close

Вход

Забыли?

вход по аккаунту

?

121.Журнал Сибирского федерального университета. Сер. Биология №4 2010

код для вставкиСкачать
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Журнал Сибирского федерального университета
2010
Journal of Siberian Federal University
3 (4)
Биология
Biology
???????????? ?????
???????? ??? ?.?.???????
???????? ??? ?.?.?????????
???????? ??? ?.?.???????
??.-?. ???, ?-? ???.-???.????
?.?.???????????
??.-?. ???, ?-? ???.-???. ????
?.?.???????
??.-?. ???, ?-? ????. ????
?.?.??????
??.-?. ???, ?-? ???.-???. ????
?.?.????????
???????? ???, ?-? ???.-???. ????
?.?. ???????
????-????. ???, ?-? ???.-???. ????
?. ?. ????
Editorial Advisory Board
CONTENTS / СОДЕРЖАНИЕ
Е.Е. Тимошок,
С.Н. Скороходов, Е.Н. Тимошок
t?%!= "/?%*%?%!?/. ???%" "?!.%",L !. `*2!3 (q?"?!%)3L?*,L .!?K?2, 0??2!=???/L `?2=L)
? 351 ?
Elena V. Eremeeva, Ludmila A. Frank,
Svetlana V. Markova and Eugene Vysotski
Ca2+-regulated Photoprotein Obelin as N-terminal Partner in the
Fusion Proteins
? 372 ?
Chairman:
Eugene A. Vaganov
Members:
Kirill S. Alexandrov
Josef J. Gitelzon
Vasily F. Shabanov
Andrey G. Degermendzhy
Valery L. Mironov
Gennady L. Pashkov
Vladimir V. Shaidurov
Veniamin S. Sokolov
Е.А. Бондаревич, С.В. Осипова
b/?%*%? ?%??!?=?,? ???2??,?%" " ?????=. !??,*2%"%?% ??=*=
Melica turczaninowiana (Poaceae)
? 384 ?
Editor-in-Chief:
Mikhail I. Gladyshev
В.В. Зуев, Н.Е. Зуева,
А.П. Зотикова, О.Г. Бендер, В.Л. Правдин
j%?C??*??/? ,?????%"=?, %2*?,*= -%2%?,?2?2,???*%?%
=CC=!=2= ??, ?,K,!?*%L (Picea obovata Ledeb.) ?= "%???L?2",?
rt-b-!=?,=?,,
Founding Editor:
Vladimir I. Kolmakov
? 391 ?
Editorial Board:
Managing Editor:
Olga F. Alexandrova
Executive Editor for Biology:
Nadezhda N.Sushchik
???????? ?.?. ?????? ????????? ?.?. ??????????
???????????? ??????? ?.?. ?????????
????????? ? ?????? 17.12.2010 ?. ?????? 84x108/16. ???. ???. ?. 8,5.
??.-???. ?. 8,0. ?????? ???. ?????? ????????. ????? 1000 ???. ????? 3264.
?????????? ? ?? ???. 660041 ??????????, ??. ?????????, 82?.
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Editorial board for Biology:
Sergey I. Bartsev
Alexander Y. Bolsunovsky
Tatiana G. Volova
Eugene S. Vysotski
Nikolai A. Gaevsky
Egor S. Zadereev
Valentina A. Kratasyuk
Elena N. Muratova
J. Woodland Hastings
Frank D. Salisbury
Malcolm K. Hughes
Ernst-Detlef Schulze
Akira Osawa
Takayoshi Koike
Marc D?Alarcao
Mikhail G. Karpinsky
Liliana Zalizniak
C.Ю.Терещенко, Е.И. Прахин, И.А.Новицкий,
В.Б. Цхай, М.И. Гладышев, Н.Н. Сущик,
Г.С. Калачева, Н.А. Шакина,
И.В. Исаков, Н.Н. Горбачева
j%????2!=?,, ",2=?,?= D, %K???% IgE, ?,2%*,?%" , ?C?*2!
?,!?/. *,??%2 " C3C%",??%L *!%", 3 ?%"%!%?????/. %2
?=2?!?L ? ?=?,?,?? " =?=????? *?,?,???*,. C!% "???,L
=2%C,???*%?% ??!?=2,2=
? 407 ?
Н.О. Ронжин, К.А. Харин,
А.П. Пузырь, В.С. Бондарь
m=?%=??=?/ " K,%2?.?%?%?,,: C!,?????,? ??
K??*%" , ?%??=?, ,??,*=2%!?/. 2??2-?,?2??
"/?????,
? 418 ?
????????????? ? ??????????? ???
?? ? ??77-28-725 ?? 29.06.2007 ?.
????? ???????? ? «???????? ??????? ????????????? ??????? ???????? ? ???????, ? ??????? ??????
???? ???????????? ???????? ??????? ?????????? ??????????? ??
????????? ?????? ??????? ??????? ?
????????? ????» (???????? 2010 ?.)
Elena I. Zuykova, Nickolai A. Bochkarev,
Anna S. Semenova and Alexey V. Katokhin
Morphological Differentiation, Mitochondrial and Nuclear
DNA Variability Between Geographically Distant Populations
of Daphnia galeata and Daphnia cucullata (Anomopoda,
Daphniidae)
? 434 ?
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Journal of Siberian Federal University. Biology 4 (2010 3) 351-371
~~~
??? 581.93: 630*181(235.222)
????? ???????????? ????? ???????? ?. ?????
(??????-??????? ??????, ??????????? ?????)
?.?. ???????,
?.?. ??????????, ?.?. ???????*
???????? ??????????? ?????????????
? ????????????? ?????? ?? ???,
?????? 634055, ?. ?????, ??. ?????????????, 10/3 1
Received 3.12.2010, received in revised form 10.12.2010, accepted 17.12.2010
? ???????????? ????? ??????-???????? ?????? ???????? ??????? ??????? ????????????
?????????? ????????, ?????????? ? ? ??????????????? ???????????. ????????? ????????
?? ???????????????, ??????????????, ????????????? ?????????? ????? ???????????? ?????
? ???????? ??????????????? ??????????? ? ???????????????, ???????????????? ?? ?????
????? ? ???????????????? ?? ????????????????? ??????????. ? ?????????? ???????????
????????? ????. ??? ????????? ??????????? ?????????? ? ????????? ????????????.
???????? ?????: ????, ?????????, ?????????? ????????, ??????-??????? ??????.
????????
?????-???????? ?????????, ????????????? ? ?????? ???????, ???????? ?????
?? ???????? ?????? ??????????? ??????????? ????????. ?????????????? ??????????
?????????? ????? ????? ??????? ???? ?????? ??????? ? Global 200 ? ?????? ???????????
??? ???? ?????????? ??????????? ?????, ?
??????? ????????????? ????? 90 % ????????
????????????.
? ?????? ????? ???? ???????? ??????? ????????? ? ??????? ????????????? ???????, ??????? ????? 50 % ??? ??????????
(????????, 1960). ? ?????, ??? ????? ????? ???? ?????????? ??????? ????????? 655
????? ?????????? ????????, ??? ????????
????? ? 233, ????????????? ? 341. ? ??????*
1
???????? ??????? ???????? ????? ???????
????????? ???????? ??????????? (35,6 %) ?
????????? (32,6 %) ????; ? ?????????????
??????????? ??????????? ???? (42,2 %),
??????? ????????? ????? ???? (31,0 %).
????????????? ?????? ????? ???????, ??? ?
???????? ? ????????????? ?????, ??????????????? ?? ?????????? ?????, ??????????? ???????? (59,2 ? 55,7 % ??????????????).
? ?? ?? ????? ?.?. ???????? (1960) ????????????, ??? ??? ?????? ????? ????? ?????????? ???????????? ??????? ???????????,
?????????? ? ??????????. ? ????????????? ?? ???????? ????? ?????? ????? ???????? ?????????????? (12,5 %), ? ????????????? ? ????????????? (17,3 %). ???????
?????????? ??????????? ??????????? ????
Corresponding author E-mail address: timoshokee@mail.ru
© Siberian Federal University. All rights reserved
# 351 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ???????, ?.?. ??????????? ????? ???????????? ????? ???????? ?. ??????
(8,6 % ? ??????????? ? 4,4 % ? ???????????????).
???????? ???????????????? ????????????? ?.?. ????????? (1960) ??????-???????
?????? ????????? ? ???????? ?????????????
?????? ??????????-?????????? ????????????? ??????.
?? ????????????????? ????????????? (??????, ?????, 1965) ??????? ??????? ?????? ? ????????? ?????? ????????
? ??????-?????????? ?????? ????????????
???-????????? ?????, ??? ?????? ???? ???????? ?????? 1200-2400 ? ??? ??. ????.
?????????? ? ?????? ?????? ????????????? ????? ??????????????? ???????? ?????????? ?????? ?? ??????, ?????????? ??
?????????? ?????????????? ????????????
??????? ????-??????? ?????? ? ???????? ?.
????????. ?? ?????? ???? ???????, ?????????????? ????? ??????? ??????????????
???????? ????? ??????????, ? ??? ??????
????????? ?????????????? ???????? ?????-
???????????? ? ????????????? ????. ? ?????? ??????? ???????????????? ?????????
?????????: ??????????????? ???????????;
???????????????, ???????????????? ?????
??????? ? ???????????????? ?? ????????????????? ??????????, ? ????? ??????? ??????????, ?????? ? ?????????? ???? ????????
? ?? ???????.
???? ???????.
? ?????????? ?.?. ???????? ? ?????????? (1980) ??????? ?????? ???????? ?
?????-????????-??????????
???????????????? ?????????, ?????????????? ?????????????? ?????????? ??????? ???? ?? ??????
?????????? ?.?. ??????? ? ?.?. ????? (1965,
1967).
?????? ???? ???? ????????? ?? ???????
????? 2000 ? ??? ??. ????, ????????????? ?
???????????????? ???????? ?? ???????????
???????? ?? ??????-??????? ??????, ?? ?????????? ??????? ???????? ???????? ??????????????.
????? ????? ???????????? ???? ???????? ???????????? ????????? ????? ???????????? ????? ???????? ?. ?????, ?? ?????????????? ????????????? ???????????? (?
???????? ??????? ?????), ??????? ??????
???????? ??? ?????????? ??????????????
(??????-??? ? 4173 ?, ?????-??? ? 4075 ?).
? ???? ????? ?????? ????????????? ??????????? ??????????.
??????? ????? ???????????? ????????
????????? ???????????????? ??????????
?????????? ??????? ? ??????????? ?????????? ? ????? ????????????? ?????, ???????
???????? ? ???????????? ???? (??????,
1949). ?????? ????? ????????, ????? ????????????-????????? ???????????, ??????? ?
???? ??????. ?? ?????? ? ????? ?????? ?????
??????, ? ? ??????? ?????, ?????? ????????,
????????. ? ?????? ?????????? ??????? ????? ?????, ????? ? ?????? ?????. ? ??????? ??????????? ??????? ? ??????? ? ???????
??????????? ??? ??????? ???????????? ????????????? ? ???????? ? ????????? ?????? ?
????, ???????, ????????? ?? ?????? ?. ?????
?? ?????? ?????????, ???????? ?????????
????? (??????, 1982).
????? ?????,
????????? ? ??????
?????????????? ?????? ?????
? ???????? ????????????
??????-??????? ?????? ??????? ? ???????? ??????????? ?? 70 ??. ?? ?????? ??
????????? ???????? ??????? ?. ?????, ?????????? ??? ?? ?????????? ??????, ?? ??????? ? ??????? ?. ?????-???? (??????, 1949).
????? ???????????? ?????????? ? ???????? ??????? ????? ?????? ? ?????? ???? ????????, ??? ??????? ?????? ????????? 3600 ?
??? ??. ????, ? ??? ?????? ????????? 4000 ?
# 352 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ???????, ?.?. ??????????? ????? ???????????? ????? ???????? ?. ??????
??? ??????-???????? ?????? ?????????? ???????? ??? ????? ???????? ?????????
??????????????. ?????-?????? ???? ???????? ????? ?????? 1800 ? 2200 (2300) ? ??? ??.
????; ????????????? ?????? ? 2300-2500 ?;
?????-????????? ???? ? 2500-3050 ? ??? ??.
????. ??? ?????????????? ?? ???????? ???????????? ????????????? ????????? (???????, 2004).
?.?. ???????? (1996), ?????????????
?????????? ????????????? ????? «?????»,
????????????? ? ??? 265 ????? ??????????
????????. ? ????? ?????? ????? ??? ????
??????? ????????, ??? «????????????» ???????????? ? ?????? ?. ????? ???????? ???
?? ????? ???????? ? ??????????? ?????????,
????????????? ???? ??????????? Lonicera altaica, Betula nana subsp. rotundifolia, Cotoneaster uniflora, Spiraea media, ????????????? ?
????????. ????? ??????????? ???????? ????
??????????? Hedysarum austrosibiricum, Festuca altaica, Aconogonon alpinum» (????????,
1996).
???? ? ???? ??????????? ????????????
? ????????? ?. ????? ????????????? ?????
400 ????? ?????????? ???????? (Timoshok,
Scorohodov, 2005).
?????? ???????? ? ??????? ????? ?????? ?. ????? ????????? ??????????? ?.?.
????????????, ?????????? ?? ? 1898 ?.: «?
?????????? ? ?????? ????? ????? ????????????? ? ??????, ?????????? ???????? ????,
??????? ?????????????? ?????????????
????????, ????? ???????? ?????? ?????? ???????????? ???????? ?????????????? ? ????
???? ? ???? ?????? ???????, ? ?????? ? ??
???????????? ????????????? ?????? ?????.
????? ??????? ??????????? ???????? ?????
?? ???????? ? ???? ?? ѕ ?????? ?» (??????????, 1901, 142).
? ????????? ????? ?? ????? ?????, ?????????? ?.? ???????????? (1901), ?????-
?????? ????????? ????????????? ????????????? ???? ? ????????? ???????? ?????. ??
????? ??????? ?????? ?. ????? ?????????????? ????????????? ???????????-???????? ?
???????????-???????? ????????????? ???? ?
??????? ???????????????? ?????. ? ????????????? ????? ??????????? Spiraea chamaedrifolia, Cotoneaster uniflora, Juniperus sibirica,
???? ? J. pseudosabina. ? ???????? ???????
???????????-???????? ????? ???????????
Carex macroura, ???????????-???????? ? Calamagrostis pavlovii. ? ?????? ???????????
????????? ? ? ??? ? ? ?????? ????????? Aegopodium alpestre, Aquilegia glandulosa, Crepis
sibirica, Dianthus superbus, Geranium pseudosibiricum, Lilium pilosiusculum, Poa altaica,
Polemonium c?eruleum, Saussurea controversa,
Solidago dahurica, Trifolium lupinaster ? ??. ??
????? ??????? ??????? ?????? ????????????? ????????-?????????????-????????????
????????????? ????????????? ????, ??? ???????????? ?????? ????? Betula rotundifolia ?
Vaccinium vitis-idaea, ?? ???? ????????????
Aegopodium alpestre, Cerastium pauciflorum,
Galium boreale ? ??.
???????? ????????? ? ????????? ?. ?????
??????????????? ???????? ???? (Timoshok,
Narozhniy, 2004, ??????? ? ??., 2005), ???????????? ?????? ???????? ????? 500 ??? ??
??????? 2100-2300 ? ??? ??. ????. ?????????? ????????? ??? ??????????? ????? ???????????? ??????????? ???????, ????????????
? ???????? ????? ? XVII ? XIX ??. (????????,
1986, ?????? ? ??., 2000), ????? ????????? «????????? ??????», ????????????? ?
?????? ??????, ????????? ???? ??? ?? ????
????????? ???????? ??????-???????? XIX ?.
??? ???? ?? ??????????? ??????? ? ?????????
??????????? ?????????? ?? ??????? ???????????????, ???????????????? ????? ???????
?? ??????? ?????? (???????, 2009). ? ?? ????????????? ????? ??????????? Betula rotun-
# 353 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ???????, ?.?. ??????????? ????? ???????????? ????? ???????? ?. ??????
difolia, ? ??????? ??????? ????????? Salix
sajanensis, S. saposhnikovii ? Lonicera altaica.
? ???????-?????????????? ????? ???????????? ???????????? ????? ????, ????? ???????
Aegopodium alpestre, Bergenia crassifolia, Bistorta vivipara, Cerastium pauciflorum, Festuca
altaica, F. kryloviana, Stellaria peduncularis,
Swertia marginata ? ??.; ?? ???????????? ???????????? Vaccinium vitis-idaea ? Empetrum
nigrum. ? ??????-???????????? ????? ??????????? ????????? ???? Cladonia ? ???????? ?????? ??? Hylocomium splendens ? Pleurozium schreberi.
?? ????????????????? ?????????? ?
?????? ?. ????? ??????????? ??????? ?????????????? ? ????????????? ?????? ?? ??
(Salix coesia, S. saposhnikovii, S. hastat? ? ??.) ?
????????? ???????-??????? ????????.
???? ???????????? ??????????? ? ???????? ??????????? ????? ??????-????????
?????? (50°05' ?.?., 87°45' ?.?.), ?? ???????? ???????????, ? ????????? ?. ?????. ???????????? ???? ????????????? ? 1988, 1999-2006 ??.
?? ????????????? ????????, ??????????
?? ????????? ????????? ?? ??? ?????? ??
??????? ????????? ????? ?? ????????-???????????? ? ???????-??????-???????? ??????? ?????? ?. ?????, ?? ?????????? ???????
2100-2300 ?.
???????? ????????????
?????????? ??? ???????????? ????? ???????????? ????? ???????? ?. ????? ???????
307 ?????? ???????? ?????????? ????????,
????????? ???? ? ????-??????? ? 1988, 19992006 ??. ? ????????????? ????? ?????????
104 ??????????????? ????????, ? ??? ????? ?
??????????????? ??????????? ? 38, ? ????????????? ??????????????? ? 35, ? ??????????????? ?? ????????????????? ?????????? ? 31 ????????. ??????????????? ????????
???????-??????????????? ????? ???????????
?? ???????????? ??????? (????????, 1976)
?? ????????? ???????? 10 ? 10 ?. ??????????? ???????? ??????? ???? ??????????? ?
?????????. ????? ??????? ?????????????
?????? ????????? ? ????????? ?. ????? ????????? ????? 3 ??2.
??? ????????? ???????? ??? ??????????? ???????????? ?????? (????????, 1974), ?
?????? ???????? ????? ????????????? ?? ??????????? ????????????? ??????????????
??????????, ???????????? ????????????
?????????? ??????? ??????????, ????????,
????? ????????. ????????????? ??? ?? ????????? ???????????? ??????? ????????????
????????? (????? ?????????? ? ???????????
?????????) ? ??????? ???????????? ????????????? ????? (??????????????? ????????????? ??????????; ??????????????, ???????????????? ????? ??????? ????????-?????
XIX ?.; ??????? ??????????????, ????????????? ?? ?????-?????????? (????????????????? ??????????).
??? ??????? ????????? ???????? ??????????? ??????????? ???????? ???????
(?????, 1984):
Kq = c / (? + ? ? ?),
??? ? ? ????? ????? ? ?????? ?????????; ? ?
????? ????? ?? ?????? ?????????; ? ? ?????
?????, ????? ??? ???? ????????. ?????????? ????? ???????????? ?????????? ???, ???
??? ????????????? ??????? ???? ?? ????????
?????????? ?????????????? ?????????????
? ??????????? ????????????.
??? ?????????? ??????????????? ?
???????-??????????????? ???????? ????? ?
???????? ????????????? ????? ?????????
???????? ? ?????????, ?????????? ? ??????? ?.?. ????????? (1962, 1974), ?.?. ??????? (1965), ?.?. ???????? (1965). ???
?????????????? ??????? ???????????? ??????????? ?????????? ?????????????? ??-
# 354 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ???????, ?.?. ??????????? ????? ???????????? ????? ???????? ?. ??????
??? ? ???????? ???????? ? ?????-??????????
????????? ??????-???????? ?????? ? ???????????? ??????, ?????? ????? ?.?. ????????? (1960), ??? ????????? ????? ? ??????
?.? ????????? (1996) ? ?.? ???? (2003). ???
?????????? ????????? ????????????? ????????? ????? ???????????? ????? ? ?????????? ???????? ???? ?????? ???????? ???? ?
???? ?????????: ?) ?? ?????? ??????? ?????,
? ?????? ??????????; ?) ?? ????-???? ???????? ????? (??????????-???????????, ????
??????????-???????????? ?????????, ????
??????????-???????????-???????????? ?????????), ???????? ?.?. ????????? (1960). ???
?????????? ??????????????????? ???????
???????????? ????????????? ?.?. ??????????? (1962). ????????? ???????? ??????????
???????? ????????? ? ???????? ?? ?.?. ?????????? (1995).
??????????
????? ???????????? ?????
???????? ?. ?????
?? ????? ???????????? ????? ????????
?. ????? ???? ???????????????? 166 ?????
?????? ?????????? ???????? ?? 100 ?????,
42 ???????? (???. 1, ????. 1). ??????? ????????? ???????? ????????? Asteraceae (11,3 %, 18
?????), Poaceae (10,1 %, 17 ?????), Salicaceae
(7,1 %, 12 ?????), Ranunculaceae (6,5 %, 11
?????), Rosaceae (5,4 %, 9 ?????), Cyperaceae
(5,4 %, 9 ?????), Caryophyllaceae ? Apiaceae
(?? 4,8 %, 8 ?????). ??????? ???? ?????????
Asteraceae ??????????? ?? ???? ???????? ???????? ???????????? (16 ?????), ?????????
Poaceae ? ????????? ????????????? ????????
(7 ?????) ? ???????? ???????????? ???? Poa
(7 ?????), ????????? Salicaceae ? ?? ???? ???????? ???????? ???????????? ???? Salix. ??
???? ????????? ? ??????? ?????????? 4 ????.
??????? ???????? ????????? ???? ????????
????? ?????? 12 (28,6 %), ???? ???????? ? 30
???????? (71,4 %). ????? ???????? ???????
????? ? Salix (12 ?????), Carex (8), Poa (7), Festuca ? Pedicularis (?? 4 ????), ?????????? ?
???????????? 35 ????? (21 %). ????? ???????? ????? (63 ????, 63 %) ???????? ?????? ??
?????? ????. ???????? ???????? ???????????? (????????? ????? ????? ? ????? ?????) ?
1,7. ??????? ???????? ????? ????- ? ?????????? ???????? (? ????? 25 ????????, 60 %)
? ??????????? ????? ??????????????? ? ???????????? ????????? ????? ????????????
????? ???????? ?. ?????.
? ??????? ?????????????? ??????? ??????????? ????????? ???? (51,5 %), ? ?????
??? ? ??????????????? (28,1 %). ? ??? ????
???? ??????? ????-????????-??????????????????? (14,4 %), ????????????? ? ????????????? (4,2 %), ????-????????? (3,6 %) ?
????-????????-????????????????? (1,2 %)
?????. ??????????? ???????????? ????? ?????? ????? ? ???????? ???????? (48,5 %), ?
???????? ??????????? (25,1 %) ? ?????????????? (19,8 %) ????.
?????? ??????-????????? ?????????
???????, ??? ? ???????-?????????????? ??????? ????? ???????? ? ?????-????????? ????
(46,0 %) (???. 2). ???????????? ???? ?????????? ????? (33,0 %) ?????? ?????, ??????
??????? ?????????? ? ??????????????? ????? (?? 17,5 %) ?????????. ???? ??????? ?????? (13,0 %) ? ?????-??????????????? ?????
(6 %).
????????????? ?????? ?? ?????? ??????
??????? ?????????? ??????????, ??? ?? ????? ???????????? ????? ???????? ?. ????? ???????????? ???????? (67,1 %); ????? ??? ? 4
???? ?????? ?????????????? (16,2 %) ? ?????????????? (15,4 %). ???? ?????????? (1,2 %)
? ?????????? (1 %) ?????? ?????????????.
????? ???????, ?????? ??????? ??????? ??????????, ??? ?? ????????????? ?????????
????? ???? ???????????? ????? ????? ?? ??-
# 355 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ???????, ?.?. ??????????? ????? ???????????? ????? ???????? ?. ??????
???????? ?? ????????? ?????? ?????, ??? ??
???????? ?? ?? ???????? ??????????????,
?? ?? ???????????.
????????????? ?????? ????? ?? ???????? ???????? ????? ?????????? ????????????? ?????? ??????????? ?????????????
?????. ???????? ???????????? ?????? ???????????, ???????????? ????? ???????? ????? (45,6 %), ????? ??????? ?? ?????? ?????
?????????? ?????????? (20, 4 %), ?? ?????? ?
?????????????? (14,4 %). ???????????????? ? ???????????????? ??????? ?????? (??
5,4 %). ????? ???????????? ??????? ??????????? ? ????????????? ????????? ???? ????? ? ???????? ?? ???????????, ????????????? ????????? ????????????? ?????. ?????
????????? ????????????? ????? ???????????
???????? (31,1 %). ???? ?????? ????????????? ????? ????? ???????????? (????????????? 7,8 %; ????????????? 6,0 %, ?????????
4,8 %, ????????????? ? ?????????????? ??
1,8 %, ????????? 1,2 %). 9 % ????? ?????????
? ?????? ??????????, ??? ??????????????? ?
??????? ? ???? ????? ?????????? ?????????????. ????? ???????, ? ????? ????? ??????,
??? ?????????????? ??????? ????? ???????????? ????? ????? ???????? ????-, ????????????? ??????, ??? ????????????? ????????
????????? ?????????? ?? ???????? ??????????????, ???????? ????????????? ?????, ???
? ?????????????? ???????? ? ?????????????
?????? ????? ????????????? ????? ????? ??
?????? ???????????.
?? ????? ????????????? ????? ???? ???????? ???????????? ???????????? ????????? ???? ?????????? ???????? ? 16 (????. 2).
? ?????????????????? ??????? ???????????
??????????? ????? ? 78,0 % ?????, ? ?????
??? ??????????? (???????- ? ?????????????????) 31,5 %. ??????? ???????? (????????????? ? ??????-????????) ???? ????? ? 2
???? ???? ? 18,5 %. ?? ????????? ????????
??????????? ???? ?????????? (16,0 %). ????
???????????? (4,0 %) ? ????????????????
(1,0 %) ????? ????. ??????? ????????????
?????? ????? ??????: ?????? ????????? ?
???????????? ?????????. ???????? ?????
? ????????-??????? Stellaria peduncularis ?
Minuartia biflora.
? ????????? ?. ????? ?? ???????? ???
???? ?????? ????????: ??????????????? ???????? ?????, ????????????? ????????????? ????? ? ??????? ??????????????? ??
????????????????? ??????????.
????????? ???????????????
???????? ?????
?????????? ????? ????? ??????????
???????? ???????? ? ??????????????? ???????? ?????: 104 ???? ?? 67 ?????, 35 ????????
(????. 1, ???. 1). ? ?????? ????????? ???????? ???? ??????? ????????, ??????? ????????????? ? ????????? ???????: Poaceae
(12 ?????), Caryophyllaceae (7), Ranunculaceae
(7), Asteraceae (6), Cyperaceae (6), Pyrolaceae
(5), Salicaceae (5 ?????). ?? ???? ????????? ?
??????? ?????????? 3 ????. ??????? ???????? ????????? ???? ???????? ????? ?????? 11
(31 %), ???? ???????? ? 24 ?????????. ???????? ??????? ???? Poa (6 ?????), Salix ? Carex
(?? 5 ?????), Festuca, Pedicularis (?? 4 ????).
? ??????? ?????????????? ??????? ???????? ????? ???????? ?????????? ????????? ???? (51,4 %), ????? ??????? ??????????? ??????????????? (22,3 %); ?????
???????????
???????
????-??????????????????-????????? (14,6 %), ????????????? ? ?????-???????? (6,8 %), ????-?????????
(5,8 %) ? ????-????????-?????????????????
(1,9 %) ?????. ? ????? ????? 48,6 % ?????????? ???? ? ???????? ????????: 23,3 % ? ??????????????, 21,4 % ? ??????????? ? 3,9 % ?
??????-?????????-?????????, ????????????
???. ? ??????????????? ???????? ????? ????
# 356 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?????????????
??????????????
??????????????
?? ?????????????????
??????????
1
???????????????
??????????
??????? 1. ?????? ????? ?????????? ???????? ? ?????????? ???????????? ????? ???????? ?. ?????
2
3
4
+
+
-
Alliaceae
Allium altaicum Pallas
Apiaceae
Aegopodium alpestre Ledeb.
+
+
+
Bupleurum aureum Fisch. ex Hoff.
-
+
-
Bupleurum multinerve DC.
-
+
-
Heracleum dissectum Ledeb.
+
+
-
Pachypleurum alpinum Ledeb.
+
-
+
Pachypleurum schischkinii Serg.
-
+
-
Phlojodicarpus villosus (Turz. ex Fisch. &C.A.Mey.) Ledeb.
-
-
+
Pleurospermum uralense Hoff.
+
+
-
Seseli condensatum (L.) Reichenb.
-
-
+
-
+
-
Asteraceae
Achillea millefolium L.
Antennaria dioica (L.) Gaertn.
-
-
+
Aster sibiricus L.
-
-
+
Cicerbita azurea (Ledeb.) Beauverd
+
+
-
Crepis multicaulis Ledeb.
-
-
+
Crepis sibirica L.
-
+
-
Erigeron elongatus Ledeb.
+
-
-
Erigeron uniflorus L.
-
+
-
Hieracium korshinskyi Zahn.
-
+
+
Hieracium czamyjashense Tupitzina
-
+
-
Ligularia altaica DC.
-
+
+
Leontopodium ochroleucum Beauverd
-
-
+
Petasites rubellus (J.F. Gmel.) Toman
+
-
-
Saussurea controversa DC.
+
+
-
Saussurea parviflora (Poer.) DC.
+
+
-
Scorzonera radiata
-
-
+
Solidago dahurica Kitag.
-
+
+
Taraxacum officinale Wigg.
-
-
+
Tephroseris integrifolia (L.) Holub.
+
-
-
+
-
+
-
+
+
Berberidaceae
Berberis sibirica Pallas
Betulaceae
Betula fruticosa Pallas
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
??????????? ????. 1
1
2
3
4
+
+
+
Draba hirta L.
+
-
-
Draba sibirica (Pallas) Thel.
+
-
-
Draba subamplexicaulis C.A. Mey.
-
+
-
Campanula glomerata L.
+
+
-
Campanula rotundifolia L.
+
+
+
+
-
-
Betula rotundifolia Spach.
Brassicaceae
Campanulaceae
Caprifoliaceae
Linnaea borealis L.
Lonicera altaica Pallas ex DC.
+
+
+
Lonicera hispida Pallas ex Schult.
+
+
+
Cerastium pauciflorum Stev. ex Ser.
+
+
-
Dianthus superbus L.
+
+
-
Gastrolychnis tristis (Bunge) Czer.
+
-
-
Gypsophila cephalotes (Schrenk) Com.
-
+
+
Gypsophila sericea (Ser.) Kryl.
+
+
-
Caryophyllaceae
Minuartia biflora (L.) Schinz & Thell.
+
+
-
Moehringia umbrosa (Bunge) Fenzl
+
+
-
Stellaria peduncularis Bunge
+
-
-
Juniperus pseudosabina Fisch. & C.A. Mey.
+
+
-
Juniperus sibirica Burgsd.
+
+
+
Cupressaceae
Cyperaceae
Carex aterrima Hoppe
+
-
-
Carex capillaris L.
-
-
+
Carex coriophora Fisch. & C.A. Mey.
-
-
+
Carex macroura Meinsh.
+
+
-
Carex media R. Br.
+
+
+
Carex orbicularis Boott
-
-
+
Carex sabynensis Less. ex Kunth.
+
-
-
Carex sempervirens Vill.
+
+
-
Kobresia myosuroides (Vill.) Fiori
+
+
-
+
+
-
Equisetum pratense Ehrh.
+
-
-
Equisetum variegatum Schleich. ex Web.
-
-
+
+
+
-
Empetraceae
Empetrum nigrum L.
Equisetaceae
Ericacea
Vaccinium uliginosum L.
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
??????????? ????. 1
1
2
3
4
+
+
-
-
-
+
Astragalus frigidus (L.) A. Gray
+
+
+
Hedysarum austrosibiricum B. Fedtsch.
+
+
-
Vaccinium vitis-idaea L.
Fabaceae
Astragalus austrosibiricus Schischk.
Hedysarum neglectum Ledeb.
+
+
+
Trifolium lupinaster L.
+
+
+
Gentianaceae
Gentianopsis barbata (Froel.) Ma
+
-
Gentiana decumbens L.fil.
-
+
-
Gentiana uniflora Georgi
-
+
-
Gentiana grandiflora Laxm.
+
-
-
Swertia marginata Schernk
+
-
+
Geraniaceae
Geranium albiflorum Ledeb.
+
+
-
Geranium pseudosibiricum J. Mayer
+
+
-
Ribes atropurpureum C.A. Mey.
+
+
-
Ribes nigrum L.
+
+
-
-
+
-
Luzula parviflora (Ehrh.) Desv.
+
-
-
Luzula sibirica V. Kresz.
+
-
-
Grossulariaceae
Iridaceae
Iris ruthenica Ker-Gawl.
Juncaceae
Lamiaceae
Dracocephalum imberbe Bunge
+
-
+
Dracocephalum nutans L.
-
+
-
Dracocephalum peregrinum L.
-
+
-
Lilium pilosiusculum (Freyn) Miscz.
-
+
-
Veratrum lobelianum Bernh.
+
+
-
Chamaenerion angustifolium (L.) Scop.
+
+
+
Chamaenerion latifolium (L.) Th. Fries & Lange
-
-
+
-
+
-
+
-
+
Larix sibirica Ledeb.
+
+
+
Pinus sibirica Du Tour.
+
+
+
Liliaceae
Onagraceae
Paeoniaceae
Paeonia anomala L.
Parnassiaceae
Parnassia palustris L
Pinaceae
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
??????????? ????. 1
1
2
3
4
Poaceae
Anthoxanthum alpinum A. et D. Love
+
-
-
Bromopsis altaica Peschkova
-
+
-
Calamagrostis obtusata Trin.
+
+
-
Calamagrostis pavlovii Roshev.
+
+
-
Elymus transbaicalensis (Nevski) Tzvel.
-
+
+
Festuca altaica Trin.
+
+
-
Festuca kryloviana Reverd.
+
-
-
Festuca sphagnicola B. Keller.
+
+
+
Festuca rubra L.
+
-
+
Poa alpina L.
-
+
+
Poa altaica Trin.
+
+
+
Poa krylovii Reverd.
+
+
-
Poa palustris L.
+
-
+
Poa pratensis L.
+
-
-
Poa sibirica Roshev.
+
+
+
Poa urssulensis Trin.
+
-
+
Trisetum mongolicum (Hult.) Peschkova
+
-
+
-
+
-
+
+
-
Aconogonon alpinum (All.) Schur
-
+
+
Bistorta major S.F. Gray
+
+
-
Bistorta vivipara (L.) S.F. Gray
+
+
+
Polemoniaceae
Polemonium caeruleum L.
Polygalaceae
Polygala comosa Schkuhr
Polygonaceae
Primulaceae
Primula nivalis Pall.
-
-
+
Primula pallasii Lehm.
-
+
-
Orthilia obtusata (Turcz.) Hara
+
-
-
Orthilia secunda (L.) House
+
-
-
Pyrola incarnata (DC.) Freyn
+
-
+
Pyrola minor L.
+
-
+
Pyrola rotundifolia L.
+
+
+
Aconitum decipiens Worosch. & Anfalov
+
-
-
Aconitum glandulosum A Khokhr.
+
-
-
Pyrolaceae
Ranunculaceae
Aconitum leucostomum Worosch.
+
-
-
Aquilegia glandulosa Fisch. ex Link
+
+
-
Aquilegia sibirica Lam.
-
+
+
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
??????????? ????. 1
1
Atragene sibirica L.
2
3
4
+
+
-
Callianthemum sajanense (Regel) Witas.
+
-
-
Delphinium elatum L.
+
+
-
Pulsatilla flavescens (Zucc.) Juz.
-
+
-
Thalictrum minus L.
-
+
-
Trollius asiaticus L.
-
+
-
Rosaceae
Alchemilla vulgaris L.
-
+
-
Cotoneaster uniflorus Bunge
+
+
+
Dryas oxyodonta Juz.
-
-
+
Pentaphylloides fruticosa O. Schwarz.
-
-
+
Potentilla gelida S.A. Mey
+
-
-
Rosa acicularis Lindl.
-
+
-
Rosa oxyacantha Bieb.
+
-
-
Spiraea chamaedrifolia L.
-
+
-
Spiraea flexuosa Fisch. ex Cambess.
-
+
-
-
+
-
Salix arctica Pall.
-
-
+
Salix berberifolia Pall.
+
-
+
Salix coesia Vill.
-
-
+
Salix glauca L.
-
-
+
Rubiaceae
Galium boreale L.
Salicaceae
Salix hastata L.
-
-
+
Salix phylicifolia L.
+
+
+
Salix pyrolifolia Ledeb.
-
-
+
Salix rectijulis Ledeb. ex Trautv.
-
-
+
Salix reticulata L.
-
-
+
Salix sajanensis Nas.
+
-
-
Salix saposhnikovii A. Skvorts.
+
+
+
Salix vestita Pursh.
+
+
+
+
+
-
Bergenia crassifolia (L.) Fritsch
+
+
-
Saxifraga cernua L.
+
-
-
Saxifraga punctata L.
