēniem. Spēcīgs mutagēns ir radioaktīvais staro-
jums, piemēram, rentgenstari. Arī daudzām orga-
niskajām vielām piemīt mutagēna aktivitāte, pie-
mēram, pesticīdiem (vielām, ko izmanto augu slimību, kaitēkļu un nezāļu iznīcināšani), dažā-
diem medikamentiem, arī formalīnam, benzolam, organiskajiem šķīdinātājiem, arsēnam un citām ķimikālijām. Konstatēts, ka mutācijas var radīt smēķēšana un narkotisko vielu (piemēram, dietil-
amidlizergīnskābes - LSD) lietošana. Arī auto-
mašīnu izplūdes gāzes var uzskatīt par mutagē-
niem. Mutācijas izmanto selekcijā jaunu šķirņu iegū-
šanai. Šim nolūkam pielieto dažādus mutagēnus. Mutagēnus lieto mikroorganismu selekcijā, lai no baktērijām iegūtu dažādas antibiotikas, aminoskā-
bes un citas vielas. Lai gan daudzas mutācijas ir smagu iedzimto slimību cēlonis, tomēr citām ir liela loma evolū-
cijas procesā. Mainīgas vides apstākļos daļa no mutācijām ir noderīgas. Tās nodrošina sugu sagla-
bāšanos, pielāgojoties jaunajiem apstākļiem. 1. Kādi ir mutāciju veidi ? 2. Kas irpoliploīdija? 3. Kādi faktori izraisa mutācijas ? 4. Kāpēc mutācijām ir svarīga loma organismu evolūcijas procesā ? 5. Atkārtojiet apgūto vielu par DNS kodu un olbaltumvielu sintēzi! 6. Uzrakstiet, kāda mRNS veidosies uz dotā DNS fragmenta bāzes. Kāda būs aminoskābju secība sintezējamā olbaltumvielā ? pasīvā DNS ķēde >ATG TCG GTT AGC CAG AAT CGA GGA CCT transkribējamā DNS -> TAC AGC CAA TCG GTC TTA GCT CCT GGA 7. Kā mainīsies mRNS nukleotīdu sastāvs un aminoskābju secība, ja būs notikusi iezīmētā fragmenta delēcija? TAC AGC CAA TCG GTC TTA GCT CCT GGA ATT 8. Kā mainīsies mRNS un aminoskābju uzbūve, ja būs notikusi iezīmētā fragmenta dupli-
kācija? TAC AGC CAA TCG GTC TTA GCT CCT GGA ATT 9. Kā mainīsies mRNS un aminoskābju uzbūvēja būs notikusi iezīmētā fragmenta inversija? TAC AGC CAA TCG GTC TTA GCT CCT GGA ATT 10. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem mutācija, mutagēns, poliploīdija! Vides ietekme uz iedzimtību Cilvēku darbības dēļ vidē nonāk daudz kaitīgu vielu. Bez jonizējošā starojuma un radioaktīvajiem nukleotīdiem nav iespējama modernā medicīna, kultūraugu selekcija un citas nozares. Taču pat nelielas radiācijas devas var nelabvēlīgi ietekmēt organisma funkcijas un dzīvotspēju. Piemēram, apstarojot ar rentgenstariem augļmušu - drozo-
filu, mutāciju biežums palielinās 150 reizes. Cil-
vēkam radiācijas iedarbības sekas ir atkarīgas no apstarojuma devas un veida. Radiācija rada • pārmaiņas somatiskajās (ķermeņa) šūnās, kuru rezultātā rodas ļaundabīgie audzēji; • mutācijas dzimumšūnās, kas ietekmē pēcnācēju dzīvotspēju; • iedzimtus defektus jaunajam organismam (ja apstaro grūtnieci); • staru slimību un nāvi (ja ir liela apstarojuma deva). Arī daudzas ķīmiskas vielas negatīvi ietekmē iedzimtību. Piemēram, lauksaimniecībā izmanto-
jamie pesticīdi, metāli (Cr; Pb; Cd; As; Ni; Hg), tabakas dūmi, alkohols, kancerogēnās vielas, kas rodas, nepareizi gatavojot ēdienu. Pārtikas produktos mutagēnās vielas var ras-
ties, ja • tiem pievieno vielas, kas uzlabo garšu vai pa-
garina uzglabāšanas laiku; • organismos augšanas laikā nokļūst toksiskas vie-
las, piemēram, pesticīdi; • augi satur indīgas vielas, piemēram, alkoloīdus; • termiski nepareizi apstrādā produktus, piemē-
ram, vairākkārt lieto cepamos taukus vai eļļu; • nepareizi glabā vai neievēro glabāšanas termiņu; • produktus bojā pelējums un citi mikroorganismi. Ļoti svarīga ir gaisa kvalitāte telpās, jo vismaz 1/2-4/5 diennakts cilvēks pavada telpās. Mutagēni rodas, nepilnīgi sadegot gāzei gāzes plītīs, kā arī malkai krāsnīs un kamīnos. Arī celtnes un telpu apdares materiāli, piemēram, azbests, eļļas krā-
sas, plastmasas, sintētiskie paklāji, skaidu plāks-
nes, kas piesūcinātas ar formaldehīdu, ietekmē cil-
vēka veselību. Audzēji Ja tiek traucēta gēnu darbības regulācija, kas kontrolē šūnu dalīšanos, var veidoties audzēji -
mutāciju pārveidotu, organismam netipisku šūnu sakopojumi. Audzēju šūnas strauji aug un vairojas, turklāt augšana un vielmaiņa nenoris normāli. Pēc augša-
nas īpatnībām audzējus iedala labdabīgos un ļaun-
dabīgos audzējos. Labdabīgais audzējs parasti aug lēni, atbīdot apkārtējos audus, bet neieaugot tajos. Ļaundabīgais audzējs (vēzis) aug ātri, iespiežas veselajos audos un orgānos, saindē tos ar kaitī-
giem vielmaiņas produktiem un sagrauj tos. Audzē-
ja šūnas ir nepilnvērtīgas organisma šūnas. Vēža šūnas nav pielāgotas organismam rakstu-
rīgo funkciju veikšanai. Vēža šūnu kodoli ir palie-
lināti, un tajos var būt nenormāls hromosomu skaits. Tā kā vēža šūnām nav kontaktu ar blakus esošām šūnām, tās izveido audzēju. Kad vēža šū-
nas nokļūst limfvados vai asinsvados, tās pārvie-
tojas uz jebkuru ķermeņa vietu un tur veido meta-
stāzes - jaunus audzējus. Normālas šūnas ap-
tuveni pēc 50 dalīšanās reizēm iet bojā, turpretī vēža šūnas var dalīties nepārtraukti. Šūnu dalīšanos kontrolē augšanas kontroles sis-
tēma, kas nosaka, kad šūnai sākt vai beigt dalīties. Šūnas var izdalīt augšanas faktorus, olbaltum-
vielas, kas stimulē šīs pašas šūnas vai arī citas šū-
nas dalīšanos. Augšanas kontroles sistēmas darbī-
bu regulē noteikti gēni. Ja šajos gēnos notiek mutācijas, tie kļūst par onkogēniem, kas vairs neierobežo šūnu augšanu un dalīšanos. Tā rezul-
tātā augšanas kontroles sistēma pārstāj funkcio-
nēt un sākas šūnu nekontrolēta augšana un da-
līšanās, kāda raksturīga audzējiem. Aktīva un spē-
cīga imūnsistēma spēj pasargāt organismu no audzējiem, jo audzēju šūnas atšķiras no normālām organisma šūnām, tāpēc imūnšūnas spēj tās at-
pazīt un iznīcināt. Ja imūnsistēma ir novājināta (slimību rezultātā vai sasniedzot lielāku vecumu), audzēju veidošanās risks palielinās. Faktorus, kas, ilgstoši iedarbojoties uz organis-
mu, var izraisīt ļaundabīgu audzēju, sauc par kan-
cerogēniem. Ļaundabīgos audzējus var izraisīt radiācija, onkovīrusi, hormonālā līdzsvara trau-
cējumi, embrionālās attīstības defekti un hroniski iekaisumi. Daudz kancerogēnu ir tabakas dūmos. Saslimšanas biežums ar ļaundabīgajiem audzē-
jiem dažādās pasaules valstīs ir atšķirīgs. Latvijā ļaundabīgie audzēji ir viens no izplatītākajiem nā-
ves cēloņiem. Ļaundabīgo audzēju ārstēšanā iz-
manto ķirurģisko, staru un medikamentozo tera-
piju, kā arī imūnterapiju. Populāciju ģenētika Populāciju ģenētika ir ģenētikas nozare, kas pē-
ta ģenētikas likumu darbību populācijās. Tā ir ļoti cieši saistīta ar evolūcijas mācību. Populāciju ģe-
nētika izskaidro, kādā veidā individuālā mainība populācijās ir saistīta ar grupu mainību. Populācija ir mazākā vienas sugas īpatņu kopa, kas savā starpā brīvi krustojas, dzīvo noteiktā teritorijā, ieņem noteiktu ekoloģisko nišu un spēj pastāvēt evolucionāri ilgu laiku. Populācija ir da-
bisks sugas grupējums noteiktā teritorijā. Tā ir sugas eksistences pamatforma. Dabā eksistē dažādas populācijas. Visciešākās saites starp indivīdiem ir panmikstiskā populācijā. Panmiksija ir indivīdu brīva krustošanās, kad ne-
pastāv faktori, kas to ierobežo. Ja populācijā brīvi krustojas dominantie un recesīvie īpatņi, tad pir-
majā paaudzē visi hibrīdi ir heterozigoti. Otrajā paaudzē notiek skaldīšanās šādās attiecībās: 1AA: :2Aa:laa. Šāda pati attiecība saglabājas arī nāka-
majās paaudzēs. Brīvas krustošanās gadījumā po-
pulācijas genotipiskais sastāvs no paaudzes uz pa-
audzi nemainās. Šo likumsakarību sauc par Hār-
dija-Veinberga likumu. Abi šie zinātnieki to atklāja 1908. gadā neatkarīgi viens no otra. Tomēr Hārdija-Veinberga likums ir spēkā tikai tad, ja pastāv šādi nosacījumi: 1) populācija ir pie-
tiekami liela; 2) tā ir izolēta no citām savas sugas populācijām; 3) nedrīkst rasties jaunas mutācijas; 4) nedrīkst notikt izlase, kas ir labvēlīga vai nelab-
vēlīga atsevišķiem gēniem. Dabā šie nosacījumi nav spēkā kaut vai tāpēc, ka nepārtraukti rodas mutācijas, kā arī pastāv dabiskā izlase. Novirzes no Hārdija-Veinberga likuma ir evolūcijas procesa pamatā. Mutāciju rašanās rezultātā populācijās uzkrājas recesīvās mutācijas, kas ārēji neparādās. Kad mu-
tāciju koncentrācija kļūst pietiekami augsta, notiek tādu īpatņu krustošanās, kuru genotipā ir recesīvo gēnu alēles. Šajā gadījumā mutācija iz-
paužas fenotipiski. Ja pazīme ir organismam lab-
vēlīga, tad viņš saglabājas, bet, ja nelabvēlīga, -
viņš iet bojā (notiek dabiskā izlase). Mainoties ap-
kārtējās vides apstākļiem, noteikta veida mutā-
cijas var palielināt indivīdu spējas izdzīvot. Līdz ar to vides pārmaiņas virza sugas pārveidošanos noteiktā virzienā - notiek virzošā izlase. Ja ap-
kārtējās vides apstākļi ir nemainīgi, tad krasas fe-
notipiskas pārmaiņas īpatņiem reti dod priekšro-
cības izdzīvošanai. Mutantiem ir daudz lielākas iespējas iet bojā. Tā ir stabilizējošā izlase. Mutācijas palielina organismu iedzimto mainī-
bu, un līdz ar to tās var uzskatīt par evolūcijas virzošo spēku. Ja populācijas ir nelielas, tad heterozigotisko īpatņu skaits tajās samazinās, bet, ja tās ir lielas, tad heterozigotisko īpatņu skaits pakāpeniski pa-
lielinās. Populāciju ģenētiskās struktūras pār-
maiņu, ko izraisa dažādi nejauši cēloņi, sauc par ģenētisko dreifu. Tas palielina populāciju geno-
fondu. Ģenētiskais dreifs var radīt pārmaiņas, kam nav pielāgošanās rakstura. Tā rezultātā starp tuvām organismu sugām rodas atšķirības, kuras nepalielina šo sugu īpatņu izdzīvošanas iespēju. Atsevišķiem indivīdiem nokļūstot izolētās terito-
rijās, var rasties jaunas populācijas. 1. Kas ir populāciju ģenētika ? 2. Kāds ir Hārdija-Veinberga likums ? 3. Nosauciet profesijas, kuru pārstāvji visbiežāk saskaras ar mutagēnajiem faktoriem! Kā iespējams šos cilvēkus pasargāt no mutagēno faktoru iedarbības uz organismu ? 4. Kuras no minētajām mutācijām (jauniegūtām iedzimstošām pazīmēm) evolūcijā ir palie-
linājušas minēto organismu izdzīvošanas iespējas, kuras - samazinājušas ? 1) Neattīstīti spārni augļmušai drozofilai; 2) balts apmatojums aiz polārā loka dzīvojošiem zaķiem; 3) Dauna sindroms cilvēkiem; 4) tumši spārni industriālajos rajonos dzīvojošiem tauriņiem; 5) koša brīdinājuma krāsa indīgajiem abiniekiem; 6) lapu vītes zirņiem; 7) sirpj-
veida anēmija (nepilnvērtīgi eritrocīti) cilvēkiem; 8) albīnisms kaķiem (albīnie dzīvnieki parasti ir kurli); 9) tumša ādas krāsa negroīdu rases cilvēkiem; 10) garš knābis bradā-
tājputniem; 11) apspalvošanās traucējumi vistām. 5. Nosauciet 5 dažādu organismu pazīmes, kuras evolūcijas gaitā ir palielinājušas šo orga-
nismu pielāgotību dzīves videi! 6. Augļmušu populācijā 1/4 īpatņu ir homozigotiski recesīvi - ar īsiem spārniem, bet % īpatņu ir dominantā pazīme-gari spārni. Kāda būs spārnu garumu nosakošo dominanto un recesīvo alēļu sastopamība nākamajā paaudzē, ja pastāv visi apstākļi, kuros darbojas Hārdija-Vein-
berga likums? 7. Traukā ar barotni ievietoja 150 augļmušas ar genotipu Gg un 100 augļmušas ar genotipu gg. Kāda būs šo genotipu sastopamība nākamajā paaudzē, ņemot vērā Hārdija-Veinberga likumu ? 8. Kur jūs sadzīvē saskarieties ar mutagēnām un kancerogēnām vielām ? Kā var mazināt šo vielu ietekmi ? 9. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem kancerogēns, onkogēns! Gēnu inženierija Dabā samērā plaši izplatīta parādība ir gēnu pārkombinēšanās starp diviem dažādiem organis-
miem. Tas notiek, piemēram, dzimumvairošanās procesā, veidojoties zigotai. Šajā gadījumā pār-
kombinēšanās notiek starp vienas sugas indivī-
diem. Baktērijām ir iespējama arī gēnu pārkom-
binēšanās starp sugām. Piemēram, transformāci-
jas procesā baktērijas piesaista DNS molekulas no citu sugu baktērijām. Ir iegūti dati, kas liecina, ka vīrusi var pārnēsāt gēnus starp eikariotu organis-
miem. Pēc iekļūšanas eikariotu šūnā vīruss tur var eksistēt vairākus mēnešus vai pat gadus. Pa-
metot saimniekšūnas hromosomu, vīruss reizēm paņem līdzi arī kādu iecirkni no eikariota DNS. Ja šāds vīruss inficē citu organismu, tajā nonāk arī iepriekšējā saimnieka DNS, un jaunais vīrusa saim-
nieks iegūst gēnus no sev neradniecīgas sugas. Gēnus no vienas sugas indivīda citas sugas in-
divīdam var pārnest arī laboratorijas apstākļos. To panāk ar gēnu inženierijas metodēm (sk. 6.28. att.). Gēnu pārnešanai izmanto vektorus - tādas B. Ja cilvēka un plazmīdas DNS ir sadalītas ar viena veida fermenta restriktāzes palīdzību, tad tām veidojas vienādi "lipīgie" gali. Sajaucot cilvēka un plazmīdas DNS, dažas no tām savienojas savā starpā, tādējādi iespējams ievietot cilvēka DNS plazmīdas DNS sastāvā. DNS molekulas, ar kuru palīdzību ir iespējams pārnest tajās ieslēgtus gēnus uz cita organisma šūnu, kur šīs molekulas reduplicējas. Par vekto-