+
-
-
Santalaceae
Thesium repens Ledeb.
Saxifragaceae
Scrophulariaceae
Castilleja pallida (L.) Spreng.
-
-
+
Pedicularis brachystachys Bunge
+
-
-
Pedicularis compacta Steph.
+
-
-
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ???????, ?.?. ??????????? ????? ???????????? ????? ???????? ?. ??????
????????? ????. 1
2
3
4
Pedicularis elata Willd.
1
+
+
-
Pedicularis incarnata L.
+
+
-
Veronica krylovii Schischk.
-
+
-
-
-
+
-
-
+
+
+
-
Tamaricaceae
Myricaria dahurica (Willd.) Ehrenb.
Valerianaceae
Patrinia sibirica (L.) Juss.
Violaceae
Viola altaica Ker-Gawl.
??????????: «+» ? ??????? ????, «-» ? ?????????? ????.
?????????? 7 ?????-???????? ?????????:
Aconitum decipiens, A. glandulosum, Gypsophila sericea, Poa Krylovii, Pedicularis brachystachys, Rosa oxyocantha, Salix sajanensis. ?????
??????????? ???? ???, ?????????? ? ???????
????? ?? (2008), ? Aconitum decipiens ? ???
???? Allium altaicum ? Rosa oxyacantha ????????? ? ??????? ????? ?????????? ?????
(1996).
? ????????? ??????????????? ???????????, ??? ? ?? ????? ???????????? ?????
???????? ?. ?????, ??????????? ?????????????? ???? (???. 2). ???????????? ?????????? ? ??????????????? ???? ??????????
37,0 % ?????? ?????????, ?????? ??????????? ????? ??? ?????????? (20,5 %). ??????
????? 16,5 %, ?????-??????????????? ????
??????????????? (5,0 %).
????????????? ?????? ????????? ?????? ?? ??????? ?????????? ??????????, ??? ?
??? ???????????? ???????? (72,8 %). ????
?????? ????? ???????????? ?????????????
(????????????? ? 13,6 %, ????????????? ?
12,6, ????????? ? 1 %). ????? ???????, ?
? ???? ?????? ?????????? ?????????????
????????? ?? ???????? ???????? ?????????????? ??????????????? ???????? ?????
? ?? ????????????? ??????????? ?? ?????????.
?????? ??????? ?????????????? ???????
??????????, ??? ? ????????? ??????????????? ???????? ?????, ??? ? ? ????? ?? ?????
????????????? ???????????? ????? ???????? ?????, ???? ?????? ??????????? ??????????? (53,4 %). ?? ??? ?????????? ??????????? ? 21, 4 %, ??????????????? ? 18,4 %,
???????????????? ? ???????????????? ? ??
6,8 %. ?? ?????? ????????????? ?????? ?????????? 46,6 %, ????? ??????? ???????????
???????? (25,2 %). ??????????? ???? ????
?????????????? (8,7 %), ??????????????
(7,8 %), ?????????????? (2,9 %) ? ??????????????? (1,9 %).
? ???? ????????? ???????????? 15
????????? ???? ?????????? ????????. ?
?????????????????? ??????? ???????????
??????????? ????? (????. 2). ????? ??? ??????? ????????? ??????????? ??????????? (31,0 %). ??????????? ??????? ????????
????, ? ???????? ??????, ? 21 %. ???? ?????? ??????????? ???????? ??????? ??????.
????? ????????? ???????? ????? ??????????? ?????????? (16 %). ???????????? ??????? (5,0 %). ??????? ???????????? ????
?? ????? ??????, ??? ? ?? ????? ? ?????. ?
??????????? ???????? ??? ???? ??????????????? Stellaria peduncularis ? Minuartia
bifl ora.
# 362 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
42
36
35
I
25
100
67
70
II
44
166
104
III
96
69
0
20
40
60
80
100
120
140
160
180
???????????? ????
??????????????? ??????????
????????????? ??????????????
?????????????? ?? ????????????????? ??????????
???. 1. ?????????? ???????? (I), ????? (II) ? ????? (III) ?????????? ???????? ?? ????? ????????????
????? ???????? ?. ?????, ?????????? ??????????????? ???????????, ????????????? ??????????????? ?
??????????????? ?? ????????????????? ??????????
41,5%
I
46,0%
56,5%
37,7%
17,5%
20,5%
II
III
13,5%
8,2%
11,6%
0,0%
17,5%
16,5%
13,0%
16,5%
17,7%
17,4%
IV
V
20,3%
6,0%
5,0%
4,1%
10,0%
13,0%
20,0%
30,0%
40,0%
50,0%
60,0%
???????????? ????
??????????????? ??????????
????????????? ??????????????
?????????????? ?? ????????????????? ??????????
???. 2. ??????????? ???????-?????????????? ????? ?? ????? ???????????? ????? ???????? ?. ?????,
?????????? ??????????????? ???????????, ????????????? ??????????????? ? ??????????????? ??
????????????????? ??????????: I ? ?????-????????? ????; II ? ??????c??? ????; III ? ???????????????
????; IV ? ??????; V ? ?????-??????????????? ????
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ???????, ?.?. ??????????? ????? ???????????? ????? ???????? ?. ??????
??????? 2. ?????????????????? ????????? ????? ???????????? ????? ???????? ?. ?????,
???????? ??????????????? ???????????, ????????????? ??????????????? ? ??????????????? ??
????????????????? ?????????? (% ?? ????? ????? ????? ????? ??? ?????????)
????????? ?????
???????????? ??????????????? ?????????????
????
??????????
??????????????
?????????????? ??
?????????????????
??????????
????????? ????????
???????
1
2
1
1
??????????
16
16
16
16
???????????
4
5
4
4
???????????????
1
2
0
0
??????????????????
18
15
19
26
?????????????????
13
16
16
13
?????????????
13
15
11
12
??????????????
5
6
4
4
???????????????
10
5
9
9
?????????????
6
3
7
4
????????????????
5
7
6
4
?????????
2
3
3
3
??????????
2
2
2
3
???????????
1
2
1
-
???????
1
1
-
-
???????????
1
-
-
-
??????????? ????????
????????? ?????????????
???????????????
?? ?????????? ????? ?????????? ???????? ????????? ????????????? ??????????????? (???. 1, ????. 1) ????????????? ??????????
?? ????????? ??????????????? ???????????.
????? ???????? ????? ??????? ????????. ??
??????-?????? ?????? Poaceae ? Asteraceae
(?? 10 ?????), ?? ??????? ? Ranunculaceae (7
?????). ????? ??????? Apiaceae ? Caryophyllaceae (?? 6 ?????), Rosaceae (5 ?????). ???????? ??????? ??? Poa (5 ?????). ?? ???? ????????? ? ??????? ?????????? 2,7 ????. ???????
???????? ????????? ???? ???????? ????? 10
(27 %), ???? ???????? ? 26 ????????.
? ?????????????? ??????? ???? ????????? 50,3 % ????????? ????, ????? ??????? ??????????? ??????????????? (28,9 %).
?? ?? - ???? ???? -??? ? ?? ? ??? -? ?????? ??
???? ????? ??????? ??????? (13,4 %). ????
????-?????????, ?????-???????? ? ????????????-????????????????? ????? ????????????? (4,1, 3,1, 1 % ??????????????). ?????? ???????? ??????????????? ?????????
(49,7 %) ? ???? ? ???????? ????????, ??
??? 34,0 % ???????????, 12,4 % ?????????????? ? 3,1 % ???????????????-?????????.
?? ????????? ? ????????????? ????? ????
?????????? ?????? 2 ????. ??? ??????????
????? ? ? ??????????????? ??????????? Poa
krylovii ? Gypsophila sericea. ????? ????????
?????? ???? ?????? ???, ?????????? ? ??????? ????? ?????????? ????? (1996), ? Allium
altaicum.
? ????????? ????????????? ??????????????? ??????? ?????-????????? ?????
# 364 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ???????, ?.?. ??????????? ????? ???????????? ????? ???????? ?. ??????
??????????? ???? (56,5 %) (???. 2), ??? ?
??????????????? ???????????, ? ???????
???????????? ????? ???? (21,7 %), ??????
?????????? ????? ?????? (13,5 %), ??? ??????????????? (8,2 %). ?????? ????? ?????
17,7 %, ?????-??????????????? ????? ??????? (4,1 %).
????????????? ?????? ???? ?????????
?????? ?? ??????? ?????????? ???????, ???
? ????? ???????? ????????? ???????????
(73,3 %). ?????????????? ??????? ??????
(17,5 %), ? ?????????????? ?????? (9,3 %),
??? ? ??????????????? ???????????.
?????? ??????? ?????????????? ???????
??????????????? ????????? ??????????????? ? ???, ??? ?????, ? ??????? ?? ?????????
??????????????? ???????????, ?????? ?????
??????????? ????????? (40,2 %). ???? ????? ?????? ??????????? (? ????? 36,0 %,
?????????? ??????????? ? ???????????????
?? 14,4 %, ???????????????? ? 4,1 %, ???????????????? ? 3,1 %), ????????????? ????????? ????????????? ?????, ? 1,5 ???? ????,
??? ? ??????????????? ?????. ??????????
??????? ??????????? ? ????????????? ??????????????? ???????, ?????? ?????, ? ???,
??? ??? ????? ???? ????????????? ??????
??????? ????? ????? ????????????, ????????? ??? ???? ??????????? ?? ?????????? ?????? ???????, ??? ??????????? ??-?? ????????????? ???????? ????, ??? ? ?????? ?????
???????, ??? ??????????? ???????????????
?????????? (??????? ?????, 1987). ?????
????, ???-???????? ?????? ?????? ?? ????
???????????? ?????? ????????? ????????.
???? ?????? ????????????? ????? ? ???????
???? ????????? ??????????? ????: ?????????????? 10,3 %, ?????????????? 5,2 %,
?????????? 2,1 %, ??????????????? 1,9 %,
?????????? 1 %.
? ????????? ????????????? ??????????????? ???????? 13 ????????? ????
(????. 2). ????? ????? ??????????? ??????????? ????? (? ????? 75 %), ????? ??????? ???????? ??????????? ??????? ??????????? ????
(35 %); ?????? ??????? ?????????????????? ????????? ????, ??? ?????????????????. ??????????? ??????? ???????? (?????
? ???????? ??????) ? ??????????????? ????,
???? ? ?????????????, ???????????????? ?
??. ????????? ???????? ? ?????????????????? ??????? 21,9 %. ?? ??? ???????? ?????? ??????? ??????????? (16 %), ????????????
????? ??????? (5 %). ???????? ???? ?????? 2
????. ? ???? ????? ???????? ???? ????????????? ???????? Minuartia biflora.
????????? ??????? ???????????????
?? ????????????????? ??????????
? ????????? ??????? ???????????????
?? ????????????????? ?????????? ???????? ????? 69 ????? ?????????? ???????? ?? 44
????? ? 25 ???????? (????. 1, ???. 1). ? ????
?????????? ????????? ??????? ????????
?????? ???: Salicaceae (11 ?????), Asteraceae
(9) ? Poaceae (9 ?????). ?? ???? ?????????,
??? ? ? ????????????? ???????????????, ?
??????? ?????????? 2,7 ????. ??????? ???????? ????????? ???? ???????? ????? ?????? 8
(32 %), ???? ???????? ? 17 ????????. ????????
??????? ??? Salix (11 ?????), ?? ??? ???????
Poa ? Carex (?? 4 ????).
? ??????? ?????????????? ??????? ????? ???????? ? ????????? ???? (49,2 %), ?????
???, ??? ? ? ??????????????? ??????????? ?
????????????? ???????????????, ??????????? ??????????????? ???? (27,5 %). ? ????
????????? ???? ??????? ????-??????????????????-????????? (17,4 %); ????????????? ? ????-????????? ????? (4,3 %). ?????
? ???????? ???????? 50,8 %, ?? ??? 26,2 %
??????????????, 20,3 % ??????????? ? 2,9 %
???????????????-?????????, 1,4 % ???????????. ??????, ? ??????? ?? ???????????????
# 365 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ???????, ?.?. ??????????? ????? ???????????? ????? ???????? ?. ??????
? ????????????? ?????, ????? ???????????
????-????????-????????????????? ???? ?
?????-???????? ????????.
? ???? ????????? ??????? ?????????????? ????? ??????????? ???? (37,7 %),
??? ? ???? ???? ????????????? ?????????? (???. 2). ?????????? ? ???????????????
???? ?????????? ????? ????????? ???????
??????????????? (31,9 %, ?? ??? ??????????
20,3 %, ??????????????? 11,6 %). ?????? ?????, ??? ? ? ?????? ???? ??????????, ???-
?????? ???? ??????????, ????? ???????????
??????????? ?????, ?? ??????? ?????????? ? ????? 79,0 %, ? ????? ??? ???????????
(39,0 %), ? ?????????? ???????? ?????????????????? ????. ??????????? ??????? ?
???????? ???? (16,0 %), ??????? ???????
?????-????????, ? ??????? ??????? ??????????????. ??????? ???? ?????? ??????? ???????? (????. 2). ????? ????????? ????????
??????????? ??????????. ???????????, ???
? ? ???? ????????????? ??????????, ? ???-
?? ????? ????? (17,4 %), ? ?? ????? ??? ????
?????-??????????????? ????? ????? ? 2,5 ????
???? (13 %).
????????????? ?????? ?????? ????????? ?????? ?? ??????? ?????????? ???????,
??? ???????? (62,2 %) ??????????? ? ?????.
???? ?????????????? (20,3 %) ????, ??? ?
???? ??????????????? ??????????, ? ?????????????? ????????? ???? (14,5 %).
??? ?????? ???????? ??????????????
??????? ?????, ??? ? ? ????????? ????????-
??????????????? ??????? ???????????? ?????????????.
??????? ???????????, ??????????? ????????
?? ?????? ??????????? (55 %), ????? ???????
?????????? ??????? ????????? ?????????? ?????????? (21,7 %) ? ??????????????
(18,8 %), ? ???????????????? ? ???????????????? ??????????? ?????? (8,7 ? 5,8 %). ????
????????? ???????? ????? ? ?????????? ????
????? ????? ????????? (20,3 %). ??????, ?
??????? ?? ???? ?????? ????????, ????? ???????? ???????????? ??????? ??????????
(10,1 %), ??? ??????????? ???????????????
??????? ??????????????? ? ????? ??????
?. ?????. ???? ?????? ????????????? ?????
?? ????????? ???????-?????? ?????????????
??????? ? ????????????? ????????? ????? ????????? (????????????? ? 5,8 %, ????????????? ? 4,3 %, ?????????????? ? ?????????
?? 1,4 %).
? ????????? ??????? ???????????????
????????? ???? ?????? 12 (????. 2). ??? ? ?
??????????
??????????? ???????????? ?????????
??????? ?????????? ? ??????? ??????? ???????????? ?????????? ???????? ? ???????????? ????? ???????? ?. ?????, ??? ?? ???????
???????? ????? 3 ??2, ?????????? ???????
????????????, ???????????????? 166 ?????,
??? ?????????? ????? 25 % ?????, ???????????? ?.?. ????????? (1960) ?? ????? ?????
????? ?????. ????? ????? ? ????????? ??????????????? ??????????? ?????????? ?????
???????? ?? ?????????? ?????, ???????????
?? ??? ????? ???????? ????? (236 ?????), ?
????? ????? ? ????????? ????????????? ??????????????? ? ??? ????? 30 % ?????, ?????????? ?.?. ????????? ??? ??????????????? (341 ???) ?? ???? ?????????? ?????.
?? ????? ??????? ???????? ? ??????????
????? ????????? ??????????????? ??????????? ? ????????????? ??????????????? ????
??????????. ?? ????? ?? ??????? ????? ???
????????? ?????????? ???????????.
????????? ????????, ???, ???????? ??
??????????????? ???????? ???????????? ????????????? ?????, ????? ??????? ????????
? ?????????? ????? ???????? ???????????
?? ???? ???????? ?? ????????. ???, ???? ?
??????????????? ??????????? ???????? ????
# 366 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ???????, ?.?. ??????????? ????? ???????????? ????? ???????? ?. ??????
??????? ????????, 104 ???? ?????????? ????????, ?? ? ??????? ??????????????? ??
????????????????? ?????????? ? ??????
??? ??????? ?????????, 69 ????? ??????????
???????? (???. 1). ????? ????, ?????????? ??????? ???????????? ???????? ? ???????? ????? ????????. ?????? ????? ????????? Poaceae
? ????????????? ???????? ???????????????
??????????? ? ????????????? ??????????????? ???????, ????????, ? ????? ??????????
???????? ?? ?????????????. ????????????
????? ???? ?????? ?????? ???????????? ?
??????? ????????? ???????. ??????? ?? ????????? ???????? Salicaceae ? Asteraceae ? ???????????????, ????????????? ?? ????????????????? ??????????, ???????, ??????
?????, ? ???, ??? ????????????? ???? ????????
???????????????? ? ??????? ??????? ?????
? ???????? ????????? ????????? ???? ?????????? ??????? ??????????.
? ?? ?? ????? ? ????????????? ?????,
????????????? ? ???????? ????? ??????, ?????????? ????? ????? ?????????? ????????
??? ???? ?????????? ???????? ????? ????????????? (22 ????, 12 %). ????? ??? ????????????? ?????? ???????: ??????? Pinus sibirica
? Larix sibirica, ?????????? Betula rotundifolia, Cotoneaster uniflorus, Juniperus sibirica,
Lonicera altaica, L. hispida, Salix saposhnikovii,
S. phylicipholia, S. vestita ????? Aegopodium
alpestre, Astragalus frigidus, Bistorta vivipara,
Campanula rotundifolia, Chamaenerium angustifolium, Carex media, Festuca sphagnicola,
Hedysarum neglectum, Poa altaica, P. sibirica,
Pyrola rotundifolia, Trifolium lupinaster.
? ?????????? ??????????????? ??????????? ? ????????????? ???????????????
???????? 60 ????? ????? ?????????? ???????? (??????????? ???????? ?? ??????? 0,42).
????? ? ????? ????????? ??????? ????????
???????? ???????????? ?????????????? ???????? ???? ????? ???????? ?? ?? ???????
???????????????? ????????????. ? ??? ????
?????? ????? ????? ????? ??? ??????????????? ??????????? ? ??????? ???????????????
?? ????????????????? ?????????? (33 ????);
????????????? ??????????????? ? ???????
??????????????? ?? ????????????????? ?????????? (30 ?????). ???????????? ????????
?? ??????? ???? ???????? ???????? ?????
(0,23 ? 0,21 ??????????????). ??? ???????, ??????????, ? ???, ??? ?? ??????? ????????????????? ?????????? ?????????? ?????????
??????????????? ????????? ? ?????? ????????????, ????????? ?? ?????????? ???????
????? ???????? ????? ????????? ??????????
????????, ??? ???? ??????????? ??? ?????????? ???? ????????? ?????? ??????.
? ??????????? ???????????? ????????
??????????????? ? ???????????? ????? ?????,
????????????? ?????? ? ????? ?? ????????
(????????????? ????). ??? ?????, ?????????
?????? ? ??????????????? ??????????? ? ??
?????????? ? ??????????????? ????????????? ? ??????? ??????????????? ?? ????????????????? ??????????, 33 (30 % ?? ?????
????? ???? ?????????). ????? ??? ????????
???????????? ???? ?? ?????? ???????????, ?
????? ??????? ?????????? ?????????? Luzula
sibirica, Anthoxanthum alpinum, Callianthemum
sajanense, Carex sabynensis, Draba hirta, Festuca kryloviana, Gastrolychnis tristis, Gentiana
grandiflora, Pedicularis compacta, Potentilla
gelida, Rosa oxyacantha, Stellaria peduncularis
? ??.; ?????????????? Luzula parviflora, Aconitum decipiens, A. glandulosum, A. leucostomum, Draba sibirica, Pedicularis brachystachys;
??????????????? Dracocephalum imberbe,
Salix sajanensis. ????? ????????????? ?????
???? ????????? ???????? ????? ? ????????
Equisetum pr?tense, Erigeron elongatus, Linnaea
borealis, Orthilia secunda, Poa pratensis ? ??.
?????, ?????????? ?????? ? ????????????? ???????????????, 27 (????? 30 % ??
# 367 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ???????, ?.?. ??????????? ????? ???????????? ????? ???????? ?. ??????
????? ????? ?????????). ? ??????? ?? ??????????????? ???????????, ????? ????????????? ????? ???? ????????? ???????????
???????? Achillea millefolium, Bupleurum aureum, Crepis sibirica, Galium boreale, Dracocephalum nutans, Lilium pilosiusculum, Paeonia
anomala, Polemonium caeruleum, Primula pallasii, Pulsatill? flavescens, Scorzonera radiat?,
Spiraea chamaedrifolia, S. media, Thalictrum
minus, Trollius asiaticus, Veronica krylovii. ???????? ????? ? ???? ?????? ?????????????
?????: ????????????? Iris ruthenica, Bupleurum multinerve, Rosa acicularis, ?????????????
Dracocephalum peregrinum, ??????????????
Draba subamplexicaulis, ????????? Gentiana
uniflora ? ??.
? ??????? ??????????????? ?? ????????????????? ?????????? ???????????
27 ????????????? ????? (????? 40 % ?????
???? ?????????), ????? ??????? ????????
???????????? ???? ?? ?????? ???????????,
? ??? ?????: ?????????? ?????????? Crepis
multicaulis, Dryas ?xyodonta, Leontopodium
ochroleucum, Patrinia sibirica, Salix arctica,
S. rectijulis, S. reticulat?; ???????????????
Primula nivalis, Salix hastat?; ?????????????? Antennaria dioica, Carex orbicularis, Salix
glauca, Seseli condensatum, ??????????????
Phlojodicarpus villosus. ?? ?????? ????????????? ????? ???????? ????????? Carex capillaris, C. coriophora, Myricaria dahurica, Salix
coesia, ????????????? Aster sibiricus, Salix
pyrolifolia, ???????? Chamaenerion latifolium,
Equisetum variegatum, Pentaphylloides fruticosa, Taraxacum officinale, Scorzonera radiata,
???????????? Castilleja pallida; ???????? Astragalus austrosibiricus.
? ???????? ?????????????? ??????? ????? ???????????? ????? ???????? ?. ?????,
???????? ??????????????? ???????????, ??????????????? ????????????? ? ??????????????? ?? ????????????????? ????????-
?? ??????? ????????? ????? ????? ???????????
(51,5, 50,4, 50,34, 49,2 % ??????????????), ???
?? ????? ????? ????? ? ????? (41,1 %), ? ????? ? ?? ?????? ??????????? ? ??????????????? ?????, ??? ??????? ????????? ????????
??????????? ???? (????????, 1960).
?????????? ????? ?????-???????? ????????? (7) ???????????????? ? ??????????????? ???????? ?????, ?? ????? ? ????????????? ??????????????? ??????????? ??????
(2). ? ??????????????? ?? ????????????????? ?????????? ?????????? ???? ?? ??????????.
? ??????????????? ??????????? ????????: ???? ??? Aconitum decipiens, ??????????
? ??????? ????? ?? (2008) ? ?????????? ????? (1996) ? ??? ???? Allium altaicum ? Rosa
oxyacantha, ????????? ? ??????? ????? ?????????? ????? (1996). ? ?????????????
??????????????? ??????? ?????? ???? ??? ?
Allium altaicum, ????????? ? ??????? ?????
?????????? ?????. ? ??????? ??????????????? ?? ????????????????? ??????????
????, ?????????? ? ??????? ????? ?? (2008)
? ?????????? ????? (1996) ?? ??????????.
????????????? ?????? ????? ???????????? ????? ???????? ?. ????? ? ???? ????????????? ???? ???????? ?? ?????? ??????
??????? ?????????? ?????????? ??????????
?????????? ? ??? ?????????. ?????????? ???
???? ????????????? ????????? ?? ????????
??????????? ? ???????? ?????????????? ?????, ????????????? ?? ??????? ????? 2100 ?.
????????????? ?? ??????, ???????????
???????? ?????????????? ?.?. ?????????
(1960), ???????? ?????????? ????????????
?????? ???????????, ???????????? ?????
???????? ????? ? ??????????????? ???????????, ??? ????? ??? ? ??? ???? ????, ??? ??? ??????????? ????? ? ?????. ? ???????????????
?????????????, ??? ?????? ???? ?????????
(40 %) ? ??????????? (36 %), ??????? ??????-
# 368 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ???????, ?.?. ??????????? ????? ???????????? ????? ???????? ?. ??????
??? ? ??? ???? ????, ??? ? ???????????????
????? ?????. ????? ????????????? ?????????,
? ????? ????? ??????, ???????? ?????????
???????? ??????????? ????????????? ?????,
????????????? ? ???????????????? ????????
?? ????????????? ?????.
? ?????, ????? ???????????? ????? ???????? ?. ????? ????? ???????????? ????????
? ??????????? ??????. ??? ????????????? ??
???? ???????????? ?????? ?? ??????? ?????
? ???????????????, ??????? 13 ???. ?. ?. (??????, 1982), ?? ???? ?????? ? ????????????
?????.
??????????
???????????? ???? ???????? ?. ?????,
?? ?????????????? ????????????? ???????????? (? ???????? ?????? ???????? ????????), ?? ?????????? ??????? ?????????
??????? ??????? ???????????? ??????????
????????. ????? ????????????? ???????? ?????????? ??????? ?????????????,
??????? ?????? ?????-???????? ?????????
? ?????, ?????????? ? ??????? ?????, ?????????? ??????????????? ??????????. ??
???? ???????? ???????? ????? ??????? ???????????? ???????????. ??????????????
?????????? ????? ????? ? ?????????? ??????????????? ???????????, ?????????????
??????????????? ? ??????? ??????????????? ?? ????????????????? ??????????,
?????? ??????? ?? ???????? ???????? ???????????? ?????????????? ???? ????????,
????????????? ? ???????????????? ???????? ???? ?? ?????. ????????? ?????????????? ? ???????????? ??? ? ??????? ?????
????? ???????? ?. ????? ? ?????, ??? ? ?
??????? ???? ?????????? ???????? ???????????? ??????? ????????? ??????????.
????? ????????????? ????? ???????? ?. ????? ??????????????? ?????????? ???????????? ????????? ???????? ??? ??????????
????????????? ???????????? ???????????
???????????? ????? ? ?????????? ????????????? ??????????? ????????? ???????????????.
?????? ????????? ??? ????????? ?? ??? (????????? YII.63.1, ?????????????? ??????
? 56), ??????? ?????????? ??? ? 4 ? ??????????? ????? ??????????????? ????????????.
?????? ??????????
???????? ?.?. (1986) ????????????? ???????? ???????? ?? ?????????? ??????? ????? ?
XYII-XIX ??. ???????? ????????????????. ?: ???????????????? ? ??????????????????. ???????????: ?????, ?. 106-107.
??????? ?.?. (2009) ????????? ???????? ?????????? ? ???????????? ???????????? ?????: ???????. ????. ????. ????. ??????????, 23 ?.
???????? ?.?. (1976) ???????? ???????????? ?????????. ??????? ???????????. ?.5. ?.:
?????. ?.7-130.
??????? ????? ?????????? ????????? (???????? ? ?????) (2008). ?.: ???????????? ??????? ??????? ???, 855 ?.
??????? ????? ?????????? ????? (????????) (1996). ???????????, 130 ?.
?????? ?.?., ????? ?.?. (1965) ???????????????? ????????????? ? ???? ????. ?: ???? ??????? ?????. ?.: ?????, ?. 28-144.
?????? ?.?., ????? ?.?. (1967) ???? ???????? ? ????????????? ????? ??????? ?????. ?.:
?????, 222 ?.
# 369 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ???????, ?.?. ??????????? ????? ???????????? ????? ???????? ?. ??????
???????? ?.?. (1960) ???????????? ?????? ?????. ???????????: ???-?? ?? ?? ????,
450 ?.
??????? ?????, ????? (1987). ?.: ???????????????, 120 ?.
??????? ?.?. (1965) ???????????? ????? ?????????? ?????. ?.-?.: ?????, 367 ?.
?????? ?.?. (1982) ???????? ?????????? ????? ? ??????? ??????????? ? ????????. ?????:
???-?? ???????? ????????????, 208 ?.
??????, ?.?. ???????? ?.?., ???????? ?.?. (2000) ???????? ???????? ? ??????? ? ????? ????? ??????. ?: ???????????? ?????????? ?????????. ?. 4. ????????-?????????????
?????????. ?????, ?. 164-199.
??????? ?.?. (1965) ? ???????? ? ??????? ???????? ?????. ???????? ?? ?? ????. ???.
????.-???. ????, 8, ???. 2: 2-9.
??? ?.?. ????????? ???????? ????? (2003). ?????: ???-?? ???????? ????????????, 196 ?.
???????? ?.?. (1996) ??????????? ????????????? ????? ?????-???????? ?????? ???????
(?????????????, ???????????, ?????????). ???????, 287 ?.
?????????? ?.?. (1901) ?????? ? ?? ??????. ??????????? 1897-1899 ??. ?????, 312 ?.
?????????? ?.?. ????????????? ?????????? ???????? (1962). ?.: ?????? ?????, 377 ?.
?????? ?.?., ????????? ?.?., ???????? ?.?. ? ??. (1980) ???? ????? ??? ????? ??????.
???????????: ?????, 336 ?.
??????? ?.?. (2004). ?????? ? ?????????? ?????????????? ???????????? ?????????????
??????? ????????????? ???????? ????? . ?????: ??????? ?????, 69 ?.
??????? ?.?., ??????? ?.?., ?????????? ?.?. (2005) ?????? ????????? ????? ?????????????? ?????? ??? ????? ????????????? ??????????? ???????????? ????? ?????. ?: ??????
????????? ????????? ?? ????????????????????? ???????????. ????????? ????????. ?????,
?.548-551.
???????? ?.?. (1962) ?????? ?????? ?? ???????. ?.: ???-?? ???, 100 ?.
???????? ?.?. (1974) ???????? ? ????????? ????????. ?.: ???-?? ???, 244 ?.
?????? ?.?. (1949) ?????? ?????????? ?????. ?.: ?????????, 376 ?.
????????? ?.?. (1995) ?????????? ???????? ?????? ? ???????????? ??????????. ???.: ???
? ?????, 990.
????? ?.?. (1984) ?????????????? ?????? ? ????????. ?.: ???-?? ???, 288 ?.
Timoshok E., Narozhniy Yu. (2004) Ecosystems and glaciological studies in the Aktru glacier
basin (associated Aktru cluster). In: Global Change Research in Mountain Biosphere Reserves.
Proceedings of the International Launching Workshop Entlebuch Biosphere Reserve, Switzerland, 1013 November, 2003. Paris: UNESCO, P. 174-182.
Timoshok E., Scorohodov S. (2005) Species, coenotic and ecosystem diversity in headwater basin
Aktru (Severo-Chuisky Range, Centrai Altai) In: Global Changes in Mountain Regions (M.F. Price,
ed.) Duncow: Sapiens Publ., P. 144-145.
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ???????, ?.?. ??????????? ????? ???????????? ????? ???????? ?. ??????
Flora of High-Mountain Forests
of Actru River Sources
(Severo-Chuisky Range, Centralny Altay)
Elena E. Timoshok,
Sergey N. Skorokhodov and Eugeny N. Timoshok
Institute for Monitoring of Climatic
and Ecological Systems SB RAS,
10/3 Akademichesky, Tomsk, 634055 Russia
High-altitudinal forests of Severo-Chuisky range have high biodiversity of vessel plants. The highest
biodiversity are registered in old age Siberian stone pine forests. The article includes information of
taxonomical, chorological and ecological structure of flora of high-altitudinal forests; information
on coenoflora of old Siberian stone pine and younger Siberian larch forests, which was formed at
the place of cinder-places and fluvioglatial scurf. Asian species are dominating in coenoflores. All
coenoflores are noticeably isolated and enriched with psychrophit species.
Keywords: forests, coenoflora, vessel plants, Severo-Chuisky range.
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Journal of Siberian Federal University. Biology 4 (2010 3) 372-383
~~~
??? 577.112
Ca2+-regulated Photoprotein Obelin
as N-terminal Partner in the Fusion Proteins
Elena V. Eremeevaa, Ludmila A. Franka, b*,
Svetlana V. Markovaa, b and Eugene Vysotskia
a
Institute of Biophysics SB RAS,
Russia, 660036, Krasnoyarsk, Akademgorodok
b
Siberian Federal University,
Russia, 660041, Krasnoyarsk, Svobodny av., 79 1
Received 3.12.2010, received in revised form 10.12.2010, accepted 17.12.2010
Ca2+-regulated photoproteins genetically fused with biospecific polipeptides have been extensively
used in intracellular Ca2+ measurements and in the development of binding assays. Gene fusions to
aequorin have been limited to its N-terminus, since as previous studies indicated the protein loses
bioluminescent activity upon modification of its C-terminus. To investigate this in regard to another
photoprotein ? obelin (OL) the one was elongated at its C-terminus with tyrosine (Y) and then fused
with green fluorescent protein Clytia gregaria (cgreGFP) through the flexible 31 aa linker. Both
proteins (OL-Y and OL-cgreGFP) were isolated and investigated. The OL-Y was found to form a
stable photoprotein comlex, possessing 75 % of WT-OL bioluminescent activity. OL-cgreGFP activity
preserves 46 % of WT-OL activity and demonstrates an effective resonance energy transfer, where
OL-partner and cgreGFP-partner are energy donor and acceptor respectively. Thus, it was shown
that the labels on the base of Ca2+-regulated photoprotein obelin may be obtained by fusing with biospecific polypeptides regardless its termini.
Keywords: obelin, C-end fusing, cgreGFP.
Introduction
Ca2+-regulated photoproteins of marine
coelenterates, e.g. aequorin from the jellyfish
Aequorea (Shimomura et al., 1962) and obelin from
the hydroid Obelia (Morin et al., 1971) are stable
complexes consisting of single-chain apoprotein
(about 20 kDa) and pre-oxidyzed substrate ?
peroxycoelenterazine, tightly but non-covalently
immobilized in hydrophobic cavity (Head et al.,
Liu et al., 2000). The proteins are characterized
by high sequence homology and contain three
??EF-hand?? Ca2+-binding consensus sequences
*
1
like other Ca2+-binding proteins. The binding
of Ca ions initiates conformational changes in
a molecule resulting in peroxycoelenterazine
decarboxylation and emission of visible light
(?max = 470-490 nm). Some photoprotein cDNAs
were cloned and expressed in E. coli cells (e.g.
Prasher et al., 1985; Inouye et al., 1993; Illarionov
et al., 1995), making the recombinant apoproteins
available. The apophotoproteins are turned into
photoproteins by simple incubation with synthetic
coelenterazine at reducing conditions without any
folding problems. Due to the high quantum yield
Corresponding author E-mail address: lfrank@yandex.ru
© Siberian Federal University. All rights reserved
# 372 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena V. Eremeeva, Ludmila A. Frank? Ca2+-regulated Photoprotein Obelin as N-terminal Partner in the Fusion Proteins
and low background it is possible to discriminate
as small as 10 -18 mol of photoprotein. That is why
the recombinant Ca2+-regulated photoproteins
(aequorin and obelin, first of all) are widely used
as effective reporters in cells and in vitro assays
(see for ref. Blinks et al., 1982; Lewis et al.,
2000). To become a specific label, photoproteins
are conjugated with proper bio-specific molecule
chemically or by engineering of genetically
fused proteins (chimeras). Many photoproteins
cloned for to date (aequorin, obelins, clytin)
contain C-end Pro. As was reported for native
aequorin, any modifications on the C-terminus
proline (deletion, substitution or addition) result
in almost total loss of its bioluminescent activity
or stability (Nomura et al., 1991; Watkins et al.,
1993). Since modification of the N-terminus of
aequorin and obelin has no any adverse effect on
luminescence activity, the gene fusions had been
made only through their N-termini (Zenno et al.;
Frank et al., 1996; Waud et al., 2001; Baubet et al.,
2000; Gorokhovatsky at al., 2004). At the same
time, the functionality of some polypeptides
lies in their C-terminal region, as well as the
recognition of some antibodies occurs only at the
epitope on polypeptide C-terminus. Hence, the
development of C-terminus-extended derivatives
of obelin would essentially broaden its analytical
applications.
The goal of our work was to investigate
Ca2+-regulated photoprotein obelin as N-terminal
label in the fusion proteins. The main background
for the study was the fact that mitrocomin ?
photoprotein of the hydromedusan Halistaura
(Mitrocoma), contains additional tyrosine after
C-end proline (Fagan et al., 1993). This is the
reason why tyrosine was taken for the shortest
prolongation of obelin C-terminus. Then OL-Y
was fused with N-terminus of a green fluorescent
protein from Clytia gregaria (cgreGFP). In the
paper we describe the construction of expression
vectors encoding the proteins of interest, their
expression in E. coli cells, purification and
properties.
Materials and methods
1. Reagents
QIAprep Spin Miniprep Kit, QIAquick Gel
Extraction Kit, QIAquick PCR purification kit
were from QIAGEN (Germany); phosphatase
CIP and T4 ligase were from BioLabs (USA); Pfu?urbo polymerase, E. coli cells strains XL1-Blue
and BL21-Gold were from Stratagene (USA).
Coelenterazine
was
obtained
from
PJK GmbH (Kleinblittersdorf, Germany).
Recombinant obelin of wild type (WT-OL)
and cgreGFP of high purity were obtained as
described in (Illarionov et al., 2000; Markova et
al., 2002; 2010).
All other chemicals were from standard
sources and were of reagent grade or better.
Oligonucleotides were purchased from
Syntol (Russia):
1. 5?-ACTCCATGGCTTCAAAATACGCAGTTA-3?