riem parasti izmanto plazmīdas jeb nehromoso-
mālos DNS fragmentus, kas sastopami dažādās baktērijās vai arī vīrusos. Gēnu inženierijas at-
tīstības sākumposmā plaši izmantoja baktērijas E. coli plazmīdas, taču vēlāk sāka pielietot arī māk-
slīgi radītas plazmīdas. Lai pārnestu kādu noteiktu gēnu (vai gēnu gru-
pu), to vispirms nepieciešams izdalīt un ieslēgt vektorā. Gēnu izdalīšanu veic ar fermentu - re-
striktāžu palīdzību. Šo fermentu dabiskā funkcija ir noārdīt šūnā iekļuvušo svešo DNS. Restriktāzes pārgriež DNS molekulu jeb veic restrikciju. Šos restrikcijas fragmentus ar īpašām metodēm atdala. Gēnus var iegūt arī, tos sintezējot. DNS mo-
lekulu sintēzes metodi izstrādāja Hars Bainds Ko-
rānā 20. gs. sešdesmitajos gados. Pēc šīs metodes mākslīgi sintezē veselus gēnus (piemēram, gēnus, kas satur informāciju par cilvēka hormonu insu-
līnu). Fragmentu ieslēgšanu vektoros veic ar fer-
mentu - DNS ligāžu palīdzību. Pēc vektora un tajā iekļautā gēna ievadīšanas gēns sāk producēt to ol-
baltumvielu, par kuras sintēzi tas satur informā-
ciju. Tādus vidē brīvi dzīvojošus organismus, ku-
riem ievadīti sveši gēni, sauc par transgēniem organismiem. Ar gēnu inženierijas palīdzību ir iespējams iegūt dažādas nozīmīgas bioloģiski aktīvas vielas, pie-
mēram, hormonu insulīnu, kas nepieciešams dia-
bēta slimniekiem, augšanas hormonu, interfero-
nus - olbaltumvielas, kas kavē vīrusu vairošanos. Cilvēka gēnus lielākoties ievada zarnu nūjiņas E. coli šūnās, kuras pēc tam sintezē šīs vielas. Tās izmanto medicīnā. Ar baktēriju palīdzību iespē-
jama pat toksisku produktu (naftas, pesticīdu) sa-
šķelšana. Gēnu inženierijai ir liela nozīme drošu vakcīnu radīšanā. Šī metode palīdz noskaidrot at-
sevišķu gēnu funkcijas un to nozīmi organismā. Attīstās specifiska ārstniecības metode - gēnu te-
rapija. Tās pamatā ir bojāto gēnu aizstāšana ar normāliem. Tiek izstrādātas gēnu terapijas meto-
des iedzimto asins slimību ārstēšanai. Viens no sarežģītākajiem uzdevumiem ir nodro-
šināt šūnās ievadīto gēnu darbības regulāciju. Daudz vienkāršāk ir ar ievietota gēna palīdzību likt baktērijai E. coli producēt kādu vielu nekā iesaistīt šos gēnus augstāk attīstītu organismu šū-
nu darbībā un dzīvības procesos. Ja izdosies pa-
nākt insulīna sintēzi diabēta slimnieka organismā, tad šis cilvēks vairs nebūs atkarīgs no insulīna preparātiem un būs izārstēts. Savukārt, ja izdosies graudaugiem ievadīt gēnus, kas piesaista atmosfē-
ras slāpekli, tad ievērojami palielināsies graudu ražas un samazināsies vides piesārņojums, ko rada slāpekļa mēslojumi. Ģenētiķiem rodas ētiskas da-
bas jautājumi. Vai cilvēkam ir nepieciešamas tādas spējas, ko nav devusi daba? Vai mums ir tiesības noteiktā veidā virzīt evolūcijas procesu? Vai mēs esam tam gatavi? Gēnu inženierijas metodes tiek izmantotas arī zemkopībā un lopkopībā. Pārtikas produktus, kas iegūti no organismiem, kuri izveidoti ar gēnu inže-
nierijas metodēm, sauc par ģenētiski modifi-
cētu pārtiku. Pasaulē plaši audzē ģenētiski pār-
veidotu soju, kokvilnu, rapsi un kukurūzu. Laboratorijās ar gēnu inženierijas metožu palī-
dzību atsevišķi gēni tiek pārnesti no viena orga-
nisma uz citu. Piemēram, augiem tiek ienesti ku-
kaiņu vai citu organismu gēni. Šādā veidā tiek iegūti augi ar noteiktām īpašībām. Piemēram, kā-
dā organismā tiek atrasts efektīvs gēns, kurš, ja to pārnes uz augu, veido vielas, kas atbaida kaitēk-
ļus. Cits gēns var nodrošināt izturību pret her-
bicīdiem. Audzējot šādus augus, var droši lietot herbicīdus - nezāles tiek apkarotas, bet kultūraugi paliek neskarti. Kopš 1996. gada, kad ģenētiski pārveidotā pār-
tika ir pārdošanā, tiek pētīta tās ietekme uz cil-
vēka veselību. Līdz šim nekas ļauns nav atklājies. Tiek audzēti arī ģenētiski modificēti dzīvnieki, piemēram, cūkas ar palielinātu dzīvsvaru, cāļi ar lielāku muskuļu apjomu, mājputni ar paaugsti-
nātu dējību. Pagaidām droši nevar apgalvot, ka šādi produkti nav kaitīgi veselībai. Piemēram, ģe-
nētiski modificēta pārtika var izraisīt alerģiskas reakcijas. Vairumā valstu joprojām netiek prasīts norādīt, vai pārtika ir ģenētiski pārveidota vai nav. Jādomā, ka ģenētiski modificētus produktus pirktu mazāk, tāpēc to ražotāji nav ieinteresēti uzrādīt attiecīgus marķējumus. Biotehnoloģijas vēsture 1944. gadā tiek pierādīts, ka DNS molekulas nes iedzimtības informāciju. 1952. gadā atklāj plazmīdas - elementus, kas spēj pārnest ģenētisko informāciju no vienas šūnas uz citu. 1953. gadā izveido DNS struktūras modeli. 1961.-1967. gadā nolasa ģenētisko kodu. 1973. gadā iegūst divu dažādu organismu (baktērijas un vīrusa) DNS hibrīdu. 1976. gadā nodibina Genetech - pirmo firmu, kas izmanto biotehnoloģijas sasniegumus. 1977. gadā iegūst baktērijas, kas sintezē cilvēka augšanas hormonu. 1978. gadā baktērijās klonē cilvēka insulīna gēnu. 1980. gadā tiek patentēts pirmais ģenētiski modificētais organisms (baktērija). 1981. gadā radīti pirmie transgēnie dzīvnieki - peles. 1983. gadā radīts pirmais transgēnais augs - tabaka, kuru uz lauka sāka audzēt pēc 5 gadiem. 1985. gadā siera ražošanā pirmo reizi izmanto no ģenētiski pārveidotiem mikroorganismiem iegūtu enzīmu. 1989. gadā aizsākas darbs pie cilvēka genoma izpētes. 1990. gadā radīta pirmā ģenētiski pārveidotā govs, kas pienā izdala svešo gēnu darbības produktus. 1994. gadā tirdzniecībā nokļūst pirmais ģenētiski pārveidotais augs - tomātu šķirne, kuru var ilgstoši uzglabāt. 1997.-1998. gadā uzsākta dzīvnieku klonēšana. 2002. gadā diskusijas par cilvēka klonēšanu. 2003. gada aprīlī pabeidz cilvēka genoma sekvencēšanu. Latvijā molekulārās bioloģijas jomā ir veikti pla-
ši pētījumi. 1964. gadā vairāki zinātnieki - Elmārs Grēns, Gunārs Cipēns, Gunārs Duburs, Raimonds Žagata u. c. - Latvijas Organiskās sintēzes insti-
tūtā pievērsās pētījumiem molekulārajā bioloģijā. 1975. g. tika izveidota Nukleīnskābju ķīmijas labo-
ratorija, bet 1988. g. tā kļuva par Molekulārās bio-
loģijas nodaļu. 1991. g. tika izveidots Molekulārās bioloģijas institūts, kurš 1993. g. kļuva par Latvijas Universitātes Biomedicīnas pētījumu un studiju centru. Tā vadītājs bija akadēmiķis Elmārs Grēns. Pašlaik centrā tiek veikti pētījumi biomedicīnā, molekulārajā bioloģijā un ģenētikā, kā arī rekom-
binantu biotehnoloģijā. Viens no galvenajiem centra pētījumu virzieniem ir jaunu vakcīnu ra-
dīšana, ar kurām ienest organismā nepieciešamo gēnu. Ar gēnu inženierijas palīdzību tiek radītas olbaltumvielas (proteīni) ar iepriekš aprēķinātām īpašībām un pielietošanas iespējām. Jādomā, ka turpmākajos gados strauji attīstī-
sies jauna medicīnas tehnoloģija - gēnu terapija. Tā dos iespēju šūnā ievadīt jaunu ģenētisko ma-
teriālu. Šāda medicīniska iejaukšanās iekļauj gan trūkstošo, šūnai vajadzīgo gēnu ievadīšanu, gan šūnai nevēlamo gēnu darbības bloķēšanu. Tas nozīmē, ka ar gēnu terapijas palīdzību būs iespē-
jams ārstēt iedzimtas slimības, kas līdz šim tika uzskatītas par neārstējamām. Ar šo metodi var pārmainīt somatisko šūnu, nevis dzimumšūnu ge-
nomu, tāpēc radītās pārmaiņas pacienta gēnos pēcnācēji nepārmantos. Gēnu terapijas un moderno vakcīnu pamatprin-
cipi ir līdzīgi. Abos gadījumos notiek olbaltumvielu inženierija. Kā moderno vakcīnu, tā arī gēnu te-
rapijas preparātos tiek veidoti mākslīgie nesēji -
vektori. Vektors ir līdzīgs vīrusa daļiņai vai struk-
tūrai, taču tajā ir izņemtas tās daļas, kas cilvēkam ir kaitīgas, un ievietotas tādas struktūras, kas ne-
pieciešamas, lai vīrusveidīgā daļiņa darbotos kā efektīvs gēnu terapijas vai vakcīnu preparāts. Tie genoma elementi, kas ielikti gēnā, ir ņemti no da-
bas, taču savirknēti vajadzīgajā veidā. Vektoram jābūt tādam, lai pēc ievadīšanas organismā tas no-
nāktu līdz noteiktām organisma šūnām vai orgā-
niem. Tam ne vien jāpazīst vajadzīgās šūnas, bet arī jāiekļūst tajās un jāatbrīvo "iepakotais" gēns. Turklāt nepieciešams, lai gēns efektīvi darbotos un preparāts nebūtu organismam kaitīgs. Terapeitiskā iejaukšanās gēnos pagaidām vēl notiek samērā komplicēti. Viens no rezultatīvā-
kajiem gēnu terapijas veidiem ir tā sauktā ex vivo gēnu terapija. Izmantojot šo metodi, no pacienta paņem asinis, izgulsnē no tām leikocītus, ievada tajos vajadzīgo preparātu, bet pēc tam leikocītus atkal ievada cilvēkam. Jādomā, ka nākotnē gēnu ievadīšanu varēs veikt vienkārši ar zāļu palīdzību. Galvenais gēnu terapijas mērķis ir ārstēt slimī-
bas, arī tādas kā vēzi, kas principā ir iedzimta sli-
mība, jo saistīta ar gēnu defektiem, bet tā var attīs-
tīties vai neattīstīties. Arī tādas smagas infekciju slimības kā AIDS nākotnē varētu būt gēnu terapijas objekts. AIDS ārstēšana ir viens no populārākajiem gēnu terapijas pētījumu virzieniem, kurā strādā zinātnieki. 2000. gadā Alana Fišera laboratorijā Parīzē tika veikti veiksmīgi pētījumi ar maziem bērniem, kuri bija AIDS slimnieki. Iespējams, ka ar gēnu terapijas palīdzību varēs ārstēt arī garīgas saslimšanas, jo tās ir saistītas ar gēnu defektiem. Latvijā ar gēnu terapijas jautājumiem nodarbo-
jas LU Biomedicīnas pētījumu un studiju centrā Elmāra Grēna un Paula Pumpēna vadībā. Zināt-
nieki pēta himēras - vīrusveida daļiņas, kas spēj darboties kā efektīvi gēni vai imūnsistēmas stimu-
latoru nesēji. Otrs virziens ir saistīts ar priekšdarbiem cil-
vēka genoma datu bāzes veidošanai. Šī projekta uzdevums ir nosekvenēt DNS, tas ir, noskaidrot nukleotīdu secību DNS molekulā. Esošā sekvenēšanas tehnoloģija balstās uz paņē-
mienu, kuru 20. gs. septiņdesmitajos gados izstrā-
dāja angļu zinātnieks Frederiks Sendžers. Sekve-
nēšanai nepieciešams, lai nolasāmais DNS apgabals būtu pieejams ļoti lielā, pilnīgi vienādu kopiju skaitā. Tas ir iegūstams ar gēnu inženierijas un klonēšanas metožu palīdzību, saskaldot genomu sīkos fragmentos un katru fragmentu savairojot baktērijās. Sekvenci nolasa ar fermenta DNS poli-
merāzes palīdzību. Ir izstrādāti automātiskās sek-
venēšanas aparāti. F. Sendžers pirmais atšifrēja aminoskābju secību insulīnā un pirmais nolasīja baktēriju vīrusa DNS secību. Par šiem panāku-
miem viņš 1958. gadā un 1980. gadā saņēma No-
bela prēmiju. Pasaulē ir daudz biotehnoloģijas kompāniju, kas veic DNS analīzes dažādiem mērķiem - lai pierā-
dītu paternitāti, noteiktu iespēju saslimt ar audzē-
jiem utt. Tiek veidotas genoma bibliotēkas. Lai iz-
veidotu genoma bibliotēku, kāda organisma DNS sagriež gabalos un šos gabalus ievieto vektorā (pie-
mēram, plazmīdā vai vīrusā). Vektors pēc tam iekļūst saimniekšūnā, piemēram, baktērijā. Pilnī-
ga baktēriju vai bakteriofāgu klonu kolekcija, kas tiek radīta šādā veidā, satur visus šā organisma gēnus. Klonēšana Pēdējos gados daudz diskusiju ir izraisījusi dzīv-
nieku klonēšana - pavairošana ar somatiskajām šūnām. Dzīvnieku vairošanās ar somatiskajām šū-
nām kā dabisks process ir raksturīgs tikai zemāk attīstītiem dzīvniekiem - sūkļiem, hidrām un pla-
nārijām. Lielākā daļa dzīvnieku vairojas vienīgi ar Dažās valstīs tiek izstrādāti projekti, kā veidot gēnu datu bāzes, kurās glabātos informācija par visu valsts iedzīvotāju gēniem. Ierakstus gēnu datu bāzē mēdz saukt par gēnu pasēm jeb gēnu iden-
tifikācijas kartēm. Tās varētu salīdzināt ar virt-
uālajām kredītkartēm - lietotājam ir tikai kar-
tes kods, ar ko piekļūt bankas kontam, nevis pati karte. Gēnu bankas datu bāzu veidošanā ir vairāki etapi. 1. Fenotipisko datu vākšana. Šajā etapā tiks vākti dati par indivīda veselības stāvokli, ģenealo-
ģiju, dzīvesveidu, dzīves vidi un organisma reak-
ciju uz dažādiem medikamentiem. 2. Genotipisko datu vākšana. Gēnu kartes tiks izveidotas, izmantojot nodotos asins paraugus, no kuriem izolēs un analizēs asins šūnu DNS. Datu analīzes laikā nevarēs noteikt to īpašnieku, jo per-
soniskā informācija būs kodēta. 3. Datu aizsardzība. Gēnu bankas datu bāze sa-
stāvēs no galvenās un autorizētās datu apstrādes daļas. Galvenajā datu apstrādes daļā būs informā-
cija, un speciālisti vadīs datu personifikācijas pro-
cesus tad, kad būs nepieciešams iegūt informāciju par konkrētu personu un tās radiniekiem. Auto-
rizētajā datu apstrādes daļā būs tikai bezperso-