2. 5?-TGTCTCGAGCTTAGTAGGGAAC
TCCGTTGCC-3?
3. 5?-TACAATACCGGTGCCACCATAG
GGAACTCCGTTGCC-3?
4. 5?-CCGGTGGTTCAGGCGGTTCTGGTTCAG-3?
5. 5?-GAGGTTCAGGCTCTGGTGGCTCAGGAT-3?
6. 5?-ACCAGAGCCTGAACCTCCTGAA
CCAGAACCGCCTGAACCA-3?
7. 5?- CTGGAGGCTCAGGTTCCGGGGATCTGGTCA-3?
8. 5?-TATGACCAGATCCACCGGAACCTGAGCCTCCAGATCCTGAGCC-3?
2. Plasmid construction
The DNA fragment encoding obelin with
tyrosine on its C-terminus (OL-Y) was amplified
by PCR with specific primers No.1 and No.2
# 373 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena V. Eremeeva, Ludmila A. Frank? Ca2+-regulated Photoprotein Obelin as N-terminal Partner in the Fusion Proteins
Fig. 1. Engineering of OL-Y (A) and OL-cgreGFP (B) proteins
containing NcoI and XhoI sites. The pET19OL8 expression plasmid carrying the Obelia
longissima wild-type apo-obelin gene (Markova
et al., 2001) was used as a template. The PCR
products were cloned into NcoI/XhoI sites of
pET19b vector (Fig. 1).
For OL-cgreGFP chimera cloning, the
DNA fragment encoding obelin with additional
amino acids on its C-terminus ? tyrosine and two
glycines (OL-Age) ? was amplified by PCR with
specific primers No.1 and No.3 containing NcoI
and AgeI sites. The above mentioned pET19-OL8
expression plasmid was used as a template. The
PCR products were digested with NcoI/AgeI. The
DNA fragments encoding flexible linker for OLcgreGFP chimera were obtained by annealing of
five complimentary oligonucleotides (No. 4-8),
which were phosphorylated with polynucleotide
kinase (Sibenzyme, Russia) beforehand. The
annealing was carried out in 10 ?M Tris-HCl, pH
7.5, 2 ?? MgCl2, 50?? NaCl buffer by heating
up to 82°? followed by slow cooling to 23°C. The
DNA fragment encoding flexible linker had AgeI
sticky end on its 5?-end and NdeI sticky end on its
3?-end. As a vector for OL-cgreGFP construction
we used dephosphorylated and digested with NdeI
and NcoI pQE-cgreGFP25 plasmid carrying the
Clytia gregaria wild-type GFP gene (Markova et
al., 2010) (Fig. 1).
The plasmids harboring the target insertion
segments were verified by DNA sequencing. We
used E. coli BL21Gold cells for expression of
OL-Y, and XL1-Blue cells for expression of OLcgreGFP construction.
# 374 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena V. Eremeeva, Ludmila A. Frank? Ca2+-regulated Photoprotein Obelin as N-terminal Partner in the Fusion Proteins
3. Proteins expression
and purification
4. Protein analysis
The transformed E. coli cells were cultivated
with vigorous shaking at 37єC in LB medium
containing ampicillin (200 mg/l) and induced with
1 mM IPTG when the culture reached an OD600 of
0.5?0.6. After addition of IPTG, the cultivation of
OL-Y expressed cells was continued for 3 h at the
same conditions. OL-cgreGFP expressed cells
were cultivated for 24 h with vigorous shaking
at room temperature and than stored for more 24
h at 8єC.
In both cases the E. coli cells were harvested
by centrifugation, the pellet resuspended in 20
mM Tris-HCl pH 7.0 (1:5, w/v), and disrupted by
sonication (20 s x 6) at 0 єC. Then the mixtures
were centrifugated. The fusion apo-OL-Y was
purified from inclusion bodies and charged
with coelenterazine as previously reported for
recombinant WT obelins (Illarionov et al., 2000;
Markova et al., 2002).
The pellet inclusion bodies of fusion apoOL-cgreGFP was washed with the following
solutions: (a) 0.1 M NaCl, 20 mM TrisHCl pH
7.0 (x2); (b) 1 % Triton X-100, 20 mM TrisHCl
pH 7.0 (x2); and (c) 5mM CaCl 2, 20 mM
TrisHCl pH 7.0 (x1) to remove contaminating
substances. All the washing procedures were
performed with centrifugation. The fi nal pellet
was resuspended in 20 mM TrisHCl pH 7.0,
contained 6 M urea, kept at 4єC for 2 h with
stirring and then centrifuged. Supernatant (the
solution of chlorine color, illuminating under
UV-irradiation) was diluted 5-fold with 20 mM
TrisHCl pH 7.0, contained 10 mM DTT, 5 mM
EDTA and coelenterazine (1.1 molar excess to
protein) and kept at 4єC overnight. Then the
solution was concentrated and the recombinant
protein was separated from the other components
by gel-filtration on D-Salt Column (Pierce, USA)
equilibrated and eluted with 20 mM TrisHCl pH
7.0, 5 mM EDTA.
The electrophoresis was performed according
to Laemmli, using a 12.5 % polyacrylamide gel.
Protein molecular weight calibration mixture
(Amersham Bioscience, USA): phosphorylase b
(94.0 kDa), bovine serum albumin (67.0 kDa),
ovalbumin (43.0 kDa), carbonic anhydrase (30.0
kDa), soybean trypsin inhibitor (20.1 kDa),
?-lactalbumin (14.4 kDa).
Protein concentration was measured with
the BioRad DC protein assay kit.
5. Bioluminescence measurement
The bioluminescence intensity was
measured with a BLM 8801 photometer (SCTB
??Nauka??, Russia) by rapid injection of 0.2 ml of
100 mM CaCl2, 100 mM Tris?HCl, pH 8.8, into
the photometer cell containing 0.5 ml of 5 mM
EDTA, 100 mM TrisHCl, pH 8.8, and the protein
aliquot.
6. Spectral measurements
The absorption spectra were obtained
with an UVIKON 943 Double Beam UV/
VIS spectrophotometer (Kontron Instruments,
Italy). The bioluminescence and fluorescence
spectra were measured with an AMINCO
spectrofluorimeter (Thermo Spectronic, USA).
The emission spectra were corrected with the
computer program supplied with the instrument.
All spectral measurements were carried out at
room temperature.
The bioluminescence spectra were
measured in 1 mM EDTA, 50mM Bis-Tris
propane buffer pH 7.0. The bioluminescence
was initiated by injection of CaCl 2 solution
in the same buffer. The concentration of free
Ca 2+ was around 0.5 mM in order to provide
an approximately constant light level during
the spectral scans. The calcium concentration
was estimated with the MAXICHELATOR
program.
# 375 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena V. Eremeeva, Ludmila A. Frank? Ca2+-regulated Photoprotein Obelin as N-terminal Partner in the Fusion Proteins
Results and discussion
The obelin C-end extension was performed
with minimal fragment ? one amino acid (tyrosin),
and also with the whole protein approximating
obelin molar mass ? green fluorescent protein of
Clytia gregaria (cgreGFP) through 31 aa flexible
linker of almost 110 Е (Fig. 2). The linker contains
amino acids lacking large bulky hydrophobic
side chain: GGT(GGS)2GS(GGSGS)3GGSGH,
that provides its flexibility. Obelin molecule is
a compact globule with a diameter of 50 Е (pdb
code 1EL4), cgreGFP is a barrel with a height
of 45 Е (pdb code 1HPW). As a result, the
linker length and flexibility allow independent
orientation of fused molecules. Simultaneously,
it can provide the energy transfer according
to BRET mechanism, where the photoprotein
moiety is a donor and GFP ? acceptor (Ward,
1979). The scheme of fusion proteins engineering
is presented in the Fig. 1. The final construction
OL-Y was obtained by ligation of OL-Y and vector
pET19b, both carrying Ncol/Xhol restriction
sites. The final construction OL-cgreGFP was
obtained by ligation of three DNA fragments ?
OL (Ncol/AgeI), annealed linker (Agel/Ndel) and
vector pQEcgreGFP25 (Ncol/Ndel). The E. coli
cells transformed with corresponding plasmids
were used to express the proteins of interest.
SDS-PAGE analyses indicate that the
expression level of both proteins ? apo-OL-Y
and apo-OL-cgreGFP is rather high and most
of the proteins are accumulated in inclusion
bodies (Fig. 3). To produce a highly-purified
OL-Y we applied the method developed for
WT obelin. The method was as follows:
apoprotein (inclusion bodies pellet dissolved
in 6 M urea) was purified chromatographically
under denaturating conditions (Fig. 3A, lane 5),
charged with coelenterazine (overnight) and
then additionally purified on Mono Q-column.
This chromatography step allowed separation of
obelin from apoprotein that has not been charged
with coelenterazine. The yield of activated OL-Y
was 68 %.The final product was homogeneous
according to SDS-PAGE (Fig. 3A, lane 6).
The apo-OL-cgreGFP inclusion bodies
after thorough washing were dissolved in 6M
urea solution. The sample was diluted (1/10,
v/v) with 20 mM TrisHCl pH 7.0, 10 mM DTT,
5 mM EDTA, incubated with coelenterazine at
8 єC overnight and purified by gel-filtration. The
final protein was of 80-90 % purity (Fig. 3B,
Fig. 2. Schematic view of OL-cgreGFP fusion protein. Peroxycoelenterazine and GFP chromophore are displayed
by stick models in the center of molecules
# 376 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena V. Eremeeva, Ludmila A. Frank? Ca2+-regulated Photoprotein Obelin as N-terminal Partner in the Fusion Proteins
Fig. 3. SDS-PAGE analysis of OL-Y (panel A) and OL-cgreGFP (panel B) at purification. Lanes 1 and 2, wholecell lysates before and after IPTG induction respectively. Lane 3, cytosolic proteins. Lane 4, 6M urea extracts
of inclusion bodies. Lane 5 (A), apo-OL-Y after purification on DEAE-Sepharose FF column. Lane 6 (A), OL-Y
after purification on Mono Q column. Lane 6 (B), final OL-cgreGFP solution. Lanes 7 (A) and 5 (B) ? standard
proteins (see Materials and Methods). Arrows show recombinant proteins bands
lane 6) and is a polypeptide with Mr about 50
kDa that is in good agreement with the molecular
weight calculated from amino acid sequence of
the designed protein ? 50.9 kDa. Unfortunately,
we failed to separate chromatographically the
charged and uncharged OL-cgreGFP due to their
high unspecific sorption on MonoQ column.
The protein solution was of chlorine color and
illuminated under UV-irradiation.
Of special interest was the process of the
OL-Y apoprotein activation (formation of the
complex
apoprotein-peroxycoelenterazine).
Fig. 4 presents the kinetics of OL-Y activation
in comparison with WT apoobelin. Note, the
reaction of chimera activation is almost by an
order slower and reaches the plateau in 12-14
h. Thus, apoobelin C-end prolongation with
one amino acid does not prevent it to form an
active photoprotein complex, but decelerates the
process.
Bioluminescent properties of chimeric
proteins as opposed to those of WT obelin are
summarized in the Table. One can see that the
addition of one amino acid to obelin C-end had
no dramatic effect on bioluminescent activity
which retained 75 % of the WT obelin activity.
In the case of OL-cgreGFP, the lower activity
can be attributed to the lack of chromatographic
separation stage after coelenterazine activation,
so the sample may be the mixture of charged and
uncharged proteins.
The
level
of
?a2+-independent
bioluminescence (due to spontaneous photoprotein
decomposition), normalized to protein (specific
ICa-ind) may serve as the indicator of stability of
the apoprotein-peroxycoelenterazine complex.
According to this parameter, OL-Y is 4 times less
stable than WT obelin. At the same time, ?a2+independent bioluminescence is million times
lower, than Ca-triggered bioluminescence (for
WT obelin the ratio of ?a2+-independent to Ca2+triggered luminescence equals 7 log units).
There are no differences between the
absorption spectra of OL-Y and WT obelin:
both display maxima at 278 nm (polypeptide
absorption) and at 460 nm (absorption of
peroxycoelenterazine, immobilized into protein
cavity) (Fig. 5A). The cgreGFP spectrum
(Fig. 5B) displays maxima at 278 nm and 485
nm, with the 278 nm/445 nm absorption ratio
1.6. It should be noted that this ratio reflects
the level of cgreGFP maturation (spontaneous
fluorophore formation inside the molecule). The
fusion protein OL-cgreGFP spectrum presents
# 377 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena V. Eremeeva, Ludmila A. Frank? Ca2+-regulated Photoprotein Obelin as N-terminal Partner in the Fusion Proteins
Fig. 4. Activating kinetics of WT obelin (?) and OL-Y (?). Axis Y shows bioluminescence signal ratio It/Imax,
where Imax ? the bioluminescent signal after 24 h of activation. The lines are fits according to an exponential
growth model
Table. Bioluminescent properties of fusion proteins as opposed to those of WT obelin
Protein
WT-OL
Decay rate,
s-1
Bioluminescence
yielda ( %)
Bioluminescence
?max/shoulder (nm)
Specific ICa-ind
(r.u./mg)
ICa-ind/ICab
x 10 -7
6.3
100
485/400
1.8
1.1
OL-Y
5.8
75
485/400
7.2
12
OL-cgreGFP
4.8
46
500/485/400
not detectedc
not detected
Total bioluminescence emission relative to WT obelin
ICa-ind/ICa ratio of ?a2+-independent to Ca2-triggered bioluminescence
c
The protein obtained was of 80-90 % purity
a
b
the superposition of WT obelin and cgreGFP
spectra with maxima at 278 nm and 485 (Fig. 5C),
with the 278 nm/485 nm absorption ratio 0.18.
Since these two proteins in fusion are spaced
with 31 aa linker and hardly affect each other
we may consider them as equimolar solution of
obelin and cgreGFP. The spectrum of equimolar
mixture of OL-Y and maturated cgreGFP is
presented in the same Fig. 5C (dashed line) and
it shows that the 278 nm/485 nm absorption ratio
amounts to 0.56. Thus, in chimera, the maturity
of cgreGFP moiety constitutes only 38 %. The
result is not surprising since the fusion protein
was isolated from inclusion bodies. For aequorin
GFP, Cubitt and co-authors (1995) reported that
fluorophore results from autocatalytic cyclization
of the polypeptide backbone between residues
Ser65 and Gly67 and oxidation of the ?-? bond of
Tyr66. In cgreGFP the residues are Ser68, Tyr69 and
Gly70 (Markova et al., 2010). In our case the high
expression level of recombinant protein causes its
?packing? into insoluble inclusion bodies (Fig. 3).
As a consequence, insolubility prevents posttranslational fluorophore maturation of the major
part of the expressed cgreGFP module.
The OL-Y Ca 2+-triggered bioluminescence
spectrum (Fig. 6A, line 1) is broad and like
WT obelin bioluminescence spectrum displays
# 378 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Fig. 6. Panel A: Normalized bioluminescence spectra
of OL-Y (line 1), OL-cgreGFP (line 2, 2.9 ?M solution),
and fluorescence spectrum of cgreGFP (line 3, ?ex=465
nm); Panel B: Normalized bioluminescence spectra of
equimolar mixture of WT-OL and cgreGFP in 2.4 ?M
solution(line 1) and 24 ?M solution (line 2)
Fig. 5. Normalized absorption spectra of Ob-Y (A),
cgreGFP (B), and OL-cgreGFP (C). Dashed line ?
the absorption spectrum of 1:1 molar mixture of
cgreGFP:Ob-Y
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena V. Eremeeva, Ludmila A. Frank? Ca2+-regulated Photoprotein Obelin as N-terminal Partner in the Fusion Proteins
a peak at 485 nm with a shoulder at 390 nm.
The chimera OL-cgreGFP Ca 2+-triggered
bioluminescence spectrum (Fig. 6A, line 2) has
the maximum at 500 nm that is virtually identical
to the fluorescence spectrum of cgreGFP
(Fig. 6A, line 3), and shoulders at 485 nm and
390 nm (belonging to obelin bioluminescence
spectrum). The observed green bioluminescence
of OL-cgreGFP occurs due to reradiation of
obelin module (energy donor) to fluorophore of
cgreGFP module (energy acceptor) according
to BRET mechanism (Ward, 1979). The ratio of
luminescence intensities at wavelengths of the
acceptor and donor emission maxima (I500/I480,
in our case) correlates with BRET efficiency
and account for 2.6 (protein concentration in
the experiment was 2.9 ?M). The efficiency of
the process is known to depend on overlapping
of donor luminescence and acceptor absorption
spectra and on the distance between the
proteins. As one can see obelin bioluminescence
spectrum (Fig. 6A, line 1) totally overlaps
cgreGFP absorption spectrum (Fig. 5B). The
linker between modules holds them near each
other at a distance of almost 110 Е (calculated
as a sum of 31 distances between neighboring
?-carbon atoms in polypeptide chain). Actually
the linker flexibility provides any mutual
orientations of donor and acceptor, and, as a
consequence, the inter-modules distance may
be much shorter and approach 100 Е required
for effective BRET.
For comparison, we carried out the energy
transfer experiments in solution of equimolar
mixtures WT-OL and maturated cgreGFP
(Fig. 6B). At 2.4 ?M proteins concentration
(Fig. 6B, line 1) the ratio I500/I480 equals 1.1, so
the energy transfer efficiency is essentially lower
than observed for chimera OL-cgreGFP 2.9
?M solution. Meanwhile, the close to chimera
ratio I500/I480 of 2.4 was observed in a 24 ?M
mixture of OL and cgreGFP (Fig. 6B, line 2), the
concentration when the trivial energy transfer
takes place.
Thus, it was found that obelin extended
with tyrosine at C-end (OL-Y) forms an active
and stable photoprotein complex, not too
much differing from WT obelin. Fusing with
the cgreGFP gives the chimera of moderate
bioluminescence activity demonstrating effective
energy transfer to GFP. The results clearly show:
i) there is a principle possibility to construct active
obelin derivatives fused through C-end with the
other polipeptides, and, ii) the bioluminescent
properties of final chimeras will substantially
depend on the polipeptides? nature.
It should be noted that similar results were
obtained by S. Deo and co-workers (2001) at
studying cysteine-free aequorin mutant (more
stable that WT-aequorin) fused through C-end
with octa- and pentapeptide. The authors
found that contrary to WT aequorin, the
cysteine-free mutant retains practically all of
its bioluminescent activity after extending the
C-terminal region.
The gene-fusing technique has become
an increasingly useful tool in biomedical
research. Fusion proteins are constructed,
when it is necessary: to increase cellular
stability and biological activity of functional
proteins, to increase solubility of a protein
expressed in bacterial cells or to facilitate its
purification, to select and produce antibodies
etc. The construction of bifunctional molecules
containing bio-specific and reporter modules
creates effective markers to be applied in both
in vivo and in vitro assays. Ca2+-regulated
photoproteins seem to be promising reporter
modules providing high sensitivity of the assay
under development. The perspective to obtain
obelin labels by its fusing with bio-specific
polipeptides regardless to its termini likely
considerably broadens the application of the
photoprotein as an effective analytical tool.
# 380 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena V. Eremeeva, Ludmila A. Frank? Ca2+-regulated Photoprotein Obelin as N-terminal Partner in the Fusion Proteins
References
Baubet V., Mouellic H., Campbell A.K., Lucas-Meunier E., Fossier P., Brulet P. (2000) Chimeric
green fluorescent protein-aequorin as bioluminescent Ca2+ reporters at the single-cell level. Proc. Natl.
Acad. Sci. USA. 97: 7260-7265.
Blinks J.R,. Wier W.G., Hess P., Prendergast F.G. (1982) Measurement of Ca++ concentrations in
living cells. Prog. Biophys. Mol. Biol. 40: 1-114.
Cubitt A.B., Heim R., Adams S.R., Boyd A.E., Gross L.A., Tsien R.Y. (1995) Understanding,
improving and using green fluorescent proteins. Trends Biochem. Sci. 20(11): 448-455
Deo S.K., Lewis J.C., Daunert S. (2001) C-terminal and N-terminal fusions of aequorin with
small peptides in immunoassay development. Bioconjugate Chem. 12: 378-384.
Fagan T.F., Ohmiya Y., Blinks J.R., Inouye S., Tsuji. F.I. (1993) Cloning, expression and sequence
analysis of cDNA for the Ca2+-binding photoprotein, mitrocomin. FEBS Lett. 1: 301-305.
Frank L.A., Illarionova V.A., Vysotski E.S. (1996) Use of proZZ-obelin fusion protein in
bioluminescent immunoassay. Biochem. Biophys. Res. Commun. 219: 475-479.
Gorokhovatsky A.Yu., Marchenkov V.V., Rudenko N.V., Ivashina T.V., Ksenzenko V.N., Burkhardt
N., Semisotnov G.V., Vinokurov L.M., AlakhovYu.B. (2004) Fusion of Aequorea victoria GFP and
aequorin provides their Ca2+-induced interaction that results in red shift of GFP absorption and efficient
bioluminescence energy transfer. Biochem. Biophys. Res. Commun. 320: 703-711.
Head J.F., Inouye S., Teranishi K., Shimomura O. (2000) The crystal structure of the photoprotein
aequorin at 2.3 angstrom resolution. Nature. 405: 372-376.
Illarionov B.A., Bondar V.S., Illarionova V.A., Vysotski E.S. (1995) Sequence of the cDNA
encoding the Ca2+-activated photoprotein obelin from the hydroid polyp Obelia longissima. Gene.153:
273-274.
Illarionov B.A., Frank L.A., Illarionova V.A., Bondar V.S., Vysotski E.S., Blinks J.R. (2000)
Recombinant obelin: cloning and expression of cDNA, purification and characterization as a calcium
indicator. Meth. Enzymol. 227: 223-249.
Inouye S., Tsuji F.I. (1993) Cloning and sequence analysis of cDNA for the Ca2+-activated
photoprotein, clytin. FEBS Lett. 315: 343-346.
Lewis J.C., Daunert S. (2000) Photoproteins as luminescent labels in binding assay. Fresenius J.
Anal. Chem. 366: 760-768.
Liu Z.J., Vysotski E.S., Chen C.J., Rose J.P., Lee J., Wang B.C. (2000) Structure of the ??2+regulated photoprotein obelin at 1.7 Е resolution determined directly from its sulfur substructure.
Protein Sci. 9: 2085-2093.
Markova S.V., Vysotski E.S., Lee J. (2001) Obelin hyperexpression in Escherichia coli, purification
and characterization. In: Bioluminescence and Chemiluminescence 2000 (Case J.F., Herring P.J., Robison
B.H., Haddock S.H.D., Kricka L.J. and Stanley P.E. Eds.), pp. 115-118, World Scientific, Singapore.
Markova S.V., Vysotski E.S., Blinks J.R., Burakova L.P., Wang B.C., Lee J. (2002) Obelin from
the bioluminescent marine hydroid Obelia geniculata: cloning, expression, and comparison of some
properties with those of other Ca2+-regulated photoproteins. Biochemistry. 41: 2227-2236.
Markova S.V., Burakova L.P., Frank L.A., Golz S., Korostileva K.A., Vysotski E.S. (2010) Greenfluorescent protein from the bioluminescent jellyfish Clytia gregaria: cDNA cloning, expression, and
characterization of novel recombinant protein. Photochem. Photobiol. Sci. 9: 756-765.
# 381 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena V. Eremeeva, Ludmila A. Frank? Ca2+-regulated Photoprotein Obelin as N-terminal Partner in the Fusion Proteins
Morin J.G., Hastings J.W. (1971) Biochemistry of the colonial hydroids and other coelenterates. J.
Cell. Physiol. 77(3): 305-311.
Nomura M., Inouye S., Ohmiya Y., Tsuji F.I. (1991) A C-terminal proline is required for
bioluminescence of the Ca2+ binding photoprotein, aequorin. FEBS Lett. 295: 63-66.
Prasher D.C., McCann R.O., Longiaru M., Cormier M.J. (1987) Sequence comparison of
complementary DNAs encoding aequorin izotypes. Biochemistry. 26(5): 1326-1332.
Shimomura O., Johnson F.H., Saiga Y. (1962) Extraction, purification and properties of aequorin,
a bioluminescent protein from the luminous hydromedusan, Aequoria. J.Cell.Comp. Physiol. 59: 223240.
Ward W.W. (1979). Energy transfer processes in bioluminescence. Photochem. Photobiol. Rev. 4:
1?57.
Watkins N. J., Campbell A.K. (1993) Requirement of the C-terminal proline residue for stability
of the Ca2+ -activated photoprotein aequorin. Biochem. J. 293: 181-185.
Waud J.P., Fajardo A.B., Sudhaharan T., Trimby A.R., Jeffery J., Jones A., Campbell A.K. (2001)
Measurement of proteases using chemiluminescence-resonance-energy transfer chimaeras between
green fluorescent protein and aequorin. Biochem. J. 357: 687-697.
Zacharias D.A., Baird G.S., Tsien R.Y. (2000) Recent advances in technology for measuring and
manipulating cell signals. Current Opinion in Neurobiology, 10: 416-421.
Zenno S., Inouye S. (1990) Bioluminescent immunoassay using a fusion protein of protein A and
the photoprotein aequorin. Biochem. Biophys. Res. Commun. 171: 169-174.
??2+-???????????? ??????????? ??????
??? N-???????? ???????
??? ??????????????? ?????? ??????
?.?. ????????a, ?.?. ?????a,?,
?.?. ???????a,?, ?.?. ????????a
?
???????? ????????? ?? ???,
??????, 660036, ??????????, ?????????????
?
????????? ??????????? ???????????,
??????, 660041, ??????????, ??.?????????, 79
??2+-???????????? ????????????, ??????????? ?????? ? ????????????????? ?????????????,
?????? ???????????? ??? ????????? ??? ???????????????? ??????????? ??2+, ? ????? ?
??????? in vitro. ????? ???? ????????, ??? ??????????? ???????????? ???????? ?? ?-?????
???????? ? ?????? ??? ????????????????? ??????????, ??????? ???????? ????? ????????
?????? ?????????????? ??????????? ? ??? N-?????. ? ?????????????? ?????? ???????????
??????????? ????????? ?????? ?????? ?? ?-????? ??????? ???????????? ? ???????. ??? ????
??????? ?????? (OL) ??????????? ???????? ?? ???? ???????????? ? ??????? (Y), ? ????? ????????
??????, ?????? ????? ??????? ?????? ?????? (31 ????????????) ? ??????? ??????????????
?????? ?????? Clytia gregaria (cgreGFP). ??? ????? (OL-Y ? OL-cgreGFP) ???? ????????, ??
???????? ???????? ???????. ????????, ??? OL-Y ???????? ?????????? ???????????????
# 382 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena V. Eremeeva, Ludmila A. Frank? Ca2+-regulated Photoprotein Obelin as N-terminal Partner in the Fusion Proteins
????????, ????????????????? ?????????? ???????? ?????????? 75 % ?????????? ???????
?????? ???? (WT-OL). ?????????? OL-cgreGFP ?????????? 46 % ?? ?????????? WT-OL. ???
??????? ????????????????? ??????? ?????? ??????? ??????????? ??????????? ???????????
??????? ???????, ? ??????? ?????????? ????? ????????? ????? ???????? ???????, ? cgreGFP ?
?????????? ???????. ????? ??????? ???????????, ??? ??????????? ???????? ?? ??????
Ca2+-????????????? ???????????? ??????? ????? ???? ???????? ???????????? ???????? ?
????????????????? ????????????? ?? ??? ?-?????.
???????? ?????: ??????, ???????????? ????????? ?? ?-?????, cgreGFP.
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Journal of Siberian Federal University. Biology 4 (2010 3) 384-390
~~~
??? 582.542.11 (571.55)
??????? ?????????? ??????????
? ??????? ??????????? ?????
Melica turczaninowiana (Poaceae)
?
?.?. ???????????, ?.?. ????????*
??? ??? ????????? ??????????????? ??????????? ????????,
672090 ????, ??. ????????, 39?
?
?????????? ?????????? ???????? ????
????????? ???????? ??????????
? ???????? ???????? ?? ???,
664033 ???????, ??. ?????????? 132, ?/? 317 1
Received 3.12.2010, received in revised form 10.12.2010, accepted 17.12.2010
??????? ??????????? ???????? ??????? ? ??????? Melica turczaninowiana Ohwi, ????????? ?
2007 ? 2008 ??. ? ?????? ?????????????? ?????????? ??????????. ?????????? ????? ???????
????????????? ?????????? ?????????? (80-90 % ?? ????? ??????????? ??????) ? ??????
(10-20 %) ?????????? ????-, ????- ? ????????????????? ??????, ???, ?? ????????????
??????????????, ?????????? ??? ??????????? ??????????? ???????? ? ??????????? ? ???????
? ?????????? ????????????? M. turczaninowiana. ?????????? ?????? ? ??????????????
?????????? ?????????? ? ??????????? ?? ???????????????? ?????????? (7,9 % ? ??????????
?????????????, 3,3 % ? ? ???????????) ???????????? ???????? ?? ?????????? ????
?????????? ? ??????? ??????.
???????? ?????: ?????????, ?????????, ????????, ?????????.
????? ????? 900 ????????? ????? ????????? Poaceae ??? Melica ???????????? ?????????????, ? ??????? ????? ?? ??????????? ?????????????? ??????, ?? ??????????
?????????? ????????? ? ???????????? ??????, ? ?? ?????????? ?????????? ?????????? ?
????? ?????? ? Melica turczaninowiana Ohwi
? Melica virgata Turcz. ?x Trin (??????, 1976;
1987). ????????? ???? ?????, ??????????
????? ???????????? ????????????, ?????????? ?????????? ????????? ? ?????????
????????? ??????????????.
*
1
?? ?????? ???? ?????????????? (???????, 1931; ??????, 1976; ??????? ? ??., 2006),
????? Meliceae, ?????? ? Arundinariae, Dendrocalameae, Diarrheneae, Stipeae ? Oryzeae,
?????????? ? ??????? ????????????? ?????????. ??????????? ?? ????? ????????? ?????? ???????, ??? ???? ???? Melica ????????? ? ?????????? ?????????, ?????????????
?? ?????????? ??????? ? ?????????? ???????,
??? ??? ??? ???????????? ? ??????? ?????????
? ?????????? ??????????????????????? ? ??????????? ?????, ??????????????? ? ????-
Corresponding author E-mail address: osipova@sifibr.irk.ru
© Siberian Federal University. All rights reserved
# 384 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????????, ?.?. ???????. ??????? ?????????? ?????????? ? ??????? ??????????? ??????
???? ????? ??????? ??????? (???????, 1972;
???????, ???????, 1979; ????????, 2007).
Melica turczaninowiana Ohwi ? ??????????? ???????????????? ????????, ?????
????????????????? ?????. ???? ??? ???????
?? ?????????? ??????? ? ??????, ????????
????????, ????? ??????? ????????? ???????, ? ???????? ??????? ???????????, ??????? ? ???? (??????, 1976) ?? ???????? ???????
????? (???????? ??????????? ????, 1968). M.
turczaninowiana ??????????? ? ???????????,
????????????? ??????? ???????? ?????????? ???? ? Quercus mongolica Fisch. ex Ledeb.,
Armeniaca sibirica (L.) Lam., ??? Ulmus.
? ???????????? ? ??????????????? ?.?.
??????????????? (1974, 1980), ?????? ?????????? ?? ???????????? ?????????????
? ?????????? ?????????? ???? ? ????? ??????? ?????????? ???????? ????? ??????? ??
?????? ? ??????????? ? ??????? ????????
??????? ?? ???????. ????????????? ??????
????? ?? ?? ?????????????, ????????????
?. ???????? ? ?????? ???????? ????, ??????????? ?? ?????????? ???????. ?? ????
????????????? ????? ????? ????? ?? ??????
?????? ? ??????????????? ?????????, ??????????????? ?????????, ????????????????? ????????? ? ?????????, ???????????
?????? ? ????????? ?????? ? ??????? (Osborn,
1907).
??? ??????? ???????? ???????? ? ??????? ?.?. ???????? (1980, 2006), ??????? ?????????? ??????????? ???????? ???????
? ???????? ????? ????? ????????? Poaceae.
????????? ?????????????? ? ???? ?????????????? ?????????, ??????? ?.?. ???????
?????? ? ??????, ??? ? ???????????? ?????
??? ???????? ???????? ???????? ???????.
?????????? ????????????????? ??????????
? ???????? ????????? ????? ?????? ??????????? ? ??????? ???????? ? (?? 1-3 ?? 67,5 %
?? ?????????? ????? ?????). ????? ?????? ??-
???????? ?????????? ???? ???????? ? ?????,
??????? ?????????? ? ?????????????? ?????? Meliceae, Arundinariae, Dendrocalameae,
Diarrheneae, Stipeae ? Oryzeae (??????? ? ??.,
2006; ???????, 2006). ??????? ? ???????????????? ????????? ???? ?????????????????
??????? ??????????? ?????????????????
??????: ??????????, ?????????? ? ? ??????????? ????????????????? ??????????, ??????? ????? ??????? ?????? ???? ? ?????????
? ??????????????? ?????? ?? ???????? ?????????????? ??????? (???????, 1980, 2006).
? ?????????????? ?????? ??????? ??????????? ???????? ??????? ?? ??????? ?
??????? M. turczaninowiana ?? ????????? ????????????? ?????????? ?????????? ? ?????
??????? ??????????? ????? ?????????????
??????????? ???????? ???????, ?????????????? ???????????? ????????? M. turczaninowiana, ? ???????-?????????????? ????????? ????????????? ????.
????????? ? ??????
??????????
????????????
??????? ?????? M. turczaninowiana, ????????? ?
2007-2008 ??. ?? ?????????? ???? ?????????????????????? ??????? ?????????? ?????????? ? ?????? ???????? ? ?????? ?????????
(????? ??????????? ??????, 1979; ????? ??????, 1990). ?? ?????????? ?????? ????????
?????? M. turczaninowiana ???????? ? ??????? «?????????» (???. ?. ???????, ?????????
?????, ????????????? ????), ?? ??????????
?????? ????????? ? ? ???????? «??????» ?
«????????» (????????? ????? ?????????????? ????). ? ??????? «????????» ???? ???????? ??? ?????????????: «????????-1»,
??????????????? ? ????????? ??????, ? ????
???????? ?????????? ???? ? ?????? ?????;
«????????-2» ? ? ??????? ????? ??????, ?
???????? ??????, ? ???????-????????? ????;
? «????????-3», ??????????? ? ??????? ??-
# 385 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????????, ?.?. ???????. ??????? ?????????? ?????????? ? ??????? ??????????? ??????
??? ??????, ?? ????????? ????????? ????????? ? ???? ?????? ????? ? ????????? ??????????? ??????????? ? ????????.
???????????????? ???????? ???????
?? ??????? ????????? ?? ?????????, ???????????? ??? ???????????????? ????????
??????? ?? ????? ??????? (???????, 1980;
????????, 1980). ?????? ??????????? ?? ??????? ???????? (??1, ??????) ?? 70 % ??????
????. ??????? ???? ???????????? ? ?????????????? ??????? ?????????? ? ??????????
?????? ??????????? ??????? 50 ?? ?????????? ??????, ?? 7.0 + 1 ? NaCl. ????????? ???????? ? ??????? ???? ??? ???????????
4° ? ???????? ?????? ????. ????????? ???????? ??????????? ??????????? 72 %-? ???????? ??????? ??? ????????? ???????????,
??????? ???????????? ?????? ? ??????????? ??????????? 0.1 N ???????? ????????.
???????????? ????? ?????????? ?????????????????????? ??????? (Hitachi U-1100,
??????) ?? Bradford (1976) ? ?????? ???????????? ?????????? ? ???????? ?????????.
??? ??????????? ????????? ? ???? ????????????? ? ???? ????????????? ????????????,
?????????????? ????????? ??????????? ?????? ? MS Ex?el.
?????????? ? ??????????
?? ?????? ????. 1 ???????, ??? ???????? ? ????????? ?????????? ???????????
?????? (????? ??????????, ??????????,
?????????? ? ??????????) ? ??????? Melica turczaninowiana ?? ?????? ?????????
? ????????????? ?????????? ??????????
???? ??????????? ? ???????? ??????????
? ?????????? ???????????? ??????, ???
??? ?????????? ?????????? ??????????
??????????? ?? ???????????, ? ??????????
?????????? ? ?????????? ??????????? ?????????????. ????????????? ??????????
?????????? ? ??????? M. turczaninowiana
?? ?????? ????????? ?????????? ?? 80 ??
90 % (????. 2). ??? ??????????? ?????? ??
????????? ? ????????????? ???????????
???????????? ?????? ? ?????? ??????????? ??????, ???????????????? ? ?????????
?????????? ? ?????? ???????? ??????. ??
?????? ?.?. ???????? (1999), ?????????
???????-????????????? ??????????? ??????
? ???????, ????????????? ?????????? ?????????? ? ??????? Agropyron cristatum (L.)
P.Beauv. ?????????? 31 %, ? ??????? Festuca
litvinovii (Tzvel.) E.Alexeev ? Spodiopogon
sibiricus Trin. ? 46 %. ?????????? ?????????? ? ??????? Poa pratensis L. ???????????
? ??????????? ?? ???? ??????????? ? ??????????????? ?????? ????????????? ?? 21
?? 30,7 %, ? ??????? Festuca valesiaca Gaudin ? ?? 26 ?? 31,6 %, ? ??????? Festuca pratensis Huds. ? ?? 29,2 ?? 37,8 % (??????? ? ??.,
2006).