niski dati. Datu bāzes palīdzēs diagnosticēt iedzīvotājiem iedzimtas slimības, atklāt konkrētu patoloģiju ra-
šanās risku un izstrādāt individuālas terapijas me-
todes to novēršanai. Tās tiks izmantotas arī ģime-
nes plānošanai, zinātniskos pētījumos u.c. Gēnu kartes varēs lietot arī tiesu medicīnā vai gadīju-
mos, kad nepieciešams identificēt personu. Pašlaik gēnu datu bāzes tiek veidotas Islandē, Igaunijā, Lielbritānijā. Arī Latvijas valdībai ir iesniegts projekts "Latvijas iedzīvotāju genoma datu bāze". Projektu ir paredzēts realizēt desmit gadu laikā. dzimumšūnām. Abu vecāku dzimumšūnām sa-
plūstot, veidojas zigota - šūna, no kuras attīstās jaunais indivīds un kura satur informāciju par tā īpašībām. Organismam attīstoties, katra ķermeņa šūna satur to pašu ģenētisko informāciju, kas at-
rodas zigotā. Taču, šūnām specializējoties, aktīva ir tikai daļa gēnu, bet pārējie ir bloķēti. Līdz ar to organisma šūnas ir specializētas noteiktu funkciju veikšanai un no tām praktiski nav iespējams iegūt jaunu indivīdu. Pirmie klonēšanas eksperimenti tika veikti ar vardēm. No kurkuļu zarnu epitēlija ņemtus šūnu kodolus ievietoja olšūnās, no kurām bija izņemti kodoli. No šādām šūnām attīstījās normālas var-
des. Šīs vardes bija identiskas tām vardēm, no kuru šūnām bija ņemti kodoli. Šie eksperimenti parā-
dīja, ka jauna indivīda attīstībā svarīga loma ir olšūnas citoplazmai. Tā atjauno to gēnu aktivitāti, kuri ir nepieciešami organisma attīstībai, bet spe-
cializētajās šūnās atrodas bloķētā stāvoklī. Vēlākajos gados tika veikti eksperimenti, kuros zīdītāju šūnu kodolus pārstādīja olšūnās bez ko-
dola. Lai gan sākumā šie eksperimenti bija nesek-
mīgi, vēlāk tie izdevās (sk. 6.29. att.). Pirmā tehnoloģija 1. No aitas A paņem olšūnu, bet no aitas B -
jebkuru citu šūnu ar ģenētisku informāciju. 2. Olšūnu iztīra. No tās izņem ģenētisko informāciju. Savukārt no otras šūnas atstāj tikai šūnas ģenētisko informāciju, atsakoties no pašas šūnas. 3. Šūnas ģenētisko informāciju ievada olšūnā. 4. Attīstās embrijs. 5. Piedzimst jērs, kas ir aitas B kopija, jo satur tikai tās ģenētisko informāciju. Šādas aitas B kopijas var veidot neierobežoti daudz (tik, cik ir donora olšūnu). Otrā tehnoloģija 1. Dabiski apaugļo aitu A un aitu B. 2. Attīstās embrijs. 3. Embriju, kurā ir astoņas šūnas, sadala četrās daļās -
katrā pa divām šūnām. 4. No izveidotajiem četriem embrijiem attīstās četras aitas, kurām ir vienāda ģenētiskā informācija, kas nāk gan no mātītes, gan - tēviņa. Plašu sabiedrības rezonansi izraisīja eksperi-
ments Skotijā, kura rezultātā izdevās izaudzēt klo-
nētu aitu - Dolliju. Šis pētījums parādīja, ka prin-
cipiāli ir iespējama arī cilvēku klonēšana. Pēc tam tika veikti eksperimenti ar pelēm, kazām, cūkām un pērtiķiem. Eksperimentā ar pērtiķiem tika izmantota cita tehnoloģija nekā klonējot aitas. Agrīnajā dīgļa at-
tīstības stadijā dalīšanās rezultātā izveidojušās šū-
nas jeb blastomērus atdalīja pa pāriem citu no cita un pēc tam ievietoja mātes organisma dzemdē. Viena šāda eksperimenta rezultātā piedzima nor-
māls pērtiķis. Raugoties no praktiskā viedokļa, dzīvnieku klo-
nēšanas perspektīvas ir daudzsološas. Dzīvnieku klonēšana ļaus pavairot lielā daudzumā produk-
tīvus un pret ekstremāliem apstākļiem izturīgus indivīdus. Tomēr vienlaikus rodas arī ētiska rak-
stura problēmas. Tās galvenokārt saistās ar cil-
vēka klonēšanu. 2001. gada beigās ASV tika iegūts klonēta cilvē-
ka embrijs, kuram attīstījās sešas šūnas. 2002. gada beigās pirmoreiz izplatījās ziņa, ka Dienvidkorejas zinātniekiem ir izdevies sekmīgi klonēt cilvēka embriju un iegūt no tā cilmesšūnas. Daudzi me-
diķi to uzskata par svarīgu posmu, lai pēc indivi-
duāla pasūtījuma radītu zāles, kuras palīdzēs ārstēt ar diabētu, Alcheimera, Parkinsona u.c. sli-
mībām sirgstošus slimniekus. Ģenētiskais materiāls tika ņemts no sievietes donoršūnas un ievietots citas sievietes olšūnā, ku-
rai pirms tam izņemts kodols. Cilvēka embrijs tika izaudzēts tik tālu, lai no tā varētu iegūt cilmes-
šūnas. Cilmesšūnas bija ģenētiskas kopijas donor-
šūnām. No cilmesšūnām mēģenē, kā arī pēc im-
plantēšanas pelē, sāka audzēt muskuļaudus, kaul-
audus un citus audus. Tā kā šajās šūnās ir indivīda ģenētiskais materiāls, pēc diferencēšanās tās var transplantēt, nebaidoties, ka organisms varētu tās atgrūst. Komentējot darba rezultātus, zinātnieki uzsvēra, ka klonēšana veikta vienīgi medicīnas va-
jadzībām, nevis cilvēku radīšanai. Cilvēka klonē-
šana ir ļoti bīstama, jo pastāv iespēja, ka cilvēkam varētu rasties izkropļoti iekšējie orgāni. Zinātnieki uzskata, ka paies gadi, pirms embri-
ju cilmesšūnas būs izmantojamas transplantācijas medicīnā. Viņi ir pārliecināti, ka ar klonēšanas metodi varētu iegūt pārstādīšanai piemērotus orgānus, kuriem ir identiska imūnsistēma. Līdz ar to organisms orgānus neatgrūdīs. Cilvēka klonēšana nav nekas neiespējams. Mūs-
dienās jau tiek izmantotas klonēšanai līdzīgas metodes. Dzimst bērni, kuri ir attīstījušies no mē-
ģenē apaugļotas olšūnas, kas pēc tam ir implan-
tēta sievietes dzemdē. Šī metode dod iespēju dau-
dziem neauglīgiem vecākiem radīt pēcnācējus. Vienlaikus rodas ētiskas dabas jautājums: "Cik daudz mēs drīkstam iejaukties dabas un cilvēka dzīvības norisēs?" Tikumu un morāles normu ne-
ievērošana var būt bīstama cilvēces izdzīvošanai. Tāpēc jāzina robeža, kāda veida eksperimenti ir pieļaujami un kāda - nav pieļaujami. Par šiem jautājumiem ir jādiskutē, to risināšanai ir jānotiek atklāti sabiedrības pārraudzībā un kontrolē. 1. Ko iespējams paveikt ar gēnu inženierijas palīdzību ? 2. Kādas ir gēnu inženierijas turpmākās attīstības perspektīvas ? 3. Nosauciet četrus apgalvojumus par un četrus - pret pārtikā izmantojamu organismu ģe-
nētisko modificēšanu! 4. Nosauciet četrus apgalvojumus par un četrus - pret cilvēku un to orgānu klonēšanu! 5. Iedomājieties, ka dzīvojat nākotnē. Turpmāk aprakstītas vairākas ar gēnu darbību saistītas problēmas (apzīmētas ar cipariem), nosauktas arī perspektīvākās gēnu inženierijas metodes (apzīmētas ar burtiem). Kuras no minētajām gēnu inženierijas metodēm būtu pielietojamas aprakstīto problēmu risināšanā (viena metode var būt pielietojama vairāku problēmu risinā-
šanā)? a) Šūnās ievadīts gēns, kurš ražo insekticīdus; b) šūnās ievadīts gēns, kurš padara augu izturīgu pret herbicīdiem; c) pastiprināta baktēriju dabiskā spēja pārstrādāt organiskās vie-
las; d) baktēriju hromosomā ienests gēns, kurš ražo noteiktu hormonu; e) ģenētiski pārveidoti augi, lai to saknes būtu uzņēmīgas pret gumiņbaktērijām; f) baktēriju hromosomā ienests gēns, kurš ražo vīrusu vai baktēriju virsmas olbaltumvielas, pēc kurām tos dabiskos apstāk-
ļos atpazīst imūnsistēma; g) jauna ģenētiskā materiāla ievadīšana cilvēka šūnās. 1) Lielu daļu kokvilnas pogaļu bojā kaitēkļi - kokvilnas pūcītes kāpuri; 2) kviešu ražu samazina laukos augošās nezāles; 3) jūras piekrasti piesārņojusi nafta; 4) daudzi cilvēki slimo ar diabētu - insulīna nepietiekamību organismā; 5) nepietiekams slāpekļa saturs augsnē; 6) nepieciešamība iegūt mājdzīvniekus ar lielāku muskuļu (liesās gaļas) masu; 7) vakcinēšana reizēm izraisa pacienta saslimšanu; 8) daudzi cilvēki cieš no Parkinsona slimības, kuru izraisa neiroaktīvās vielas dopamīna trūkums smadzenēs; 9) nav atrasta ārstēšanas metode tādām slimībām kā vēzis, AIDS, dažādas garīgās slimī-
bas. 6. Raksturojiet kādu ar gēnu darbību saistītu problēmu, kura nav minēta iepriekšējā uzdevumā! Kāds varētu būt šīs problēmas perspektīvais risinājums, izmantojot gēnu inženierijas metodes ? 7. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem gēnu inženierija, transgēns organisms, ģenētiski modificēts, klonēšana! 6.3. SELEKCIJA Augu un dzīvnieku selekcija Selekcija ir kompleksa zinātne, kas balstās uz ģenētikas un citām bioloģijas likumsakarībām. Selekcija rada jaunas kultūraugu un mājdzīvnie-
ku šķirnes un mikroorganismu celmus, kā arī uz-
labo esošās šķirnes. Selekcijas galvenie virzieni ir 1) augu, dzīvnieku un mikroorganismu šķirņu un sugu daudzveidības izpēte; 2) lauksaimniecības augu un dzīvnieku iedzim-
tības likumsakarību noteikšana hibridizācijas pro-
cesā; 3) vides lomas izpēte augu un dzīvnieku pazīm-
ju un īpašību attīstībā; 4) tādu mākslīgās izlases metožu izstrādāšana, kuras sekmētu vēlamo pazīmju nostiprināšanos augu un dzīvnieku šķirnēm, kā arī mikroorganis-
mu celmiem. Cilvēka darbības rezultātā mākslīgi radītu īpat-
ņu kopumu ar iedzimstošām morfoloģiskām, bio-
loģiskām un saimnieciskām īpašībām sauc par šķirni (augiem un dzīvniekiem) vai celmu (mikro-
organismiem). Veicot selekcijas darbu, nepieciešama izejmate-
riāla ieguve un izpēte, hibridizācija un mākslīgā izlase. Par izejmateriālu izmanto dabā jau esošās formas. Tās var būt gan savvaļas sugas, gan cil-
vēka radītas šķirnes. Jo daudzveidīgāks ir selek-
cijas izejmateriāls un plašāks genofonds, jo selek-
cionāriem paveras lielākas iespējas izveidot augst-
vērtīgas šķirnes. 20. gs. divdesmitajos un trīsdesmitajos gados Nikolajs Vavilovs konstatēja, ka augu formu daudz-
veidība dažādos zemeslodes rajonos ir atšķirīga. Vislielākā augu sugu un formu daudzveidība ir ta-
jos rajonos, kuros atrodas senie kultūraugu izcel-
šanās centri. N. Vavilovs izdalīja septiņus kultūr-
augu izcelšanās centrus: 1) tropiskās Dienvidāzijas; 2) Austrumāzijas; 3) Dienvidrietumu Āzijas; 4) Vi-
dusjūras reģiona; 5) Abesīnijas; 6) Centrālame-
rikas un 7) Andu jeb Dienvidamerikas centru (sk. 6.30. att.). Vēlāk, izplatoties tālāk no šiem cen-
triem, kultūraugi ieņēma sugai mazāk piemērotus rajonus. Tajos formu daudzveidība kādai sugai ir mazāka nekā izcelšanās centrā. Vissenākie kultūraugi ir kvieši. Tie ir pirmais labības augs, ko cilvēks iesēja tīrumā. Senajā Ēģiptē audzēja kviešus, salātus, kāpostus, melones, pupas, redīsus, sīpolus, ķiplokus. Attīstoties kuģniecībai un tirdzniecībai, sākās kultūraugu izplatīšanās no to izcelšanās centriem pa visu pasauli. Kad eiro-
pieši atklāja Ameriku, tur tika atrasti dažādi dār-
zeņi, kādus Eiropā nepazina, to skaitā kartupeļi, tomāti. 16. gadsimtā spāņi tos aizveda uz savu dzimteni, pēc tam tie pamazām izplatījās pa visu Eiropu. Daudzus dārzeņus Eiropā sāka audzēt ti-
kai 19. gadsimtā. Selekcionāriem vēlamās pazīmes ir jāapvieno vienā indivīdā, kā arī jāatbrīvojas no nevēlamām pazīmēm. Lai to paveiktu, jāņem vērā pazīmju iedzimšanas likumsakarības, kā arī mērķtiecīga krustošana un izlase. Augu un dzīvnieku selekcijā lieto radniecisko krustošanu jeb inbrīdingu, neradniecisko krusto-
šanu jeb autbrīdingu un attālo hibridizāciju. Inbrīdings ir tuvu radniecīgu īpatņu krusto-
šana. Augu valstī inbrīdings notiek pašapputes augiem vai arī svešapputes augiem, apputeksnējot tos ar paša putekšņiem. Inbrīdingu bieži lieto, lai novērtētu šķirņu ģe-
nētisko sastāvu. Radnieciskās krustošanas rezul-
tātā populāciju var sadalīt daudzās ģenētiski atšķi-
rīgās līnijās - tīrajās līnijās. Inbrīdinga rezultātā gēni, kas atradās heterozigotiskā stāvoklī, pāriet homozigotiskā stāvoklī. Tas noved pie depresijas -
organismu dzīvotspējas un produktivitātes sama-
zināšanās. Taču atsevišķām tīrajām līnijām var parādīties dažas vērtīgas pazīmes, piemēram, ātr-
audzība, neuzņēmība pret slimībām. Sakrustojot dažādu tīro līniju pārstāvjus, var samazināt vai likvidēt inbrīdinga kaitīgo ietekmi un iegūt orga-
nismus ar noteiktām, vēlamām īpašībām. Sugām, kurām raksturīga pašappute, ir maz kai-
tīgu recesīvo gēnu, tāpēc tām depresija nenotiek. Autbrīdings ir tādu vienas sugas īpatņu krus-
tošana, kuriem iepriekšējās 4-6 paaudzēs nav ko-
pīgu senču. Neradnieciskās krustošanas gadījumā kaitīgās recesīvās mutācijas no homozigotiskā stā-
vokļa parasti pāriet heterozigotiskā stāvoklī un neizpaužas. Autbrīdingā bieži tiek novērota he-
teroze - paaugstināta hibrīdu dzīvotspēja, aug-
lība, augšanas ātrums un produktivitāte salīdzi-
nājumā ar vecākformām. Visspilgtāk heteroze iz-
paužas pirmajā paaudzē. Pēc tam tā pakāpeniski samazinās. Heterozi izmanto gan augkopībā, gan lopkopī-
bā. Bieži lieto inbrīdingu, bet pēc tam autbrīdingu, kas rada spēcīgu heterozi. Ar heterozes palīdzību ir iegūtas dējējvistas, kuras gadā vidēji izdēj 250 olas, gaļas cāļi, kuri divu mēnešu vecumā sasniedz 1,6 kg masu, kā arī cūku šķirnes ar lielu masu. Attālā hibridizācija ir dažādu sugu indivīdu krustošana vai - dažkārt - arī ģeogrāfiski attālu formu krustošana. Ar attālo hibridizāciju iespē-
jams apvienot dažādu sugu vai šķirņu derīgās īpa-
šības (augsta ražība, salcietība u. c.). Piemēram, plūmju šķirne 'Skoroplodnaja' ir Ķīnas un Ame-
rikas hibrīdplūmes šķirnes 'Climax' un Usūrijas plūmes hibrīds. Tā ir šķirne, kas ātri sāk ražot, zied agrāk par citām plūmju šķirnēm un kam aug-
ļus var novākt pirms gatavības. Reizēm attālo hibridizāciju lieto arī dzīvnieku selekcijā. Piemēram, mūļi ir zirga mātītes un ēzeļa tēviņa hibrīdi. Tie ir spēcīgi un izturīgi dzīvnieki, kas labi noder darbam. Tā kā mūļi ir neauglīgi, viņus var iegūt tikai hibridizācijas ceļā. Augu selekcijā plaši izmanto poliploīdus orga-
nismus. Tie parasti ir lielāki, ražīgāki un bieži vien arī izturīgāki pret slimībām. Poliploīdas ir dau-
dzas graudaugu, kartupeļu, augļu koku (ābeļu, bumbieru, plūmju), dažādu puķu un citu kultūr-
augu šķirnes. Svarīga selekcijas procesa sastāvdaļa ir māk-
slīgā izlase. Izšķir masveida mākslīgo izlasi un individuālo mākslīgo izlasi. Masveida izlase ir in-
divīdu novērtēšana pēc fenotipa (ārējā izskata, ra-
žības, izturības pret slimībām utt.), nepārbaudot atsevišķu īpatņu genotipus. Izlase ir pozitīva, ja pavairošanai izvēlas vai-
rākus fenotipiski labākos indivīdus, bet negatīva, ja no populācijas izbrāķē vājāk attīstītos indivīdus. Masveida izlasi visbiežāk lieto svešapputes augu selekcijā. Lai iegūtās šķirnes būtu kvalitatīvākas, izlase ir jāatkārto vairākkārt. Individuālā izlase ir indivīdu genotipa novēr-
tēšana. To izmanto pašapputes augu un dzīvnieku selekcijā. Svešapputes augiem individuālo izlasi veikt ir sarežģītāk. Selekcijas darbs Latvijā 20. gs. sākumā Latvijā sāka veidoties pirmās selekcijas un izmēģinājumu saimniecības un uz-
sākti sistemātiski zinātniskie pētījumi. Pagājušā gadsimta trīsdesmito gadu beigās Latvijā darbojās 17 selekcijas un izmēģinājumu stacijas. Daļa no tām, piemēram, Priekuļu, Stendes, Pūres, arī paš-
laik turpina darbu. 1946. gadā nodibināja Zinātņu akadēmijas Augs-
nes zinību un zemkopības institūtu. 1956. gadā uz šī institūta bāzes izveidoja Latvijas Zemkopības zi-
nātniskās pētniecības institūtu, kuram tika pa-
kļautas selekcijas un izmēģinājumu stacijas. Uz institūta bāzes izveidojās arī Latvijas Valsts zem-
kopības zinātniskās pētniecības institūts "Agra". Augsnes zinību un zemkopības institūta dārz-
kopības nodaļu vadīja Jānis Sudrabs. 20. gs. sešdes-
mitajos gados izveidojās augļkopības selekcijas labo-
ratorija Dobelē. To ilgus gadus vadīja Pēteris Upītis. Dārzkopības speciālisti pētīja, kā izveidot jau-
nas, labākas šķirnes, kādus potcelmus lietot, kā cīnīties ar augļu koku slimībām un kaitēkļiem, kā-
du augļu dārzu audzēšanas tehnoloģiju pielietot, lai ik gadu iegūtu augstu ražu. Pūres izmēģinājumu stacijā selekcijas darbu ar plūmēm sāka Antons Spolītis, Olga Romanovska -
ar ķiršiem, Aleksis Vāvere un Ilmārs Zunde - ar ābelēm. Anna Meļehina Pūrē nodarbojās ar upeņu selekciju, bet Alberts Tīcs - ar cidoniju selekciju. Alūksnē Vilis Bleijers veica selekcijas darbu ar saldajiem ķiršiem, bumbierēm un citiem augļu ko-
kiem. 1954. gadā Iedzēnos selekciju uzsāka Alek-
sandrs Maizītis, Rūdolfs Āboliņš un citi zinātnie-
ki. Viņi ir izveidojuši ābeļu šķirnes - Tedzēnu', 'Forele', 'Atvasara', saldo ķiršu šķirnes 'Agris', 'Balzams', 'Dzintars' un citas. Daudzpusīgu selekcijas darbu ir veicis Pēteris Upītis. Viņš savu darbību sāka 1953. gadā Dobeles kokaudzētavā "Lauciņi". Tika izveidoti selekcijas Mikroorganismu selekcija Mikroorganismu selekcijas rezultātā iegūst tā-
du baktēriju vai sēņu celmus, kurus var izmantot dažādu vielu, piemēram, fermentu, aminoskābju, raugu, antibiotiku, vitamīnu ražošanai. Mikroor-
ganismu selekcija ir ļoti cieši saistīta ar bioteh-
noloģiju - dažādu nozīmīgu vielu un medikamentu ieguvi, izmantojot mikroorganismus, kā arī augu un dzīvnieku šūnas. Mikroorganismu selekcijā ir šādas metodes: 1) dabā esošo klonu mākslīgā izlase; 2) inducētā (ierosinātā) mutaģenēze; 3) mutantu mākslīgā izlase; 4) piemērotu celmu ieguve ar hibridizācijas un gēnu inženierijas palīdzību. Inducēto mutāciju iegūšanai izmanto rentgen-
starus, ultravioletos starus, kā arī ķīmiskos mu-
tagēnus, piemēram, kolhicīnu. Ar selektīvo ba-
rotņu palīdzību atlasa noderīgākos klonus. dārzi, kuros bija vairāk nekā 60 tūkstoši augu (ābeļu, bumbieru, saldo un skābo ķiršu, aprikožu, persiku, cidoniju, lazdu, valriekstu, zemeņu, ave-
ņu, upeņu, jāņogu, ērkšķogu un dekoratīvo augu). P Upītis izveidojis tādas ābeļu šķirnes kā 'Velte', 'Ilga', plūmju šķirnes - Kaukāza plūmes 'Agrā dzeltenā', 'Spīdola', veicis aprikožu aklimatizāciju, atlasījis vērtīgākos ceriņu sēklaudžus un ieguvis jaunas ceriņu šķirnes. Panākumus ogulāju selekcijā guvis Arvīds Vīksne. Viņš izveidojis ērkšķogu šķirnes 'Koknese' un 'Veldze'. Latvijā veikti darbi arī kartupeļu, zirņu, miežu, stiebrzāļu, graudaugu, cukurbiešu selekcijā. Izvei-
dotas jaunas lauksaimniecības dzīvnieku šķirnes, piemēram, Latvijas brūnās govis, Latvijas tumš-
galves aitas, Latvijas baltās cūkas, Latvijas brau-
camzirgi. 1978. gadā radīts "Selekss" - lopkopības informācijas sistēma, kurā apkopoti ciltslietu dati. Tā dod iespēju saimniecībām izvēlēties labākos vaisliniekus. Mūsdienās meža koku sugu selekcijas pētījumi tiek turpināti Latvijas Valsts mežzinātnes insti-
tūtā "Silava". Selekcijas darbs ar atsevišķām augu sugām notiek arī Latvijas Nacionālajā botāniskajā dārzā un Latvijas Universitātes botāniskajā dārzā. Piemēram, plašus pētījumus rododendru selekcijā veicis Rihards Kondratovičs. Gēnu inženierijas izmantošana paver plašas iespējas mikroorganismu selekcijā. Ja baktēriju šūnās ievada noteiktus gēnus, tie var likt sintezēt specifiskus fermentus, hormonus, medikamentus vai kādas citas bioloģiski aktīvas vielas. Ar mikroorganismu selekciju ir nodarbojušies arī Latvijas mikrobiologi, kuri radījuši augstražī-
gus citronskābes un nikotīnskābes producentus. Ir izstrādāta metode lizīna ieguvei. Lizīns ir neaiz-
stājama aminoskābe, kas nepieciešama lopbarības ražošanā. No mikroorganismiem producēti arī da-
žādi fermenti un vitamīni. Ar gēnu inženierijas metodēm no mikroorganismiem ir iegūti nozīmīgi medikamenti - interferons, interleikīns un citi. 1. Kas ir selekcija ? 2. Kādus hibridizācijas veidus izmanto augu un dzīvnieku selekcijā? 3. Kas ir masveida izlase? Kas ir individuālā izlase? 4. Kāda ir mikroorganismu selekcijas nozīme ? 5. Noskaidrojiet, kuriem mājdzīvniekiem un kultūraugiem ir izveidotas dažādas šķirnes! 6. Nosauciet vienas mājdzīvnieku sugas un vienas kultūraugu sugas dažādas šķirnes! 7. Kuras no minētajām pazīmēm piemīt sugai, kuras - šķirnei! I) Radusies dabiski evolūcijas rezultātā; 2) radusies cilvēka mērķtiecīgas darbības rezultātā; 3) ietver radniecīgus, bet ģenētiski daudzveidīgus organismus; 4) ietver ģenētiski ļoti tuvu radniecīgus organismus; 5) savā starpā krustojas un dod auglīgus pēcnācējus; 6) savā starpā nekrustojas (tikai daži izņēmumi) un nedod auglīgus pēcnācējus; 7) salīdzinoši liels gēnu fonds; 8) salīdzinoši mazāks gēnu fonds. 8. Krievu zinātnieks Nikolajs Vavilovs izdalīja 7 svarīgākos kultūraugu izcelšanās centrus: 1 - Dienvidāzija; 2 - Austrumāzija; 3 - Dienvidrietumu Āzija; 4 - Vidusjūra; 5 - Abesīnija; 6 - Centrālamerika; 7 - Dienvidamerika. Nosauciet, no kurienes ir ievesti un aklimatizēti Latvijā audzētie kultūraugi: kartupeļi; tomāti; gurķi; sīpoli; ķiploki; kāposti; kukurūza; kvieši; zirņi! Papildiniet šo augu sarakstu pēc savas izvēles! 9. Kuras no nosauktajām pazīmēm raksturo inbrīdingu, kuras - autbrīdingu un attālo hibridi-
zāciju ? 1) Tuvu radniecīgu īpatņu krustošana; 2) attāli radniecīgu īpatņu krustošana; 3) dažādu sugu vai dažādu vienas sugas rasu krustošana; 4) krustošanas rezultātā iegūtie pēcnācēji ir auglīgi; 5) krustošanas rezultātā iegūtie pēcnācēji var būt neauglīgi; 6) gēni no heterozigotiska stāvokļa pāriet homozigotiskā stāvoklī; 7) gēni no homozigotiskā stāvokļa pāriet heterozigotiskā stāvoklī; 8) krustošanas rezultātā samazinās ģenētiskā daudzveidība; 9) krustošanas rezultātā palielinās ģenētiskā daudzveidība; 10) samazinās organismu dzīvotspēja un produktivitāte; II) palielinās organismu dzīvotspēja un produktivitāte. 10. Daudzām mājdzīvnieku šķirnēm ir noteiktas veselības problēmas, piemēram, čau-čau šķir-
nes suņiem mēdz parādīties diatēze - alerģiski ādas izsitumi. Arī kultūraugu šķirnēm ir savi "vājie punktiKāds ir šo problēmu zinātniskais izskaidrojums ? Kā tās varētu risināt ? 11. Viens no lielākajiem sasniegumiem mājlopu selekcijā Latvijā ir govju šķirnes 'Latvijas brūnā9 izveide 1922. gadā. Kādas govju šķirnes Latvijā tiek audzētas šobrīd? Kādas ir šo šķirņu raksturīgākās pazīmes ? 12. Noskaidrojiet, kad un kur tika pieradināti mūsdienu mājdzīvnieki! 13. Papildiniet savu skaidrojošo vārdnīcu ar jēdzieniem šķirne, selekcija, inbrīdings, autbrīdings! SKAIDROJOŠĀ VĀRDNĪCA A Adenīns (A) - viena no slāpekli saturošām bāzēm, kas veido DNS un RNS nukleotīdus. ADP (ADF, adenozīndifosfāts) - divas fosfātgru-
pas saturošs nukleotīds, kas var piesaistīt vēl vienu fosfātgrupu un kļūt par ATP Aerobā elpošana - glikozes aerobā noārdīšana, kas sastāv no citoplazmā notiekošās glikolīzes, Krebsa cikla un elektronu transporta mitohondrijos. Rezultātā veidojas oglekļa dioksīds, ūdens un visbiežāk 38 ATP Aktīns - muskuļu olbaltumviela, kas muskuļšķiedrā veido plānus diedziņus. Tā kustības saīsina muskuļšķiedru, radot muskuļa kontrakciju. Aktīvais centrs - fermenta virsmas rajons, kurā notiek substrāta pievienošanās un realizējas reakcija. Aktīvais transports - plazmatiskās membrānas proteīnu pārnesēju izmantošana daļiņu pārvietošanā no vietas ar zemāku vielas koncentrāciju uz vietu ar augstāku koncentrāciju pretēji koncentrācijas gradientam; tā norisei nepieciešama enerģija. Alantojs - embrija apvalks, kas putniem un rāpuļiem uzkrāj slāpekļa atkritumvielas un zīdītājiem piedalās nabas asinsvadu veidošanā. Alēle - gēna alternatīva forma. Alēles atrodas vienā un tajā pašā homologo hromosomu lokusā. Alopoliploīds - indivīds, kura šūnu kodolā ir vairāk nekā 2 dažādu sugu hromosomu komplekti; veidojas, krustojoties sugām. Aminoskābe - organiska viela, kurai ir aminogrupa un hidroksilgrupa; aminoskābēm savienojoties, veidojas olbaltumviela. Amitoze - tiešā šūnu dalīšanās, kuras laikā kodols pārdalās bez precīzas hromosomu sadalīšanās pa meitšūnām. Amnijs - putniem, rāpuļiem un zīdītājiem raksturīgs embrionālais apvalks, kas veido ar šķidrumu pildītu maisu. Anabolisms (asimilācija) - savstarpēji saistītu biosintētisko procesu kopums šūnā, kas notiek, patērējot enerģiju. Anaerobs - organisms vai bioķīmisks process, tāds, kura attīstībai vai norisei skābeklis nav nepieciešams, vai ir pat kaitīgs. Analizējošā krustošana - indivīda, kuram ir dominantais fenotips, sakrustošana ar indivīdu, kuram ir recesīvais fenotips, lai noskaidrotu, vai indivīds ar dominanto fenotipu ir homozigotisks vai heterozigotisks. Anatomija - zinātne par dažādu organismu iekšējo uzbūvi. Androcejs - putekšņlapu kopa. Androcejs ir zieda vīrišķā daļa. Anterīdijs - vīrišķais dzimumorgāns dažām sēnēm, aļģēm, sūnām un papardēm. Anterīdijā attīstās vīrišķās dzimumšūnas. Antikodons - trīs tRNS nukleotīdi, kas saistās pie komplementārā mRNS kodona. Apaugļošanās - olšūnas un spermatozoīda kodola saplūšana, veidojot zigotu, kas attīstās par jauno indivīdu. Apputeksnēšana - putekšņu nokļūšana no zieda vīrišķajiem vairošanās orgāniem uz zieda sievišķajiem vairošanās orgāniem. Apputeksnēšana ir būtiska augu dzimumvairošanās procesā. Ar dzimumu saistītas alēles - alēles, kas atrodas dzimumhromosomās, bet var kontrolēt arī tādas pazīmes, kas nav saistītas ar dzimumu. Arhegonijs - sievišķais dzimumorgāns dažām sēnēm, aļģēm, sūnām un papardēm. Arhegonijā attīstās sievišķās dzimumšūnas. Asimilācija - biosintēzes reakcijas, kurās no vienkāršām vielām veidojas sarežģītas uzbūves organiskās vielas. ATP (ATF! adenozīntrifosfāts) - nukleotīds, kas satur trīs fosfātgrupas. ATī^ sašķeļoties par ADP + P, atbrīvo enerģiju, kura ir nepieciešama šūnas enerģētiskajiem procesiem. Atvārsnītes - mikroskopiskas poras augu lapās. Atvieglotā difūzija - vielu kustība koncentrā-