????????????? ?????????? ??????????
? ??????? M. turczaninowiana ?? ?????? ????-
??????? 1. ?????????? ????? ??????????? ?????? ? ???????? ??????? ? ??????? M. turczaninowiana ??
????????? ????????????? ?????????? ?????????? (??/? ????? ????? ????)
???????? 1
???????? 2
???????? 3
??????
?????????
????? ???????????
??????
?????????
51.0 ± 0.8
39.3 ± 0.6
55.4 ± 0.6
69.2 ± 5.6
34.3 ± 2.2
3.0 ± 0.5
3.5 ± 0.3
3.1 ± 0.1
3.1 ± 0.6
3.1 ± 0.2
?????????
1.3 ± 0.4
1.2 ± 0.1
1.2 ± 0.1
1.4 ± 0.0
1.3 ± 0.0
?????????
3.0 ± 1.1
2.2 ± 0.5
2.7 ± 0.1
2.3 ± 0.1
2.7 ± 0.1
?????????
43.5 ± 0.1
32.4 ± 0.9
48.4 ± 0.5
62.4 ± 5.1
27.2 ± 0.8
# 386 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????????, ?.?. ???????. ??????? ?????????? ?????????? ? ??????? ??????????? ??????
??????? 2. ?????????? ???????? ??????? ? ??????? M. turczaninowiana ?? ????????? ?????????????
?????????? ?????????? ( % ?? ????? ??????????? ??????)
???????? 1
???????? 2
???????? 3
??????
?????????
?????????
5.9 ± 0.8
8.9 ± 0.7
5.6 ± 0.1
4.5 ± 0.5
9.0 ± 0.4
?????????
2.5 ± 0.7
3.0 ± 0.4
2.2 ± 0.2
2.0 ± 0.2
3.8 ± 0.1
?????????
5.9 ± 0.4
5.5 ± 1.4
4.9 ± 0.1
3.3 ± 0.4
7.9 ± 0.2
?????????
85.3 ± 1.1
82.4 ± 1.0
87.4 ± 0.6
90.1 ± 0.1
79.2 ± 0.9
????? ? ????????????? ?????????? ?? 3,3 ??
7,9 % ?? ????? ??????????? ??????. ??????
?????????? ?????????? ??? ????? Meliceae
???? ???????? ?????, ????????, ????????????? ???? Glyceria ????? Meliceae ?????????
?????? 1,1-1,9 % ?????????? (??????? ? ??.,
2006; ???????, 2006).
??????????? ???????? ??????? ? ??????? M. turczaninowiana, ? ?????? ??????
(10-20 %) ?????????? ????- , ????- ? ????????????????? ??????, ? ????? ??????? (?? 8090 %) ?????????? ????????????????? ??????????, ? ???????????? ? ???????????????
?.?. ??????????????? (1974), ???????????????
? ????????????? ????????????? ? ?????????
???? ? ?????? ??????????? ? ????????????
??????? (????????, 2007) ? ?????????? ????????????? M. turczaninowiana.
?????? ???????? ? ????????????? ?????????? ???????? ??????? ? ??????? ??
?????? ????????????? (????. 3) ???????
??????????? ????? ?? ??????? ???????????.
?????? M. turczaninowiana ?? ???? ????????????? ????? ?? ????????? ? ???????? ??
?????? ????????????? ????? ?????? ????????? ?????????? ??????????? ?????? ?
????????? ? ????? ??????? ?????????????
?????????? ????????????????? ??????:
??????????, ?????????? ? ???????? ??????????. ?? ????????? ? ??????? ??????????
??????? ???????????, ??????????????? ?
???? ?????? ?????? ?????? ????????, ?????
?????, ??????????????? ??????? ??????-
????? ??????? ? ??????? ????????????????
?? ????????? ?? ??????? ? ?????. ?????????? ???????? ? ?????????? ??????????
????? ? ????????????? ?????????? ????????? ???????? ??????? ????????? ? ???????
?? ?????? ??????????? ? ???????? (????.1-3).
????? ????? ????? ? ????????????? ????????, ?? ????????? ? ?????????????? ???????????, ?????????? ????????????? ? ???????
?????????? ?????. ? ??????? ?? ????????????? ???????? ???? ?????????? ?????????? ?????????? ?????????? ????????????
?????, ?????????? ????????????? ?????????? ?????????? (90 %) ? ????? ?????? ????????????? ?????????? ?????????? (3,3 %
?? ????????? ? 7,9 % ? ??????? ?? ????????????? ???????????) (????. 2). ????????,
??????????? ???? ???????? ? ???????????
???????? ??????? ? ???????, ????????? ?
??????????? ?? ???????????????? ??????????, ??????? ? ?????????? ????? ?????????? ? ?????????? ???????? ?????????????
M. turczaninowiana. ????????? ???????? ?
????????????? ?????????? ???????? ??????? ? ??????? ?? ?????? ?????????????
??????? ??????????, ????????, ??????? ?
?????????? ???????????? ?? ?????? ??????? ??????? ??????.
????????????? ?????????? ???????
?????????? ????????? ???, ??? ? ???????
?? ?????????? ??? ????? ?????? ?????????????????? ???????????? ?????, ????? ????????????? ??? ??????????? ? ???????? ?
# 387 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
??????? 3. ???????? ????????? (t) ? ?????? ????????????? ???????? ? ?????????? ????? ???????????
?????? ? ???????? ??????? (??/? ????? ?????) ? ??????? M. turczaninowiana ?? ????????? ?????????????
?????????? ??????????
???????? 1
???????? 2
???????? 3
??????
????? ??????
???????? 2
11.6**
???????? 3
4.6*
20.9**
??????
4.2*
5.3*
2.4
?????????
6.5*
1.5
8.9**
5.5*
?????????
???????? 2
2.8
???????? 3
1.1
4.3*
??????
1.4
5.0*
2.4
?????????
3.5*
0.3
7.7**
7.0**
?????????
???????? 2
0.6
???????? 3
0.5
1.8
??????
0.7
2.1
0.6
?????????
2.0
2.2
8.7**
7.5**
?????????
???????? 2
0.2
???????? 3
2.7
0.5
??????
5.0*
1.5
3.8*
?????????
5.9*
1.8
15.5**
3.8*
?????????
???????? 2
2.2
???????? 3
0.6
4.8*
??????
4.0*
7.9**
6.6*
?????????
4.6*
2.5
7.1**
12.7**
?????? ??????? ? ??????????? ?????????? t-????????, ??????????? ??????????? ????????.
* ? P < 0.05; ** P < 0.01.
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????????, ?.?. ???????. ??????? ?????????? ?????????? ? ??????? ??????????? ??????
??????? ?????????? ???????? ?????? ???
???????? ? ????????? ????????? ???????????? ??????? ? ?????? (???????, 2006; ??????? ? ??., 2006).
?.?. ????????? ? ???????? (2009) ???????? ??????????? ????? ??????????? ?????????? ? ??????? ?????? ?????? ???????
?????? ????????????? ?????????????? ? ??
???????? ? ???????? ??????????? ?????. ?
????? ?????? ??????? ????????? 1, ??????????????? ? ????? ??????? ????????????????????? ????????, ?????? ?????????
? ???????? ???????? ??????? ?????????? ??????????, ? ????????????? ?????????? ?????????? ???? ? 1,5 ???? ????, ??? ? ????? ??????????? 29. ?.?. ????????? ? ???????? (2009)
?????? ? ??????, ??? ??????? ?????????
?????????? ?????? ? ????? ??????? ????????????? ???????? ?????????????? ? ????????
??????, ????? ??? M. turczaninowiana, ?????????????? ? ???????????? ???????????.
??????????? ??? ????? M. turczaninowiana ??????????? ???????? ???????, ??????
(10-20 %) ?????????? ????- , ????- ? ????????????????? ?????? ? ????? ??????? (??
80-90 %) ?????????? ?????????????????
??????????, ???????????????? ??????? ?
????????????? ?????????????? ? ?????????? ???? ? ?????? ??????????? ? ???????????? ??????? ? ?????????? ????????????? M. turczaninowiana. ?????????? ??????
? ???????????? ????????? ? ?????????????
?????????? ?????????? ? ??????? M. turczaninowiana ?? ??????????? ?? ???????????????? ?????????, ???????????? ????????
?.?. ???????? ?? ?????????? ???? ??????????, ????????? ????????? ????? ???????
?????????? ????????? ? ???????, ???????-
????? ????????????? ????????????. ????????, ??? ????? ? ? ????????? ???????????
??????? ????? ?????? ??? ????????? ???????????.
?????? ??????????
?????????????? ?.?., ???????????? ?.?. (1974) ???????? ????????? ????? ???????????
??????????? ? ??????????? ????????. ?: ???????? ????????? ?????? ????????. ?.: ?????,
7-15 ?.
?????????? ?.?. (2009) ???????-????????????? ??????????? Melica turczaninowiana Ohwi
(Po?ceae) ? ????????? ??????????: ???????. ????.????. ????. ????. ????-???. 18 ?.
??????? ?.?. (1980) ????? ???????. ?.: ?????, 351 ?.
??????? ?.?., ??????? ?.?. (1984) ??????????? ? ??????? ????? ?????? (????????????
? ??????????). ???????????: ?????, 265 ?.
??????? ?.?. (1972) ??????? ????? ??????????? ??????. ?.: ?????, 207 ?.
???????? ??????????? ???? (?? ?????????? ????????????? ????????? ??. ?.?. ????????)
(1968) ???. ?.?. ??????. ???. 4. ?????. ?.: ?????, 123 ?.
???????? ?.?. (2007) ?????? ? ?????????? ???? ????? ??????: ????????, ??????. ???????????: ????????, 399 ?.
??????? ?.?. (1980) ???? ?????????? ? ???????? ??????. ???. ????. 12: 1766-1771
??????? ?.?. (2006) ????????????????? ????? ?????, ?? ?????????? ???? ? ???????? ?
??????????????? ????????. ???. ????. ????. 6: 809-824
??????? ?.?., ????????? ?.?., ???????? ?.?., ?????????? ?.?., ???????? ?.?., ???????? ?.?. (2006) ?????????? ????????? ?????? ? ??????????? ????????. ??????: ???? ???
???
# 389 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????????, ?.?. ???????. ??????? ?????????? ?????????? ? ??????? ??????????? ??????
????????? ?.?., ??????? ?.?., ???????? ?.?. (2009) ??????????? ????????? ?????????? ?????? (?? ??????? ?????? ???????) ? ????????????? ???????? ?????????????. ???????
?????. 1:8-10
???????? ?.?. (1994) ?????????? ???????: ???????? ????????. ???????????: ?????, 165 ?.
????? ??????????? ?????? (1979). ??? ???. ?.?.????????, ?.?.????????. ?.1. ???????????: ?????, 536 ?.
????? ??????: Poaceae (Gramineae) (1990) ??? ???. ?.?.????????, ?.?.???????????,
?.?.?????????? ? ??. ?.2. ???????????: ?????, 361 ?.
?????? ?.?. (1976) ????? ????. ?.: ?????, ?. 5-61, 547-556
?????? ?.?. (1987) ??????????? ?????? (???????) ? ?? ????????. ?.: ?????, 75 ?.
??????? ?.?. (1999) ???????-??????????????? ??????????? ????????? ??????????? ?????? ?????????? ? ????? ????????: ???????. ????. ????. ????. ????. 21 ?.
Bradford M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities
of protein utilizing the principle of protein-dye binding. Analyt. Biochem. 72: 248?254
Osborn T.B. (1907) The proteins of the wheat-kernel. Carnegie Institution of Washington. P. 119.
High Contents of Glutelins in Seeds
of Relic Melica Turczaninowiana (Poaceae)
Eugeniy A. Bondarevicha and Svetlana V. Osipovab
a
Chita Medical State Akademy,
39a Chita, Gor?ky st., 672090 Russia
b
Siberian Institute of Plant Physiology
and Biochemistry of Siberian Branch of RAS,
132 Lermontova st., p.b. 317, Irkutsk, 664033 Russia
The study was focused on the content of protein fractions of Melica turczaninowiana Ohwi
(Poaceae) seeds collected in 2007 and 2008 in various cenopopulations of Eastern Zabaikal?ye. M.
turczaninowiana seeds are characterized by very high content of glutelins, up to 80-90 % in different
populations. That it is much more in comparison with relative glutelins content in other xerophytes
crops growing in the region and ?an be connected with relic origin of the species. Seeds from the
cenopopulations contrasted by moisturizing conditions differed in prolamine content by two times. In
the seeds from humid stow ?Ingoda? prolamine content amounted to 3.3 %, whereas the seeds from
droughty stow ?Angaikhata? it equaled 7.9 %. These data confirm the hypothesis on adaptive role of
prolamines in crops.
Keywords: glutelins, prolamines, evolution, adaptation.
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Journal of Siberian Federal University. Biology 4 (2010 3) 391-406
~~~
??? 551.510.536
??????????? ???????????? ???????
?????????????????? ???????? ??? ?????????
(Picea obovata Ledeb.)
?? ??????????? ??-?-????????
?.?. ????*, ?.?. ?????,
?.?. ????????, ?.?. ??????, ?.?. ???????
???????? ??????????? ?????????????
? ????????????? ?????? ?? ???
?????? 634055, ?????, ??. ?????????????, 10/3 1
Received 3.12.2010, received in revised form 10.12.2010, accepted 17.12.2010
???????? ??????? ???????????????? ???????? ?? ??????????????? ???????? ????????
??????? ?? ????? ?????, ????????????? ? ????????????????? ?????????. ? ??????
???????????? ?????????? ???????????? ???????????? ??????? ???????????????? ???????? ??
????????????????? ??????? ??? ????????? (Picea obovata Ledeb.) ?? ????? ????? 308 ?? ???
????????????, ??????? ? ?????? ???????? ?? ?????? ????? ????? ? ???????? «???????? ????», ?
??????? 30 ????. ???????? ??????? ????????????? 7-8 ????, ?? ??????? ??????? ? ???????????
?? ???????? ???? ??????????? ???????? ?????? ?????????????????? ???????? ?? ?????????.
???, ? ??????? ?????? ?????? ??????????, ?.?. ?????? ????????????? ??????????????
???????? ???????, ???????? ????????? ??????????????? ????????? ??????????????????
???????? ?? ??????????. ?????? ??????????? ?????? ??????????????? ?????????? ??????
?????????? ????????????????? ?????????, ?????????? ?????? ?????????? ??????????
??????? ?? II ? ????????????? ???????????? ???????????, ????????????? ?????????????
???????, ??????????? ???? ???? ???????? ????. ? ??????? 15 ?????, ??? ?????????????
???????? ??????? ????? ???????????? ??????????? ??? ??????????? ??????? ??????
?????????? ?????, ???????? ?????????? ????????????? ?? ???????????. ? ??????????
???????? ??-?-???????? ??????????? ???????????????? ????????????? ??????????, ?
?????????? ???? ?????????? ?????????????? ??????????? ?????. ?????? ? ?????????????
?????????? ?? ????????????????? (????? ???? ??????) ??????????? ??????????????? ??-?
???????? ????????? ????????? ??? ?? ???????????, ??? ???????? ? ????????? ??????????
????????? ? ??????????????? ????????? ?????????????????? ????????.
???????? ?????: ???????????????? ????????, ????? ?????????? ?????, ????????? ????,
????????????? ???????????, ?????????, ?????????, ????????? ?????.
????????
???? ???????????? ???????? ????????, ????-
? ??????? ????????? ???????? ????????
? ????????? ????? ??????????? ??????????
*
1
?? ?? ???????? ?????????? ?????. ????????
???? ???????? ???????? ?? ????????? ???-
Corresponding author E-mail address: vvzuev@imces.ru
© Siberian Federal University. All rights reserved
# 391 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ????, ?.?. ?????? ??????????? ???????????? ??????? ?????????????????? ???????? ??? ??????????
??????????? ?? ???? ???????????. ????????
???????? ???????????? ??2 ???????? ?????????? ? ????????? ??? ???????. ??? ?????????? ???????????, ??? ???????, ?? ??????
?????????? ???????? ???????????, ?? ? ????????????? ????????????? ???????. ???????
???????? ?????????? ?? ???????? ??????????? ???????????? ?????????? ????????
???????? ? ?????????.
???????? ???? ? ???????????? ??????????? ?????? ?????? ?????????? ????,
??????? ????? ??????? ??????????? ?? ?????????? ??????, ??????????????? ? ????????? ?????. ??? ??????? ????????? ??? ???????? ?????? ????????????????? ??????
??????????? ????????????? ????????????
???????????? ??2 ? ?????????? (?? ???????
????, ?? ?????? ~ 7 ??) ? ?????????? ????????? ? ?????? ?????? (???? ? ??., 2005).
? ?? ?? ????? ??????? ????, ?????? ???????
?????????? ???????????? ??????? ???????,
???????? ????????????? ? ??????????? ???
?????????, ??? ? ????????????? ????????
(??????????, ????????, 2004), ?????? ?????????? ????????? ????? ????????????? ?
??????????? ?? ???? ????????????? ???????
(?prtova et al., 1999).
?????????? ??????? ?? ????????????????? ??????? (???) ??????? ?, ??? ?????????,
?? ?????????? ??????????? ????? ?????????
????????? ???????? ???????????? ?????????
????????????? ??-?-????????? 300ч310 ??,
????????? ?????????? ?????? ??????? ???????????? ??????????????? ???????????
?????? ?????????? ????? (???) (?????, 2008).
????????? ???, ?????????? ? ??????????
?????? ??-?-????????, ??? ???????, ???????
? ????????????? ?????????????? ???????? ??????????? ??? ????????? ???????????
??????. ??????????? ??????????? ?? ???????? ????? ?? ???? ?? ???? ????? (???????????? ????????????? ???????) ???????????
? ????????? ????????? (??????, ?????????,
1974). ?????? ????????????? ???????????
???????????? ?? ???????? ????? ????? 15 ????? ?????????? ????? ????? 1 %. ??????????
????????? ??? ???????????? ???????????
????? ????? ??????????? ??? ????????????? ??????????? ???????????, ??? ???????, ??????? ????????????? ???????? (????,
2004). ???????? ??????? ????????? ???????
??????????????? ???????????????? ???????? ??????????? ? ???????? ?????????????
«???????? ????» (??? ????????? ??? ?????
220 ?.?.). ? ?????????? ?????????? ??????
??-? ???????? ???????????? ????????? ?????????? ?????????. ????? ?????????????
????????????? ???????? ?????????? ???
??-?-????????, ? ???????? ? ???????? ???????? ?????????????? ????????? ??????
(????????, ?????????, 2005). ? ?? ?? ?????
??????????? ?????????? ?? ?????? ? ????????????????? ??????????? ??????????????? ??-?-???????? ????? ???? ???????????
? ??????????.
????? ???????, ????????? ??????????
????? ???? ??????????? ??????? ???????????? ???????? ????? ??????? ??-? ???????? ?
? ??????? ?????? ??????? ????????? ???????????? ?????????????????? ???????? ???????? ????? ????????????? ???, ?? ???????
??????????? ???????????? ???????????????
????????? ??? ??? ????????? (Picea obovata
Ledeb.) ??? ?????????? ?????????? ?? ?????
????? 308 ?? ? ???????????? ~ 2 ??/?2, ???
?????????? ????????????? ?????????? ?????? ??-?-???????? ?? ?????? ????? ????? ?
???????? «???????? ????».
????????? ? ??????
??? ?????????? ???????????? ???? ??????? ??????? ??? ????????? (Picea obovata
Ledeb.) ? ???????? ???????? ???????? ? ???????? 7 ???, ?????????? ? ????????? ??-
# 392 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ????, ?.?. ?????? ??????????? ???????????? ??????? ?????????????????? ???????? ??? ??????????
??? ?? ??? ? ???????????? ????????.
???????? ???? ???????? ? ?????????????
??????? (04.06.2010 ?.) ?? ??? ?????? ?? ?????? ???????????? ??? ????????? ? ?????
????????. ????????? ????? ? ??????? ????
?????????? ?? ???? ?????????? ???????. ?
????????? ?????????????? ?????????? ???????????, 22±3є C, ??? ????????????? ????????? ??????? 65±5 %.
??????????? ??????? ??????? ???????????????? ???????? ???????? (???) ???????????? ??????????????? ???????????
Hagen Sun-Glo (??????), ?????????? ?????????, ?? ????? ???????????? ???????????????
??????? ? ??????? ???????? ????? (????????
??????????? 4200 ?). ???????????? ????????
?? 7000 ?? ??? ???????? ????? ???? ?? 2000 ??
?? ?????? ?????, ??? ??????????? ????????????? ????????????? ? ????? ?????????
??????? ? ?????? ??????? ?? ??????? ?????????????? ?????? ??????. ?????????? ????????? 10 ? (07:00 ? 17:00) ??? ???????? ?????????? ??-? ? ??????? 8 ? (08:00 ? 16:00).
? ???????? ????????? ??-?-???????? ???????????? XeCl-????????? ?????????? ????
? ????? ?????????? ?? ????? ????? 308 ??
(?????? ? ??., 2006), ??????? ????????????? ??
?????????? 35?? ?? ??????? ????????????,
??????????? ??????????? ??????? ???????????? ~ 2 ??/?2.
?????????
???????????????
??-????????? ????? ????????????? ?????????????? ????????? ????? (?3), ??????????
???????????? ???????? ????????? ???????????? ?????????? ??????? ?? ????????
??????? ????????, ??? ??????? ? ???????? ???????????? ??????????????? ?????????????????? ???????????????? 3.02.? (??????), ?
????????????? ??????? ???? ?????????? ?????????????? ???????????. ???????????? ?3
? ??????? ????? ??????? ?????????? ?? ????????? 30 ???/?3. ??????? ??????? ? ???????
???????????? ?? ????????, ? ?????? ????????
????????? ????????? ???????????? ???????????? ??????????? ?????? ????????.
???????????? ????????? ? ??? ?????. ??
?????? ????? ????????????? ????? ????????????????? ?????? ?? 3 ???????? ???. ?? ?????? ????? (18.06-09.08.2010) ??????? ??????
???????? ???????????? ??-?-?????????? ?
??????? 3 ?????? (18.06-09.07.2010), ????? ???????? ??????????????? ???????? ??? ???????? ? ?? ????????? ?????? (09.08.2010)
??? ????????? ????????????????? ????????
??-?-???????? ??? ?????????? ?????????????? ????? ???? ? ??????? ? ??????????? ????????. ? ???? ???????????? ?????????????
??????????-??????????????
????????? ? ????????????? ???????? ???
??????? ? ??????????? ?????. ???????????
???????? ???????????? ????, ?????????? ?
??????????? ????????????????? ?????????,
???????? ???????? ? ??????? ?????????
?????? ? ?????????? (??????? ????) ???? ? ?
???? ???????? ???? (??????????).
?????????? ????????????????? ????????? ?????????? ?? ???????????????? UV1601PC (SHIMADZU, ??????) ???????? ???????? ????????? (????, 1971; Lichtenthaler,
1987). ??? ????????????? ???????????? ????
????????????? ? 70 % ???????. ??????????
????? ???????? 30 ??? ??????????? ? ??????? ????? ???? ?? ?????????????? ????????? ??-2 (??????) ? ???????? ? ????????.
??? ????????? ????????????? ???????????
????????? ?? ????????? ?????????? ??? ?????? ?????????-???????????? ?????????
SIAMS MesoPlant, ??????????? ?????????
AxioStar Plus (Zeiss, ????????), ???????????
Watec LCL 217 (Watec America Corporation,
???) ? ?????????????????? ???????????
??????????? SIAMS MesoPlant (??????).
?? ?????? ????? (07.08-18.08.2010) ??????????? ??????????? ???????????? ??-
# 393 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ????, ?.?. ?????? ??????????? ???????????? ??????? ?????????????????? ???????? ??? ??????????
??????????? ???????????? ??????????? ???????? ??? ??? ?????????? ????????????
?? ????? ????? 308 ?? (??-?308). ?? ?????
???????????? ??? ???????? ??????????? ???????? ???????????? ??????????? ???????
? ??????????? ??????, ?? 3 ???????? ? ??????, ???????? ? ??????????????? ??????. ?
????????? ??????? ???????????? ??????????
????????. ????????? ??????? ???????????? ??????????? ???? ? ???????????? ??2 ?
??????? ? ??????????? ??-?308 ??????????
? ?? ???????? ?????????????? ???????????
???????????? ???????????????? Li-820 (LiCor, ???).
?? ??????? ????? (04.09-04.10.2010)
????????? ????????????? ?????? ????????????? ???????????????? ??? ??? ???????
?????????-???????????? ???????? ????????????? ??????????, ???????, ? ???????
?? ??????????? ??????? ???????????, ????
??????????? ???????????? ????????? ?????????? ? ???????? ??????????????? ????????? ?????????????????? ???????? ???????????? ??????? ? ?????. ? ???? ??????? ?????
(Genty et al., 1989; Rosema et al., 1998; ??????????, ????????, 2003).
??? ??????????? ?????? ?????????????
? ??????????? ??????????, ??????????? ??????? ????????????? ????????????? ????????
??????? ? ???? ????????? ????????? ???????????, ?????? ?????????????????? ????????????????? ?????, ????-????? ????????
????????? ?? ???. 1.
?????? (???????) ???????? ??????????? ?? ???????? ???????? ????????? ?????????????????? ????????? ????????, ?
?????????????? ??? ???? ??????? ????????????? ??????????????? ? ??????? ?????
?????????? ??? ??????? ??????? ????????????? ?????????? (F0). ? ?????????????
???? ?????? ??? ????????? ??????? ????????????? ????? ???????????? ????????????????? ????? (4), ??????? ?????????
?????????: ????? ????? ????????? 532 ??,
???????????? ???????? 2 ???, ??????? ?????????? 2 ???, ???????? ?????????? ???????? 100 ???. ??? ???????? ????????????
????????? ?????? ??????? ~ 1 ??????/(? 2 .?)
???????????? ? ????????, ??????????????
? ???????, ???????????????? ??????? (F0) ?
???????????? (Fm) ?????? ?????????????,
??? ? ???????? ????????????: F0 ? ???????
??????? ?????????????, ???????????????
???? ??????????, ??????? ???????? ?? ???????????? ? ?????? ????????? ???????????;
Fm ? ???????????? ??????? ?????????????,
????????????? ????????????? ??????????
?????????? ?? ??????????? ??????? ?C II ???
?????????????? ???? ????????? ????????
?????????? Q?. ??????? Fm ??????????????
?????????? ?????????? a ???????. ???????? ?????????????? ?????????? ?C II ????????? ?? ????????? ????????????? ????-
??????????? ??????????? ???? ?? ??????
????????????? ???????????.
??? ????????? ??????????? ????????? ???????? ??????????? ?????????? ?????
(3) Philips (ELC/5H 24V 250W, ???), ????????? ???????????? ?? ??????????? ??????? ~
2500 ??????/(?2.?) ? ???????????? ?????????
340ч630 ??, ??????? ?????????? ?? ???????
????????? ????? ? ??????? ????????????
???21 (10). ?????? ???????? ??????? ????????????? 2 ? ????????? ??? ???????????
?????? ?? II ? ?????????? ????????? ? ?????????????? ???????????? ??????? ????????????? (Fm).
????? ?????? ?????????? ??? (1) ?
??-?308 (2)-???????? ????????????????
????????. ? ?????? ?????? ????????? ????????? ???? ??? ? ????? ????? ???????-
?????? ?????? ?????????? ???????
Fm ? F0
Fm
# 394 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ????, ?.?. ?????? ??????????? ???????????? ??????? ?????????????????? ???????? ??? ??????????
???. 1. ????-????? ?????????????????? ?????? ??? ????????? ?????? ?????????????:1 ? ??????????????
????????? Sun Glo, 2 ? Xe-Cl-?????????, 3 ? ?????????? ????? Philips,4 ? ????????????????? ?????, 5 ?
???????? ???????, 6 ? ???? ??????????????, 7 ? ???????????, 8 ? ?????????, 9 ? ????? ??????????, 10 ?
??????????? ???21, 11 ? ??????????? ??19,12 ? ??????????? ??????????? ??11, 13 ? ????????????????
????????
??? ?????????? ????????. ????? ????????
????????? ????????, ??????????? ??? ??????? ?????????????? ??????????? ???????
?? II ? ???????? QA ? ?????????? ?????????, ??????????, 30 ??? (??????????, ????????, 2003).
????????? ?????????? ???????? ?????
? ??????????? ????????? ???????? ?????????????? ??????????? ??????????? ?
??????????? ???????????? (8) ????? ????? ?????????? (9). ????????????? ??? ??????????? F0 ?? 5 ? ?????????? ????????????????? ????? (4), ????? ?? 2 ? ??????????
?????????? ????? (3) ? ?????????? ???????
Fm. ??????????? ????????? ?????????????
??????????? ????? ???????? ???????, ????????? ?? ????????? ????????? (5), ???????? ???????????? ??19 (11) ?? ????????????
??????? ??????????? ?? ?????? ???? ?????
680 ?? ??? ????????? ???? ??????????? ????????????? ????? ? ????? ??????????????
(6), ??????????? ???????????????? ???????? (13) ? ?????????????? ???????????
90 % ? ????????? 10 % ? ???? ??????????
??-24? (??1 ? ??2). ??? ??????????? Fm
??? ?????????????? ????????? ????????????? ??1 ????? ??? ????????? ???????????
??????????? ??11 (12), ????????????? ??????????? ?????? ?? ??? ???????. ?????????? ????????? ????? ???????, ??? ????????? ???????? F0 ? Fm ??????????? ????????
??? 1:6. ????????? ? ??????????? ????????
?????????????? ? ??????? 4-??????????
???????????? Tektronix TDS2022B (???)
(7). ??????????? ????????? F0 ? Fm ?????????? ± 3 %.
# 395 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ????, ?.?. ?????? ??????????? ???????????? ??????? ?????????????????? ???????? ??? ??????????
?????????? ? ??????????
?????? ??????????-??????????????
????????? ??? ??? ?????????
???? ?????? ??????????? ????????? ??????? ??????????????. ?????? ????? ????????????? ??????????, ??? ?????? ????
?????????? ?????????, ???????? ??????????
?????????? ? ??????????? ???????-????????
????????? ????????????????? ??????? ?
????????? ?? ????????????? (Maslova, Popova, 1993). ?????????????, ?? ???? ? ?????????? ????? ???????? ?????? ???????????????,
????????????????? ? ????????????????
????????????? ??????????. ???????? ?????????? ?????????? a, ???????????? ?
???? ???????????? ? ?????????? ?????????
???????????? ?? ???. 2.
? ????????? ?????? ???????????? ?????????? ????????? ? ???? ??????? ????
??? ????????? ??????? ??-?-????????
?? ???????????? ???? ?????????? ?????????? ???? (? ?????? ????????) ? ???????????
? ??????? ?????????. ??? ???? ??????? ????
????????? ???? ????????? ? ?????? ? ? ????? ??????? ????? ????????????, ? ? ???? ???????? ???? ?????? ? ?????, ??? ??? ? ??????
???????????? ??? ?????????? ??? ????????
???????? ?????. ?????? ? ?????????? ????
? ???? ????????? ? ????. 1. ????????, ???
???????? ??????????????, ???????????????
????????? ????????????, ??? ??-?-????????
?????????? ?? ????????? ????????? ???????
?? ???????????? ????.
?????? ???????? ??? ????????? ?????????? ??????????? ???? ??????? ???????
??????? ? ??????????? ???????? ????
?????????????? ?????? (??????????? ???????? ?? ??????????). ?? ??? ? ?????? ?????? ?????? ????????? (?????????? ???????
?? ???. 2 ?, ?) ?????????? ?????????? ????
?????????? ????????????????? ?????????
??? ?????????? a, ??? ? ???????????? (??
35,7 ? 13,9 % ??????????????). ?????????
?????????????? ???????????? ??????????? ? ??????? ???????, ???????? ?????????
?????????? ? ??????????? ????????????????? ?????????, ????????? ????????? ????
?????????? ???????? ??????????????? ??????????? ? ????? ?? ??????????? ????????? ? ????????????? ????????. ?????? ?
????????? ????? ???????????? ??????????
???????? ????? ?????? ????????? ?????????
?????????? ?????????? a, ???????????? ?
???? ???????????? ? ?????????? ????????? (??????????? ?????????? ???????????
? ????????????). ????????, ??? ???????? ??????????????? ??-?-???????? ???????????
????????????? ? ??????? ???????? ????????
???? ?????????, ????????? ??????????????
????????, ?????????? ???, ????????? ?????? ? ??????? (????????, ?????????, 2005). ?
????????? ?? ???? ? ?????????? ????????? (???. 2 ?). ?????? ???????? ???????????? ??????????? ??????? ????-????????
(???? ?? ???????? ??????????? ????? ??????????? ? ??????? ????????) ?????????
???? ???????? ????. ?? ???? ????? ??????
???? ???????????? ? ?????????? ?????????
(???. 2 ?) ?????????? ?????????? a ? ???????????? ? ????? ?????????, ????????????-
??????? 1. ????? ?????????? ???? ? ???? ???, % ?? ?????? ????
????
???? ??????? ????
???? ???????? ????
????????
????
????????
????
18.06.2010
50
49
?
?
09.07.2010
44
43
55
52
# 396 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?
?
?
???. 2. ???????? ?????????? ?????????? a (?), ???????????? (?) ? ???? ???????????? ? ??????????
????????? (?) ? ???? ??????? ? ??????? ????? ?? ????????? ?????? (???????? ??????????, ??????????
????? ?????????? ????????????????? ?????? ? ??????? 7 ????)
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ????, ?.?. ?????? ??????????? ???????????? ??????? ?????????????????? ???????? ??? ??????????
???. 3. ????????? ??????? ????????? ?????? ? ???? ??????? ? ??????? ????? (???????? ??????????,
?????????? ????? ?????????? ????????????????? ?????? ? ??????? 7 ????)
??, ? 2,2 ? ? 2,5 ???? ??????, ??? ? ??????????? ?????????.
?????? ???? ? ?????? ??? ????????
?? ??-?-???????? ?????? ???????? ?????.
??????? ????? ?? ?????????? ??????? ???????? ????????? ????????? ????????? ??????
???????? ?????????. ????????? ??????? ????????? ?????? ? ?????????? ???? ? ? ???? ???????? ???? ???????? ??? ??????????? ? ????????????????? ?????? ???????? ?? ???. 3.
????????, ??? ? ?????? ?????? ??????
????????? ??????? ????????? ?????? ?????????? ?? ?????????? ? ????? ??????????
??????? ???????? ?????????? ????????? ???
? ?????, ??? ? ? ??????????? ?????? (???. 3,
?????????? ???????).
??????, ?????????? ????? ????????????? ??????????, ??????????????? ?
????????????? ???????? ??????? ?????? ?
??????????? ?????? ??-?-????????. ??????????? ??????? ?????????? ?????????????? ?????????, ?, ???? ?????????? ?????????? a ?? ???????? ???????? ????????,
?????????? ???????????? ????????? ?????????? ??????? ? ???? (???. 2 ?, ?). ???????
????? ????????, ??? ? ??????????????? ????
??????? ???? ??????????? ???????? ????
???????????? ? ?????????? ????????? (??
23,2 %) (???. 2 ?). ????? ????, ?? ???? ??????????????? ????????? ????????? ??????
???????? ????????? ??????? ????, ????????,
????????? ?????????, ??????? ?????????
?????? ???? ???????? ???? ? ????? ?? 34,8 %
????????? ??????????? ???????? ? ??????????? ?????? (???. 3).
? ????????? ???????? ????? ???????
????? ???????????? ????? ??????????????
????????? ??????? ?????? ???????? ?????????? ??????????? ????????? ? ?????????? ?????????? a ? ???? ??????? ????, ???
???? ??? ?????????? ? ???? ??????? ???? ?????????? ?? ?????????? (???. 2 ?). ???????????
???? ?????????? ???????????? (???. 2 ?), ???
??????? ? ?????????? ?? ???? ? ??????????
????? (???. 2 ?). ???????? ????????? ??????? ????????? ?????? ? ??????? ??????? ?????? ????????? ?? ??????????? (???. 3).
????? ?? ????????? ????????????? ????????? ??????? ???????? ????????? ????????
????? ??? ???????. ???????, ? ?????????? ?
???????????? ?????????????? ?????????,
?? ?????? ????? ???????????? ?????????
# 398 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ????, ?.?. ?????? ??????????? ???????????? ??????? ?????????????????? ???????? ??? ??????????
???. 4. ????????? ????? ???? ??????? ? ??????? ?????
??????????????? ?????? ????, ? ???? ???????? ?????????? ?? ???????? ???????. ????????? ????? ???? ?? ?????? ??????????
???????? ?? ???. 4.
?? ???? ?????????? ????? ???? ??????? ????, ??????? ??? ????????? ????, ????
?????????? ?????????? ???????? ???????????????? ???????? ?? ???? ???????? ????.
?????? ???????? ????? ??????? ???????????
???????? ? ??????? ? ??????????? ???????
??? ????? ???? ?????? ?????????. ????? ????
?????? ??????????? ??-?-???????? ???????? ??????? ???? ??????? ???? ????????????????? ???????? ????????? ?? 15,4 % ????,
??? ? ????????.
???????????? ?????????????? ????????
???? ??????? ???? ????, ???????????????
??-?308, ??????? ????????? ??????? ??????????? ?????? ???????? ? ??????. ?????
????????????, ??? ?????? ? ???????????
?????????? ???????????? ? ???????????? ?
????????? ?????? ?????????? ?????????? ???????? ??????? ????????? ???????, ??????????? ??????????????? ??-?-????????