cijas gradienta virzienā caur specializētiem membrānas olbaltumvielu kanāliem. Audi - tādu līdzīgu šūnu grupa, kuras ir apvienotas noteiktas funkcijas veikšanai. Audu kultūra - laboratorijā mākslīgos apstākļos izaudzēti audi; parasti tos audzē šķidrā vidē. Audzējs - šūnas, kas radušās no vienas šūnas, kurai notikusi mutācija un kura pēc tam ir atkārtoti dalījusies; labdabīgs audzējs paliek tā rašanās vietā, bet ļaundabīgs audzējs rada metastāzes. Augi - valsts, kurā ir daudzšūnu eikarioti, kas no neorganiskām vielām gaismā paši sev veido barības vielas. Auglenīca - segsēkļu sievišķais vairošanās orgāns, kas izveidojas, augļlapām saaugot; sastāv no sēklotnes, irbuļa un drīksnas. Auglis - 1) zīdītāju embrionālās attīstības vēlīna stadija; 2) ziedaugu veidojums, kas attīstījies pēc apaugļošanās no auglenīcas; tajā atrodas sēklas. Autbrīdings - attāli radniecisku vienas sugas īpatņu (4-6 paaudzēs nav kopīgu senču) krustošana. Autosomas - hromosomas, kuras morfoloģiski un funkcionāli ir vienādas vīrišķajiem un sievišķajiem indivīdiem. Autotrofi - organismi, kuri dzīvībai nepieciešamās organiskās vielas sintezē no neorganiskajām vielām, piemēram, augi. B Baktērijas - sīki vienšūnas organismi; vislielākā dzīvo būtņu grupa uz Zemes. Barības vielas - dažādas vielas, ko uzņem dzīvās būtnes, lai iegūtu enerģiju. Barošanās ķēde - ekoloģiskā sistēmā savstarpēji atkarīgas sugas, ko saista barošanās attiecības. Piemēram, kāpurs barojas ar auga lapām, kāpuru pēc tam apēd putns. Bezdzimumvairošanās - vairošanās veids, kad pēcnācēji (jauni organismi) rodas tikai no viena auga vai dzīvnieka; tajā nav iesaistītas dzimumšūnas. Biokatalizatori (fermenti) - olbaltumvielas, kuras nodrošina noteiktas bioķīmiskās reakcijas norisi. Blastocels - ar šķidrumu pildīts blastulas dobums. Blastula - doba, ar šķidrumu pildīta šūnu lode, kas veidojas dzīvnieku attīstības laikā pirms gastrulas stadijas. D Denaturācija - olbaltumvielas molekulas struk-
tūras maiņa, kā rezultātā tā zaudē aktivitāti. Parasti to izraisa pH vai temperatūras maiņa. Deplazmolīze - ūdens uzņemšana un citoplazmas atgriešanās normālā stāvoklī, ja plazmolizētu (ūdeni zaudējušu) šūnu ievieto tīrā ūdenī. Detrīts - organiskas vai daļēji mineralizētas organismu atliekas ūdenī. Difūzija - molekulu pārvietošanās no vietas, kur to koncentrācija ir lielāka, uz vietu, kur tā ir mazāka, līdz koncentrācijas izlīdzinās; difūzija notiek bez enerģijas patēriņa. Dīglis - 1) augiem - sēklā ieslēgts jaunā auga aizmetnis, kas sastāv no dīgļsaknes, dīgļstumbra un dīgļlapām; 2) dzīvniekiem -
organisma attīstības stadija no olšūnas apaugļošanās (partenoģenēzes gadījumā -
no olas aktivācijas momenta) līdz dzimšanai. Dīgļlapa - 1) ziedaugu sēklas sastāvdaļa; 2) mu-
gurkaulnieku embrija primārā audu kārta -
ektoderma, entoderma vai mezoderma. Dīgļpumpurs - ziedaugu dīgļa sastāvdaļa, no kura attīstās jaunās lapas. Dīgļsoma - ziedaugu megagametofīts, kurā ir olšūna. C Celuloze - polisaharīds; galvenā augu šūnapvalku sastāvdaļa. Centromēra - vieta, kas hromosomā satur kopā māshromatīdas. Centrosoma - šūnas mikrocaurulīšu veidošanās centrs, kas dzīvnieku šūnām sastāv no divām centriolām. Citokinēze - citoplazmas dalīšanās, kas seko pēc mitozes un mejozes. Citoloģija - zinātne, kas pētī augu vai dzīvnieku šūnu uzbūvi, attīstību un šūnu sastāvdaļu funkcijas. Citoplazma - šūnas saturs, kas aizpilda telpu starp kodolu (baktērijām - nukleoīdu) un šūnas membrānu. Citoskelets - tīklojums šūnas citoplazmā, kas sastāv no mikrocaurulītēm, aktīna diedziņiem un starpdiedziņiem. Citozīns - viena no četrām slāpekļa bāzēm, kas ir DNS un RNS nukleotīdu sastāvā. Dīgšana - sēklu vai sporu augšanas sākuma stadija, parasti pēc miera perioda. Diploidāls (2n) - organisms, kura šūnās esošās hromosomas ir pa pāriem; sugai raksturīgais hromosomu skaits. Disimilācija - šūnā esošo bioķīmisko procesu kopums, kuriem raksturīga vielu noārdīšana un enerģijas izdalīšanās. Divdīgļlapji - ziedaugi, kuriem ir divas dīgļlapas; viena no ziedaugu klasēm. Lielākā daļa koku pieder pie divdīgļlapju klases. Divdzimumu zieds - zieds, kurā veidojas gan putekšņlapas, gan augļlapas. Divkāršā apaugļošanās - ziedaugu viena sper-
mija saplūšana ar olšūnu un otra spermija sa-
plūšana ar dīgļsomas diploīdo šūnu (centrālo kodolu). Divmāju augs - augs, kuram putekšņi un sēklaizmetņi veidojas uz dažādiem īpatņiem. Dominantā alēle - gēna alēle, kas nosaka pazīmi; ja alēles ir heterozigotiskā stāvoklī; tā nomāc recesīvās pazīmes izpausmi. Drīksna - ziedaugu auglenīcas daļa, pie kuras pielīp ziedputekšņi, lai varētu notikt apaugļošanās. Drostalošanās - dzīvnieku attīstības sākuma stadija, kuras laikā notiek zigotas dalīšanās bez citoplazmas palielināšanās. Dzeltenuma maiss - ārpusembrija apvalks, kas oldējējiem satur embrija barošanai nepieciešamās vielas; placentāļiem tā ir vieta, kur vispirms veidojas asins šūnas. Dzemde - paplašināta sievišķo dzimumorgānu daļa, kura izvada olas ārējā vidē vai arī nodrošina embrija attīstību līdz piedzimšanai. Dzimumhromosomās - hromosomas, kas nosa-
ka indivīda dzimumu. Sievietēm ir divas X hro-
mosomas, bet vīriešiem ir X un Y hromosoma. Dzimumšūnās - īpašas šūnas (gametas), kas piedalās dzimumvairošanās procesā. Dzimumvairošanās - vairošanās, kas saistīta ar mejozi, dzimumšūnu (gametu) veidošanos un apaugļošanos; rezultātā rodas pēcnācēji, kuri manto gēnus no abiem vecākiem, bet gēnu kombinācija ir unikāla. E Eikariotiska šūna - šūna, kurai ir kodols un ar membrānām klāti organoīdi; sastopama eikariotos. F Fagocitoze - process, kurā amēbveida šūna ieskauj vielas, veidojot iekššūnas vakuolu; leikocīti fagocitozes procesā iznīcina baktērijas. Ekoloģija - zinātne par organismu un vides attiecībām. Ekosistēma - organismi kopā ar abiotisko vidi, kurā tie mīt; tai raksturīga enerģijas plūsma un neorganisko vielu riņķojums. Eksocitoze - process, kurā vielas tiek izvadītas no šūnas, veidojoties pūslīšiem, kuri saplūst ar plazmatisko membrānu. Eksons - DNS koda daļa gēnā, kas nosaka polipeptīda veidošanos. Elpošana - sarežģīts daudzpakāpju process, kurā, oksidējoties barības vielām, atbrīvojas enerģija. Embrijs - 1) daudzšūnu organismu attīstības stadija, kas rodas no zigotas; 2) sēklaugiem embrijs ir dīglis, kas atrodas sēklā. Embrioloģija - zinātne, kas pētī organisma attīstību pirmsdīgļa (dzimumšūnu veidošanās, apaugļošanās), dīgļa un augļa stadijā. Endocitoze - process, kurā šūnā no apkārtējās vides tiek uzņemtas cietu vielu daļiņas (fagocitoze) vai šķidruma pilieni (pinocitozē). Endokrīnais dziedzeris - iekšējās sekrēcijas dziedzeris; tam nav izvadkanāla; tā veidotie hormoni nonāk tieši asinīs. Endosperma - ziedaugu sēklas barības rezerves audi, kas veidojas pēc spermija saplūšanas ar sēklaizmetņa sekundāro kodolu. Enzīms - sk. Ferments. Epiderma - 1) augu audi, kas klāj saknes, lapas un lakstaugu stumbru; 2) zīdītāju ādas virsējā kārta jeb virsāda. Epistāze - parādība, kad kāds gēns nomāc cita, neatkarīgi pārmantota gēna izpausmi. Epitēlijaudi - dzīvnieku audi, kas pārsedz organismu no ārpuses un izklāj iekšējos dobumus. Etoloģija - zinātne par dzīvnieku uzvedību. Evolūcija - ģenētiski un fenotipiski atšķirīgu un konkrētajiem vides apstākļiem labāk piemērotu organismu veidošanās laika gaitā no kopējiem senčiem. Fenotips - genotipa redzamā izpausme, piemēram, brūnas acis vai pie galvas pieaugušas ausu ļipiņas. Ferments (enzīms) - biokatalizators, parasti olbaltumviela, kas paātrina šūnās notiekošās reakcijas; tā molekulas forma atbilst reaģenta molekulas formai. Filtrācija - ūdens un tajā izšķīdušu vielu sūkšanās caur puscaurlaidīgu membrānu gravitācijas vai spiediena ietekmē. Fizioloģija - zinātne, kas pētī organismā, tā orgānu sistēmās, audos un šūnās notiekošos dzīvības procesus. Floēma (lūksne) - auga audi, pa kuriem tiek transportētas organiskās vielas. Fotolīze - šķidru, cietu vai gāzveida vielu sadalīšanās gaismas iedarbībā. Fotosintēze - process, kas notiek hloroplastos; tā laikā šīs hlorofilu saturošās plastīdas uztver gaismas enerģiju un izmanto to ogļhidrātu veidošanai no ogļskābās gāzes. Fragmentācija - nelielu fragmentu atdalīšanās no organisma un jaunu organismu veidošanās no tiem. Gēnu terapija - bioinženierijas ceļā iegūtu šūnu vai biotehnoloģijas metožu izmantošana cilvēka iedzimto slimību ārstēšanā. Glikolīze - anaerobā glikozes sašķelšana, kuras rezultātā rodas divas ATP molekulas. Gonāda (dzimumdziedzeris) - orgāns, kurā veidojas gametas; olnīca, kurā veidojas olšūnas, un sēklinieks, kurā veidojas sperma. Gremošana - process, kurā notiek uzņemto barības vielu sasmalcināšana, sašķelšana un uzsūkšana. Ģenētika - zinātne par iedzimtību un tās likumsakarībām. G,Ģ Gameta - haploidāla dzimumšūna. Gametangijs - aļģu, sēņu un sūnu dzimumvai-
rošanās orgāns, kurā attīstās dzimumšūnas. Gametofīts - augu dzīves cikla haploidālā paaudze, uz kuras attīstās veidojumi, kuros rodas gametas; tām saplūstot, rodas zigota. Gametoģenēze - dzimumšūnu veidošanās. Gastrula - dzīvnieka attīstības stadija, kuras laikā, lodveida dīglim vismaz daļēji ieliecoties, veidojas dīgļlapas. Gēna lokuss - noteikta gēna atrašanās vieta hromosomā. Genoms - jebkura organisma vai arī vīrusa visu gēnu kopums. Genotips - gēni, kas nosaka pazīmes organismā, piemēram, BB vai Aa. Gēns - iedzimtības vienība; DNS vai RNS frag-
ments, kas nosaka kādu organisma pazīmi. Gēnam ir 2 alēles, no kurām vienu manto no viena vecāka, bet otru - no otra vecāka. Gēnu inženierija - tehnoloģija, ar kuras palīdzību tiek pārmainīts šūnas genoms, lai to varētu izmantot medicīnā vai rūpniecībā. H Haploidāls (n) - hromosomu skaits šūnā, kas atbilst pusei hromosomu no katra hromosomu pāra. Hemofilija - iedzimta slimība, kam raksturīga pavājināta asins sarecēšana. Hemoglobīns - dzelzi saturošs elpošanas pigments, kas atrodas mugurkaulnieku eritrocītos un daudzu bezmugurkaulnieku asins plazmā; tas saista skābekli, veidojot oksihemoglobīnu. Hemosintēze - organisko vielu sintēze no neorganiskajām, izmantojot neorganisko vielu oksidēšanas procesā iegūto enerģiju. Hermafrodīti - organismi, kuriem ir gan sievišķie, gan vīrišķie vairošanās orgāni, piemēram, sliekas. Hemostāze - asiņošanas apstāšanās vai apturēšana; asiņu sastrēgums. Heterogāmija (oogāmija) - dzimumvairošanās process, kurā saplūst atšķirīga lieluma un kustīguma dzimumšūnas. Heterotrofi - organismi, kuri barojas ar gatavām organiskām vielām, piemēram, dzīvnieki. Heterozigots - tāds organisms, kurā ir atšķirīgas alēles, kas nosaka konkrēto pazīmi. Hibridizācija - dažādu formu un sugu krustošana. Hibrīds - divu atšķirīgu vecākorganismu pēcnācējs. Hidrofila viela - viela, kuras molekulas mijiedarbojas ar ūdens molekulām, šķīstot tajās vai arī veidojot ūdeņraža saites ar ūdens molekulām. Hidrofoba viela - viela, kuras molekulas ir nepolāras un nesaistās ar ūdens molekulām. Hipertonija - paaugstināts asinsspiediens, arī pa-
lielināts audu vai orgānu spraigums (tonuss). Hipertonisks šķīdums - šķīdums, kurā ir lie-
lāka sāļu koncentrācija nekā šūnas citoplazmā, kā rezultātā šūna osmozes ceļā zaudē ūdeni. Hipotonija - pazemināts audu vai orgānu spraigums (tonuss). Hipotonisks šķīdums - šķīdums, kurā sāļu koncentrācija ir mazāka nekā šūnas citoplazmā, kā rezultātā šūna osmozes ceļā pievieno ūdeni. Histoloģija - zinātne par audu uzbūvi un funkcijām. Hlorofils - zaļais pigments, kas absorbē gaismas enerģiju; tam ir nozīme aļģu un augu fotosintēzē. Ir hlorofils a un hlorofils b. Hloroplasts - ar membrānām klāts aļģu un augu organoīds, kurā ir hlorofilu saturoši tilakoīdi, kuros notiek fotosintēze. Holesterīns - viens no izplatītākajiem lipīdiem dzīvnieku šūnu plazmatiskajā membrānā. Tas neļauj caur membrānām izplūst daudzu vielu molekulām. Homologās hromosomas - viena pāra hromosomas, kurās ir gēni, kas nosaka vienas un tās pašas pazīmes. Homozigots - zigota vai no tās attīstījies indi-
vīds, kam attiecīgā gēna alēles ir vienādas. Horijs - apvalks ap embriju, kas putniem un rāpuļiem kalpo gāzu maiņai, bet zīdītājiem piedalās placentas veidošanā. Hromatīns - no DNS un ar to saistītām olbaltumvielām veidoti pavedieni, ko var redzēt šūnas kodolā, kad šūna nedalās. Hromosoma - kodola struktūra, kas sastāv no DNS un ar to saistītām olbaltumvielām un nodod ģenētisko informāciju no vecās šūnas jaunajām un no vecākiem pēcnācējiem. I īekššūnas elpošana - vielmaiņas reakcija, kas ATP sintēzei izmanto ogļhidrātu, taukskābju vai aminoskābju noārdīšanās procesā iegūto enerģiju. Iekššūnu gremošana - mikroskopisku barības daļiņu uzņemšana un sagremošana šūnas iekšienē. K Kairinājums - pārmaiņa ārējā vai iekšējā vidē, ko uztver jušanas receptori; tā rada nervu impulsus jušanas neironos. Kairināmība - spēja sajust apkārtējās vides iedarbību (kairinājumu) un reaģēt uz to. Kalvina cikls - no gaismas neatkarīgas fotosintēzes reakcijas (tumsas fāzes reakcijas), kuru laikā tiek saistīta ogļskābā gāze un no tās rodas cukura-fosfāta molekula, ko var izmantot vai nu glikozes veidošanai, vai arī cikla sākšanai nepieciešamās vielas -
ribulozodifosfāta atjaunošanai. Šajā ciklā tiek izmantots ATP un NADPH, kas rodas gaismas fāzē. Kambijs - stumbra šūnu kārta, veidotājaudi, kas atrodas starp koksni un lūksni. Kancerogēns - faktors, kas izraisa mutācijas, kuru rezultātā var rasties vēzis. Kāpurs - daudzu bezmugurkaulnieku un dažu mugurkaulnieku attīstības stadija, piemēram, tauriņu kāpurs. Kariokinēze - mitoze; kodola dalīšanās. Imago - kukaiņu attīstības beigu stadija, kurā kukainis ir sasniedzis dzimumgatavību. Implantācija - placentāļu zīdītāju embrija blastocistas iestiprināšanās dzemdes sienā. Imunitāte - organisma spēja aizsargāt sevi no svešām vielām un šūnām, arī infekciju izraisītājiem. Inbrīdings - tuvu radniecīgu vienas sugas īpatņu krustošana. Interfāze - šūnas dzīves cikla fāze no vienas dalīšanās līdz otrai. Introducētas sugas - sugas, kuras cilvēks ir nejauši vai apzināti ieviesis tādā ekosistēmā, kur tās agrāk nav bijušas. Introdukcija - sugu ieviešana ekosistēmās, kurās tās agrāk nav bijušas sastopamas. Invazīvās sugas - masveidīga kādas sugas dzīvnieku vai augu ieceļošana (ievešana) un ieviešanās kādā teritorijā. Izmiršana - sugas izzušana. Izogāmija - vienšūnas organismu dzimumvairošanās veids - divu morfoloģiski vienādu, bet fizioloģiski un bioķīmiski atšķirīgu gametu (dzimumšūnu) saplūšana. Kariotips - hromosomas, kas ir sakārtotas pa pāriem pēc to lieluma, formas un izskata mitozes metafāzē. Kauslapas - apziedņa ārējā gredzena lapas. Lielākajai daļai augu kauslapas ir zaļas, bet dažiem augiem tās ir košā krāsā un ļoti līdzīgas vainaglapām. Klasifikācija - dzīvo būtņu sagrupēšana, lai parādītu to radniecības pakāpi. Klons - identiskas kopijas; organismi ar vienādiem gēniem; daudzas identiskas gēnu kopijas gēnu inženierijā. Klonēšana - ģenētiski identisku šūnu vai organismu radīšana bezdzimumvairošanās ceļā. Kodols - eikariotu šūnas organoīds. Vairumam šūnu kodols ir lielākais organoīds. Tajā ir vairums šūnas gēnu. Kodominēšana - iedzimtības veids, kad abas gēna alēles izpaužas vienlīdz spēcīgi. Kodons - trīs secīgi DNS vai matrices RNS nukleotīdi, kuri kodē noteiktu aminoskābi vai translācijas beigas. Kofaktors - fermenta papildinājums, kas nav olbaltumviela, bet ir nepieciešama fermenta darbībai. Kofaktori ir metālu joni vai kofermenti. Koferments (koenzīms) - organiskās vielas molekula, kas nav olbaltumviela, bet ir vāji saistīta ar fermentu un palīdz tam darboties. Kolenhīma - augu audi, kas sastāv no cita citai cieši pieguļošām šūnām ar to stūros pabiezinātiem šūnapvalkiem; tā balsta augošus stumbrus un kātus. Komplementaritāte - divu vai vairāku gēnu kopdarbība, kas dod tādu organisma īpašību, kādu nevar dod neviens no gēniem atsevišķi; tāda molekulu un to sastāvdaļu strukturālā atbilstība, kas tām ļauj savstarpēji saistīties. Komplementārie bāzu pāri - ar ūdeņraža saitēm saistītas DNS purīna un pirimidīna bāzes ( A- TunG- C). Kontrakcija - savilkšanās, saraušanās (piemēram, muskuļiem, locekļiem). Kontroles grupa - 1) paraugs, ko izmanto visa eksperimenta laikā, bet neiesaista pašā eksperimentā; 2) standarts, ko izmanto eksperimenta rezultātu pārbaudei. L Lizosoma - ar membrānu klāts pūslītis šūnā, kas satur hidrolītiskos fermentus makromolekulu sašķelšanai. Lūksne - sk. Floēma. M Makroelementi - ķīmiskie elementi, kas šūnā ir relatīvi lielā daudzumā - desmitdaļas un simtdaļas procenta no šūnas kopējās masas. Matrices (informācijas) RNS - RNS, kas veidojas uz DNS matrices un kopējot kodētu informā-
ciju par aminoskābju secību polipeptīdā; tā šo informāciju nogādā ribosomās. Megaspora - spora, kas veidojas sēklaugā no četrām sporām; tikai viena attīstās par megagametofītu (dīgļsomu). Mejoze - šūnu dalīšanās veids dzimumšūnu veidošanās laikā; katra meitšūna saņem haploīdu hromosomu skaitu. Membrāna - šūnas organoīds, ar kuru šūna ir norobežota no vides. Meristēma - nediferencēti embrionāli audi augu aktīvas augšanas rajonos. Metabolisms - visas ķīmiskās reakcijas, kas notiek šūnā tās augšanas un vairošanās laikā; vielmaiņa organismos. Metamorfoze - formas un lieluma maiņa attīstības laikā, kas raksturīga daļai dzīvnieku, piemēram, kukaiņiem. Krebsa cikls - mitohondrijos notiekošu reakciju cikls, kas sākas ar citronskābi; tajā rodas C02, ATFļ NADH un FADH2; to sauc arī par citronskābes ciklu. Krustmija (krosingovers) - hromosomu pāru hro-
matīdu apmainīšanās ar posmiem mejozes laikā. Ksilēma (koksne) - auga vadaudi, kas transportē ūdeni un izšķīdušos minerālus augšup pa augu. Tajā ir trahejas un traheīdas. Kūniņa - kukaiņu attīstības stadija starp embriju (kāpuru) un pieaugušu organismu; tajā notiek pārvērtības, pirms rodas pieaudzis indivīds. Kutikula - 1) vaska kārtiņa, kas pārklāj auga epidermu un pasargā augu no ūdens zuduma un slimības izraisošiem organismiem; 2) daudzu bezmugurkaulnieku ārējais apvalks, piemēram, posmtārpiem, posmkājiem. Metastāzes - audzēja izplatīšanās no rašanās vietas pa visu organismu; tās izraisa vēža šūnu spēja pārvietoties un invadēt audus. Mezofils - iekšējā biezākā lapas kārta, kas sastāv no parenhīmas; tajā notiek fotosintēze. Mielīna apvalks - balts, taukiem līdzīgs apvalks ap nervu šķiedru. Mikrocaurulīte - sīks, cilindrisks organoīds; sastopama citoplazmā, centriolās, vicās un skropstiņās. Mikroelementi - ķīmiskie elementi, kuru daudzums šūnā ir ļoti mazs - tūkstošās daļas procenta no šūnas kopējās masas. Mikrogametofīts - sēklaugu gametofīts, kas veido vīrišķās dzimumšūnās - putekšņus. Mikroorganismi - dzīvās būtnes, kuras var sa-
skatīt tikai mikroskopā, piemēram, baktērijas. Miofibrilla - muskuļšūnas organoīds, kas sastāv no virknē sakārtotiem aktīna un miozīna diskiem, kuri pārklājas, radot muskuļu kontrakciju. Miozīns - muskuļu olbaltumviela, kas veido resnākos disku pavedienus; tas velk aktīnu un saīsina muskuļšķiedru, izraisot muskuļa kontrakciju. Mitohondrijs - ar divkāršu membrānu klāts šūnas organoīds, kurā notiek aerobā elpošana un ATP molekulu veidošanās. Mitoze - šūnas dalīšanās, kurā no vecās šūnas rodas divas meitšūnas ar tādām pašām hromosomām kā vecās šūnas kodolā. Modificēšana - gēna iedarbība uz cita nealēliska gēna izpausmi. Monēras - vienšūnas organismi, kuriem nav šūnas kodola, piemēram, baktērijas. Monēras ir viena no piecām dzīvo būtņu valstīm. Morfoloģija - zinātne par organismu formu un ārējo uzbūvi. Morula - lodveida dīglis, kas veidojas drosta-
lošanās rezultātā pirms blastulas stadijas. Multiplās (daudzkārtējās) alēles - vairākas alēles, kas nosaka vienu pazīmi; katram indivīdam ir tikai divas no šīm alēlēm. Mutācijas - gēnu (DNS sastāva), hromosomu vai hromosomu skaita pārmaiņas, kas iedzimst nākamajās paaudzēs. Mutācijas var būt kaitīgas, tomēr dažas var nejauši izrādīties ļoti veiksmīgas. N Neiroglijas šūna - nervaudu šūna, kas nevada impulsus, bet nodrošina neironu darbību, barojot un aizsargājot tos. Neirons - nervu šūna, kurai ir šūnas ķermenis, dendrīti (īsi izaugumi) un aksons (garš izaugums). Nepilnīgā dominēšana - iedzimšanas veids, kad pēcnācējam parādās starppazīme starp abu vecāku pazīmēm, piemēram, no augiem ar sarkaniem un baltiem ziediem iegūst augus ar rozā ziediem. Nesējs - heterozigotisks organisms, kuram pašam nav novirzes no normas, bet kurš var nodot tālāk kādas iedzimtas slimības recesīvo alēli. Nimfa - kāpurstadija posmkājiem, kas attīstās ar nepilnīgo pārvēršanos. Novilkšanās - dzīvnieku ārējā apvalka maiņa. Kukaiņiem, vēžiem, čūskām novilkšanās notiek augšanas laikā. Nukleoīds - baktērijas šūnas daļa, kurā atrodas iedzimtības materiāls. Mutagēns - aģents, piemeram, radiācija vai viela, kas var radīt mutāciju. O Ogļhidrāti - sastāv no oglekļa, skābekļa un ūdeņraža. Organisms ogļhidrātus izmanto kā enerģijas avotu. Oksidācija - process, kurā atoms vai molekula zaudē vienu vai vairākus elektronus; bioloģiskajās sistēmās tā parasti ir ūdeņraža atoma zaudēšana. Ola - apaugļota vai neapaugļota olšūna, no kuras attīstās jaunais dzīvnieks. Ar olām vairojas daudzi bezmugurkaulnieki, putni, vairums abinieku, zivju un rāpuļu. Olbaltumvielas - polimēri, kas veidoti no aminoskābēm, kuras kopā satur peptīdsaites. Tās sastopamas pilnīgi visos organismos. Oldzīvdzemdētājs - dzīvnieks, kura dīglis attīstās olā, kamēr tā atrodas mātītes ķermenī. Mazulis piedzimst tūlīt pēc izšķilšanās no olas. Olnīca - dzīvnieku sievišķais dzimumdziedzeris, kas izdala sievišķos dzimumhormonus un veido olšūnas. Olšūna - sievišķā dzimumšūna. Olšūnai saplūstot ar vīrišķo dzimumšūnu (spermatozoīdu), rodas zigota, no kuras attīstās jauna dzīva būtne. Ontoģenēze - organisma individuālā attīstība, kas aptver visas pārmaiņas, kuras ar orga-
nismu notiek no tā rašanās brīža līdz nāvei. Onkogēns - gēns, kas rada vēzi. Oocīts - nenobrieduši olšūna, kurā notiek mitoze. Ooģenēze (ovoģenēze) - olšūnu veidošanās sievišķajos organismos mejozes un nobriešanas rezultātā. Operators - operona DNS secība, pie kuras piesaistās olbaltumviela represors. Operons - uzbūves un regulējošo gēnu grupa, kas darbojas kā viens vesels. Organisms - dzīva būtne. Organogēnie elementi - pamatelementi (C, H, O, N), kas veido lielāko daļu organisko vielu un sastāda 98 % no organismu masas. Organoīds - struktūra šūnas citoplazmā, kas pilda kādu īpašu funkciju; parasti tā ir klāta ar membrānu. Orgāns - specializējusies auga vai dzīvnieka daļa, piemēram, smadzenes, lapa. Orgānu sistēma - saistītu orgānu grupa, kas darbojas kopīgi, piemēram, asinsrites orgānu sistēma. Osmotiskais spiediens - spiediens, kas rodas tādēļ, ka ūdens difundē cauri puscaurlaidīgai membrānai; notiek šķidruma daudzuma palielināšanās tajā mem-brānas pusē, kurā ir lielāka šķīduma koncentrācija. P Paaudžu maiņa - bezdzimumpaaudzes (sporo-
fīta) un dzimumpaaudzes (gametofīta) maiņa viena organisma dzīves laikā, piemēram, sūnām. Paleontoloģija - zinātne, kas pētī visu pagājušo ģeoloģisko periodu fosilos organismus un dzīvās dabas attīstību. Pamataudi - audi, kas veido augu pamatmasu. Pie tiem pieder parenhīma, kolenhīma un sklerenhīma, kas piedalās vielu uzkrāšanā, vielmaiņā un veic balsta funkciju. Parazīts - organisms, kas dzīvo uz cita organisma vai tā iekšienē un barojas ar tā organiskajām vielām. Parenhīma - vismazāk specializētie augu audi, kuri ir sastopami visos augu orgānos. Pārnesējolbaltumviela - olbaltumviela, kas savienojas ar kādas vielas molekulu un transportē to cauri šūnas plazmatiskajai membrānai. Pārošanās (mugurkaulnieku) - tēviņa un mātītes uzvedība dzimumvairošanās procesā. Partenoģenēze - olšūnas attīstība par pieaugušu organismu bez apaugļošanās. Pasīvais transports - vielu kustība caur šūnas plazmatisko membrānu koncentrācijas gradienta virzienā, netērējot enerģiju. Pavadītāj šūna - šūna, kas vaskulāro audu floēmā ir saistīta ar sietstobra šūnu. Penneta režģis - režģis, kas palīdz aprēķināt ģenētisko krustojumu rezultātus, uzrakstot tā augšējā un sānu malā abu vecāku alēles un to rekombinācijas kvadrātos režģa iekšpusē. Pepsīns - kuņģa sulas dziedzeru izdalītais ferments, kas sašķeļ olbaltumvielas. Peptīds - divas vai vairākas aminoskābes, kas savienotas kopā ar kovalento peptīdsaiti. Piena dziedzeri - dziedzeri krūtīs, kuros zīdītāju mātītēm veidojas piens. Pigments - organismu krāsviela, piemēram, hlorofils, hemoglobīns, rodopsīns. Pinocitoze - process, kura laikā ap vielām (šķidruma pilieniem) izveidojas pūslīši, kas ienes tās šūnā. Pirimidīni - slāpekli saturošas bāzes, kuru sastāvā ir viens gredzens, piemēram, citozīns, timīns un uracils. Plazma - mugurkaulnieku asiņu šķidrā sastāvdaļa, kas satur barības vielas, atkritumvielas, sāļus un olbaltumvielas. Plazmatiskā membrāna - membrāna, kas ieskauj citoplazmu un sastāv no fosfolipīdu dubultslāņa, kurā