(Smith et al., 2000). ? ?????????? ??????????
????????????? ?????? ????????? ?????????? ???????.
????? ????????? ?????????????? ??????? ????????????? ? ????????? ? ???, ??? ????????? ??????? ?? ???????? ??????????? ?????????? ?????? ????????, ? ????? ???????
???????????????? ???????? ??????????
??? ??-?308-????????, ???? ????????? ???????????? ???? ??????????? ? ????????????
???????? ????? ????? ????? ??????????? ?????????. ?????????? ????????? ????? ???????????? ?? ???. 2-4.
? ??????? ??????? ?????????? ????????? ???????? ?????????? ????????? ????
??????? ??????. ????????? ???????????
????????? ???????????????? ? ???????????
?????? ????????, ??????????? ???? ?????????? ????????? ?????? ??????????? ???????? ?????????. ?????? ?????????? ?????????? a ? ???? ????????????????? ??????
???????? ????, ??? ? ????????, ? ??????????
?????????? ???????????? ??????????? ????? ?????????? (???. 2 ?, ?). ??? ??????????
????????? ??????? ????????????? ???????????????? ?????????? ?????????. ? ??????????, ?? ???? ????????? ????? ???? ???????????? ? ?????????? ????????? ???????? ?
????????, ????????? ?????????? ?? ????
? ?????????? ????????? ??????? ??????
# 399 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ????, ?.?. ?????? ??????????? ???????????? ??????? ?????????????????? ???????? ??? ??????????
(???. 2 ?). ??????????? ????????? ???????
????????? ?????? ???? ? ??????? ?????? ??
???????????????? (???. 3).
???????? ????? ???? ??????? ???? ? ??????????? ?????? ???????? ???????? ????????????, ? ? ????????? ??????? ??????????
?? ????? ???????? ???????? ???????? ?????????? ????. ? ??????? ??????, ???????? ??
?????????? ??????????? ???????, ????? ????
??????? ???? ?? ???? ??????????? ?????? ?????????? ?????????? ?? ?????????? (???. 4),
? ?????????? ?? ????????? ? ???????? ???????? 37 %.
???????????? ?????????????? ???????? ???????? ???? ????????, ??? ??????????
??????? ??????????? ????????????? ??????
????????? ???????? ?, ?????????????, ????
??????????? ?????????? ???????? ????????.
???????? ????????? ????
???????????? ???????????
??????????? ????????? ??2 ? ??????????????? ??????? ????????? ??????? ??
???? ????? ? ????? ? ?????????????? ???????-
?????? ???????? ??????? ????????? ???????? ??????????????? Li-820. ?????? ??? ?????
?? ??????? ???????? ???????? ? ????????
???? ???????????? ??????????? ? ???????
? ??????????? ??????. ??? ???? ?????????
???????? ????????? ? ???????????? ???????? ???????????? ??2 ? ???????? ??????????????? ??????? ?????? ???? ????, ??? ?
???????? ?????????. ?????? ? ??????? ?????
(? 1800 15.08 ?? 1600 18.08.2010), ??????????
?? ??????? ????? ??????????, ???? ???????????????? ?????????? ???????? ?????????
???? ??2 ? ??????? ? ??????????? ???????.
?????? ???????? ???????????? ??????????? ? ??????? ???????????? ??2 (???) ? ????
?????? ?????????? ?? ???. 5.
?????????? ?????? ?????????? ???????? ??? ??2 ? ?????????? ??????????????? ????????? ? ???????? ??????????. ?
??????????? ?????? ???????? ????????????
???????? ???????? ? ??????????? ? ???????
????? ??????????? ?? ????????. ? ?????? ?
???????? ?????????? ????????? ???? ????????????? ???????????? ???????????. ??
???. 5. ???????? ???????????? ??????????? ???????? ??? ????????? ??????? ? ??????????? ?????
? ??????? ???????????? ??2 (????????????? ??????? ???????? ??????? ?????: ??????? ? ??????
??????? ?????, ?????? ? ????? ????????? ????????? ???)
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ????, ?.?. ?????? ??????????? ???????????? ??????? ?????????????????? ???????? ??? ??????????
??????, ?????????????? ?? ???. 5, ??????????? ???????? ???????????? ??2 ??????? ??
32,5 %. ????? ????, ?????????? ??????????
???? ???????????? ??????????? ???? ? ???????? ????, ??? ??????????????? ? ????????????
?????????? ????????????? ??????? ??????? ???????? ?????????? ???????, ??????????
????????? ??-?308-????????.
????? ???????, ??????????? ?????????????? ??? ???????????????? ???????? ??
????? ????? 308 ?? ? ??????? ??????????
???????, ???????????? 7 ????, ???????
????????????? ???????????? ???????????
? ??????????? ????????????? ???????. ???????, ??? ???????????? ???? ? ??????? ?
??????????? ???????? ???????? ?? ??????????.
????????????? ?????????
???????? ????????????? ??????????
??? ?????????
?? ??????? ????? ???????????? ? ?????????????? ? ??????? ????????, ??????? ?
??????? ?????? ???????????? ???????????
??-?308-????????, ?????????????? ???????
(F0) ? ???????????? (Fm) ?????? ?????????????, ?? ??????? ?????????? ?????????
????? ?????????? ?????????? ??????? ?? II
Fm ? F0
. ????????? ????????? ??????????
Fm
?? ?????? ?????????? (04.09-04.10.2010) ???????????? ?? ???. 6.
?? ?????? ????????? ????????? ?????
???????? ?????? ???????????????? ???????
????????????? 7-8 ????, ?? ??????? ???????
????????? ??????????????? ?????????? ??????????? ????????. ????????, ??? ? ???????
?????? ?????? ????????? ???????? ????????? ?? ???????????. ?????????????, ????????????????? ??????? ??? ???????? ??????????? ?????????????, ????? ?????????????
??????? ?????????, ???????????? ??????????? 8-??????? ???????????.
?????????? ???????? ??-?308-????????
?????????? ? ??????? ?????? ?????? ?????????. ?????????? ?????????? ???????? ????
????????????? ?????? ????????????? Fm
(???. 6 ?), ??? ??????????????? ? ???????????? ???????? ?????????? ?????????? a ?
???? ??????? ????????. ?????????? ????????? ?????? ??????????? ? ??????? ???????
????? ????????????, ??????????????? ??
???. 2 ?. ?????????????????? ? ???? ??????
???? ???????? ?????????? ?????? (???. 6 ?)
????? ??????????????? ?? ????????? ??????????????? ????????? ?C II. ?????? ? ????
????????? ?????? ???????? ??????????? ?????????? ???????????? ??????????? (???. 5).
?? ??????? II ? III ???????? ??????????????? ???? ????????????? Fm, ???? ??????? ??
?? ?????? ????????, ??????? ??????????? ?
??????? ?????? ?????? ?????????? (???. 6 ?).
????????? ???????? Fm ??????????????? ??
?????????? ?????????? ?????????? a ? ????
?????????? ????????, ??? ??????????? ? ???????????? ???????????? ??????? (???. 2 ?).
? ???? ?? ?????? ?????????? ???? ?????????? ?????? ????????? ?????????????? ?????????
Fm ? F0
(???. 6 ?). ????? ???????,
Fm
????????? ????????? ? ???? ??? ?????????
??????????? ??????????????, ????? ??????
??????????? ?????????? ??? ????????? ??????????????? ??-?-???????? ?????????? ?
???????? ????? ???????????? ???????????
(?? 15 ?????).
?????????????? ??????? ??????? ??????? ????????????? F0 ????????? ???????
????????? ????????? ???? ??????????? ?????????? ???????????? ???????, ??????? ???????? ?? ???????????? ? ?????? ?????????
??????????? (???. 6 ?). ????????, ??? ????-
# 401 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?
?
?
???. 6. ????????? ??? ???????? ????????? ????????????? ???????????? (Fm) ????????????? (?),
?????????? ?????? ?????????? ?????????? ??????? ?? II
Fm ? F0
(?) ? ??????? (F0) ????????????? (?)
Fm
?????????????? ? ??????? ???????? ??? ??????????? ?????????? ??? ??-?308-???????? (???????????
??????? ?????????? ??????? ???????????????? ???????? ? ???? ?????? ?????????)
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ????, ?.?. ?????? ??????????? ???????????? ??????? ?????????????????? ???????? ??? ??????????
???. 7. ????????? ?????? ????????? ?????????? ???? ??? ????????? ????? 30-???????? ??????????? ???308-????????
????????? ??????????? ??-?308-????????
?????????? ? ?????????? ???????? ???????
????????? ? ????, ??????? ???????, ? ???????
II ? III ????????.
??? ??????????? ?????????? ??? ???308-???????? ????? ???? ?????? (IV ??????;
???. 6 ?) ?? ???? ?????????????? ?????? Fm
??????????? ??????? ?????????? ???????
??????? ????????????? (???. 6 ?), ??? ??????????????? ? ?????? ?????????? ???? ??????????? ??????????. ? ?? ?? ????? ?????????? ?????????? ???? ??????????????
?????????? ?C II, ????????? ????? ?????????? ?????????? ??????? ????????? ????? ??????????? ???????? ?? ?????? ??????????.
????????????? ?????? ?????????? ????
??????? ????, ??????????? ?? ????????? ????????????, ??????? ????????? ?????????
? ????????? ???????? ?????? ????????? ??
????????? ? ????????? (???. 7). ???, ? ???????? ??????????? ?????? ???????????????
??????? ???????????, ? ???? ???????? ?????? ?????????? ????????? ????????. ?
??????? ???????? ????????? ???????????
??????????? ?????????? ?????????, ?? ??????? ??????????? ? ???????. ????????, ???
??????? ? ?????????? ???????????? ????????-
??, ? ??????? ??? ?????????. ? ?????????
????? ???????? ??????????? ?? ????????, ??
?????????? ?? ???????????????. ???????,
??? ????????? ??????? ?????? ???????? ??
??????????????.
??????? ??????? ??????????? ??????????? ?????????? ??? ??-?308-????????
?? ???? ??????? ???? ??? ????????? ????????? ????????????? ?????? ????????????????????????? ???????, ????????????
?? ????????? ???????? ????? ????????????
(????. 2). ?????????? ?????????? a ? ?????
????????? ?? 38,8 % ??????, ??? ? ????????
??? ?????????????? ???????? ? ??????????
???????????? (6,4 %). ??? ???? ??????????
???? ???????????? ? ?????????? ????????? ? ????? ?? 43,7 % ????, ??? ? ????????.
????????? ? ??????? ?????? ???????? ????? ???????????? ???????? ??????? ? ????
??????????? ??????, ????????? ????????
??????????? ????????? ????? ??????????,
????????? ?????????????? ?????? ??? ??????????? ?????? ???? ??????? ????? ???????????? (?????? ?? 09.08.2010 ? ????. 2).
????? ???????, ?????????? ???????????? ???????????? ????????, ??? ????????????????? ??????? ??? ????????? ???????? ?
# 403 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ????, ?.?. ?????? ??????????? ???????????? ??????? ?????????????????? ???????? ??? ??????????
??????? 2. ?????????? ?????????? a, ????? ???????????? (???/? ?? ?????? ????) ? ???????????
????????????????? ????????? ? ???? ??????? ???? ??? ????????? ?? ????????? ???????? ?????
????????????
?????????
????????
????
*?????? ?? 09.08.2010
????????? a
908±12
654±10
911±11
????? ????????????
264±5
281±5
223±6
4,6
3,2
5,1
??????????/???????????
* ? ??????? ??????? ????? ???????????? ???????? ??????? ? ?????? ??????????? ??????.
??????????? ??-?-???????? ? ??????? ????????? ????????? ???????????? ????????????? ?????????. ??????????? ??????????
?????? ??? ??? ????????? ???????????
?????? ??? ?????????? ? ???????????? ???????? ????????????????? ??????????? ??-?????????, ????? 15-23 ?????. ????????? ????
? ??-?-????????? ?????????????? ?? ????????? ??????? ??????????? ? ????????????
?? ?????????. ? ???? ??????? ???? ?????????? ??? ??????????? ??????????????? ??
??????????? ?????? ? ?????????? ?????????
????????? ??????, ???? ??????? ???? ???????????? ?? ????????????? ?????? ?? ????
??????? ? ?????????? ???????? ???????
(????????, ???????????) ? ??????? ????????. ?????????? ???????? ?????????? ???
??-?-???????? ?????????? ??????????????? ?? ???????? ??????????????? ??????????
???? ??????? ????. ??????? ?????????? ???
???????? ? ??????? ???????, ???????????? ?????? ????????????? ?????????, ??????????? ????????? ?? ????. ????????? ?
????? ?????? ??????? ?? ??? ???? ??? ????????? ????????? ??????????? ??????????
??? ??-?308-???????? ????? ???? ??????. ???
?????????????? ?????????? ?????????? ????????? ????????????? ??? ?? ??????????? ? ?????????. ? ???? ?????????? ????????
?????????????? ?????? ???? ????????????
???????????, ? ??? ????? ? ?????????? a, ???????????????? ?????????? ?????? ????
??????????? ??????????. ?????????? ????-
????????? ???????? ?????????????? ?????????? ?C II. ??????????? ????????? ??????????? ?????? ?????????.
??????????
?????? ?????????????????? ????????
??? ????????? (Picea obovata) ?? ?????????? ????????? ??????????? ?????? ???-???????? ? ?????? ????? 308 ?? ???????
?? ????????????????? ????????? ? ???????? ????. ?????? ? ???????? ???????????????????????? ????????? ??? ?????????????? ?????????? ??????????????. ?
???????????????? ??????????? ? ????????
????????????? ?????????????? ??????? ????????????????? ??????? ??? ??????????. ?????? ????? ?????????? ????????? ???????? ?
????????? ??????????: ??????????? ?????????? ????????????????? ?????????, ? ???
????? ?????????? a ? ????????????, ????????? ????????? ????? ?????????? ??????????
??????? ?? II ? ????????????? ????????????
???????????, ????????????? ?????????????
???????, ???? ???????? ???? ???????? ????????? ? ?????.
?????????? ?????????? ???? ?????????
????????, ??? ???????? ????????????? ??????????? ?????????? ????? ? ??????? ????????? ???????? ??? (Bunn, Goetz, 2006) ? ???????????? ??????? ??????????? ??????????
??????????? ????????? ??? ??-?-????????
? ?????? ????????????? ????????? ?????????? ? 80-90-? ??. ???????? ????????.
# 404 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ????, ?.?. ?????? ??????????? ???????????? ??????? ?????????????????? ???????? ??? ??????????
?????? ????????? ??? ????????? ?????????? ????????? ?????? ???? ?08-05-00558-?
? ??????? ?????????? ??? ?4.10.
?????? ??????????
?????????? ?.?, ???????? ?.?. (2003) ??????? ????????? ?? ??????????? / ??? ???. ?.?.
????????. ?.: ???????????? ????? «????????», 256 ?.
???? ?.?. (2004) ???????? ???????? ???????????. ???????????: ?????, 307 ?.
???? ?.?., ????? ?.?., ????? ?.?., ????? ?., ?????? ?. (2005) ????? ????? ??????????? ????
?? ????????? ??? ??????????? ?????? ?????? ? ??????????? ??????????. ?????? ????????? ? ??????. 18 (7): 618-620.
????? ?.?. (2008) ????? ????????? ???????????? ???????? ??-? ????????? ???????? ?
??????????? ?????? ?????????? ?????. ?????? ?????????? ???????????? ????????????, ????????. 1 (4): 345-357.
?????????? ?.?., ???????? ?.?. (2004) ????????????? ??????????? ??????????? ????????. ?.: ?????????, 336 ?.
???????? ?.?., ????????? ?.?. (2005) ?????????? ????????. ?.: ?????? ?????, 737 ?.
?????? ?.?., ?????? ?.?., ????????? ?.?., ???? ?.?., ?????? ?.?., ??????? ?.?., ??????? ?.?.
(2006) ????????? ?????????? ? ?????????? ???????? ? ?? ?????????? (?????). ??????? ? ???????
????????????. ?4: 1-22.
?????? ?.?., ????????? ?.?. (1974) ????????????????? ???????. ?.: ???????????????, 568 ?.
???? ?.?. (1971) ??????????? ??????????? ? ???????????? ? ?????????? ??????? ???????. ?: ????????????? ?????? ? ??????????. ?.: ?????, ?. 154 ? 170.
Bunn A.G., Goetz S.J. (2006) Trends in satellite-observed circumpolar photosynthetic activity
from 1982 to 2003: the influence of seasonality, cover type, and vegetation density. Earth Interactions.
10(12): 1-11.
Genty B., Briantais J.M., Baker N.R. (1989) The relationship between the quantum yield of photosynthetic electron transport and quenching of chlorophyll fluorescence. Biochimica et Biophysica
Acta. 990 (1): 87-92.
Lichtenthaler H.K. (1987) Chlorophylls and Carotenoids. In: Methods Enzymol. V.148, Pigments
of Photosynhetic Biomembranes, p. 350-383.
Maslova T.G., Popova I.A. (1993) Adaptive properties of the plant pigment systems. Photosynthetica. 29 (2): 195-203.
Rosema A., Snel J.F.H., Zahn H., Buurmeijer W.F., Van Hove L.W.A. (1998) The relation between
laser-induced chlorophyll fluorescence and photosynthesis. Remote Sensing of Environment. 65 (2):
143-154.
Smith J.L., Burritt D.J., Bannister P. (2000) Shoot dry weight, chlorophyll and UV-B-absorbing
compounds as indicators of a plant's sensitivity to UV-B radiation. Annals of Botany. 86: 1057-1063.
?prtova ?., Marek M.V., Nedbal L., Prasil O., Kalina J. (1999) Seasonal changes of photosynthetic
assimilation of Norway spruce under impact of enhanced UV-B radiation. Plant Science. 142: 37?45.
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ????, ?.?. ?????? ??????????? ???????????? ??????? ?????????????????? ???????? ??? ??????????
Integrated Studies of the Response
of the Photosynthetic Apparatus of the Siberian Spruce
(Picea obovata Ledeb.) to the Effects of UV-B Radiation
Vladimir V. Zuev*,
Nina E. Zueva, Albina P. Zotikova,
Olga G. Bender and Vladimir L. Pravdin
Institute for Monitoring of Climatic
and Ecological Systems SB RAS,
10/3 Akademichesky, Tomsk, 634055 Russia
The nature of the effect of ultraviolet radiation on the physiological processes of plants depends on
the wavelength, intensity and the duration of the exposure. The article presents the results of the
integrated study of the effect of ultraviolet radiation on the photosynthetic apparatus of the Siberian
spruce (Picea obovata Ledeb.) at a wavelength of 308 nm and the irradiation, which is close to the
level of radiation at a given wavelength in the ?ozone hole? within 30 days. The periods of 7-8 days
are distinguished. At the boundaries of these periods the response of the photosynthetic apparatus
to irradiation varies significantly, depending on the age of the needles. So during the first week of
exposure, i.e. within the natural synoptic time-scale, there are no significant changes in the functional
state of the photosynthetic apparatus. The second week is characterized by a pronounced decline
in photosynthetic pigment content, the quantum yield of primary charge separation of PS II and the
intensity of the observed photosynthesis. There is also a respiration increase and the growth of pine
needles of the current year is slowing down. In fact, within 15 days, which correspond to an average
lifetime of a blocking anticyclone at the lowest levels of total ozone, the action of photo adaptation
mechanisms is not observed. Furthermore, the effect of UV-B radiation stimulates the functioning
of adaptive mechanisms, resulting in the restoration of the pigment fund. However, the adaptation
mechanisms can no longer cope with the effects of abnormal duration influences (more than 3 weeks)
of the short UV-B radiation and this leads to serious structural failures and malfunction of the
photosynthetic apparatus.
Keywords: ultraviolet radiation, total ozone needle structure, photosynthetic intensity, adaptation,
chlorophyll, quantum yield.
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Journal of Siberian Federal University. Biology 4 (2010 3) 407-417
~~~
??? 577.1:612.017: 616-053.2
???????????? ???????? D, ?????? IgE,
????????? ? ?????? ?????? ??????
? ?????????? ????? ? ?????????????
?? ??????? ? ???????? ? ????????
??????????? ??????????
???????????? ?????????
C.?.??????????*, ?.?. ???????,?,
?.?.?????????,?, ?.?. ???? ?,
?.?. ?????????,?, ?.?. ????? ?,?, ?.?. ???????? ?,
?.?. ???????, ?.?. ???????, ?.?. ??????????*
?
??? ??????????? ??????? ?????? ?? ????,
660022, ?. ??????????, ??. ?.????????? 3?;
?
???????????? ??????????????? ??????????? ???????????,
660022, ?. ??????????, ??. ?.????????? 1;
?
???????? ????????? CO ???,
660036, ?. ??????????, ?????????????, ???.50;
?
????????? ??????????? ???????????,
660041, ??????????, ??. ?????????, 79;
?
??????? ????? ?? ???????????? ? ?????? ?? ????
? ??????? ????????????? ?????????????,
660049, ?. ??????????, ??. ?. ??????, 45 1
Received 3.12.2010, received in revised form 10.12.2010, accepted 17.12.2010
? ????????? ????? ?????????? ???????? ??????????? ????????? ???????????
???????????????? ?????? ?????? (????) ? ???????? D, ???????? ???? ? ??????????
???????????? ????????? (??). C ?????? ???????, ??????? ????????? ?????? ? ??????
??????????????? ??? ????????? ????????? ???????????? ????????????? ???????? ? ???????.
?????? ?????? ?? ???? ?????? ?? ?????? Th1/Th2 ??????????, ???????????? ???????? D ?
?????? ???? ??? ? ??????? ???????? ???????? ? ??????? ????????? ????????????????
? ??? ???? ??????? ???????????? IFN?, IL-1 ?, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12, TNF?,
TNF?, IL-13, IL-18, IP-10, ?????? IgE ? ???????? D ? ?????????? ????? ?????????????. ?????
????, ? ???? ?? ????????????? ?????????? ?????? ???? ??????????? ?????????? ?????
(??????????? ??????? ????-?????????????). ?????????? ? ???????????? ?????????????
???? ????????? ?? ??? ?????? ? ? ??????????? (n=29) ? ???????? (n=19) ???????????????
???????? ?? ??????? ??????????? ?????????? ?? ? ?? ???????. ????????, ??? ? ?????????????
*
1
Corresponding author E-mail address: legise@mail.ru
© Siberian Federal University. All rights reserved
# 407 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
C.?.?????????, ?.?. ??????? ???????????? ???????? D, ?????? IgE, ????????? ? ?????? ?????? ???????
?? ??????? ? ???????? ?? ???? ??????? ???????????? IL-13, IL-18 ? ?????????? ????? ?
?????????? ?????????? ?????-??????????? ??????? (???). ????? ???????, ??????? ?
???????? ? ?????? ?????????????? ?? ?????? ?? ????????? IL-13, IL-18 ? ??? ??? ? ???????
???????? ???????, ??? ?????????????? ??????????????? ? ???????????? ??????? ?????????
????????? ? ????? ???? ???????????? ? ???????? ?????? ???????? ??????????????????? ?
???????????? ??.
???????? ?????: ?????????????, ?????????? ?????, ????????, ??????? D, ?????? ???????,
???????? ???????????, ??????????? ????????.
????????????? ???? ?????????????????? ????????????? ??????????? (???????????? ????????? (??), ???????????? ?????,
?????????, ?????????????? ??????), ?????????????????? ?? ?????? ??????? ?? ????????? ???????????, ? ?????? ?????????? ????????? ???????? ? «???????? ????????».
???????? ????????? ? ???????????? ??????
????? ? ????????? ??????? ???? ??????? ??
??????????? ?????????? ????? ?????? ??????????????????. ?????? ?????????????????? ???? ???????????, ???????? ? ???????
?????????, ???????? ??????????? ???????,
? ??????????? ????????? ???????????? ?
?????? ?????????????.
??????????? ?????? (? ?????? ???- ? ?????????????) ???????????? ????????????
????? ? ??????? ???????????????? ??????
???????? ?????? ???????????????? ????????????? ??????????? ? ????? ?????? ?????????? ??? ?????????????? ? ????????????? ????????????? ??????? ????????? ? ?????????
???????????? ? ??????????? ???????????,
???????? ???????????????? ???? ? ?????????????? ???????? ??????????. ? ?????????
???? ? ???? ????? ??????????????? ???????? ??????? ????????? ???????? ????????:
Canadian Childhood Asthma Primary Prevention
Study (Chan-Yeung et al., 2005), German Infant
Nutritional Intervention Study (von Berg et al.,
2003), Childhood Asthma Prevention Study (Peat
et al., 2004).
????? ????????? ????????? ????????
????????? ???????????? ????????????? ??-
????????? ? ????? ???????? ?????????? ???????? ???????????? ???????? ?????? ????? ???????????? ?????? ? ?????? ????????
???????, ? ?? ????? ??? ????????, ??? ???????????? ????????????? ???????????? ??????????? ????? ???? ??????????? ? ???????
????????????? ????? ? ? ???????? ??????
?????? ?????.
???????????? ?????????? ????? ??? ????????? ?????? ????? ? ??????? ?????? ???????????? ?????? ???????????? ? ?????????
????? ?????????? ??????, ? ??????? ?????
????? ????? ? ???????? ?????????? ?????????? ??????????? ??????? IgE (Lopez et al.,
2002; Van Bever, 2002) ? ??????? ??????????
????????? (Lohmann et al., 2002; Ohshima
et al., 2002). ???, ????????, ???? ????????
??????????? ????? ??????????????? ?????? ? ??????? ?????????????? ?????????
???????????-? ? IL-13 ? ?????????? ????? ??
????? (Kopp et al., 2001), ????? ?????? ??????? IgE ?????????? ????? ? ????? ?? ???????
? ??????? ??????????? ????? (Karmaus et al.,
2001), ?????????? ??????????? ?????????
IL-4/ ??????????-? ? ????? ? ???????? ????????? ?? ?????? (Gabrielsson et al., 2001).
????????? ???????????? ??????????,
??? ??????? ???????? D ?????? ? ???????
?????? ???????????? ????????????? ??????????? ? ?????, ???? ?????? ???????????????? ????????? ?????? ??????? ????????
???????????? (Litonjua, 2009). ???????? ????????? ?? ??????? ????????????? ???? ??????????? ???????? ???????? D ? ??????????
# 408 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
C.?.?????????, ?.?. ??????? ???????????? ???????? D, ?????? IgE, ????????? ? ?????? ?????? ???????
???????????? ??????????? ???????????. ?
?? ?? ????? ????????? ??? ?????? ??????????? ??????????, ??????????? ???????? ?????
???????????? ???????? D ? ?????????????
???????? ????????? ?? ??????.
????? ??? ??????? ??????????? ????????????, ?????????? ?? ???????? ????? ??????????? ???????????????? ?????? ??????
(????) ? ??????????? ????????????? ???????????, ??????? ?????? ??????????? ?????? ????????????? ?????? ?????? ???? ?-3
?? ????? ???????????? ? ???????? ?? ?????????? ???????????? ????????? ???????? ??????? (Furuhjelm et al., 2009). ??????????????,
??? ????????????????? ? ?????????????????
???????, ??????? ?????????????????? ?
????????????????????? ???????????, ???????? ???????? ??????? ?? ????????????
????????????? ???????????. ??????? ?????????????? ??????? ????????????? ??????
??? ?-3, ??? ? ?-6 ???? ? ????????? ?? ??????????? ???????????? ?????? ???????????
? ????????????? (Gold et al., 2006). ??????
???????????? ?????????? ???? ? ?????????? ????? ? ????? ? ??????????? ???????? ?
?????? ?? ???? ? ???????? ??????? ????? ????????????? ???????? ?? ?????????? ???????
?? ?????????.
????????? ??????????????? ????????
????? ???????????? ???????????? ????????
???????? ????????????? ???? ??????? ?????? ? ??????????? ??????????? ? ?????????
????????????? ???????, ???????? ? ??? ??????. ??????? ???????????? ??????? ???????????? ?????? ????? ?????????? ????????????
?????????, ??????????????? ?????? Th1/Th2
??????????, ???????? D ? ??????? ??????
?????? ? ????????? ????????? ??????????
????? ????????????? ? ???????? ???????????? ????????? ? ?? ???????.
????? ????? ?????? ???? ???????????? ????? ?????????? ???????????? ????-
?????, ??????????????? Th1/Th2 ??????
(IFN?, IL-1 ?, IL-2, IL-4, IL-5, IL-6, IL-8, IL10, IL-12, TNF?, TNF?, IL-13, IL-18, IFN??????????????? ???????? 10), ?????? IgE,
???????? D, ? ????? ??????????????? ?????????? ???????????????? ?????? ?????? ?
????????? ??????????? ?????????? ?????
????????????? ? ???????????????? ?????????? ?? ??????? ???????????? ????????? ?
?? ???????.
????????? ? ??????
??? ???????????? ???????? ????? ?????????? ????? ? 48 ????????????? ? ????????? ???? ? 5 ?. ???????????, ??????? ??
????????? ????????? ? ???????????. ?? ????
????????????? ????????? ?????????? ????????????? ?????? ?????? ??????? ? ?????????? ????????????????? ????????? ?? ?????
?????????? ?????. ? ???????????? ? ???????
?? ?????? ? 56 ?????? ?????????? ? ???????????? ????????????? ???? ????????? ??
??? ?????? ? ? ??????????? (n=29) ? ???????? (n=19) ??????????????? ???????? ?? ??????? ??????????? ?????????? ????????????
????????? ? ?? ???????.
? ?????????? ????? ???????????:
? ???????????? 11 ?????????, ??????????????? Th1/Th2 ?????? (IFN?, IL-1
?, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10, IL12, TNF?, TNF?, ?? ??????????????? FACSCalibur, «Becton Dickinson»,
USA);
? ???????????? ?????? IgE, IFN??????????????? ???????? 10 (IP-10),
IL-13, IL-18 ??????? ????????????????? ???????;
? ???????????? ???????? D ???????
?????????????-????????? ?????????????????, ?????????????? ?????????? Immulite 2000, Siemens Healthcare
Diagnostics Inc, USA;
# 409 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
C.?.?????????, ?.?. ??????? ???????????? ???????? D, ?????? IgE, ????????? ? ?????? ?????? ???????
? ???????????? ?????? ?????? (?? 12:0
?? 24:1?9) ? ?????????????? ????? ?????????? ????? (????????????? ?????? ?????? ? ????-??????????????????
?????????,
6890/5975C,
Agilent
Technologies, USA).
?????? ???????????? ? ???? ???????
(25-75 % ????????). ?????????????? ?????????? ???????? ?????????????? ?????????
????????????? ? ??????? ???????? ?????????? (U).
?????????? ? ??????????
??????????? ?????? ??????? ??????????
????????????? ???????? ???????? ? ?????????? 11 ?????????, ??????????????? Th1/
Th2 ?????? (IFN?, IL-1 ?, IL-2, IL-4, IL-5,
IL-6, IL-8, IL-10, IL-12, TNF?, TNF?), IFN??????????????? ???????? 10 (IP-10), ???????????? ?????? IgE ? ???????????? ???????? D ? ??????? ????????????? ? ????????
? ??????????? ???????? ?? ????????? ? ??
??????? ? ???????? ??????????? ??????????
???????????? ?????????.
? ?? ?? ????? ???? ??????? ?????????????? ???????? ? ?????????? ?????????????
IL-13 ? IL-18 ? ??????? ????????? (???. 1 ? 2).
??? ??????? ?? ?????????????? ?? ???. 1 ? 2
??????, ???????? ?????????? ???????? ???????????? IL-13? IL-18 ? ?????? ????? ????????????? ?? ??????? ? ???????? ? ????????
??????????? ?????????? ???????????? ?????????.
IL-13 ? ???????, ????????? ????????
??????? ??????????, ?????????? ? ?-???????
CD4+, CD8+, ? ??????????? ? ????????? ?????????? ???????. ?????????, ??? ?????????
????? ??????????? ???????????? ?????? IgE
? ?????????????? ??????????? ????, IL-13
???????????? ???????? ???????????? ?????
? ??? ???? ???????????? ???????? ??????????? ????????????? ??????? ?????? (Barnes,
2008). ? ????????? ????? ? ??????? ? ???????????? ?????? ???????? ??????????? ????????? ?????????????? ????????, ??????????? IL-13.
?????? ? ?????????? IL-13 ? ?????????? ????? ? ??????????? ??? ?????????????
??? ???????? ???????? ???????????? ??????????? ?????????????. ???, ???????? ???????? ????????? IL-13 ? ????? ?? ????????? ?
???????????? ?????????????, ??? ?????????
?????????????? ?????? ??????? (Williams
et al., 2000). ?????? ?????? ???????? ????????? ?????? ????? ???????? ? ?????????? ????? ? ????? ? ???????????????????? ? ??????
(Kopp et al., 2001). ?? ???????, ???, ????????
?? ????????????? ???????? IL-13 ? ????? ?
?????????????? ???????????????????? ?
???????????? ???????????? ?????????, ?????????? ?????????????? ???????????? ???
????????? ??? ????????? ???????????????
????.
???? ???????? ???????????? ??? ??????? ???? IL-18 ? ???????? ???????????? ??????? ??????????? ???????????????????. IL-18 ?
???????????? ???????, ???? ? ??????????
????????? IL-1 (?? ?????????, ????????? ????????, ??????? ?????????? ???????, ??
????????????????????? ?????????), ? ?????
? IL-12. ???????? ??????? IL-18 ??????????
?? ?????????? ????????? ????? ?????????,
??? ????, ????, IL-1?, ? ????? ??????? ??????? ? ????????, ????????????? ???????.
?????????? ?????????? ?????? Th2 ????. ????????, IL-18 ???????? ???????? ?????????,
???????????? ? ?????????????? ???????? ??????? ?????????? Th1 ????.
??????????????? ?????????????? ???????? ???????? ???? IL-18 ? ??????????
???????? ??????????? ???????????. ??????????? ??? ???????, ?????? ?????, ?? ????
???? ?????????? ??????????? IL-18 ???????????? ?????? ???????????-?. ????????
# 410 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
IL-13, ??/??
1,7
1,6
1,5
IL-13, ??/??
1,4
1,3
1,2
1,1
1,0
0,9
Median
25%-75%
Min-Max
0,8
1
2
???. 1. ???????????? IL-13 ? ?????? ?????????? ????? ?????????????: 1 ? ?????? ?????????????
? ??????????? ? ???????? ??????????? ?????????? ???????????? ????????? ? ?? ???????; 2 ? ??????
????????????? ? ???????? ? ???????? ??????????? ?????????? ???????????? ????????? ? ?? ???????,
p= 0,02
IL-18, ??/??
65
60
55
IL-18, ??/??
50
45
40
35
30
25
20
Median
25%-75%
Min-Max
1
2
???. 2. ???????????? IL-18 ? ?????? ?????????? ????? ?????????????: 1 ? ?????? ?????????????
? ??????????? ? ???????? ??????????? ?????????? ???????????? ????????? ? ?? ???????; 2 ? ??????
????????????? ? ???????? ? ???????? ??????????? ?????????? ???????????? ????????? ? ?? ???????,
p=0,003
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
C.?.?????????, ?.?. ??????? ???????????? ???????? D, ?????? IgE, ????????? ? ?????? ?????? ???????
0,05
0,04
18:3w6 (%)
0,03
0,02
0,01
0,00
Median
25%-75%
-0,01
1
2
???. 3. ?????????? ?????????? ?????-??????????? ??????? (% ?? ????? ??) ? ????????? ???????????
?????????? ????? ?????????????: 1 ? ?????? ????????????? ? ??????????? ? ???????? ???????????
?????????? ???????????? ????????? ? ?? ???????; 2 ? ?????? ????????????? ? ???????? ? ????????
??????????? ?????????? ???????????? ????????? ? ?? ???????, p=0,1
?????????????? ???? ? 1-?????? ????????????? ?????????? ??????? ????????????? ?????? ???? ??????????? ??????????
??????????-?-????????????? ?????? ?????????? ????? ??? ?????? ????? ????????
???????????? ????????? ? ????? ????????
????????, ?? ???????, ??? ? ???????? ??????????????? ??????? ????? ?????????????
???????????? ?????????? ????????????
IL-18 ? ?????????? ?????. ??? ????????
??? ?????? ???? 34 ??/?? (??????? 25-??
???????? ? ????? ???????) ???? ???????????? ???????????? ??????????? ??????? ?????????? ???????, ???????? ??? ?????????
?????? ???????? ?? ????????? ??????????
??????????-?-????????????? ?????? ?????????? ?????.
??? ??????? ??????? ?????? ??????
??????? ??????????? ????????????? ? ???????? ? ??????????? ? ???????? ??????????? ?????????? ???????????? ?????????
? ?? ??????? ???? ???????? ???????? ??????????? ?????????? ?????? ???? ??????
?????? ? ?????? ????? ? ???????? ?????????
? ?? ??????? ? ????????????????? (p=0,025) ?
?-??????????? (p=0,1).
??????? ????????, ?? ??? ??????, ??????????? ?????????? ???? ???? ????????
?-??????????? ??????? ? ????????? ??????????? ????????????? ? ??????????????
?????????????? ?? ???????????? ?????????
(???. 3).
????????? ???????? ??????????????
?????????? ?-??????????? ??????? ???????????????? ? ????????????? ??? ????????? ?????????? ???????????? ????????? ??
?????? ????????????, ??????????? ??????
????????, ? ????? ???????, ??????????????
??????????????? ? ??????????? ?????????
???????? (??????? ?????? ????? ???????
????? ????????????????? ?????????), ? ?
?????? ? ????????????? ??????????? ????????????? ??????? ????????? ??? ????????????
? ??????????? ??????? ??????????? ?????
???????????? ???????????? ????????? ? ??????????? ???????. ??? ????????? ??????????? ?????? ?????? ?-??????????? ???????,
? ??????? ???????????? ?????????????????
# 412 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
C.?.?????????, ?.?. ??????? ???????????? ???????? D, ?????? IgE, ????????? ? ?????? ?????? ???????
? ??????? ????? ???????? ???????????? ?????????, ?????????? ?????????? ??????????
??????????????? ?????????????? ?????????? ??????? ?????????????.
??? ? 1929-1930 ??. G.O. Burr ? M.M. Burr
??????? ??????? ??????????? ????? ?????????? ????????? ? ????, ????????? ??????????? ?? ????? ????. ??????? ?????????????
???? ???????? ? ???????????? ???????,
????????????, ??????????? ? ?????????????
????. ?????????? ???????????? ????????,
??? ????? ??????? ???????? ? ?????????
??????????????? ?????????? ?????????????
??????, ??????????? ???????? ???????????
???? ??????????? ????, ????????? ?????????????? ?????????? ? ????????? ?????????? ?????????????, ????????????? ????????? ??????????? ?????? ???????????.
??????? ???? ???????????, ??? ???????
??????? ???? ? ???????? (??????? ?????
? ?????????????????? ?????????????? ?
???????? ? ?????????????? ?????) ???????? ???????????? ????????? ????, ?????????? ????? ????????? ??? ???????? (???? ?
??????? ??????). ? 1958 ?. A.E. Hansen ? ?????. ????????????, ???, ????????? ????????? ???? ??? ???????? ???? ????? ?????????? ??????? ??? ??????????? ?????????
(??), ??????????????????? ????????? ?????
??????????? ?????? ????? ???????? ??????
?????? ?????? ?????? (Hansen et al., 1958).
??? ???????? ????? ???? ????????????? ?
?????????????? ????????????? (????????
????? ????????? ?????? ?????????????? ?????????????), ?????????, ??? ??? ?? ? ?????? ????? ? ????????? ????????? ???????
???????????? ??????????? ????????? ??????? ?6-????: ?????? ????? ?-???????????
(18:3?6) ???????, ?? ????? ? ?????????????????, ????????????, ?????????????????
??????, ??? ???, ??? ???????????? ????? ????????? ??????? ???? ????????? ????????.
????? ????????? ????????? ????????????,
??? ??? ?? ??????? ???????? ??????????
??????-6-?????????? ? ????????, ????????????? ????????? ??????? ? ????????????????? ?6-????, ? ??? ????? ? ?-???????????.
???????????? ??????? ???? ??????????
????? ???? ??????????? ????????? ????????
? ????????? ??????????? ????????? ???????? ?????????? ??????-6-??????????.
??????? ????????????? ???? ? ??????? ?? ???????? ? 30-40-? ??. ???????? ????.
???? ? ???? ??????? ??? ?? ?????????????
??????? ???? ?6-???? ??? ??, ??????, ?????????????? ???????????? ????? (????????,
??????????), ??????? ?6-????, ???????? ?
????????????? ??????????????? ???????,
? ??????? ?? ??????????????, ???????????
?????, ??????? ??????????????? ?3-????
(????? ??????, ???????? ??????). ????? ??????? ????????????, ????????????? ? ????????
? ?????? 80-? ??., ??????? ? ??????????????
????? ???????, ??????????? 72 % ?????????
??????? ? 9 % ?-???????????. ???????????
?????????? ??????? ??????? ????????????
??????? ?? ????????????? ????? ???????
??? ??, ???????? ? ????????? ???? (Horrobin,
2000). ?? ?????? ??????, ? ?????????? ??????? ????????????? ?????? ? ???????????
??????? ?6-???? ??? ?? ?????? ??????????????, ???????? ?????????????? ?????? ?
?????????????? ????????????. ??? ???? ??????? ????????, ??? ?????????? ????????????
??????? ? ????????? ????????????? ?????
???? ??????? ? ????????????? ?????????????? ?????? ?????????? ?????????, ?????????????? ???????? ????, ? ??????????? ??????? ??????, ?????????????????? ???
????, ?? ??????????? ???????? ?????????
?????????.
?????????? ? ???? ????????? ?????????????????? ??????? ?????? ????????? ??????????? ? ???????????? ????? ????????-
# 413 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
C.?.?????????, ?.?. ??????? ???????????? ???????? D, ?????? IgE, ????????? ? ?????? ?????? ???????
?????? ???? ?????, ??????????? ???????
??????? ?????? ?????? ? ?????, ??????????
??????????? ?????????? ? ??????? ???????????? ? ? ??????? ????????.
???, ?????? ??? ?-??????????? ???????
? ????????? ??????????? ???? ???? ???????? ????? ? ???????? ?? ? ???? ???????????????? ????????. ?????? ??????????
?-??????????? ??????? ? ????????? ??????????? ???????? ? 83 % ????? ? ???????
?? (SCORAD-?????? > 21), ? 60 % ? ??????
?? (SCORAD-?????? < 21) ? ?????? ? 41 %
???????? ????? (????????? ? ??., 2005). ?
?????? ????? ?????????? ?-???????????
??????? ?? ?????????? ? ??????????? ?? ??????? ? ??????? ??????? ??. ????? ????, ?
?????? ???????????? ?? ???????? ??????????? ???????? ?-??????????? ??????? ????????? ??????? ? ???????? ?????, ???????
?? ? ??????? ????????, ? ??????? ?? ?????,
?? ??????? ?????? ????????????? ?????????? ? ???????? (????????? ? ??., 2010). ???????? ???????? ????????? ?-???????????
??????? ? ???????????? ? ??????????? ?
????????? ???????????? ??????? ?????????????? ??????????????? ? ?????????, ??????????? ????????? ?????? ?6-???? ?
????? ? ??, ??? ????? ???? ???????????? ?
???????? ??????? ????? ??????????? ? ?????
???????? ????????.
??????????
? ???????? ??????????????? ???????
????? ???????????? ???????????? ???????? ????????????? ???????????? ???????-
??? ???????????? IL-18 ? ??????????
?????. ??? ???????? ??? ?????? ???? 34
??/?? ???? ???????????? ????????????
??????????? ??????? ?????????? ???????,
???????? ??? ????????? ?????? ????????
?? ????????? ?????????? ??????????-?????????????? ?????? ?????????? ?????. ????? ?????? ??????????? ???????????
?????? ??? ??????????? ????? ????????
??? ?????????? ???????????? ?????????????? ????????????. ????????? ?????????? ?? ???? ??????????????? ??????? ?????
???????? ?????????? ???????????? IL-13 ?
?????????? ?????, ??? ????? ????????? ?
?????????????? ??????????? ? ????????????? ????????????.
? ????????????? ? ??????????????
?????????????? ?? ???????????? ????????? ??????? ????????????? ??????????
?-??????????? ??????? ? ????????? ???????????, ??? ???????? ???????????? ??? ???????????? ? ??????????? ??????? ?????????
????? ???????????? ???????????? ?????????
? ??????????? ???????. ??????????? ??????????? ?????? ??? ???????????? ????? ???????? ??? ?????????? ???????????? ?????????????? ????????????.
???????????? ?????? IgE, ???????? D,
IFN?, IL-1 ?, IL-2, IL-5, IL-6, IL-8, IL-10, IL-12,
TNF?, TNF? ? IFN?-?????????????? ???????? 10 (IP-10) ? ?????? ????? ?? ??????? ? ?????????????? ?????????????? ? ???????????
???????????? ? ?? ????? ??????? ?????????
????? ???????????? ???????????? ????????
? ????? ???????? ????????.
???????????? ????????? ? ?????? ?????? ????????????? ???????? ????? ????????? ??????? ? ??????-??????????? ????????????.
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
C.?.?????????, ?.?. ??????? ???????????? ???????? D, ?????? IgE, ????????? ? ?????? ?????? ???????
?????? ??????????
????????? C.?., ????? ?.?., ?????? ?.?., ???????? ?.?., ???????? ?.?., ??????? ?.?.,
????????? ?.?., ???????? ?.?. (2005) ?????? ?????? ?????? ? ??????????? ??????????? ??????? ??????????? ? ????? ? ??????????? ??????????. ??????? ??????? ?????????? 3 (6): 5-8.
????????? ?.?., ?????? ?.?., ?????? ?.?., ???????? ?.?. (2010) ?????????????? ???????? ?????? ? ??????????? ??????? ? ?????. ??????????: ??? ?????, 205 ?.
Barnes P.J. (2008) The cytokine network in asthma and chronic obstructive pulmonary disease. J.
Clin. Invest. 118(11): 3546-3556.
Berg A. Von, Koletzko S., Grubl A., Filipiak-Pittroff B., Wichmann H.E., Bauer C.P., Reinhardt
D., Berdel D. (2003) The effect of hydrolyzed cow?s milk formula for allergy prevention in the first year
of life: the German Infant Nutritional Intervention Study, a randomized double-blind trial. J. Allergy
Clin. Immunol. 111(3): 533-540.
Chan-Yeung M., Ferguson A., Watson W., Dimich-Ward H., Rousseau R., Lilley M., Dybuncio A.,
Becker A. (2005) The Canadian Childhood Asthma Primary Prevention Study: outcomes at 7 years of
age. J. Allergy Clin. Immunol. 116(1): 49-55.
Furuhjelm C., Warstedt K., Larsson J., Fredriksson M., Bottcher M.F., Falth-Magnusson K.,
Duchen K. (2009) Fish oil supplementation in pregnancy and lactation may decrease the risk of infant
allergy. Acta Paediatr. 98(9): 1461-1467.
Gabrielsson S., Soderlund A., Nilsson C., Lilja G., Nordlund M., Troye-Blomberg M. (2001)
Influence of atopic heredity on IL-4-, IL-12- and IFN-gamma-producing cells in in vitro activated
cord blood mononuclear cells. Clin. Exp. Immunol. 126(3): 390-396.
Gold D.R., Willwerth B.M., Tantisira K.G., Finn P.W., Schaub B., Perkins D.L., Tzianabos A., Ly
N.P., Schroeter C., Gibbons F., Campos H., Oken E., Gillman M.W., Palmer L.J., Ryan L.M., Weiss S.T.
(2006) Associations of cord blood fatty acids with lymphocyte proliferation, IL-13, and IFN-gamma.
J. Allergy Clin. Immunol. 117(4): 931-938.
Hansen A.E., Haggard M.E., Boelsche A.N., Adam D.J., Wiese H.F. (1958) Essential fatty acids in
infant nutrition. III. Clinical manifestations of linoleic acid deficiency. J. Nutr. 66(4): 565-576.
Horrobin D.F. (2000) Essential fatty acid metabolism and its modification in atopic eczema. Am.
J. Clin .Nutr. 71(1 Suppl): 367S-372S.
Karmaus W., Arshad H., Mattes J. (2001) Does the sibling effect have its origin in utero?
Investigating birth order, cord blood immunoglobulin E concentration, and allergic sensitization at age
4 years. Am. J. Epidemiol. 154(10): 909-915.
Kopp M. V., Zehle C., Pichler J., Szepfalusi Z., Moseler M., Deichmann K., Forster J., Kuehr J.
(2001) Allergen-specific T cell reactivity in cord blood: the influence of maternal cytokine production.
Clin. Exp. Allergy 31(10): 1536-1543.
Litonjua A.A. (2009) Childhood asthma may be a consequence of vitamin D deficiency. Curr.
Opin. Allergy Clin. Immunol. 9(3): 202-207.
Lohmann T., Laue S., Nietzschmann U., Kapellen T. M., Lehmann I., Schroeder S., Paschke
R., Kiess W. (2002) Reduced expression of Th1-associated chemokine receptors on peripheral blood
lymphocytes at diagnosis of type 1 diabetes Diabetes 51(8): 2474-2480.
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
C.?.?????????, ?.?. ??????? ???????????? ???????? D, ?????? IgE, ????????? ? ?????? ?????? ???????
Lopez N., de Barros-Mazon S., Vilela M.M., Condino Neto A., Ribeiro J. D. (2002) Are
immunoglobulin E levels associated with early wheezing? A prospective study in Brazilian infants.
Eur. Respir. J. 20(3): 640-645.
Ohshima Y., Yasutomi M., Omata N., Yamada A., Fujisawa K., Kasuga K., Hiraoka M., Mayumi
M. (2002) Dysregulation of IL-13 production by cord blood CD4+ T cells is associated with the
subsequent development of atopic disease in infants. Pediatr. Res. 51(2): 195-200.
Peat J.K., Mihrshahi S., Kemp A.S., Marks G. B., Tovey E.R., Webb K., Mellis C.M., Leeder S.R.
(2004) Three-year outcomes of dietary fatty acid modification and house dust mite reduction in the
Childhood Asthma Prevention Study. J. Allergy Clin. Immunol. 114(4): 807-813.
Tereshchenko S., Pro?horenkov V., Novitzkiy I., Olkhovsky I., Shakina N., Isakov I., Vasilieva
L. (2007) IgE level, CD26, CD30 expression and intracellular interferon- production by cord blood
mononuclear cells as predictors of atopic dermatitis forming in infants: a one-year prospective birth
cohort study. World Allergy Organization Journal 11: S124.
Van Bever H. P. (2002) Early events in atopy. Eur. J. Pediatr. 161(10): 542-546.
Williams T.J., Jones C.A., Miles E.A., Warner J.O., Warner J.A. (2000) Fetal and neonatal IL-13
production during pregnancy and at birth and subsequent development of atopic symptoms. J. Allergy
Clin. Immunol. 105(5): 951-959.
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
C.?.?????????, ?.?. ??????? ???????????? ???????? D, ?????? IgE, ????????? ? ?????? ?????? ???????
Cord Blood Vitamin D, Total IgE, Cytokines Concentrations
and Polyunsaturated Fatty Acids Spectrum
in Newborns from Mothers
with Atopic Dermatitis History
Sergey Yu. Tereshchenkoa, Efim I. Prahina,b,
Ivan A. Novitzkiya,b, Vitaly B. Tzhaib,
Michail I. Gladyshevc,d, Nadezhda N. Sushchikc,d,
Galina S. Kalachovac, Natalya A. Shakinae,
Igor V. Isakove and Natalya N. Gorbachevaa*
a
Medical Research Institute for Northern Problems,
3g Partizana Geleznyaka, Krasnoyarsk, 660022 Russia
b
Krasnoyarsk State Medical University,
1 Partizana Geleznyaka, Krasnoyarsk 660022, Russia
c
Institute of Biophysics of Siberian Branch
of Russian Academy of Sciences,
50 Akademgorodok, Krasnoyarsk, 660036 Russia
d
Siberian Federal University,
79 Svobodny pr., Krasnoyarsk, 660041 Russia
e
Krasnoyarsk Regional Centre of Prevention
and Contest against HIV and other Infections,
45 Marks str., Krasnoyarsk, 660049 Russia 1
At the present time there is a hypothesis on the presence of congenital polyunsaturated fatty acids
(PUA) and vitamin D metabolism disturbance, which plays its role in the pathogenesis of atopic
dermatitis (AD). On the other hand, the maternal atopy may be considered as one of the important
predictor for allergic diseases in children. However, does this factor influence on Th1/Th2 balance
forming, cord blood vitamin D and PUA concentrations already on the moment of infant?s birth? We
used flow cytometry and ELISE techniques to study IFN?, IL-1 ?, IL-2, IL-4, IL-5, IL-6, IL-8, IL-10,
IL-12, TNF?, TNF?, IL-13, IL-18, IP-10, total IgE, vitamin D cord blood concentrations and mass
spectrometry method to study the content of PUA in cord blood erythrocytes. These markers were
studied in two newborns groups: the 1-st one is newborns from mothers without AD history (n=29) and
2-nd one is newborns from mothers with AD history (n=19). Statistical analysis was performed using
the Mann?Whitney U-test. In neonates from mothers with presence AD history we found decreasing
of IL-13, IL-18 cord blood concentrations and gamma-linolenic (GLA) acid percentage in cord blood
erythrocytes. Thus, maternal history of AD may influence on IL-13, IL-18 and GLA production already
on the moment of infant's birth which suggests genetic background and may be used as the early
markers of AD predisposition.
Keywords: newborn, cord blood, cytokines, vitamin D, fatty acids, erythrocyte membranes, atopic
dermatitis
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Journal of Siberian Federal University. Biology 4 (2010 3) 418-433
~~~
??? 577.332.23: 539.199
?????????? ? ?????????????:
?????????? ??? ????????? ??????
? ???????? ???????????? ????-??????
?.?. ??????a*, ?.?. ?????a,
?.?. ???????, ?.?. ???????a,?
a
????????? ??????????? ???????????,
???????? ??????????????? ???????? ? ?????????????,
?????? 660041, ??????????, ??. ?????????, 79
?
???????? ????????? ?? ???,
?????? 660036, ??????????, ?????????????, 50, ???.50 1
Received 3.12.2010, received in revised form 10.12.2010, accepted 17.12.2010
??????????? ??????????? ?????????? ??????????? ? ?????????????. ?? ??????? ???????
?????????????? ????????????? ?????????? ?? ?????????? ??????-??????????? E. coli
???????? ??????????? ???????????? ????????? ?????? ?? ??????? ???????? ?????? ?
??????? ???????????: ??????? ?????????? ??? ???????? ???????????? ? ?????? ???????;
????????? ?? ???? ??????????????? ???? ???????? ??????? ??????? ? ?????????????
???????????, ???????? ???????? (?? ?????? SDS-?????????????) ? ??????? ?? 40-45 %.
??????????????? ??????????? ????????????? ??????????? ? ???????? ?????? ????????? ??
??????? ??????????????? ????????????????? ????-??????? ?? ?????? ????????? ??????????????????? ? ???????? ?????????? ???????.
???????? ?????: ???????????????? ????????????? ??????????, ??????????????
????????????? ??????????, ????????? ?????, ?????????????, ????????????????, ???????????.
????????
????????????? ???????? ??????????????
??????????? ???????????? ??????????? ???????????? ????? ???????????? ??????? ???????? ??????? ?????, ??????????? ? ????????? ?????? ???????????? ???????? ? ?? ??????
?????????? ???????? ? ??????? ?????????
???????. ????????? ?????????????? ? ?????????????? ? ????? ???????, ??? ????????, ?????????????, ????????, ????????????, ?????*
1
???, ????? ?????????????? ?? ?????? ?? ?????
???????????? ???????. ? ???? ??????????? ?
???? ??????? ?????????? ???????????? ? ????????????? ????????? ??????-??????????
???????, ? ?????? ?????????? ???????? ? ???????? ????? ??????????? ????? (Ascencio
et al., 2005; Webster, Ahn, 2007; Marshall et al.,
2007; Ai et al., 2009; Tavera-Davila et al., 2009;
Nikitin et al., 2010; Purtov et al., 2010; Wang et
al., 2010; Lopez-Moreno et al., 2010).
Corresponding author E-mail address: roniol@mail.ru
© Siberian Federal University. All rights reserved
# 418 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????, ?.?. ?????? ?????????? ? ?????????????: ?????????? ??? ????????? ???????
??? ????????????, ?????????? ? ??????
???????, ??????????? ??????? ????? ???????????? ?????????? (??), ?????????? ??????? ?????????????? ??????? (?????? ? ??.,
1984). ? ????????? ????? ???????????? ??
???????? ???????? ?????????????? ? ??????
? ???? ?????????? ????? (????????, ?????,
???????, ????????), ?????? ????????? ?????????? ????? ?????? ??????????? ??????????
?????? (?????????, 2004). ?? ??????????
?????? ??? ?? ????????? ?????????????
??? ??????? ??????????? ?????. ????? ???,
??????-?????????? ???????? ??, ??????
????? ?????????? ?????????? ???????????
??????????? ?????????? (????????, 1994;
Krueger, 2008; Schrand et al., 2009), ?????????
?????????????? ??????????????? ?? ?????????? ? ????????????? ? ???????? ?????? ?????????? ??? ?????????? ??????????? ???????
????????? ? ??????? ???????????? ? ??????????????? ?????? ????????? ? ????????
???????? ??????? (???????, ??????, 2005;
Puzyr et al., 2007; Purtov et al., 2010).
?????? ??????? ????????, ??? ????????????? ??, ???? ??????????? ???????????,
???????? ????? ??????????? ??? ??????????????????? ??????????, ????????????? ?????? ?????????? ????????????? ??????????
? ????????????? ??????. ?????????? ?????
????????: ????????????? ????????? ?????????? ?????????? ?????????? ??? ?????????
????????????; ????????? ? ????????? ??????
???????????? ???????????? ?? ? ??????????. ?????? ?? ??????-?????????? ????????
?? ??????????? ??????????? ?????????
???? ??????????. ??????? ???????? ????????
?? ?????, ?????? ??????????? ???????????
??????????.
???????? ?????? ??????????? ??????????, ??????????? ???????? ?? ???????????,
???????????? ? ??????, ????????????????
?????????? (???), ??????? ???????? ????-
?????? ?????????? ????????????? ? ????????????? ?????? ? ?? ????? ??????? ???????? (???????, ??????, 2004; ??????, ???????,
2005; Puzyr et al., 2005; ?????? ? ??., 2007).
? ?????????? ????????? ????????????? ???? ????????, ??? ??? ????? ??????????? ??? ?????????????????? ?????????
??? ????????-????????? ? ??????? ??????? ?????? ?? ?????????????? ??????????
? ????????? ???????? (???????, ??????,
2000; ??????? ? ??., 2004) ? ?????????????? ??????? ???????? ??????????, ???????????? ????????????? ??????? (???????,
??????, 2005; Puzyr et al., 2007). ?? ?????
????????????? ???????????? ??????????
??? ? ????????????? ???????? ?????????? ?? ?? ?????? ????? ??????? ????????? ?
??????????? (????-???????, ???????). ?????
???? ???????????, ??? ????????, ??????????????? ?? ???????????, ????????? ????
?????????????? ??????? (?????? ? ??.,
2001; ?????? ? ??., 2004). ??? ??????? ???????????? ??? ?????????? ??? ? ??????????????? ???????????? ?????? (???????
?????????????????), ? ??????? ?????????
????????? ???????? ???????? ??????????? ? ????????? ????? (?????) (Puzyr et al.,
2007; ??????? ? ??., 2008). ? ?????????, ?????? ???????-????????? ????? ????????
??????????????? ????? (???????????? ?
??????????), ????????? ? ???????? ?????? ???????????????? ???????????? ??????
????? ? ??????? ????????? ???????.
? ???????????? ?????? ????????? ??????????? ?????????????? ????????? ??????
?? ??????? ???????? ?????? ? ??????? ???
?? ??????? ??????? ?????????????? ?????????? ?? ?????????? ??????-??????????? E.
coli ? ?????? ? ??????????????? ??????????????? ???????????? ??????? ?????????????
???????? ? ?????????????? ????????? ????????????? ? ?????????? ???????.
# 419 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????, ?.?. ?????? ?????????? ? ?????????????: ?????????? ??? ????????? ???????
????????? ? ??????
???????????? ????????? ? ?????????????? ???, ?????????? ??????? ?????????? ????????????? ? ????????????? ??????
? ??????? ??????? ????????? 30 ? 125 ??.
???????????? ??????????? ????????? ???
? ?? ??????-?????????? ???????? ????????
???? ? ?????????? ??????? (???????, ??????, 2004; ??????, ???????, 2005; Puzyr et
al., 2005; ?????? ? ??., 2007). ??? ????????????? ???????????? ????????? ? ????????????? ??? 10,0 ?/?, ??????? ????????
??????????? ?????????????? ???? ? ???????
??????? ??????????. ?????????????? ????
???????? ? ??????? Milli-Q system (Millipore, ???).
? ????????????? ???????????? ????????: ???? (????-(?????????????)-??????????),
???-????-??????, ??? (Sigma Chemical Co.,
???), ?????????? ??????? Sepharose 4B
(Pharmacia Fine Chemicals, ???); ??Cl2
(Serva, ????????), D-??????? (??????, ??????) ???????????? «???».
??? ????????? ?????????? ?????????
????????????? ?????? Escherichia coli ??????????????? ??????-?????????? Z905 ??
????????? ??? ?? ???, ?????????? ???????? pPHL7 ? ?????? ????????????? ?????????????? ??????? Photobacterium leiognathi
(??????????, ???????????, 1987; ??????????, ????????, 1997). ???????? ????????
????????, ?????????? ???????? ?????????????? ??????? (??????? ??????????), ???????? ????????? ???????. ???????? ????????????? ?????? ???????????????? ? 5 ??
????-HCl ?????? (?? 7,0) ? ??????????? 1:10
(?????:?????). ?????? ????????? ?????????????? ?????????? ?????????? ????????? ??
??????? ????, ????????? ?????????????? ????????????? UD-20 (Techpan, ??????) (?????
?????????: 22 ???, 5 ??? ?? 20 ? ? ??????????? 1 ???), ????? ???? ????????? ?????? ???-
???? ?????????????????? ? ??????? ?????????? Avanti® J-E (Beckman Coulter, ???)
(??????? ?????????: ????? JA14, ???????????
4 °?, ???????????? ????????? 31000 g, ?????
14 ???, ????????? ? ?????????? ?????????).
??? ????????? ?????????????????
?????????? ?????????? ???????????? ?????????? (?????? ??? 8801) ????????????
???? «?????» (??????????, ??????), ????????????? ?? ?????????????? ?????????
?????????-??????. ???? ??????????????
??????? ?????????? 108 ??????? ? 1 ?. ?????????????? ??????? ?????????????? ? ??????? ????????? (?????? 2210) ????? «LKB»
(??????).
?????????? ?????????? ??????????? ?
??????? ???????????????????? ??? (??????? ? ??., 1988). ??????????? ????? ????????:
450 ??? 20 ?? ?????????? ?????? (?? 7.0); 50
??? 4.7·10 -6 ? ?????????????; 1?5 ??? ???????????? ????????? (???????? ????????, ?????????? ??????????; ?????????, ?????????? ????????? ??????????-??????????) ???
?????????????? ????-???????, ??????????
?? ?????? ????????? ?????????-??????????
? ?????????? ???????. ??????? ????????? ????????????? ? ?????? 500 ??? 7.8·10 -5
? ???????????????????? ???. ??? ??????
??????? ??????? ???????? ??????? ?? ?????????? ? ???????????? ?????????? ????? (???????????? ??????? ? ???????, ???????? ?
?????? ?????????? ???????????-??????????)
??? ????????? ???????????????? ???????????? ?????? ? ??????????? ?????????
??: ????-HCl, ???-????-?????????? (???),
Na-????????? (NaAc), ???????-?????????
(A????).
??????? ? ???????? ???????? ???(?)
?:???-??????????????? ????????? ?????
?????????: ?? ????????????????? ???????
???????????? ??????? ????????????????????????? (???????? ? ??., 1984), ?????-
# 420 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????, ?.?. ?????? ?????????? ? ?????????????: ?????????? ??? ????????? ???????
??? ?????????? ??? 8801, ? ???????????
?????????????????????? ??????? ????????? ???(?)(?)-????????? ????????? (???????, 1981) ??? ? = 340 ?? ? ??????? UV/
VIS ???????????????? UVIKON 943 (Kontron
Instruments, ??????). ? ?????? ?????? ??????????? ????? ????????: 450 ??? 20 ??
?????????? ?????? (?? 7.0), 10 ??? 4.7·10 -6 ?
?????????????, 10 ??? 7.8·10 -5 ? ???, 5-50
??? ???????????? ???????. ?????? ???????
???????????? ??????????? 5 ??? 10 -2 ?
???(?)?. ??? ?????????????????????? ????????? ?????????? ??????????????? ??????????? ????? (????? ????? 1 ??) ?????????: 20 ?? ????????? ????? (?? 7.0), 10 ???
10 -2 ? ???? (??? ?????), 10?100 ??? ???????????? ???????. ??????? ????????????
??????????? 10 ??? 10 -2 ? ???.
????????????????? ?????????? ?????
? ???????? ? ? ??????? ???????????? ?????????? ????????? ??? ????????? ????????
? ?????????? (TB-85 Thermo Batch, Shimadzu,
??????) ??? ??????????? 36 °?.
???????? ???-?????????? ????????
??? ????????? ???????? ?? ?????????? ????????????? ?????? E. coli ? ??????? ??????????? ? ?????? ? ??????????? 5 %-? D-???????.
??? ???? ? ???????? ????????? ??????, ?????????? ???????? ???-??????????, ?????
??????? ????? ???????? ? ?????? ???????????????? ? 5 %-? ???????? D-???????.
????????
???-??????(Ca-??????)?????????? ???????? ????????? ????????.
? ????????? ??? ??? ?????????? ????????????? ???????????? ????????? ??????
?????? ????????? ?????????? ??????? ?
?????????? ?????? ? ???????????? ???????????? ??? ??????????? ????????? ?????????, ? ??????? ??????? ?????????? ???????????? ? ???????? ??????????? ???????.
????? ????? ??????? ??????????? ?????????
???-?????? ???????? ????????????????-
?? ? ?????? ???????? ?????, ?????? ???
????????????? ?? ? ??????? ??????????????????. ? ???????? ???????????????????
????????? ???-?????? ????????? ???????
????????? ?????????. ??????? ? ??????????????? ?????? ???????? ??????????????????, ?????????? ?????? ????????? ??? ???????? ???????? ?????????????????? ?????
? ?????????? ???????? ? ????????? ?????????, ????????????? ??????? ? ???????? 5 %-?
D-???????.
??????????????? ???????????? ??????????? ????????? ?? ????????? ?????. ??
?????????? ???????? (????????? ???????? ? ???????? ????????? 1,5 ??) ???????? ????????????? ?????? ???? ??????????
???????, ?????????????? ???????? ? 5 %-?
???????? D-???????. ??? ????? ???????? ?
????????????? ??????????? ???? ?? ???????? ?? ???????? ? ??????, ??????? «?????????????» ????? ???? ?? ????. ??? ????????????
??????? ??????????? ???? ???????? ????????? ?? ??????? ??? ????????? ???????????
? ??????? 2-3 ???. ?? ??????????? ??????
????????, ?????????? ????????????? ???????, ???????? ?? 15 ??? ? 5 %-? ???????
D-??????? ? ?????????????????? ???????????? ?????????? (???-??????????,
???-??????-??????????).
?????????? ? ??????????
1. ????????????? ?????????
?????????? ? ??????
? ??????? ???
????? ??????? ???????? ????????, ????????????? ? ???????????????? ? ???? ????????????, ???????? ????????? ??????. ?
????????? ????????? ????????? ?? ????????
????????????? ?????? ????????? ?????????
??? ? ??????????? 1:1 (?????:?????) ? ????? ????????????? ????????? ? ??????? 5
??? ??????????? ? ??????????????? ??????
# 421 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????, ?.?. ?????? ?????????? ? ?????????????: ?????????? ??? ????????? ???????
??????? 1. ????????????? ?????????? ?????????? ?? ??????? ????????? ???????? ? ?????? ? ???????
???
??????
???????? ????????
????? ???????
(??)
????????
??????????
????????
(???.??./??)
?????
??????????
????????
(???.??.)
????? ????????
???????? ( %)
100
66,0 ? 105
66,0 ? 107
100
200
2,0 ? 103
4,0 ? 105
0,06
??????????? ????? ?????????
????????? ????????? ???
????????? ???????? ??????
??? ? ???????????????
??????
????????? ????? ????????
400
8,0 ? 103
32,0 ? 105
0,48
1100
25,3 ? 10
4
27,8 ? 107
42,06
????????? ??? ? ??????
????????? ?????????
200
51,0 ? 104
10,2 ? 107
15,45
???????? ??????????????????. ??? ?????
??????? ????????? ??? ? ????????? ?????
?????????????????? ????????? ?????? ?????? ?? ???????????? 100?120 ??. ?????????? ?????? ?????? ???????? ????????? 5 ?? ???? ? ??????????? ?????? ???
???????????????? ? ?????? ?????? ???????????? ???????? ?, ????? ?????????? NaCl
? ????????? ???? ????????????, ????????
??????????????????. ??????????? ??????
????????? ???????? ????? ???????? ???????????????? ?????? (?????????) ?????????? ?
??????????? ?????????? 50 ?? ?????????
??????? (?? 7,0), ?????????? 5 ?? ????.
??? ?????????????? ????????? ???????? ???????? ???? ???????????? 100 ?? ????????? ?????????, ??????????? 530 ?? ?????????? (?????? ?????????? ??????????
????????? ?? ????????????? ???????????
????????????? ????????????? ?? ?????????? ??????? ????????). ??? ???????? ???????????? (????. 1), ??? ????????????????
???????? (??????????? ??????? ????????? ?
?????????, ???????????? ???????? ???????)
????????? ????????? ????????? ??? ?????????????? ??????????? ?????? ??????????
?????????? ? ?????????? ?????????? ???????? ? ???????????? ?????????? ?? ????? 0,06 %
????????. ??????????? ?????????? ???????
?????? ????????? 5 ?? ???? ? ???????????
100?120 ?? NaCl (?? 200 ?? ?????? ???) ??
???????? ? ????????? ???????? ? ??????????
? ????????? ?????? ??????? ?????????? ??
????? 0,5 % ????????. ?????????? ?? ??????????? ?????? ??????? ???????????? ????????? ?????? 50 ?? ????????? ??????? (??
100?200 ??) ????????? ?????????? ? ??????????? ?????????? ????? 40 % ???????? ???????? (????. 1). ???????, ????????????? ??
?????? ????. 1, ??????????, ??? ??????????
??????????, ?????????? ??? ?? ?????????
? ??????? ???, ?????????? 223 ??. ?? ?????? SDS-????????????? (???. 1), ??????????
??????? ????? ????? ??????? ??????? ???????.
?????????? ?????? (????. 1) ?????????
????????? ????????????? ? ??????? ???? ????????? ?????????? ?????????????? ???????
?????????? ? ???????????? ???: ?) ????????? ?????????? ???????? ? ??????????? ???
?????????? ? ???????????? ???????????
????????? (????? 40 % ???????); ?) ???????,
???????? ?????????????, ?????????? ? ??????? ?????????? (????? 40?45 % ???????); ?)
??????? ?????????? ???????? ? ???????????
??? ?????????????? ??????? (????? 15 % ??-
# 422 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????, ?.?. ?????? ?????????? ? ?????????????: ?????????? ??? ????????? ???????
???. 1. ????????????????? ???????? ?????????? ??? ????????????? ?? ????????? ? ??????
? ??????? ???. ?? ??????: 1 ? ???????? ????????; 2 ? ??????????? ????? ????????? ?????????
????????????; 3 ? ???????? ?????? ?????????? ? ???????????????? ???????; 4 ? ???????? ????????
???????? (?????)
?????). ? ?????? ?????????? ???????? ?????????????? ??????????????? ??? ????, ??? ????
????? ???????????? ?????? ????? ?????????? ???????? ?????? ????????? ? ????????????
??? ? ??? ???? ??????? ????????? ???? ?????????? ? ??? ?????????? ??????? ?????????
?????????? ? ????????? ?????, ???????????
? ????????????? ??????, ? ??????? ???????
??????????? ???????? ??????????????????
???????. ?? ????? ???????, ??? ??????????? ?
?????????? ???????? ???????? ???????? ????????? ??????????? ????????? ???????????????????, ??????? ????? ??????????????
??? ???????? ???????????? ????-??????.
?????????? ????????, ??? ? ?????????? ???????? ????????? ??????????
?? ???????????????? ?????????? ???(?)
?:???-??????????????? ??? ????????????
???????????? ????????????????? ???????? ? ?????????????????????? ???????,
??? ??????????????? ?? ?????????? ???????? ??????? ???????? ? ??????? ????????.
??????????????? ?????????????? ????
???????????, ??? ? ???????? ????????????
??????????, ????????????? ??? ?????????
?????????? (??????, ?????????? ? ?? ???????? ???????), ??????????????? ?? ?????????-
???? ?? ??????????? ??? ? ????????? ?????? ? ??????????? ????????? ????????? ??
??????? ????????? ????????????? ?????????
????????? ? ??????????? ???????? ??????
??? ? ???????????????? ???????. ??? ????? ?? ?????????????? ?????? (???. 2), ?????
????????? ?????????? ??????????????????
??????????? ??? ?????????? ???????? ?????????????? ? ????????????. ??????????????
?????????? ??????????????? ?????????? ?
???????? 5 ?? ????, ??????????? ??? ???????? ?????? ?????????? (???. 2). ???? ???????? ?????, ??? ?????????? ?? ????? ?????????? ?????????????, ???????????? ? ???????
????????? ????????? (??????????? ???????
????????? ? ????????? ??? ? 1:1.5), ? ????????? ??????? ??? ? ????????, ??? ???????????? ?????????????, ?? ???????? ? ????????? ???????????????. ?????? ?? ????? ?????
??????? ????? ? ???, ??? ????? ???????, ?????????? ?? ?????????? ???, ????????? ????????? ????????? ??? ???????? (??????????
? ???(?)?:???-???????????????), ???????? ? ?????? ???????????? ??????????????
??????? (????????? ? ??., 1984; ???????? ?
??., 1984). ? ???? ???????, ??? ????? ??????
???????????? ????????, ????????? ??????? ?
# 423 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????, ?.?. ?????? ?????????? ? ?????????????: ?????????? ??? ????????? ???????
???. 2. ???????? ?????????? ????????? (? = 340), ?????????????? ??? ????????? ?????????? ???(?)
?:???-??????????????? ? ???????? ?? ?????? ????????? ?????????? ? ??????? ???
?????????? ?????????? ???????? ???(?)