ir iegremdētas olbaltumvielu molekulas; tā regulē molekulu iekļūšanu šūnā un izkļūšanu no tās. Plazmīda - dubultoties spējīgs DNS gredzens, kas atrodas baktērijas citoplazmā. Plazmolīze - augu šūnas protoplasta (citoplazma ar organoīdiem) atdalīšanās no šūnapvalka, kas notiek, ja šūna atrodas šķīdumā, kuram ir augstāka osmotiskā koncentrācija nekā šūnsulai - hipertoniskā šķīdumā. Plejotropija - stāvoklis, kad viens gēns ietekmē daudzas organisma pazīmes. Polārais kermenītis - divas vai trīs » nepilnvērtīgas šūnas, kas veidojas ooģenēzes laikā. Poligēnā iedzimtība - iedzimšanas veids, kurā pazīmi kontrolē vairāki alēļu pāri; katra dominantā alēle iedarbojas līdzīgi un papildina pazīmes izpausmi. Polimērija - gēnu mijiedarbības veids, kad vienu (parasti kvantitatīvu) pazīmi rada vairāki gēni. Polimērs - makromolekula, ko veido kovalenti saistīti monomēri, piemēram, olbaltumviela ir veidota no monomēriem, ko sauc par aminoskābēm. Poliploīdija - šūnas hromosomu komplekta daudzkāršošanās. Poliribosoma - ribosomu virkne, kura vienlaikus veic viena un tā paša mRNS reģiona translāciju olbaltumvielas sintēzes laikā. Populācija - vienas sugas īpatņu grupa, kas apdzīvo noteiktu teritoriju un nedaudz atšķiras no citām populācijām. Progesterons - sievišķais dzimumhormons, kas liek dzemdes endotēlijam menstruācijas laikā izdalīties laukā; kopā ar estrogēnu tas nosaka sievietes sekundārās dzimumpazīmes. Prokariotiska šūna - šūna, kurai nav ar membrānu norobežota kodola un organoīdu, piemēram, baktērijas un arheji. Promoters - DNS secība operonā, no kuras sākas RNS polimerāzes transkripcija. Proteīns - sk. Olbaltumviela. Protisti - vienšūnas organismi ar kodolu. Protisti ir viena no valstīm dzīvo būtņu klasifikācijā. Protoplasts - auga šūna, no kuras ir atdalīts šūnapvalks. Pumpurošanās - jauna organisma veidošanās no vecā organisma izauguma (pumpura). Pumpurs - 1) neattīstīta vasa; meristēmas audi, ko pārklāj neattīstītas lapas un aizsargā pumpurzvīņas; 2) dzīvnieku ķermeņa sienas izaugums, no kura veidojas jauns indivīds. Purīni - slāpekli saturošas bāzes, kuru sastāvā ir dubultgredzeni, piemēram, adenīns un guanīns. R Recesīvā alēle - alēle, kas rada fenotipisku izpausmi tikai tad, ja tā ir homozigotiskā stāvoklī; tās izpausmi heterozigotiskā stāvoklī nomāc dominantā alēle. Reducēšana - elektronu pievienošana atomam vai molekulai, uzkrājot enerģiju; bioloģiskajās sistēmās tā ir galvenokārt ūdeņraža atomu pievienošana. Regulatorgēns - operonā esošs gēns, kas kodē represoru. Rekombinantā DNS - pārveidota DNS, kurā ienesti gēni no vairākiem organismiem. Replicēšanās - DNS molekulas dubultošanās specifisku fermentu klātbūtnē. Represors - operonā olbaltumvielas molekula, kas piesaistās operatoram, neļaujot RNS polimerāzei saistīties pie promotera piesaistīšanās vietas operonā. Ribosoma - olbaltumvielu sintēzes vieta citoplazmā, kas sastāv no divām subvienībām un olbaltumvielām. Ribosomālā RNS - RNS, kas atrodas ribosomās un koordinē antikodonu savienošanos ar ko-
doņiem olbaltumvielu sintēzes laikā. RNS (ribonukleīnskābe) - nukleīnskābe, kas veidojusies, kovalenti saistoties nukleotīdu monomēriem, kuri satur cukuru ribozi; ir trīs veidu RNS: matrices RNS (mRNS), ribosomālā RNS (rRNS) un transporta RNS (tRNS). RNS polimerāze - ferments, kas veicina RNS veidošanos uz DNS. Rodopsīns - gaismu absorbējoša viela nūjiņās un vālītēs, kas satur pigmentu un olbaltumvielu opsīnu. Puscaurlaidība - plazmatiskās membrānas spēja regulēt vielu iekļūšanu šūnā un izkļūšanu no tās, dažas vielas laižot cauri, bet citas aizturot. Putekšņi - sēklaugu mikrosporas ar vīrišķajām dzimumšūnām. Putekšnīca - vīrišķā sēklaugu vairošanās orgāna daļa, kurā veidojas putekšņi (vīrišķās dzimumšūnās). Putekšņlapa - vīrišķais sēklaugu vairošanās orgāns, kas sastāv no putekšņlapas kātiņa un putekšnīcas. s Saistaudi - dzīvnieka audi, kas saista savā starpā dažādas struktūras, veic balsta un aizsargfunkciju, aizpilda tukšās vietas, uzkrāj taukus, veido asins šūnas. Pie tiem pieder taukaudi, skrimšļaudi, kaulaudi un asinis. Saknenis (rizoms) - apakšzemes stublājs; vasas pārveidne. Sānu meristēma - meristēma, kas nodrošina auga augšanu resnumā. Saprofīti - mikroorganismi, sēnes un augi, kas barojas ar organismu atliekām. Sēkla - nobriedis sēklaizmetnis, kurā ir dīglis un barības vielas aizsargapvalks ap to. Sēklinieks - dzīvnieku tēviņa dzimumdziedzeris, kas veido dzimumšūnas un vīrišķos dzimumhormonus. Sēklotne - zieda auglenīcas daļa, kurā pēc apaug-
ļošanās veidojas sēklas. Katrā sēklotnē ir olšūna. Sekretorie audi - audi, kas veic vielu izdalīšanas (sekrēcijas) funkciju. Sekundārās dzimumpazīmes - pazīmes, kas rodas vīrišķo un sievišķo dzimumhormonu ietekmē. Selekcija - jaunu cilvēkam noderīgu augu, dzīvnieku, mikroorganismu iegūšana un līdzšinējo formu saimniecisko īpašību uzlabošana. Sietstobri - augu floēmas audu šūnas, kas ir savienotas cita ar citu un transportē sulu ar barības vielām. Sievišķais zieds - zieds, kurā nav putekšņlapu. Simbioze - divu dažādu sugu organismu kopdzīve, kurā vienam no otra ir kāds labums. Skābekļa parāds - skābekļa izmantošana anaerobās elpošanas rezultātā radītās pienskābes pārvēršanai piruvātā. Skeleta muskuļi - šķērssvītrotie, gribai pakļautie muskuļaudi, kas piestiptināti pie skeleta. Sklerenhīma - augu balstaudi, kas sastāv no šūnām ar spēcīgi sabiezinātiem šūnapvalkiem. Skropstiņas - mazi pavedienveida organoīdi šūnas virspusē. Ar skropstiņu palīdzību šūnas pārvietojas vai pārvieto šķidrumu ap tām. Š Šķērssvītrotie muskuli - sk. Skeleta muskuļi. V ' ' Šķirne - ilgstošas cilvēka darbības rezultātā izveidots mājdzīvnieku vai kultūraugu iekšsugas grupējums, kura īpatņiem ir vērtīgas saimnieciskās īpašības un pazīmes, kā arī līdzīgs izskats un pielāgotība vides apstākļiem. Slēdzējšūna - augu šūna, kas piedalās atvārsnītes veidošanā. Katra atvārsnīte sastāv no divām slēdzējšūnām, kuras, mainoties šūnas turgora spiedienam, regulē atvārsnītes spraugas lielumu. Sperma - biezs, gaišs šķidrums, kas satur spermatozoīdus un vairāku vīrišķo dzimumdziedzeru sekrētus. Spermatoģenēze - spermatozoīdu veidošanās vīrišķajos organismos mejozes un nobriešanas rezultātā. Spermatozoīds - kustīga vīrišķā dzimumšūna (gameta), kurā ir haploīdāls hromosomu skaits. Sporas - mikroskopiski vienšūnas veidojumi, ar kuriem augi un sēnes vairojas, izplatās, kā arī pārdzīvo nelabvēlīgus apstākļus; baktēriju neaktīvā stadija. Sporangiji - sēņu un sūnu bezdzimumvairoša-
nās orgāns, kurā attīstās sporas. Sporaugi - augi, kas izplatās ar sporu palīdzību (sūnas, papardes, kosas, staipekņi). Sporofīts - augu bezdzimumpaaudze. Steroīdi - lipīdi, kuru molekulas sastāv no četriem savienotiem gredzeniem, piemēram, holesterols, progesterons un testosterons. Stroma - liels hloroplasta centrālais nodalījums, kas ir pildīts ar šķidrumu, kurš satur fotosintēzei nepieciešamos fermentus. Struktūrgēns - gēns, kas kodē vielmaiņai nepieciešamu fermentu. Substrāts - viela, uz kuru iedarbojas reaģents; reakcijas izejviela. Suga - klasifikācijas pamatvienība; uzbūves ziņā līdzīgu organismu grupa, kuri spēj savā starpā krustoties un radīt sev līdzīgus auglīgus pēc-
nācējus, kā arī apdzīvo noteiktu teritoriju jeb areālu. Ja kādas sugas populācijas ir ģeogrā-
fiski izolētas un ilgstoši nošķirtas, no tām var izveidoties pasugas un jaunas sugas. Šķirtlapains vainags (kauss) - zieds ar brīvām, nesaaugušām vainaglapām (kauslapām). Sūna - visu dzīvo būtņu uzbūves pamatvienība, izņemot vīrusus. Sūnapvalks - apvalks ap augu, sēņu un baktēriju šūnām, kas piešķir tām formu un izturību. Sūnas cikls - šūnas augšanas un dalīšanās atkārtošanās. Šūnstarpu šķidrums - šķidrums, kas apskalo katru organisma šūnu. Sūnu teorija - viena no bioloģijas pamatteorijām, kas apgalvo, ka visi organismi sastāv no šūnām; šūnās notiek visi dzīvības procesi un jaunas šūnas rodas tikai no vecajām šūnām. T Taksonomija - bioloģijas nozare, kas identificē, apraksta un nosauc organismus. Tauki - sastāv no glicerīna un taukskābēm. Dzīvnieku taukos galvenokārt ir piesātinātās taukskābes, bet augu eļļās - nepiesātinātās taukskābes. Tauku reserves organisms izmanto tikai tad, ja trūkst ogļhidrātu. Tilakoīds - maisiņš hloroplasta granas iekšienē, kura membrānā ir hlorofils un notiek fotosintēzes gaismas reakcijas. T-limfocīts - limfocīts, kas nobriest aizkrūtes dziedzerī; nogalina antigēnu nesošās šūnas. Toksīni - indīgas vielas (galvenokārt olbaltumvielas), kas, nonākot cilvēka vai dzīvnieku organismā, rada audu bojājumus un dažkārt pat nāvi. Traheīda - ziedaugu koksnes (ksilēmas) šūna ar konusveida galiem un iedobumiem, caur kuriem plūst ūdens un sāļi. Traheja - 1) četrkājaino mugurkaulnieku gaisa vads, kas atrodas starp balseni un bronhiem; arī kukaiņu gaisa vadi, kas atrodas starp elpatverēm un traheolām; 2) koksnes (ksilēmas) vadaudi, kas veidojas saplūtot vairākām šūnām un atmirstot to saturam, vada ūdeni un sāļus. Transgēns organisms - vidē brīvi dzīvojošs organisms, kuram ievadīti cita organisma gēni. Transkripcija - process, kurā DNS pavediens kalpo par šablonu mRNS sintēzei. V Vadaudu cilindrs - vadaudu dzīsla augu saknēs, kas sastāv no primārās floēmas un primārās ksilēmas, kuru parasti apņem apvalks. Vadaudu kambijs - augu sānu meristēma, kas rada sekundāro floēmu un sekundāro ksilēmu. Vadaudu kūlītis - augu primārā floēma un primārā ksilēma, ko ieskauj kūlīša apvalks. Vainaglapas - iekšējās apziedņa lapas zieda apziednī. Tās bieži ir lielas un krāsainas, lai piesaistītu apputeksnētājus dzīvniekus. Valsts - dzīvo būtņu klasifikācijas augstākā vienība. Pavisam ir piecas valstis: monēras, protisti, sēnes, augi un dzīvnieki. U Urīnviela - slāpekli saturošs atkritumprodukts, kas rodas sauszemes abinieku un zīdītāju organismā un tiek izvadīts ar urīnu. Uzbudināmība - spēja reaģēt uz nervu impul-
siem ar īpašu, vienveidīgu atbildes reakciju; piemīt nervu, muskuļu un dziedzeru šūnām. Translācija - process, kurā mRNS kodonu secība nosaka (kodē) aminoskābju secību polipeptīdā. Transpirācija - ūdens izkļūšana no auga atmosfērā, kas galvenokārt notiek, iztvaikojot caur atvārsnītēm. Transporta RNS (tRNS) - RNS veids, kas olbaltumvielu sintēzes laikā piegādā ribosomām noteiktu aminoskābi. Triplets - ģenētiskā koda elementārā vienība, kurā sakombinējušies trīs blakus esošie nukleotīdi. Tie kodē vienu aminoskābi. Trombocīti (asins plātnītes) - asiņu sastāvdaļa, kas ir nepieciešama asins sarecēšanai; šūnu fragmenti. Tumsas reakcijas - fotosintēzes reakcijas, kurām gaisma nav nepieciešama; tās notiek hloroplastu stromā, un tajās tiek izmantoti gaismas fāzes produkti ogļskābās gāzes reducēšanai un ogļhidrātu ieguvei. Turgora spiediens - auga šūnas satura spie-