?:???-??????????????? ????? ??????? ??
???????? ??? ????????????? ?????????? ?
??????? ????????? ??? ?????????????????
???????????? ????????? ?????? ??????????????.
????? ???????, ? ???? ??????? ???????????? ?? ??????? ??????? ??????????
?????????????????? ??????????? ????????????? ?????????? ??? ? ???????? ?????????? ??? ???????????? ????????? ???????
?????? ??????? ? ?????? ?? ?????? ???????? ?????? ? ????????? ??????? ?????????
??????? ??????? ??????? ? ?????????????
???????????. ????????, ??? ??????? ???????
???????? ? ??????? ??? ?????????? ?????,
???????? ????????? ?????????? ???????? ?
?????????????? ? ?????????????? ????????
????????????.
2. ????????????? ???
? ???????? ?????????????????
???????????? ????-???????
??????????? ???????? ?????????? ???????? (???????? ???-??????????) ??? ???
???????????? ????????????? ??? ??????????????? ???????????? ????-??????? ????-
???????? ?? ????????? ?????? ??????????
?????????????? ??????? ?????????, ??????????????? ?? ??????????? ??? (??????
? ??., 2001; ?????? ? ??., 2004; Puzyr et al.,
2007), ? ???????????, ?????????? ? ??????
??????. ??? ???? ?????????? ????????, ???
?????? ????????????? ??????????? ????????????? ?????? ?????????? ????? (????????,
????????) ? ??????????????? ? ???????? ?????? ????????? ????????? ? ??????????????
???????????? ??????? ??????? ?? ? ????? ???
?????????? ? ????????? (????????, ????????????). ?????? ?? ????? ?????????????? ???
???????? ????????????? ?????? ??????????
?????????? ? ???????? (????????) ? ????? ??
????????? ?? ??????????? ??????????? (???????? ???-??????????).
????????? ???? ???? ????????, ??? ? ???????? ????????? ?????????? ?? ??????????
?????? E. coli ? ??????? ??? ????? ???????? ????? ?????? ??????????? ? ?????????????
? ????????? ??? ???? ???? ??????????????
???????, ???????? ???-?????????? ???
??? ?????????? ? ??????????????? ?????????????? ????-??????? ???????? ?? ???????????????? ?????????????? ????? ???????
????????. ?????? ? ???? ?????? ??? ??????
# 424 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????, ?.?. ?????? ?????????? ? ?????????????: ?????????? ??? ????????? ???????
???. 3. ?????????? ?????????? ? ???????? ? ? ??????? ???????????? ?????????? ? ??????????? ??
??????? ????????? ??? ??????????? 36 °?
????????? ????? ???????????? ? 5 %-? ???????? D-???????. ?????????? D-???????
?????????????? ??????????????, ?????????
????????, ??? ???????? ????? ????????? ???????? ???????? ?? ?????, ????????, ??? ??
????????, ????????????? ? ?????????? ??????????? (???????, ??????, 2000; ?????,
2009). ?????? ???, ?????????? ?? ??????????? ?????? ??????? ?????????? (?????
???????????? ?????? ?????) ? ??????????
??????????? ? ?????? ????????? ?????????
(?????????? ???????? ???-??????????), ???????????????? ? 5 %-? ???????? D-???????
? ???????????? ? ??????. ?????????????
??????? ??????????? ????????? ??????????
???????? ?? ?????? ??????????????? ?????????? (???-??????) ? ??????????. ???????? ?????? ???????? ?????????????? ??????
???????????, ????????? ????????, ??? ??????? ??????? ??????? (??????) ????????? ?
???????? ?????????? ??? ????????? ????????????? ?????????? (??????? ? ??., 1988).
????????, ??? ??? ???????????? ????????????? ????-??????? ?????, ????????
? ?? ??????, ????? ?????????? ????? ????-
?????? ? ???????? ????????? ???????????
? ????????????? ??????????? ????????????
??????????? ?????????? ??????????? ??????????? ?????. ? ????? ?????? ??? ?????
??????????? ??? ????????? ??????????????
??????? ????????????? ? ??????????? ?????
???????????????????? ???, ??????????????
???????? ?????????????? ??? ????????? ???????? ?????? ???????????. ??????? ?????
?????, ????? ??????? ????????????? ?????? ?????? ?? ?????????? ??????????. ???
????????? ????? ??????? ???? ?????????
????????????? ???????????? ????????????????? ????????, ???????????? ? ???????? ?
? ??????? ???????????? ?????????? (????????????? ? ???-??????-??????????). ?
???? ????? ??????? ???????????? ?????????? (??? ???????????? ??????????) ???????????? ? ?????????? ??? ??????????? 36 °C,
????? ?????? ????????? ??????? ?? ??? ???????? ?????? ?? ?????? ???????? ? ????????? ????????? ?????????? ????????.
?? ?????????? ?????? ??????? (???. 3),
??? ??????????, ??????????????? ?? ??????????? ??????????, ???????? ???????????
# 425 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????, ?.?. ?????? ?????????? ? ?????????????: ?????????? ??? ????????? ???????
???. 4. ?????????? ?????????? ? ???????? ? ? ??????? ???????????? ?????????? ??? ?????????????
??? ????????? ????????? ???????? ?????? ? ??????????? ????????? ??
??????? ??????????????????, ?? ?????????
? ?????????, ??????????? ? ????????. ?
????? ???????, ??? ?????????? ?????? ??????????? ? ?????????????? ???????????????
? ???, ??? ?????, ??????????????? ?? ??????????? ????????, ????? ??????????? ? ??????????? ????????? ???????????? ????????
(???????????????? ????????, ???????????,
?????? ? ?? ?????, ? ?.?.). ? ?????? ? ????????? ??????? ????? ? ???, ??? ??? ????????
?????????????? ????-??????? ????????????? ???????? ? ?????????????? ??????????
????????????? ??????????????? ?????????
???????? ?? ??????? ???.
????????? ?????? ???????? ??????? ????? ????????? ??????? ?? ?????????? ????????, ?????????????? ?????????????? ????????????? ?????? ?????????? ?????????? ?
???????? ? ????? ?? ????????? ?? ???????????
?????????? (????????? ???-?????????? ?
???-??????-??????????) ??? ????????????? ?????? ???????? ??????. ??? ????? ???????????? ????????? ???????? ??????? ?
??????????? ????????? ??: ????-HCl, ?T?,
A???? ? NaAc, ? ????? ????????? ?????,
??????? ??????? ???????????.
??? ????? ?? ?????????????? ??????
(???. 4), ?? ???? ??????? ?????? ??????????
?????? ?? ?????? ???????? ??????? ???????? ? ???????? ?????????? ??????????. ?????? ???????, ??????????????? ?? ????????
???, ??????????? ?? ???? ??????? ????????
??????? ??????????? ? ?????????????? ???????? ????????, ?? ????????? ? ?????????
? ????????. ? ?? ?? ????? ???????, ??????????????? ?? ??????? ???????????????? ????????????? (???-??????), ???????? ?????
???????? ?? ????????? ??? ? ????????????
?????????, ??? ? ???????? ? ?????? ????????? ???-?????????? (???. 4).
??? ??????????????? ????????????
????-??????? ? ???????? ?????????? ???????
???? ???????????? Sepharose 4B. ??????????
??????? ????? ???????? ????? ????????, ??????? ??????????? ?? ???????????? ??????
????, ??????? ??? ?????????? ???????? ??????? ???????? ? ?????????? ???????? ? ?????
??????????? ?????? ???????????? ?? ?? ??-
# 426 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????, ?.?. ?????? ?????????? ? ?????????????: ?????????? ??? ????????? ???????
???. 5. ????? ????? ??????????????? ???????????? ????-??????? ?? ?????? ????????? ???-??????????
? ?????????? ???????
?????????. ???????? ???????? ? ????????????? ?????????????? ?? ??????????? ???????
????????????? ????????????? ????????? ?
?????????? ???????, ???????? ?????????? ?
???????????? ???????? ? ?????????? ????????????.
? ????????????? ???? ???????????, ???
??????????? ????-??????? ? ???? ??????????? ??????? (??????? 1,5 ??) ???????? ???????? ??????? ??? ???????????? ????????????,
???????? ??????????? ??????????? ?????????
??????????? ??? 8801. ??????????????????
?????? ??????????????? ????? ????-??????? ?
?? ??? ???????????? ?? ????? (???. 5). ??? ???????????? ????????????? ??????????????
???????? ????-??????? ???????? ? ??????
???????????, ?????????? ?????????????
?????, ? ???????? ??????????? ????????????
????????? ??????? ??????????????. ?????
??????????? ????????? ??????? ????-???????
????????? ?? ??????, ????????? ??????
???? ??? ???????? ????????? ??????? ? ?????
?????????? ??? ?????????.
??????????? ??????? ????????? ?????????? ????? ?? ??????????? ? ????????
??????????? ????????? ???-??????????
? ?????????? ??????? ????????? ???????
????????????????? ???????????? ???????????, ?????? ??????????? ???????????
(?? 40 ? ????? ???) ???????????? ?? ? ?????????????? ???????????? (???. 6). ??? ??????? ?? ???????? ?????????????? ????????,
?????????????? ??? ???????????? ????????????? ????????????????? ????-???????, ?????????? ?????? ????????????????? ????????? ? ??? ???? ?????????????? ??????????.
?? ??????????? ?????? ?????, ??? ??? ?????? ????? ?????????? ????????????? ????????????? ? ??????? ?????????? ????????
????? 9 ???. ??., ????? ???? ??? ????????? ?
??????? ?? ?????????? ?????????? ???????
(? ??????? ????? 4 ???. ??.) ??? ???????????
30 ??????????.
??? ????, ??? ????????????? ????????
?? ????? ??????????? ?????????? ???????,
? ??????? ?? ????? ? ?????????? ?? ?????????????, ????? ????????????????? ??? ? ????????? ????? ????? ?? ????-???????, ??? ?
??? ????????? ??????????? ??? ?????????
????????? ??????????? ??????????? ?????
????? ????????????? ???????????? ???????????????????? ???. ?????????? ?????????? (???. 6) ????????? ??????? ??? ?????????????, ??????????? ??????????? ??????.
# 427 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????, ?.?. ?????? ?????????? ? ?????????????: ?????????? ??? ????????? ???????
???. 6. ???????? ????????????? ?????????????? ???????? ??? ???????????? ????????????? ???????????, ????????? ? ??????????? ????????? ???-?????????? ? ?????????? ???????
??-??????, ????? ????????? ???????????
????????????? ???? ????? ??????? ?????????????? ??????????: ??????????????, ?????? ???????????? ?????????????? ?????????? ??? ????????? ??????? ???????????;
??????????????? ? ????? ?????????? ? ??????? ???????????? ? ?????????? ????? ??????????? ???? ?????????????? ???????. ????????, ?????? ?????????, ??? ??? ?????????
?????????????? ??????? ????? ???????????
??????????????? ????????? ??????? ??????????, ???????? ??????? ?? ????? ??????????? (???????????????) ????????? ? ?????
?????????? ? ???????????????.
???????? ??????????? ?????? ?????????
? ??????? ??????????????? ??????????????
?????????? ????-??????? ? ????? ??????????? ?????????????? ??????? ????????.
?????????????????? ???????? ???? ?????.
????-??????? ??????? ???????? ? ??????
??????????? ? ????????? ??????????? ????????? ????????????? ????????????? ???
??????????? ????????? ?????????? ?????????? ?????. ????? ????-??????? ????????? ??
?????? ? ????? ??????? ????? ?? ?????????
??????? ???????? ?? 15 ? ? ?????? ? ?????,
???????? ?? 45 °?, ????? ???? ?? ?????????
?????? ???????? ???? ? ????? ????????????
??? ????????? ??????????. ? ?????????? ??????????? ???????????? ???? ????????, ???
????? ??????????????? ?????????????? ??????????? (???. 7) ????????????? ?? ?????????????? ???????? ??????????? ??????????
?????????? ??????? (? ??????? ????? 4 ???.
??.), ??? ????? ????????????????? ? ??????
????????????? ? ??????? ???? ????? ??????? (??? ???? ??????????????? ?????????)
?????????????? ??????????.
??????? ????????, ??? ??????????? ?????????? ???? ???????? ? ??? ?????? ? ????????????, ??????? ???? ??????????????? ? ?????????????? ??????????????? ??????????
???-??????. ??? ????? ?? ?????????? ?????? (???. 8), ???????? ?????????????? ????????, ?????????????? ????? ???????????????
?????????????? ????-??????? ? ?????????
????????? ???-??????-??????????, ??? ?
? ?????? ????????????? ?????????? ??????????? (??. ????), ????? ???????????? ?????????? ??????? ? ????????? ?????????? ?
?? ????????. ??? ???? ?????, ??? ??? ????????????? ?????? ????-??????? ????????
# 428 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????, ?.?. ?????? ?????????? ? ?????????????: ?????????? ??? ????????? ???????
???. 7. ????????????? ???????? ????-??????? ?? (?????? ?????????) ? ????? ?????????????? ??? 45 °C
(????????? 2 ? 14)
???. 8. ???????? ????????????? ?????????????? ????????, ?????????????? ??? ????????????
????????????? ????-??????? ? ???????????? ????????? ???-??????-?????????? ????? ??
?????????????? ??? 45 °C
?????????????? ?????????????? ????????
?????????? ? ??????? ????? 4.5 ???. ??. ? ????? ????? ?? ???????, ??? ? ??? ?????????????
????-??????? ? ???????????? ?????????
???-?????????? (???. 7).
????????, ??? ????????? ??????? ?
????????????? ???? ????? ??????? ?????-
????????? ?????????? (??? ?????????
??????????????? ?????????? ??????? ???????? ??? ????????? ???????????) ???????
??????????????? ????????????.
? ?????, ?????????? ?????????????, ?????????? ????, ?? ?????? ????????? ????????????? ? ????????? ????????? ??????
# 429 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????, ?.?. ?????? ?????????? ? ?????????????: ?????????? ??? ????????? ???????
??????????
???????????? ????????? ??????? ??????
??????? ? ?????? ?? ?????? ???????? ??????
? ????????? ??????? ????????? ??????? ??????? ??????? ? ????????????? ???????????.
????????, ??? ??????? ??????? ???????? ?
??????? ??? ?????????? ?????, ?????????? ? ?????????????? ???????? ????????????
? ????????? ?? ???? ??????????????? ????
??????????? ?????? ?????????? ?????????,
???????? ? ?????? ???????????????? ????????????? ????????? ?????????? ? ???(?)
?:???-???????????????.
????????????
????? ???????? ?????????? ?????????? ?
???????????? ??? ??? ?????????? ?????????? ???????? ??????? ??????????? ??????????? ???????????? ????????? ?????????????????? ????? ? ??? ?????????? ?
??????????????? ???????????? ????-??????.
??????????? ??????? ????????? ????????
?? ??????? ??? ? ???????? ???????????
????????? ? ?????????? ??????? ?????????
??????? ?????????? ??????????????? ???????, ??????? ????? ??????????? (?? 40 ? ????? ???) ???????????? ? ?????????????????
????? ???????, ?? ??????? ??????? ?????????????? ????????????? ??????????
?????????????????? ??????????? ?????????? ?????? ??? ? ???????? ?????????? ???
????????????. ? ????? ?????????? ??????????? ???????????? ?????????? ???????????
?????????? ?????????? ??? ??? ????????????? ??????????????????? ??????????.
????????????? ?????????, ?? ? ????? ??????????? ??? ???????? ???????????? ?????????? ?? ?????? ???? ?????????.
?????????????? ???? ?????? ???????
?????????????? ???????????? ???????????
????????? ????-??????? ?? ?????? ????????? ???-?????????? ? ?????????? ???????
? ????? ????. ? ???? ????? ?????????? ??????? ????????? ????? ???????????? ???????
????? ???????? ?? ??? ???? ????????? ?????
?????? ? ??????????? ?????????? ????????
??????? ???????????? ?? ???????. ?? ?????? ??????????????? ????????????? ???????, ??? ????? ????????? ?? ???????? ?????? ?
??????????? ??????????? ?????????? ?????,
????????? ? ?????? ???????. ???????? ??????????????? ??????????, ?????????????????
? ?????? ????, ??? ?????????? ????????????
??????? ????? ????????? ??? 4 °? ? ????????? ?????????????? ?????????????? ???????
??? ???????????? ????????? ??????? ??????????????????? ???.
?????? ??????????
??????? ?.?., ???????? ?.?., ???????? ?.?., ????????? ?.?., ???????? ?.?. (1988) ????????? ????????? ????????????? ?????????? ??? ?????????????????? ???????. ??????????
???????? ? ?????????????. 24: 745-753.
??????? ?.?., ?????????? ?.?., ?????? ?.?. (2004) ?????????? ??????????? ??? ?????????? ? ??????? ??????. ?????? ???????? ????. 46 (4): 737-739.
??????? ?.?., ?????? ?.?. (2004) ?????????? ??? ????????????? ????????????. ??????
???????? ????. 46 (4): 698-701.
??????? ?.?., ?????? ?.?. (2005) ??????????? ? ??????????? ???????? ????? ?????????????? ?? ?????? ?????? ????????????? ???????????: ??????-????????????? ? ???????????
???????. ??????????? ?? ?????????????? ??????????. 4: 80-94.
??????? ?.?., ?????? ?.?., ?????? ?.?., ????????? ?.?., ??????????? ?.?., ????????? ?.?. (2008) ?????????? ? ????????????? ??????????: ?????????? ? ???????? ? ??????# 430 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????, ?.?. ?????? ?????????? ? ?????????????: ?????????? ??? ????????? ???????
??. ?: ??????? ??????? ???????? ??????-??????????????? ?????? ?????????????? ?????? ??
???????????????. 2. ?., ?.90-92.
????????? ?.?., ???????? ?.?., ????????? ?.?. ? ??. (1984) ?????????? ???????? (??????????? ?.?., ???.). ???????????: ?????, 277 ?..
????????? ?.?. (2004) ?? ??????? ???????? ??????? ???????????. ?????? ???????? ????.
46 (4): 581-584.
?????????? ?.?., ??????????? ?.?. (1987) ???????????? ? ?????????? ????? ?????????????? ??????? Photobacterium leiognathi. ???????????? ????????, ????????????? ? ???????????. 8: 41-46.
?????????? ?.?., ???????? ?.?. (1997) ????? ???????? Escherichia coli ? ????????? ????????????? ??????????. ?????? ?? ?2073714, ?????. 02.20.1997..
??????? ?.?., ?????? ?.?.?. (2000) ?????? ???????????? ???????????, ??????? ????????? ?????????? ??????????? ? ??????????. ?????? ?? ?2143889, ?????. 10.01.2000..
??????? ?.?. (1981) ???????????? ??????????? ?? ???????????. ?.: ?????? ?????, 272 ?..
???????? ?.?., ???????? ?.?., ????????? ?.?., ??? ?.?., ???????? ?.?. (1984) ???????????? ??????? NADH:FMN-??????????????? ? ?????????? ?? ?????????? ????????. ????????. 49 (4): 699-709.
?????? ?.?., ?????????? ?.?., ??????? ?.?. (2004) ???????? ??????????????? ???????
? ?????????????? ??????????? ? ????????????? ??????????. ?????? ???????? ????. 46 (4):
740-742.
?????? ?.?., ??????? ?.?. (2005) ?????? ????????? ??????????? ????????? ??????? ? ?????????? ?????????? ?????????????. ?????? ?? ?2252192, ?????. 20.05.2005 ???. ? 14..
?????? ?.?., ???????? ?.?., ??????? ?.?., ?????????? ?.?. (2007) ????????????? ???????????????? ???????? ? ?????? ?? ?????????. ?????? ?? ?2306258, ?????. 20.09.2007 ???.
?26.
?????? ?.?., ??????? ?.?., ?????? ?.?. (2001) ???????? ??????????????? ????????? ??
?????? ?????????? ? ??????? ?? ????????? ????????. ??????? ???. 380 (3): 411-414.
?????? ?.?., ???????? ?.?., ?????? ?.?., ?????? ?.?. (1984) ???????????????? ????????
???????, ?????????? ? ?????????????? ??????? ??????. ?????? ??????? ? ??????. 20: 100104.
????? ?.?. (2009) ????????????????? ???????????? ??????????? ?? ?????? ??2+????????????? ???????????? ???????. ???????. ????. ????. ????. ????, ???, ???. ???-?, ??-?
?????????. ??????????: ??-? ?????? ?? ???, 41?..
???????? ?.?. (1994) ???????????? ????????????? ??????? ???????????????? ???????.
?????????? ??????. 56: 266-268.
Ai K., Liu Y., Lu L. (2009) Hydrogen-bonding recognition-induced color change of gold nanoparticles for visual detection of melamine in raw milk and infant formula. J. Am. Chem. Soc. 131:
9496-9497.
Ascencio J.A., Rincon A.C., Canizal G. (2005) Synthesis and theoretical analysis of samarium
nanoparticles: perspectives in nuclear medicine. J. Phys. Chem. B. 109: 8806-8812.
Krueger A. (2008) The structure and reactivity of nanoscale diamond. J. Mater. Chem. 18: 14851492.
# 431 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????, ?.?. ?????? ?????????? ? ?????????????: ?????????? ??? ????????? ???????
Lopez-Moreno M.L., de la Rosa G., Hernandez-Viezcas J.A., Peralta-Videa J.R., Gardea-Torresdey J.L. (2010) X-ray absorption spectroscopy (XAS) corroboration of the uptake and storage of
CeO(2) nanoparticles and assessment of their differential toxicity in four edible plant species. J. Agr.
Food Chem. 58: 3689-3693.
Marshall A.T., Haverkamp R.G., Davies C.E., Parsons J.G., Gardea-Torresdey J.L., van Agterveld D. (2007) Accumulation of gold nanoparticles in Brassic juncea. Int. J. Phytoremediation. 9:
197-206.
Nikitin M.P., Zdobnova T.A., Lukash S.V., Stremovskiy O.A., Deyev S.M. (2010) Protein-assisted
self-assembly of multifunctional nanoparticles. PNAS. 107: 5827?5832.
Purtov K.V., Petunin A.I., Burov A.E., Puzyr A.P., Bondar V.S. (2010) Nanodiamonds as carriers
for address delivery of biologically active substances. Nanoscale Res. Lett.5: 631-636.
Puzyr A.P., Bondar V.S., Bukayemsky A.A., Selyutin G.E., Kargin V.F. (2005) Physical and
chemical properties of modified nanodiamonds. NATO Science Series. II. Mathematics, Physics and
Chemistry. 192: 261-270.
Puzyr A.P., Baron A.V., Purtov K.V., Bortnikov E.V., Skobelev N.N., Mogilnaya O.A., Bondar V.S.
(2007) Nanodiamonds with novel properties: a biological study. Diamond and Related Materials. 16:
2124-2128.
Schrand A., Hens S. A. C., Shenderova O. A. (2009) Nanodiamond Particles: Properties and Perspectives for Bioapplications. Solid State Mater. 34: 18-74.
Tavera-Davila L., Liu H.B., Herrera-Becerra R., Canizal G., Balcazar M., Ascencio J.A. (2009)
Analysis of Ag nanoparticles synthesized by bioreduction. J. Nanosci. Nanotechnol. 9: 1785-1791.
Wang Z., Lee Y.H., Wu B., Horst A., Kang Y., Tang Y.J., Chen D.R. (2010) Anti-microbial activities of aerosolized transition metal oxide nanoparticles. Chemosphere. 80: 525-529.
Webster T.J., Ahn E.S. (2007) Nanostructured biomaterials for tissue engineering bone. Adv.
Biochem. Eng. Biotechnol. 103: 275-308.
Nanodiamonds in Biotechnology:
Application for Purification of Proteins
and Test-Systems of Indication
Nikita O. Ronzhina*, Konstantin A. Kharina,
Alexey P. Puzyrb, Vladimir S. Bondara,b
a
Siberian Federal University,
79 Svobodny, Krasnoyarsk, 660041 Russia
b
Institute of Biophysics SB RAS,
50/50 Akademgorodok, Krasnoyarsk, 660036 Russia
This paper discusses the perspectives of applications of the detonation nanodiamonds in biotechnology.
An effective separation of proteins from complex protein mixtures by using of nanodiamonds is shown
on the example of purification of recombinant luciferase from the extracts of E. coli bacterial cells:
the process requires minimum equipment and time; one technological cycle yields 40-45 % of desired
# 432 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????, ?.?. ?????? ?????????? ? ?????????????: ?????????? ??? ????????? ???????
product with high-quality (according to the SDS-PAGE). The application of nanodiamonds for design
of indicating systems is demonstrated on the example of a biosensor system based on the nanodiamondluciferase complex and inert polymeric matrix.
Keywords: modified detonation nanodiamonds, recombinant luciferase, protein purification,
biotechnology, bioluminescence, test-system.
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Journal of Siberian Federal University. Biology 4 (2010 3) 434-453
~~~
??? 575 + 591.151/.158:595.324
Morphological Differentiation, Mitochondrial
and Nuclear DNA Variability
Between Geographically Distant Populations
of Daphnia galeata and Daphnia cucullata
(Anomopoda, Daphniidae)
Elena I. Zuykovaa*, Nickolai A. Bochkareva,
Anna S. Semenovab and Alexey V. Katokhinc
a
Institute of Systematics and Ecology of Animals,
Siberian Branch of Russian Academy of Sciences,
11 Frunze, Novosibirsk, 630091 Russia
b
Atlantic Research Institute of Marine Fisheries
and Oceanography,
5 Dm. Donskoy, Kaliningrad, 236022 Russia
c
Institute of Cytology and Genetics, Siberian Branch
of Russian Academy of Sciences,
10 Lavrentyev, Novosibirsk, 630090 Russia 1
Received 3.12.2010, received in revised form 10.12.2010, accepted 17.12.2010
Although members of genus Daphnia (Anomopoda, Daphniidae) are the most common water
invertebrates and are considered as model organisms for many taxonomic, ecological and
evolutionary studies their systematics remains unresolved. Here, morphological differentiation
and genetic polymorphism between the geographically distant populations of the sister species
Daphnia galeata Sars, 1864 and Daphnia cucullata Sars, 1862 in the Curonian Lagoon, a large
shallow freshwater lagoon of the Baltic Sea (Russia, Kaliningrad Oblast) and Novosibirsk Reservoir
(Russia, Novosibirsk Oblast) are presented. The divergence between species and their populations
was analyzed based on traditional morphological traits and a large set of morphometric traits
describing the body shape. The traits describing the shape of head and helmet, and spine were the
most variable morphological characters. Phylogenetic relationships between species and populations
were constructed based on variation in mitochondrial 16S and 12S rRNA genes and nuclear ITS2
rDNA sequences. The mitochondrial DNA divergence between D. galeata and D. cucullata species
was significant and reflected their monophyletic origin, whereas intraspecific genetic distances are
estimated as insignificant.
Keywords: Daphnia galeata, Daphnia cucullata, morphological variation, mitochondrial DNA,
nuclear DNA, genetic divergence
*
1
Corresponding author E-mail address: ih@eco.nsc.ru
© Siberian Federal University. All rights reserved
# 434 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena I. Zuykova, Nickolai A. Bochkarev? Morphological Differentiation, Mitochondrial and Nuclear DNA?
Introduction
Cladoceran of genus Daphnia (Anomopoda,
Daphniidae) are the most common invertebrates
in water ecosystems. Many species of this genus
are used as model organisms in the different field
of biology including toxicology, biogeography,
and evolutionary ecology. The most reliable
taxonomic keys of some Daphnia species were
developed by S.M. Glagolev (1986). However, the
systematics of many Daphnia species complexes
remains unresolved and morphological distinction
between some species is often lacking. The
main cause of taxonomic confusion consists in
remarkable morphological plasticity in response
to ecological and genetic factors. The body shape,
helmet and tail spine sizes were shown to depend
on water temperature, turbulence, quantity of
available food, and presence of invertebrate and
vertebrate predators (Hebert, Grewe, 1985; Mort,
1989; Sorensen, Sterner, 1992; Burns, 2000;
Lass, Spaak, 2003; Laforsh, Tollrian, 2004).
Both considerable morphological variability
and similarity may be due to interspecific
hybridization and introgression as it was shown for
species of Daphnia longispina complex based on
genetic studies (Taylor, Hebert, 1992; Colbourne,
Hebert, 1996; Schwenk et al., 1998; Gie?ler et al.,
1999; Schwenk et al., 2000; Hobжk et al., 2004;
GieЯler, Englbrecht, 2009). At present time both
mitochondrial and nuclear genetic markers have
a wide use for delineation of Daphnia species and
phylogenetic relations assignment between them
(Taylor et al., 1996; Schwenk et al., 1998; Gie?ler,
2001; Duffy et al., 2004; Petrusek et al., 2008).
These studies deal with both geographically
limited and distant Daphnia populations
inhabiting different waterbodies of Western
Europe and North America. Meanwhile, the
study of genetic diversity of Daphnia populations
from Russian water bodies is extremely shallow
(Bychek, Mьller, 2003; Kotov et al., 2006; Ishida,
Taylor, 2007). Besides, often genetic studies
of daphniids are not confirmed by analysis of
the taxonomic traits, therethrough generate
obvious mistakes in species identification.
Different statistical methods on quantitative
and qualitative morphological data sets were
successfully applied to reveal traits useful for
species delineation (Dodson, 1981; Schwartz et
al., 1985; Benzie, 1988; Gie?ler, 2001; Duffy et
al., 2004).
The purpose of this study is to perform
comparative morphological analysis of the body
shape variability using multivariate statistical
method and to evaluate the variability of the
16S and 12S mitochondrial DNA and the ITS2
nuclear DNA markers in geographically distant
populations of sister species D. galeata Sars,
1864 and D. cucullata Sars, 1862 (D. longispina
complex) from Novosibirsk Reservoir of West
Siberia and the Curonian Lagoon of the Baltic
Sea.
Materials and Methods
Study areas
Novosibirsk Reservoir (54°28?N, 82°23?E)
is a large artificial water body in the Ob River?s
valley located in two regions: Novosibirsk
Oblast and Altai Territory. Some reservoirs
characteristics are given in Table 1. In winter
this water body is covered by ice in the whole.
According to literature data zooplankton
community was originated from zooplankton
of drowned flood-plane water bodies belonging
to the river channel. The reservoir is used for
recreation and fishing. In different periods of the
reservoir?s formation three species D. longispina,
D. cucullata, and D. hyalina among genus
Daphnia were identified (Solonevskaya, 1961;
Bityukov, 1964; Pomerantseva, 1976; Kotikova,
1985). At present D. cucullata and D. longispina
inhabit in the lacustrine part of the reservoir and
D. cucullata has being dominated since 1995
(Ermolaeva, 2007).
# 435 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena I. Zuykova, Nickolai A. Bochkarev? Morphological Differentiation, Mitochondrial and Nuclear DNA?
Table 1. Some characteristics of the waterbodies investigated, specimens number in morphological and genetic
data sets
Volume
(km3)
Mean depth (m)
Max depth (m)
Morphology
sample
16S
12S
ITS2
Morphology
sample
16S
12S
ITS2
Curonian
Lagoon
Area (km 2)
Novosibirsk
Reservoir
D. cucullata
Altitude
(m a.s.l.)
Waterbody
D. galeata
113
1082
8.8
8.3
25.0
75
7
6
7
4
3
4
4
0
1584
6.2
3.8
5.8
71
17
19
10
31
3
3
3
The Curonian lagoon (55°18?N, 20°55?E) is
a large shallow freshwater lagoon of the Baltic
Sea is subjected to strong anthropogenic impact.
Some characteristics of the lagoon are provided
in Table 1. The continuing eutrophication of the
lagoon is accompanied by water ?hyperbloom?
under the mass development of blue-green algae
(Alexandrov, Dmitrieva, 2006). Their biomass
significantly exceeds the level conditioning the
secondary pollution of the water body in some
year. According to hydrochemical data and
the structural and functional characteristics
of zooplankton, the Curonian Lagoon belongs
to eutrophic water bodies with a transition to a
hypereutrophic stage (Alexandrov et al., 2006;
Semenova, Alexandrov, 2009). This water body is
covered by ice for a short winter period. According
to literature data several Daphnia species were
registered in the Curonian Lagoon, namely D.
longispina, D. hyalina, D. cucullata, D. cristata,
and D. pulex (Szidat, 1926; Schmidt-Ries, 1940;
Kiselite, 1957; Naumenko, 1994; Pliuraite, 2003).
At present, D. galeata is dominant species and D.
cucullata is subdominant one.
Sampling
For studies of morphological and genetic
variability of Daphnia specimens in Novosibirsk
Reservoir the zooplankton samples were taken
in August, 2008 with the Apstein net (mesh
size 250 ?m). For studies of morphological
variability of Daphnia in the Curonian Lagoon
we used the samples collected from April to
September, 2008. For study of their genetic
polymorphism the samples were collected in
May-June and September, 2009. In the Curonian
Lagoon the samples were taken with a Van-Dorn
bathometer.
The samples were preserved in 5 % (or
4 %) formalin solution with sucrose (Haney,
Hall, 1973) for morphological and morphometric
analyses. For genetic analysis of Daphnia species
zooplankton samples were stored directly in
ethanol (90-95 %) until DNA was extracted.
Morphological analysis
Daphnia species were identified according
to the keys presented in the recent literature
(Glagolev, 1986; Flц?ner, Kraus, 1989). Females
of D. galeata ? D. cucullata in the forth or fifth
age-size groups were photographed for digital
morphological analysis in lateral view under
AxioScan microscope (Carl Zeiss, Germany) (Ч50
or Ч100 magnitude) (for sample size see Table 1)
To analyze a body shape 23 morphological
measurements were made using the digital
images with the AxioVision software. The
morphometric characters were taken according
to the set given in Zuykova, Bochkarev (2010).
Three characters were additionally used, namely,
# 436 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena I. Zuykova, Nickolai A. Bochkarev? Morphological Differentiation, Mitochondrial and Nuclear DNA?
the distance from center of the eye to the point of
tail spine attachment (O.l.t.sp.), the distance from
the antennulae tip to the rostrum tip (a.r.) and the
helmet angle (helmet angle).
A principal component analysis (PCA) was
performed to estimate morphological variation
just as it has been done for other Daphnia
species (Schwartz et al., 1985; Benzie, 1988).
This analysis calculates new variables (principal
component) which are linear combinations of the
original characters and allows distinguishing the
most significant characters. Obtained variables
were normalized and centered. The components
were estimated as new traits, and then an average
loading value, an error in mean, and a standard
deviation were calculated for each sample. To
estimate the significance of morphological
divergence between all Daphnia samples based
on the average loading values the Student t-test
was applied (Efimov, Kovaleva, 2005). As the
first principal component accounts for the most
variation and explains the size variability, hence
the body shape parameters between the Daphnia
samples were analyzed in the space of the second
and third PCA axes. The PCA variables were
used as input in UPGMA analysis to estimate
the divergence among the samples. All statistical
analyses were performed using STATISTICA
version 6.0 (StatSoft Inc., USA), SNEDECOR
version 5.0 (ODS Soft, Novosibirsk, Russia), and
PAST version 2.05 (http://palaeo-electronica.org)
softwares.
DNA analysis
Ethanol-preserved animals were used for
analysis of nucleotide polymorphism. Total DNA
was extracted from a single individual (female or
male) or an ephippium using a 5 % suspension
of Chelex 100 resin (BioRad). Before use in PCR
the extracted DNA was stored under -20?C. The
polymerase chain reaction was used to amplify
the 16S and 12S mitochondrial genes and the
ITS2 region of nuclear DNA including part of
flanking 5.8S and 28S ribosomal RNA genes.
The primers and conditions for PCRs in a 20 ?l
reaction volume were as following: 2-5 ?l DNA
homogenate, 0.2 ?M dNTPs, 2 ?l 10Ч PCR buffer
(10 mM Tris?HCl, pH 8.3, 50 mMKCl), 2.5 mM
MgCl2, 0.5 ?M of each primer and 1 unit of
Thermus aquaticus DNA polymerase (Taq-pol).
The 16S gene was amplified using the
originally designed primers:
16Sin-F 5?-TTTGTAAATGGCCGCAGTA-3?
and
16Sin-R 5? -CGGTTTGAACTCAGATCATGTA-3?.
A thermocycler (BIS-N, Novosibirsk, Russia)
was run for 2 min at 94 °C (1 cycle), followed by
30 s at 94 °C, 30 s at 56 °C, 1 min 45 s at 72 °C (35
cycles) and extension for 2 min at 72 °C.
The 12S gene was amplified using the
primers:
12S-F 5?-ATGCACTTTCCAGTACATCTAC-3?
and
12S-R 5?-AAATCGTGCCAGCCGTCGC-3?
(Colbourne, Hebert, 1996). A thermocycler was
run for 2 min at 94 °C (1 cycle), followed by 1 min
30 s at 94 °C, 45 s at 58 °C, 1 min 30 s at 72 °C (35
cycles) and extension for 6 min at 72 °C.
The ITS2 region was amplified using the
specially designed forward primer 5.8Fr 5?CCCTGAACGGTGGATCACTA -3? and a reverse
primer according to Taylor et al. (2005) 28SD2BR
5?-TTAGAAGGAGTTTACCTCCCGCTTAGG
-3?. A thermocycler was run at 2 min at 94 °C
(1 cycle), followed by 1 min at 94 °C, 45 s at
53 °C, 1 min at 72 °C (35 cycles) and extension
for 6 min at 72 °C.