diens pret šūnapvalku, kas atkarīgs no ūdens satura vakuolā; tas rada iekšēju atbalstu šūnai. Vasa - auga virszemes daļa, kas sastāv no stumbra, lapām un pumpuriem. Vaskulārie augi - augi, kuriem ir vadaudi. Veģetācija - augu sega, augājs; vēsturiski izveidojusies kāda apvidus augu kopa. Vēzis - ļaundabīgs audzējs, kura mazdiferencētās šūnas aug nekontrolēti un spēj iespiesties audos un veidot metastāzes. Vica - garš, tievs izaugums, kas dažām baktērijām, vienšūņiem un spermatozoīdiem kalpo kustību veikšanai. Viendzimuma zieds - zieds, kurš satur tikai viena dzimuma gametangijus: sievišķajam ziedam tie veidojas augļlapās, vīrišķajam ziedam - putekšņlapās. Vienmājas augs - augs, kuram sievišķie un vīrišķie ziedi (čiekuri) veidojas uz viena auga. Vīrišķais zieds - zieds, kurā nav augļlapu. Vīruss - bez šūnu dzīvības forma, kas sastāv no DNS vai RNS un olbaltumvielu apvalka. Dzīvības norises vīrusiem notiek, tikai atrodoties šūnā. Vitamīns - būtiska uztura sastāvdaļa, kas nepieciešama nelielā daudzumā. Tie parasti ir daļa no kofermentiem. Z Zarnu bārkstiņas - sīki pirkstveida izaugumi tievās zarnas iekšējā sieniņā. Ziedaugi (segsēkļi) - augi, kuriem ir ziedi, augļi un sēklas. Zigota - apaugļota olšūna. Zilaļģes - sk. Ciānbaktērijas. RĀDĪTĀJS A adenīns 50, 51, 82, 83, 84 adenozīntrifosfāts, sk. ATP aerenhīma 35 aerobi organismi 62 AIDS 13, 119 akmensšūnas, sk. sklereīdas aktīvā pārnese 18, 20, 21 aktīvais centrs 49, 55, 56 alantojs 78, 79 alēles 91, 92, 93, 94, 95, 96, 102, 104, 112, 115 amilāze 56 aminoskābes 46, 59, 83, 84 amitoze 65 amnijs 78, 79 anaerobais posms, sk. glikolīzē anaerobi organismi 61 analizējošā krustošana 92-93, 96 anēmija 112 anterīdiji 70 antikodons 84, 85 apaugļošanās 69, 71, 72, 76, 90 apputeksnēšana 90 ārējās sekrēcijas dziedzeri 37 arhegoniji 70 asimilētājaudi 35 asinsgrupa 94, 95 atklāta sistēma 53 ATP 39, 52, 54, 58, 59, 60, 61, 62, 63 attālā hibridizācija 123 atvieglotā difūzija 18 audi 33-38 augu 34-36 balstaudi 35, 36 dzīvnieku 24, 36-38 mehāniskie, sk. balstaudi meristēma 34, 35 muskuļaudi 36, 37 nervaudi 36, 38 segaudi 34, 35 segepitēlijs 36 skrimšļaudi 36, 37 vadaudi 35, 36 veidotājaudi, sk. meristēma audzēji 113, 114 auglenīca 70, 71 auglis 71, 78, 79 augļlapas 70 augļlapu kopa, sk. ginecejs autbrīdings 123 autolīze 26 autosomas 103, 106, 107 autotrofi organismi 53 B baktērijas 53, 60, 61, 69, 87, 116 dzelzs 60 hemosintezējošās 60 nitrificētājbaktērijas 60 sēra 60, 61 balstaudi 35, 36 barošanās ķēde 11 bezdzimumvairošanās 69, 70, 72 binārā dalīšanās 65 biokatalizators 49, 54, 55 bioķīmiskā metode 108 biosfēra 11 biosfēras rezervāts 11 biotehnoloģija 118 blastocels 77 blastomēri 77 blastopora 77 blastula 77 C, Č celms 122, 124 celuloze 23, 42, 43, 59 centriola 14, 28,* 33, 66, 67 centromēra 64, 66, 68 centrosoma 28 ciete 30, 42, 59, 62 cilmesšūnas 121 ciltskoks 107, 108 cilvēka genoma projekts 111 citoģenētiskā metode 89, 108 citokinēze 67 citoplazma 14, 21, 24, 32, 40, 65, 67, 88, 162, 275 citoskelets 14, 17, 24, 33 citozīns 50, 51, 82, 83, 84 citronskābes cikls 62 čaumala 75 D dabas parki 11 dabiskā izlase 114 daltonisms 104, 105 Dauna slimība 106, 107 delēcija 112 denaturācija 48, 56 deplazmolīze 40 depresija 123 desmosomas 23, 24 destruktori 11 dezoksiribonukleīnskābe, sk. DNS dezoksiriboze 42, 50, 51 difūzija 18, 79 dīglis 70, 71, 77, 78 dīgļlapas 77, 78 diploidāls hromosomu skaits 64 dīgļsoma 71, 72 dīgļstobrs 71 dihibrīdiskā krustošana 95-97 divdzimumu ziedi 71 divkāršā apaugļošanās 71, 72 divkāršs hromosomu skaits, sk. diploidāls hromosomu skaits divmāju augi 71 DNS 31, 33, 50, 64, 66, 82-88 DNS dubultošanās, sk. DNS replikācija DNS polimerāze 83 DNS replikācija 65, 83 dominēšana 94 drostalošanās 76, 77 duplikācija 112 dvīņu metode 108 dzeltenums 75, 77, 78, 79 dzemde 77 dziedzeraudi 35, 37 dziedzerepitēlijs, sk. dziedzeraudi dziedzeri ārējās sekrēcijas 37 dzimumdziedzeri 72, 73, 104, 105 eksokrīnie, sk. ārējās sekrēcijas dziedzeri dzimumdziedzeri 72, 73, 104, 105 dzimumhormoni 45, 104 dzimumhromosomas 103-105 dzimumpaaudze 70, 72 dzimumšūnas, sk. gametas dzimumvairošanās 69, 70, 72 dzīvības pamatpazīmes 9 E eikarioti 30, 31, 32, 33, 65, 66, 83 , 87, 116 ekosistēma 11 ekskrēcija 9 eksocitoze 18, 22 eksokrīnie dziedzeri, sk. ārējās sekrēcijas dziedzeri eksoskelets 43 ektoderma 77, 78 embrijs 78, 79, 120 endocitoze 18, 21, 22 endoplazmatiskais tīkls 14, 24, 25, 32, 33 endosperma 71, 72 enerģētiskā vielmaiņa 54, 61-63 entoderma 77, 78 epiderma 35, 78 epiģenēzes teorija 89 epistāze 97, 98-100 epitēlijaudi, sk. epitēlijs epitēlijs 36, 37 estradiols 45 etanols 61 etilspirts, sk. etanols F fagocīti 21 fagocitoze 18, 21 fenotips 92, 103 fermenti 21, 26, 37, 49, 55-56, 62, 124, 125 fibrīns 49 filtrācija 18, 20 fizioloģiskais šķīdums 20, 40 folikuli 74, 75 ' fosfolipīdi 16, 17, 18, 25, 44 fotolīze 58 fotosintēze 27, 31, 35, 53, 57, 60 fragmentācija 70, 72 fruktoze 42, 62 G gaisa kamera 75 gametangiji 70 gametas 69-70, 76, 91, 93, 94, 95, 96, 99, 100, 103-105 gametofīts 70 gametoģenēze 73-75 gastrulācija 77 gastrula 77 genoma mutācijas 112 genotips 92, 97, 103 gēns 64, 87, 91 gēnu banka 119 gēnu inženierija 108, 116, 117, 125 gēnu kartes 119 gēnu mutācijas 111 gēnu terapija 117, 118, 119 ginecejs 70 glikogēns 42, 62 glikolipīdi 17 glikolīze 56, 61-63 glikoproteīni 17 glikoze 42, 61, 62, 63 Goldži komplekss 14, 25, 26, 32, 33 gonādas, sk. dzimumdziedzeri granas 27, 58 guanīns 50, 82, 83, 84 Ģ ģenealoģiskā metode 107 ģenerācijas laiks 65 ģeneratīvā šūna 71 ģenētika 6, 89-121 ģenētiskā informācija 50, 69, 83-
85, 120 ģenētiskais dreifs 115 ģenētiskais kods, sk. ģenētiskā informācija ģenētiskais materiāls 30 ģenētiski modificēta pārtika 117 H haploidāls hromos'omu skaits 64 Hārdija-Veinberga likums 115 hemofilija 104, 105 hemoglobīns 48 hemosintēze 53, 60-61 hermafrodīti 72, 105 heterotrofi organismi 53 heteroze 123 heterozigotiski organismi 92 heterozigots, sk. heterozigotiski organismi hibridoloģiskā metode 89 hipofize 104 histoloģija 6 hitīns 43 hlorofils 27, 58 hloroplasts 27, 31, 33, 35, 58 holesterīns 17, 44, 45 homeostāze 9, 41 homozigotisks organisms 92 homozigots, sk. homozigotisks organisms horijs 78, 79 hormoni 25, 45, 88 hromatīda 64, 65, 66, 67, 68, 110 hromatīns 31, 66 hromoplasti 27 hromosomas 31, 64, 103-110, 112 hromosomu kartes 110 hromosomu mutācijas 112 HUGO (cilvēka genoma organizācija) 111 I iegūtais imūnsistēmas deficīta sindroms, sk. AIDS iekšējā apaugļošanās 76 ieligzdošanās 77, 79, 121 ieslēgumi 30 imago 80 implantācija, sk. ieligzdošanās inbrīdings 123 inhibitori 56 interfāze 66, 69, 76 interferons 49, 125 invazīvās sugas 11 inversija 112 izlase 115, 122, 123 izotonisks šķidrums 20 izšķirtspēja 15 J Jakoba sindroms 105 K Kalvina cikls 59 kambijs 35 kancerogēni 114 kāpurs 79 kariokinēze 67 kariotips 64, 106 keratīns 47 Klainfeltera sindroms 105 klonēšana 119, 121 kodoliņš 14, 31, 32, 33, 75 kodolplazma, sk. nukleoplazma kodols 14, 30, 32, 33, 40, 66, 67, 74, 75, 120 kodominēšana 94-95 kodons 83, 84, 85, 86 kofaktors 49 kolenhīma 36 komplementaritāte 82, 83, 97, 101 koncentrācijas gradients 18, 19, 20 konsumenti 11 konvencija, Riodežaneiro 11 korķis 35 kortikosteroīdi 45 krāsu akluma gēns 104, 105 Krebsa cikls, sk. citronskābes cikls kristas 27 krosingovers, sk. krustmija krustmija 68, 109-110 krustošana 90-96, 123 kultūraugi 122, 123 kūniņa 79 L laktoze 87 leikoplasti 27, 28, 30 lipāze 55 lipīdi 39, 43-45, 49, 59 lizosomās 14, 26, 32, 33 lokuss 92, 110 lūksne 36 M mainība 89 makroelementi 39 mazasinība, sk. anēmija mehāniskie audi, sk. balstaudi mejoze 65, 67, 73, 74 membrāna, šūnas plazmatiskā 14, 16-21, 23, 24, 32, 33, 65, 88 meristēma 34, 35 metabolisms, sk. vielmaiņa metamorfoze 79-80 mezoderma 77, 78 mikrobioloģija 6 mikrocaurulīte 24, 29 mikroelementi 39 mikroskops 15, 16 miksotrofi organismi 53 miofibrillas 37 mioglobīns 48 mitohondrijs 14, 24, 26-27, 32, 33 mitoze 65, 66, 67, 73, 74 modificējošā mainība 103 modificēšana 97, 101 molekulārā bioloģija 6, 82 monohibrīdiskā krustošana 90-92 monosaharīdi 41, 42, 61 monosomija 106 morfoloģija 6 morula 77 muskuļaudi 36, 37 mutācijas 111-115, 124 mutagēni 113 N nabas saite 78, 79 nacionālie parki 11 neatkarīgās iedzimšanas likums 95 neiroglija 38 neirons 38 neirulācija 78 nepilnīgā dominēšana 94 nervaudi 36, 38 netiešā dalīšanās, sk. mitoze nimfa 79 nitrificētājbaktērijas 60 nukleīnskābes 39, 50-52, 64 nukleoīds 50, 51, 52, 65, 83, 84 nukleoplazma 30 O ogļhidrāti 17, 30, 41-43, 61, 62, 63, 83 ola 75, 79 olbaltumvielas 30, 39, 45-49, 55, 61, 62, 83-88 olnīcas 72, 74, 78, 104 olšūna 34, 71, 72, 74, 75, 76, 77, 120 olvads 76 onkogēni 114 ontoģenētiskā metode 89 ooģenēze 73, 74-75 oogonijs 74 operons 87 organogēnie elementi 39 organoģenēze 78 organoīdi 14, 24-30 orgānu sistēmas 33 osmotiskais spiediens 20 osmoze 18, 19, 20, 40, 79 otrās paaudzes hibrīdu skaldīšanās likums 91 ozona caurums 11 ozona slānis 10 P paaudžu maiņa 70 paleontoloģija 6 pamataudi, sk. parenhīma panmiksija 115 parenhīma 35 partenoģenēze 72 pārvēršanās, sk. metamorfoze pavadītājšūnas 35, 36 pazīme 91, 107 dominanta 91 dominanta autosomāla 107 recesīvā 91 recesīvā autosomāla 107 pēcembrionālā attīstība 79-80 Penneta režģis 91 pepsīns 56 peptīdsaite 45, 46, 85 performisma teorija 89 peroksisomas 28 pienskābā rūgšana 61 pinocitozē 18, 21, 22 pirmās paaudzes vienveidības likums 90 placenta 78, 79 plastīdas 27, 31, 32 plastiskā vielmaiņa 54-55 plazmodesmas 23, 24, 31 plazmolīze 40 plejotropija 97, 102 polārais ķermenītis 74, 75 polihibrīdiskā krustošana 97 polimērija 97-98 poliploīdija 112-113 poliribosoma 25 polisaharīdi 39, 41, 42, 59, 61 populācija 11, 114 populāciju metode 108 prenatālās diagnostikas metode 108 producenti 11 prokarioti 30, 31, 32, 33, 65 proteināze 55 proteīni, sk. olbaltumvielas protoplasts 14, 24 pubertāte 74, 80 putekšņlapas 69, 71 R reakcijas norma 103 receptors 22, 88 reducenti, sk. destruktori reduktīvā dalīšanās, sk. mejoze ribonukleīnskābe, sk. RNS ribosomas 14, 24, 25, 32, 33, 85, 86 riboze 42, 50, 51, 83 RNS 50, 52, 83, 88 RNS polimerāze 56, 84, 85, 87, 88 rodopsīns 49 S saharoze 42 saistaudi 36, 37 segaudi 35 segepitēlijs, sk. segaudi sēklinieki 72, 73, 78 sēklotne 69, 70, 71 sekretorie audi, sk. dziedzeraudi sekundārais kodols 71, 72 selekcija 89, 113, 122-125 sēra baktērijas 60, 61 sietstobri 35, 36 siltumnīcefekts 11 sinapse 38 skeleta muskuļaudi, sk. muskuļaudi sklereīdas 36 sklerenhīma 36 skrimšļaudi 36, 37 skropstiņas 28-29, 33 slāpekļa bāzes 50, 51, 82 spermatogoniji 73, 74 spermatoģenēze 73-74 spermatozoīds 29, 72, 73, 74, 76, 103 spermijs 71, 72 spirta rūgšana 61 sporas 69, 70 sporofīts 70 stabilizējošā izlase 115 steroīdi 43, 44, 45 steroīdie hormoni 45 stroma 27, 58 substrāts 55, 56 suga 11 svešappute 90 Š šķirne 122, 123, 124 šķirtdzimumu dzīvnieki 72 šūnapvalks 16, 32, 33, 65 šūnas 32, 34 šūnas elpošana 27, 62 šūnsula 28 šūnu dalīšanās 65, 66-68 šūnu savienojumi 23-24 T tauki 30, 44, 59, 62 termodinamikas likumi 53 termoregulācija 40 testosterons 45 tiešā dalīšanās, sk. amitoze tilakoīds 27, 58 timīns 50, 51, 82, 83, 84 traheīdas 35, 36 trahejas 35, 36 transgēni organismi 117 transkripcija 83-84, 85, 87, 88 translācija 84-85, 86, 88 translokācija 112 transpirācija 40 transplantācija 121 transpozīcija 112 trisomija 106, 107 turgors 20 U ūdens 39-41 ūdeņraža peroksīds 28 UNESCO 11 uracils 50, 51, 84 uzkrājējaudi 35 V vadaudi 35, 36 vairošanās 69-72 vakuolas 21, 28, 31, 32, 33 vaskulārie augi 36 veģetatīvā šūna 71 veidotājaudi, sk. meristēma vicas 28, 29, 33 vielmaiņa 54, 61-62, 76 vielu transports 17-22 viendzimuma ziedi 71 vienkāršs hromosomu skaits, sk. haploidāls hromosomu skaits vienmājas augi 71 vitamīni 39, 44 Z zarnu nūjiņa (Escherichia coli) 65, 87, 117 ' zigota 69, 70, 71, 72, 75, 76, 77, 80, 120 PAPILDLITERATŪRAS UN CITU UZZIŅAS AVOTU SARAKSTS Ievads http://priede.bf.lu.lv www.izm.lv 1. Organismi un to pētīšana Kusiņa M. Šūna un organisms. - R.: Zvaigzne ABC Madera S. Bioloģija. 3. daļa. - R.: Zvaigzne ABC Skolēna enciklopēdija. - R.: Zvaigzne ABC Tūrs S. Ievads šūnu bioloģijā. Interneta publikācija, ftp://ftp.liis.lv/macmat/pedoagog/ shuunubiol.zip Valtneris A. Cilvēka fizioloģija/rokasgrāmata. - R.: Zvaigzne ABC 2. Šūnu uzbūve un daudzveidība Madera S. Bioloģija. 1. daļa. - R.: Zvaigzne ABC Selga T. Šūnu bioloģija un šūnu ekoloģija. 1.-3. daļa. - R.: Arkādija, 1997 3. Šūnu un organismu ķīmiskais sastāvs Cēdere D., Logins /. Organiskā ķīmija ar ievirzi bioķīmijā. - R.: Zvaigzne ABC Kusiņa M. Šūna un organisms. - R.: Zvaigzne ABC Madera S. Bioloģija. 1. daļa. - R.: Zvaigzne ABC Namsone D. Organiskā ķīmija vidusskolai. -
R.: Zvaigzne ABC Ostvalds I. Organiskā ķīmija. Mācību palīglīdzeklis. Interneta publikācija www.llkc.lv/nodalas/ Infor macij a/MMmat. htm 4. Vielu un enerģijas maiņa Dzīvnieki/enciklopēdija. - R.: Zvaigzne ABC Kusiņa M. Šūna un organisms. - R.: Zvaigzne ABC Madera S. Bioloģija. 3. daļa. - R.: Zvaigzne ABC 5. Organismu vairošanās un individuālā attīstība Cilvēks/enciklopēdija "Redzeslokā". -
R.: Zvaigzne ABC Dabas enciklopēdija. - R.: Zvaigzne ABC Dzīvnieki/enciklopēdija. - R.: Zvaigzne ABC Kukaiņi/enciklopēdija "Redzeslokā". -
R.: Zvaigzne ABC Kusiņa M. Šūna un organisms. - R.: Zvaigzne ABC Madera S. Bioloģija. 3. daļa. - R.: Zvaigzne ABC Mūsu putni/enciklopēdija "Redzeslokā". -
R.: Zvaigzne ABC 6. Iedzimtības materiālie pamati Madera S. Bioloģija. 1. daļa. - R.: Zvaigzne ABC Misiņa M., Loža V. Ģenētika ar selekcijas pamatiem. - R.: Zvaigzne ABC, 1991 Raipulis J. Cilvēka ģēnētika - R.: Zvaigzne ABC Raipulis J. Ģēnētika vidusskolai - R.: Zvaigzne ABC, 1994 
Автор
maks
Документ
Категория
Школьные материалы
Просмотров
40 505
Размер файла
21 706 Кб
Теги
Liga Sausiņa, abc, zvaigzne, biologija vidusskolai 1 Dzintra Porozova, Juris Porozovs
1/--страниц
Пожаловаться на содержимое документа