The PCR products were separated on 1 %
agarose 1Ч TAE gel (Low EEO Standart agarose,
BIOZYM, Russia) in the presence of ethidium
bromide and photographed under UV light. A 1-2
kb DNA ladder (MEDIGEN, Novosibirsk, Russia)
was used for the estimation of the amplicon length.
# 437 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena I. Zuykova, Nickolai A. Bochkarev? Morphological Differentiation, Mitochondrial and Nuclear DNA?
The amplified products were purified using a kit
from BIOSILICA (Novosibirsk, Russia) and both
stands were sequenced on an automated sequencer
ABI PrISM 3100 Avant Genetic Analyzer (Applied
Biosystems, USA) using Big Dye terminator
sequencing kit (Applied Biosystems, USA) at the
Center of DNA Sequencing of Siberian Branch of
the Russian Academy of Science (Novosibirsk,
Russia, http://sequest.niboch.nsc.ru). The DNA
sequences were first automatically aligned using
the CLUSTALW algorithm and then manually
edited. The nucleotide sequences of the newly
analyzed specimens were deposited in GenBank
(see Table 2 for accession numbers).
An estimation of the divergence between
sequences and the construction of a neighborjoining (NJ) phylogram based on Kimura
2-parameters (with pairwise deletion of the gaps
and missing sites) was conducted in Molecular
Evolutionary Genetics Analysis software version
4.0 (MEGA 4) (Saitou, Nei, 1987; Tamura et al.,
2007). One thousand bootstrap replicates were
run to assess the statistical support in the tree
nodes. Additionally, we analyzed the phylogenetic
relationships among individuals using minimum
evolution (ME) and maximum parsimony (MP)
methods. For comparative analysis the sequences
of respective fragments for Daphnia species from
GenBank database were included into analyses.
Results
Morphological variability
Morphological analysis of the Daphnia
populations based on the main qualitative
characters traditionally used in taxonomic keys
(Glagolev, 1986) allowed identification of D.
galeata and D. cucullata species in the Curonian
Lagoon and Novosibirsk Reservoir. These
characters included the shape of the antennulae
mound, insertion and length of aesthetasks,
presence of ocellus, the crest in frontal view,
rostrum shape and length, head shape near the eye
and the ventral margin of the head (Fig. 1, 2). In
addition we use some traits of males (Fig. 1 K ? P,
U, V, Fig. 2 J). Subsequently, analysis of the body
shape was carried out based on the morphometric
traits describing body shape only.
The body shape of D. galeata from the
Curonian lagoon was found to be remarkably
changeable. At fi rst, this can be explained by
seasonal variability, because the morphological
analysis was carried out with the samples taken
during the whole growing season. The most
significant morphological differences concerned
helmet size and form. So, D. galeata specimens
collected in April were characterized by a
rounded head or had a very small helmet (Fig. 1
A, F). The individuals collected in May had both
a large and medium-scale helmet; in September
the individuals with a large helmet were
registered only. Thus, the D. galeata specimens
from the Curonian lagoon were divided into
three groups with respect to their helmet size
and shape. D. cucullata specimens presented
the separate forth group (Fig. 1 N ? P, V). The
sample of D. galeata in Novosibirsk Reservoir
was more homogeneous. The only significant
difference among individuals was related to the
helmet size (Fig. 2 A ? F). The second group
in Novosibirsk Reservoir was presented by
D. cucullata specimens (Fig. 2 G, H).
Figure 3a displays the morphological
divergence between all groups and samples
generated by principal component analysis at
the space of the first two axes. The first PCA
axis was formed by approximately equal positive
loadings of all characters and this axis reflects a
dimensional variability (69.01 %) in the common
Daphnia samples (Table 3). The most remarkable
differences were registered between all samples
of D. galeata and D. cucullata and between the
populations of these species (Table 4). The most
significant divergence among all D. galeata
samples was found between the rounded head
# 438 #
1
D. cucullata
D. cucullata
D. cucullata
D. cucullata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
D. cucullata
D. cucullata
D. cucullata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
Species
NRCu1
NRCu2
NRCu3
NRCu4
NRG1
NRG2
NRG3
NRG4
NRG5
NRG6
NRG7
CoLCu15
CoLCu16
CoLCu17
CoLG1
CoLG2
CoLG3
CoLG4
CoLG5
CoLG7
CoLG8
CoLG9
CoLG10
CoLG11
CoLG14
CoLG18
CoLG19
CoLG20
CoLG21
CoLG22
CoLG23
CoLG24
2
Label
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
Russia
3
Country
4
Novosibirsk Reservoir
Novosibirsk Reservoir
Novosibirsk Reservoir
Novosibirsk Reservoir
Novosibirsk Reservoir
Novosibirsk Reservoir
Novosibirsk Reservoir
Novosibirsk Reservoir
Novosibirsk Reservoir
Novosibirsk Reservoir
Novosibirsk Reservoir
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Curonian Lagoon
Location
adult
adult
adult
adult
adult
adult
adult
adult
adult
ephippium
ephippium
adult
adult
adult
juv
juv
adult
adult
adult
adult
juv
adult
juv
adult
juv
adult
juv
adult
adult
juv
adult
juv
5
Developmental
stage
female
female
female
female
female
female
female
female
female
female
female
female
female
male
female
male
female
female
male
female
male
female
female
female
female
female
female
female
female
female
6
Sex
GenBank accession numbers
16S
12S
7
8
HM067407
HM100080
HM067408
HM100081
HM067409
HM100082
HM100083
HM067430
HM100087
HM067431
HM100088
HM067432
HM100089
HM067433
HM100090
HM067434
HM100091
HM067435
HM100092
HM067436
HM067410
HM100084
HM067411
HM100085
HM067412
HM100086
HM067413
HM161705
HM067414
HM161706
HM067415
HM161707
HM067416
HM161708
HM067417
HM161709
HM067418
HM100093
HM067419
HM100102
HM100094
HM067420
HM100095
HM067421
HM100096
HM067422
HM100103
HM067423
HM100097
HM067424
HM100104
HM067425
HM100098
HM067426
HM100099
HM067427
HM100105
HM067428
HM100100
HM067429
HM100101
Table 2. List of specimens? designations and corresponding GenBank accession numbers of Daphnia species genetically examined in this study
ITS2
9
HM161684
HM161685
HM161686
HM161687
HM161698
HM161699
HM161700
HM161701
HM161702
HM161703
HM161704
HM161681
HM161682
HM161683
HM161688
HM161689
HM161690
HM161691
HM161692
HM161693
HM161694
HM161695
HM161696
HM161697
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
D. galeata
D. galeata
D. cucullata
D. cucullata
D. cucullata
D. cucullata
D. cucullata
D. cucullata
D. cucullata
D. galeata
D. galeata
D. galeata
D. galeata
D. galeata
D. cucullata
1
Continued table 2
2
Canada
Russia
Germany
Germany
Netherlands
Germany
Czech Repub.
Slovenia
Russia
Canada
USA
USA
Japan
England
Germany
3
4
Guelph Lake
Volga River
Thalersee
Klostersee
Tjeukemeer
Hattstein Weiher
Medlov Pond
Lake Bled
Lake Glubokoe
5
6
7
AF064187*
AY115492*
FJ943783*
FJ943782*
FJ943784*
FJ178307*
AF277270*
AF277269*
AF277272*
8
AY730382*
AY730396*
AY730397*
AY730398*
AY730401*
AY730402*
9
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Fig. 1. Daphnia morphology from the Curonian Lagoon. D. galeata A-P: A-G. female, lateral view; H, I. Head,
female, lateral view; J. Postabdomen, female, lateral view; K, L. male, lateral view; M. Head, male, lateral view;
N. Antenna I, male; O. Postabdomen, male; P. Limb I, male; D. cucullata Q-V: Q-S. female, lateral view; T. Head,
female, lateral view; U. male, lateral view; V. Head, male, lateral view. Scale bars 200 ?m for A-I, K, L, R, S; 100
?m for J, M-P, T-V
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena I. Zuykova, Nickolai A. Bochkarev? Morphological Differentiation, Mitochondrial and Nuclear DNA?
Fig. 2. Daphnia morphology from Novosibirsk Reservoir. D. galeata A-J: A-F. female, lateral view; G. Head,
female, lateral view; H. Postabdomen, female, lateral view; I. Postabdominal claw, female; J. male, lateral view;
D. cucullata K,L: K. female, lateral view; L. Head, female, lateral view. Scale bars 200 ?m for A-G, K; 100 ?m
for H, J, L; 50 ?m for I
form and an intermediate one inhabiting the
Curonian Lagoon.
With respect to the second and third PCA
axes the morphological divergence between
all D. galeata samples was smaller, except the
rounded head form from the Curonian Lagoon
(Fig. 3 b). The second PCA axis (12.44 %) loaded
primarily on the head characters (l.cap., m.v.cap.),
the eye position (O.m.v.), helmet size and form
(l.helm., m.v.helm., helmet angle), and length
tail spine (l.t.sp.). The third PCA axis (4.30 %)
was formed by the loadings of the characters of
the eye (O, O.m.v.cap), helmet form (m.v.helm.,
helmet angle), rostrum form and length (r.m.v.,
a.r.) and the carapace characters (w.br., r.W.v.,
w.cap.d.) (Table 3). Almost all samples and forms
significantly differed with respect to the loadings
into the third PCA axis, except the D. cucullata
samples (Table 4).
A dendrogram constructed using average
values of the first three principal components
suggested that there are three main distinct
clusters (Fig. 4). The first cluster consisted of the
D. galeata specimens from both water bodies.
The D. cucullata populations comprised the
second cluster. Finally, the rounded head form
of D. galeata from the Curonian Lagoon was
separated into a distinct group, mainly due to
head shape near the eye and the ventral margin
of the head.
Mitochondrial DNA variability
16S mtDNA. For thirty Daphnia individuals
481 bp of the 16S gene were sequenced. Additional
# 442 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Fig. 3. Plot of clouds distributions and centroids of the common samples of D. galeata and D. cucullata from the
Curonian Lagoon (CoL) and Novosibirsk Reservoir (NR) according to the morphological variables in the space
of the first and second (A) and second and third (B) PCA axes; ± standard deviation. Open cirles ? D. cucullata
(CoL), black circles ? D. cucullata (NR); grey circles ? rounded form of D. galeata (CoL), open diamonds ?
helmeted form of D. galeata (CoL), grey squares ? intermediate form of D. galeata (CoL), grey triangles ? D.
galeata (NR)
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena I. Zuykova, Nickolai A. Bochkarev? Morphological Differentiation, Mitochondrial and Nuclear DNA?
2 sequences for D. galeata were obtained from
GenBank database (Table 2). The pairwise
distances for the 16S fragment within D. galeata
and D. cucullata species were 0.002 and 0.004,
respectively. The divergence between these
species was 0.022. There were 7 conservative
sites through multiple alignment 522 nucleotides
of length. The overall transition/transversion bias
was R = 3.862.
A neighbour-joining analysis (the 16S
sequence for Eubosmina coregoni was used as
outgroup, GenBank #EU650747) produced a tree
with the high bootstrap support for two branches
corresponding to D. galeata and D. cucullata
species, 89 and 88 %, respectively (Fig. 5). The
topology indicated monophyletic origin of these
groups. However, two D. cucullata specimens
(NRCu2 and NRCu3) from Novosibirsk Reservoir
formed a separate group with high bootstrap
support, 85 %. Minimum evolution and maximum
parsimony analyses (trees not presented) resulted
in identical topologies with slightly less bootstrap
support for the branches.
12S mtDNA. For the 12S gene 7 sequences
of 610 bp for D. cucullata and 24 sequences of
608 bp for D. galeata were obtained. Additional
17 sequences for both species from GenBank
database were included into analysis. The
sequence for E. coregoni was chosen as outgroup
(GenBank #AF494467). The within-specific
pairwise distances for the 12S fragment were
0.002 for D. galeata and 0.003 for D. cucullata.
The divergence between species was 0.083. If the
sequences obtained from GenBank database were
eliminated from the analysis the genetic distances
within and between species were 0.001 and 0.075,
respectively. There were 8 conservative sites
through 12S multiple alignment 743 nucleotides
of length. The overall transition/transversion bias
was R = 2.356.
NJ-tree agreed in topology with NJ-tree
based on 12S sequences (Fig. 6). There were two
Table 3. Component loadings of the morphological
characters of the common Daphnia samples into the
first three PCA axes. Major loadings are asterisked.
Character
Loadings
1 PCA
2 PCA
3 PCA
L
0.24*
0.00
0.10
o.t.sp
0.23*
-0.08
0.05
W
w.br.
0.23*
-0.08
0.10
0.21*
-0.07
0.35*
w.cap.
0.24*
0.02
-0.09
l.cap.
0.21*
0.24*
0.01
l.helm.
-0.15
0.38*
-0.14
O
0.19
-0.12
0.35*
lr
O.m.v.
0.21*
0.14
-0.15
0.16
0.31*
0.15
r.m.v.
0.22*
0.04
-0.22*
m.v.cap.
0.19
0.30*
-0.03
m.v.helm.
-0.05
0.53*
0.22*
Or
O.w.cap.
0.24*
0.06
-0.10
0.22*
0.15
-0.22*
cap.d.
0.21*
0.19
-0.01
r.W.v.
0.21*
-0.16
0.29*
w.cap.d.
0.22*
-0.14
0.30*
l.t.sp.
0.14
0.30*
-0.06
d.l.t.sp.
0.23*
-0.06
0.05
v.l.t.sp.
0.23*
-0.05
-0.07
helmet angle
0.19*
-0.22*
-0.36*
a.r.
l.cl.
0.19*
-0.17
-0.42*
0.18*
-0.06
-0.14
Cumulative %
69.01
12.44
4.30
# 444 #
0.001
3
-
0.001
0.001
1-3
0.001
-
0.001
1-4
0.001
0.001
0.001
1-5
0.001
-
1-6
0.001
0.001
0.001
2-3
-
0.001
0.001
2-4
Note: number samples see Fig. 4; differences assuming CD-test are marked by bold type.
-
0.001
1
1-2
2
Eigenvectors
0.001
0.001
0.001
2-5
P-value
-
0.001
2-6
0.01
0.001
0.001
3-4
0.001
-
0.001
3-5
0.001
0.001
3-6
Table 4. ?-values between average values of the first three eigenvectors for pairwise comparison of the common samples of Daphnia (t-test)
0.001
0.001
0.001
4-5
-
-
0.001
4-6
0.001
0.001
0.001
5-6
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena I. Zuykova, Nickolai A. Bochkarev? Morphological Differentiation, Mitochondrial and Nuclear DNA?
Fig. 4. UPGMA-dendrogram based on morphometric data for six samples of D. galeata and D. cucullata from the
Curonian Lagoon (CoL) and Novosibirsk Reservoir (NR) (Euclidean distance between the average loading values
into the second and third PCA axes). 1 ? helmeted form of D. galeata (CoL), 2 ? rounded form of D. galeata (CoL),
3 ? intermediate form of D. galeata (CoL), 4 ? D. cucullata (CoL), 5 ? D. galeata (NR), 6 ? D. cucullata (NR)
clusters with bootstrap support of the branches
for D. galeata 99 % and D. cucullata 100 %. The
topology of the 12S NJ-tree also indicated the
monophyletic origin of these species.
ITS2 nuclear DNA. Between 1075 and
1087 bp of the ITS2 region were sequenced for 7
specimens of D. cucullata and for 17 specimens
of D. galeata. Additional 6 ITS2 sequences
were obtained from GenBank database and D.
longispina ITS2 sequence (Poland, GenBank
#AY730404) was used as the outgroup. Pairwise
distances within D. galeata and D. cucullata
species ranged from 0.002 to 0.05, respectively,
with divergence between these species 0.013.
There were 11 conservative sites in the ITS2 region
through multiple alignment 1131 nucleotides of
length. The overall transition/transversion bias
was R = 1.652.
The phylogenetic relationships between
D. galeata and D. cucullata species identified
using the ITS2 region (tree is not presented)
were generally consistent with the branching
topology of trees based on mitochondrial DNA.
The ITS2 sequences were also subjected to NJ
and ME analyses. All methods produced a nearly
identical topology with respect to species. But
the support for a branch that resolves the position
both species was lost. One D. cucullata specimen
(NRCu3) from Novosibirsk Reservoir clustered
together with D. galeata.
Discussion
The use of traditionally taxonomic keys
has allowed identification of D. galeata and D.
cucullata species in the Curonian Lagoon and
Novosibirsk Reservoir. We suppose that enormous
morphological
variability,
nomenclatural
problems and the use of the inappropriate key
for the identification of species within Daphnia
longispina complex by previous studies could
result in delineation of D. longispina and D.
hyalina species in the investigated water bodies.
The remarkable fact was that D. galeata was
not recognized in the species composition of
# 446 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena I. Zuykova, Nickolai A. Bochkarev? Morphological Differentiation, Mitochondrial and Nuclear DNA?
Fig. 5. A phylogenetic tree constructed using the neighbor-joining method (NJ) based on mitochondrial 16S
rDNA sequences for D. galeata and D. cucullata. The NJ was rooted with Eubosmina coregoni. The number
above the branches represents the bootstrap confidence limit (1000 replicates)
zooplankton community in Novosibirsk Reservoir
until recently (Ermolaeva, 2007). Based on the
morphometric analysis we have shown that the
geographically distant populations of D. galeata
differed between each other based on head length,
shape of the ventral margin of the head, helmet
length, slope and shape, the position and diameter
of the eye, rostrum shape, some characters of
the carapace and length tail spine. D. cucullata
was characterized by less interpopulation
morphological variability compared with D.
galeata. However, despite the marked differences
the geographically distant populations of these
Daphnia species clustered together confirming
their species identity.
Interpopulation variability of the 16S and
12S mitochondrial genes for the studied species is
negligible and the consistency in the topology of the
# 447 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Fig. 6. A phylogenetic tree constructed using the neighbor-joining method (NJ) based on mitochondrial 12S
rDNA sequences for D. galeata and D. cucullata. The NJ was rooted with Eubosmina coregoni. The number of
the branches represents the bootstrap confidence limit (1000 replicates)
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena I. Zuykova, Nickolai A. Bochkarev? Morphological Differentiation, Mitochondrial and Nuclear DNA?
NJ-trees for both markers was found. Additional
analyses of the phylogenetic relationships
between closely related species D. galeata and
D. cucullata using the minimum evolution and
maximum parsimony methods also showed a
concordant topology. Meanwhile, the intraspecific
genetic distances for the 16S gene were higher
than those for the 12S gene but the interspecific
genetic distances were lower. An additional
point is that the genetic divergence within D.
cucullata was more significant as compared with
D. galeata, whereas the morphology of the first
species was less variable. The deletion from the
analysis of the sequences obtained from GenBank
database for the 12S gene resulted in reduction
of the differences between the D. cucullata
specimens inhabiting Novosibirsk Reservoir and
the Curonian Lagoon. Our data are consistent
with data on the phylogenetic relationships of D.
cucullata and D. galeata populations in the water
bodies of Western Europe, which also marked
monophyletic and sister relationships (Schwenk
et al., 2000; Petrusek et al., 2008). We did not
find divergence between European and Siberian
D. galeata populations using both mitochondrial
markers, as it was shown earlier for European and
North American populations (Taylor et al., 1996).
However, we found that 16S gene was scarce
conservative sites in comparison with the 12S
gene, whereas for the North American D. laevis
complex has been shown opposite (Taylor et al.,
1998).
A clear resolution between the ITS2
sequences of nuclear DNA for D. galeata and
D. cucullata species from both Novosibirsk
Reservoir and the Curonian Lagoon was not
found. The genetic divergence was lower than
it was calculated for mitochondrial DNA. The
possibility of interspecific hybridization is
suggested by the lack of divergence among the
ITS2 sequences of specimens from the studied
populations. This finding, in turn, indicates also
that both species are insufficiently isolated from
each other and demonstrate sister relationship.
The existence of hybridization between different
populations of these species has been previously
shown using other DNA markers (Schwenk et al.,
1998; Gie?ler et al., 1999; Schwenk et al., 2001;
Taylor et al., 2005; Ishida, Taylor, 2007; Petrusek
et al., 2008; Gie?ler, Englbrecht, 2009).
Conclusion
The most important finding of our study is
the absence of any significant morphological and
genetic divergence between the geographically
distant D. cucullata and D. galeata populations.
The existence of separate phylogenetic lineage of
D. cucullata in Novosibirsk Reservoir may be a
result from flooding from various water bodies
during the process of its formation. Mitochondrial
and nuclear DNA significant variation among
different morphotypes of D. galeata from the
Curonian Lagoon was absent too. Such low level
of the divergence within these morphs may be
due to either their conspecific or hybrid origin
of the intermediate morphs with inheritance of
maternal mitogenome of D. galeata. On the other
hand, the rounded head morph of D. galeata
from the Curonian Lagoon observed at the
beginning of spring enormously distinguished it
from both other morphs and D. cucullata based
on morphometric analysis. However, its specific
delineation remains in abeyance.
In general, we have demonstrated significant
morphological and genetic similarity among
the geographically distant D. galeata and D.
cucullata populations from two large water
bodies in Russia.
Acknowledgments
We thank N.M. Korovchinsky, A.A. Kotov,
and A.Yu. Sinev for advice on Daphnia
morphology and for help with preparing of the
Daphnia drawings.
# 449 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena I. Zuykova, Nickolai A. Bochkarev? Morphological Differentiation, Mitochondrial and Nuclear DNA?
References
Aleksandrov S.V., Dmitrieva O.A. (2006) Primary production and phytoplankton indices as
criteria of eutrophy of the Curonian Lagoon of the Baltic Sea. Vodn. Res. 33(1): 104?110.
Aleksandrov S.V., Senin Yu.M., Smyslov V.A. (2006) Primary production and the content of
chlorophyll and biogenic elements as indices of environmental state of the Curonian Lagoon and
Vistula Bay of Baltic Sea. Inland Water Biology 1: 41?47.
Bityukov E.P. (1964) The main features of zooplankton in Novosibirsk Reservoir. In: Izvetiya
GosNIORH, vol. 57, Leningrad, Nauka, p. 160-169. (in Russian)
Benzie J.A.H. (1988) The systematics of Australian Daphnia (Cladocera: Daphniidae). Multivariate
morphometrics. Hydrobiologia 166: 163?182.
Bychek E.A., Mьller J. (2003) Molecular genetic diagnostic of some Daphnia species (Crustacea,
Cladocera) from the Volga River. Russian J. of Genetics 39(3): 439-441.
Burns C.W. (2000) Crowding-induced changes in growth, reproduction and morphology of
Daphnia. Freshwater Biol. 43: 19-29.
Colbourne J.K., Hebert P.D.N. (1996) The systematic of North American Daphnia
(Crustacea: Anomopoda): a molecular phylogenetic approach. Phil. Trans. R. Soc. Lond. B. 351:
349?360.
Dodson S.I. (1981) Morphological variation of Daphnia pulex Leydig (Crustacea: Cladocera) and
related species from North America. Hydrobiologia 83: 101?114.
Duffy M.A., Tessier A.J., Kosnik M.A. (2004) Testing the ecological relevance of Daphnia
species. Freshwater Biol. 49: 55?64.
Efimov V.M., Kovaleva V.Yu. (2005) Multidimensional analysis of biological data. Tomsk State
University, Tomsk, p. 1-75. (in Russian)
Ermolaeva N.I. (2007) Features of zooplankton formation in Novosibirsk Reservoir. In: Romanov
V.I. (ed.) Biological aspects of the efficient use and conservation of the waterbodies of Siberia. Tomsk
State University, Tomsk, p. 77-94. (in Russian)
GieЯler S., Mader E., Schwenk K. (1999) Morphological evolution and genetic differentiation in
Daphnia species complexes. J. Evol. Biol. 12: 710?723.
GieЯler S. (2001) Morphological differentiation within the Daphnia longispina group.
Hydrobiologia 442: 55?66.
GieЯler S., Englbrecht C.C. (2009) Dynamic reticulate evolution in a Daphnia multispecies
complex. J. Exper. Zool. 311A: 531?549.
Glagolev S.M. (1986) Species composition of Daphnia in Lake Glubokoe with notes on the
taxonomy and geographical distribution of some species. Hydrobiologia 141: 55?82.
Haney J.F., Hall D.J. (1973) Sugar-coated Daphnia: a preservation technique for Cladocera.
Limnol. Oceanogr. 18(2): 331?333.
Hebert P.D.N., Grewe P.M. (1985) Chaoborus-induced shifts in the morphology of Daphnia
ambigua. Limnol. Oceanogr. 30(6): 1291-1297.
Hobжk A., Skage M., Schwenk K. (2004) Daphnia galeata Ч D. longispina hybrids in western
Norway. Hydrobiologia 526: 55?62.
Ishida S., Taylor D.J. (2007) Quaternary diversification in a sexual Holarctic zooplankter, Daphnia
galeata. Mol. Ecol. 3: 569?582.
# 450 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena I. Zuykova, Nickolai A. Bochkarev? Morphological Differentiation, Mitochondrial and Nuclear DNA?
Flц?ner D., Kraus K. (1986) On taxonomy of the Daphnia hyalina-galeata complex (Crustacea:
Cladocera). Hydrobiologia 137: 97?115.
Kiselite T. (1957) Zooplankton of the Curonian Lagoon. In: Trans. Ac. Sc. LitSSR. Ser. Biology,
vol. 4, Vilnius, p. 30-34. (in Russian)
Kotikova N.S. (1985) Zooplankton of the Novosibirsk Reservoir. In: Comprehensive studies in
the Novosibirsk Reservoir. In: Trans. West. Sib. St. Kom. of Hydrometeorol. Inst., vol. 70, p. 103-108.
(in Russian)
Kotov A.A., Ishida S., Taylor D.J. (2006) A new species in the Daphnia curvirostris (Crustacea:
Cladocera) complex from the eastern Palearctic with molecular phylogenetic evidence for the
independent origin of neckteeth. J. Plankt. Res. 28(11): 1067?1079.
Laforsch C., Tollrian R. (2004) Inducible defenses in multipredator environments: cyclomorphosis
in Daphnia cucullata. Ecology 85(8): 2302-2311.
Lass S., Spaak P. (2003) Chemically induced anti-predator defenses in plankton: a review.
Hydrobiologia 491: 221-239.
Mort M.A. (1989) Cyclomorphosis in Daphnia galeata mendotae: variation and stability in
phenotypic cycles. Hydrobiologia 171: 159-170.
Naumenko E.N. (1994) Species composition of zooplankton in the Curonian Lagoon the Baltic
Sea. In: Hydrobiological studies of Atlantic Ocean and the Baltic Sea. AtlantNIRO, Kaliningrad, p. 2033. (in Russian)
Petrusek A., Hobжk A., Nilssen J.P., Skage M., ?ernэ M., Brede N., Schwenk K. (2008) A taxonomic
reappraisal of the European Daphnia longispina complex (Crustacea, Cladocera, Anomopoda). Zool.
Scripta 37(5): 507?519.
Pliuraite V. (2003) Species diversity of zooplankton in the Curonian Lagoon in 2001. Acta
Zoologica Lituanica 13(2): 106-113.
Pomerantseva D.P. (1976) Distribution and dynamic of zooplankton. In: Biological efficiency and
commercial fishing in Novosibirsk Reservoir. Novosibirsk, p. 65-75. (in Russian)
Saitou N., Nei M. (1987) The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Mol. Biol. Evol. 4: 6?25.
Schmidt-Ries H. (1940) Untersuchungen zur Kenntnis des Pelagials eines Strangewassers
(Kurisches Haff). Zeitschriften fuer Fischerei und deren Hilfswissenschaften 6(2): 183?322.
Schwartz S.S., Innes D.J., Hebert P.D.N. (1985) Morphological separation of Daphnia pulex and
Daphnia obtusa in North America. Limnol. Oceanogr. 30(1): 189-197.
Schwenk K., Sand A., Boersma M., Brehm M., Mader E., Offerhaus D., Spaak P. (1998) Genetic
markers, genealogies and biogeographic patterns in the Cladocera. Aq. Ecol. 32: 37?51.
Schwenk K., Posada D., Hebert P. (2000) Molecular systematics of European Hyalodaphnia:
the role of contemporary hybridization in ancient species. Proc. R. Soc. Lond. B 267: 18331842.
Schwenk K., Bijl M., Menken S.B.J. (2001) Experimental interspecific hybridization in Daphnia.
Hydrobiologia 442: 67-73.
Semenova A.S., Alexandrov S.V. (2009) The zooplankton consumption of primary production and
an assessment of the waterbody trophic state on the basis of its structural and functional characteristics.
Inland Water Biology 2(4): 348?354.
# 451 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena I. Zuykova, Nickolai A. Bochkarev? Morphological Differentiation, Mitochondrial and Nuclear DNA?
Solonevskaya A.V. (1961) Zooplankon of the Ob River and the reservoir of Novosibirsk hydroelectric power station at the first year of its storage. In: Trans. Biol. Inst. SB AS SSSR, vol. 7, Novosibirsk,
p. 109-117. (in Russian)
Sorensen K.H., Sterner R.W. (1992) Extreme cyclomorphosis in Daphnia lumholtzi. Freshwater
Biol. 28: 257-262.
Szidat L. (1926) Beitrage zur Faunistik und Biologie des Kurischen Haff. In: Schriften der
Physikalisch-economischen Gesellschaft zur Kцnigsberg i Pr. 65(1): 5-31.
Tamura K., Dudley J., Nei M., Kumar S. (2007) MEGA 4: Molecular Evolutionary Genetics
Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24: 1596-1599.
Taylor D.J., Finston T.L., Hebert P.D.N. (1998) Biogeography of a widespread freshwater
crustacean: pseudocongruence and cryptic endemism in the North American Daphnia laevis complex.
Evolution 52(6): 1648-1670.
Taylor D.J., Hebert P.D.N. (1992) Daphnia galeata mendotae as a cryptic species complex with
interspecific hybrids. Limnol. Oceanogr. 37(3): 658-665.
Taylor D.J., Hebert P.D.N., Colbourne J.K. (1996) Phylogenetics and evolution of the Daphnia
longispina group (Crustacea) based on 12S rDNA sequence and allozyme variation. Mol. Phyl. Evol.
5(3): 495?510.
Taylor D.J., Sprenger H.L., Ishida S. (2005) Geographic and phylogenetic evidence for dispersed
nuclear introgression in a daphniid with sexual propagules. Mol. Ecol. 14: 525?537.
Zuykova E.I., Bochkarev N.A. (2010) Postembryonal morphological variation Daphnia galeata of
in water bodies of different types. Contemp. Probl. Ecol. 3(1): doi 10.1134/S1995425510010066.
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
Elena I. Zuykova, Nickolai A. Bochkarev? Morphological Differentiation, Mitochondrial and Nuclear DNA?
??????????????? ????????????
? ???????????? ???????????
????????????? ????????? ?????????
Daphnia Galeata ? Daphnia Cucullata
(Anomopoda, Daphniidae)
?.?. ???????a, ?.?. ???????? a,
?.?. ???????? b, ?.?. ??????? c
a
???????? ??????????? ? ???????? ???????? ?? ???,
?????? 630091, ???????????, ??. ??????, 11
b
????????????? ??????-????????????????? ????????
??????? ????????? ? ????????????,
?????? 236022, ???????????, ??. ????????, 5
c
???????? ????????? ? ???????? ?? ???,
?????? 630090, ???????????, ???????????, 10
???????? ?? ??, ??? ????????????? ?. Daphnia (Anomopoda, Daphniidae) ????????
?????? ?? ???????? ???????????????? ?????? ?????????????? ? ???????????? ? ????????
????????? ?????????? ? ???????????????, ????????????? ? ???????????? ?????????????, ??
??????????? ???????? ?????? ??????????. ????????? ???????????? ????????? ????????
??????????????? ?????????????? ? ???????????? ???????????? ????????????? ?????????
????????? ??????????? ????? Daphnia galeata Sars, 1864 ? Daphnia cucullata Sars, 1862
(Anomopoda, Daphniidae) ?? ???????????? ????? ??????????? ???? ? ????????? ?????? (??????,
??????????????? ???????) ? ?????????????? ????????????? (??????, ????????????? ???????).
??????????????? ??????????? ????? ?????? ? ?? ??????????? ??????????? ?? ???????????????
????????? ? ?? ????????? ??????? ???????????? ????? ???? ?? ?????? ????????????????
?????????. ?????? ??????????? ???? ????????, ??????????????? ????? ??????, ????? ?
????????? ????. ????????????? ???????????????? ????????? ????? ?????? ????????? ??
?????? ???????????? 16S ? 12S ????? ???????????????? ??? ? ????????? ITS2 ??????? ???.
??????????? ????? ?????? D. galeata ? D. cucullata ?? ?????? ????? ???????????????? ???
???? ???????????? ? ??????????????? ?? ?? ???????????????? ?????????????, ????? ???
????????????? ???????????? ????????? ??????????? ??? ??????????????.
???????? ?????: Daphnia galeata, Daphnia cucullata, ??????????????? ????????????,
???????????????? ???, ??????? ???, ???????????? ???????????.
? ???? ?? ?????????
?????? ???????? ???? ? ????? ????????????
??? ????????? ??????????. ? ?????????? ??????????? ???????????? ???? ????????, ???
????? ??????????????? ?????????????? ??????????? (???. 7) ????????????? ?? ?????????????? ???????? ??????????? ??????????
?????????? ??????? (? ??????? ????? 4 ???.
??.), ??? ????? ????????????????? ? ??????
????????????? ? ??????? ???? ????? ??????? (??? ???? ??????????????? ?????????)
?????????????? ??????????.
??????? ????????, ??? ??????????? ?????????? ???? ???????? ? ??? ?????? ? ????????????, ??????? ???? ??????????????? ? ?????????????? ??????????????? ??????????
???-??????. ??? ????? ?? ?????????? ?????? (???. 8), ???????? ?????????????? ????????, ?????????????? ????? ???????????????
?????????????? ????-??????? ? ?????????
????????? ???-??????-??????????, ??? ?
? ?????? ????????????? ?????????? ??????????? (??. ????), ????? ???????????? ?????????? ??????? ? ????????? ?????????? ?
?? ????????. ??? ???? ?????, ??? ??? ????????????? ?????? ????-??????? ????????
# 428 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????, ?.?. ?????? ?????????? ? ?????????????: ?????????? ??? ????????? ???????
???. 7. ????????????? ???????? ????-??????? ?? (?????? ?????????) ? ????? ?????????????? ??? 45 °C
(????????? 2 ? 14)
???. 8. ???????? ????????????? ?????????????? ????????, ?????????????? ??? ????????????
????????????? ????-??????? ? ???????????? ????????? ???-??????-?????????? ????? ??
?????????????? ??? 45 °C
?????????????? ?????????????? ????????
?????????? ? ??????? ????? 4.5 ???. ??. ? ????? ????? ?? ???????, ??? ? ??? ?????????????
????-??????? ? ???????????? ?????????
???-?????????? (???. 7).
????????, ??? ????????? ??????? ?
????????????? ???? ????? ??????? ?????-
????????? ?????????? (??? ?????????
??????????????? ?????????? ??????? ???????? ??? ????????? ???????????) ???????
??????????????? ????????????.
? ?????, ?????????? ?????????????, ?????????? ????, ?? ?????? ????????? ????????????? ? ????????? ????????? ??????
# 429 #
Copyright ??? «??? «??????» & ??? «A???????? K????-C?????»
?.?. ??????, ?.?. ?????? ?????????? ? ?????????????: ?????????? ??? ????????? ???????
??????????
???????????? ????????? ??????? ??????
??????? ? ?????? ?? ?????? ???????? ??????
? ????????? ??????? ????????? ??????? ??????? ??????? ? ????????????? ???????????.
????????, ??? ??????? ??????? ???????? ?
??????? ??? ?????????? ?????, ?????????? ? ?????????????? ???????? ????????????
? ????????? ?? ???? ??????????????? ????
??????????? ?????? ?????????? ?????????,
???????? ? ?????? ???????????????? ????????????? ????????? ?????????? ? ???(?)
?:???-???????????????.
????????????
????? ???????? ?????????? ?????????? ?
???????????? ??? ??? ?????????? ?????????? ???????? ??????? ??????????? ??????????? ???????????? ????????? ?????????????????? ????? ? ??? ?????????? ?
??????????????? ???????????? ????-??????.
??????????? ??????? ????????? ????????
?? ??????? ??? ? ???????? ???????????
????????? ? ?????????? ??????? ?????????
??????? ?????????? ??????????????? ???????, ??????? ????? ??????????? (?? 40 ? ????? ???) ???????????? ? ?????????????????
????? ???????, ?? ??????? ??????? ?????????????? ????????????? ??????????
?????????????????? ??????????? ?????????? ?????? ??? ? ???????? ?????????? ???
????????????. ? ????? ?????????? ??????????? ???????????? ?????????? ???????????
?????????? ?????????? ??? ??? ????????????? ??????????????????? ??????????.
????????????? ?????????, ?? ? ????? ??????????? ??? ???????? ???????????? ?????????? ?? ?????? ???? ?????????.
?????????????? ???? ?????? ???????
?????????????? ???????????? ???????????
????????? ????-??????? ?? ?????? ????????? ???-?????????? ? ?????????? ???????
? ????? ????. ? ???? ????? ?????????? ??????? ????????? ????? ???????????? ???????
????? ???????? ?? ??? ???? ????????? ?????
?????? ? ??????????? ?????????? ????????
??????? 
Документ
Категория
Информатика
Просмотров
46
Размер файла
2 515 Кб
Теги
журнал, университета, 2010, 121, биологии, сер, сибирской, федеральное
1/--страниц
Пожаловаться на содержимое документа