close

Вход

Забыли?

вход по аккаунту

?

405.Вестник Тверского государственного университета. Серия Биология и экология №3 2011

код для вставкиСкачать
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
ТВЕРСКОГО
ГОСУДАРСТВЕННОГО
УНИВЕРСИТЕТА
Научный журнал
Основан в 2003 г.
№ 20 , 2011
Зарегистрирован в Верхне-Волжском региональном территориальном
управлении МПТР РФ ПИ № 5-0914 от 31.05.2004 г.
Серия «Биология и экология»
Выпуск 23
2011
Учредитель
ГОСУДАРСТВЕННОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ
ВЫСШЕГО ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ
«ТВЕРСКОЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ»
Редакционный совет:
Председатель А.В. Белоцерковский
Зам. председателя Г.А. Толстихина
Члены редакционного совета:
Е.Н. Брызгалова, Б.Л. Губман, А.А. Залевская, И.Д. Лельчицкий,
Т.Г. Леонтьева, Д.И. Мамагулашвили, Л.Е. Мошкова, Ю.Г. Папулов,
Б.Б. Педько, А.Я. Рыжов, А.А. Ткаченко, Л.В. Туманова, А.В. Язенин
Редакционная коллегия серии:
д-р биол. наук, проф. А.Я. Рыжов (отв. редактор),
д-р биол. наук, проф. В.И. Миняев,
действительный член РАМН, д-р мед. наук, проф. В.М. Баранов,
д-р биол. наук, проф. А.Н. Панкрушина,
д-р биол. наук В.И. Николаев, д-р биол. наук Н.П. Александрова,
канд. биол. наук, проф. С.М. Дементьева (декан биол. ф-та),
д-р биол. наук, проф. А.В. Зиновьев, канд. биол. наук, доц. Л.В. Петухова,
канд. биол. наук С.А. Иванова (отв. секретарь),
канд. биол. наук, доц. А.А. Нотов (зам. отв. редактора),
канд. биол. наук, доц. М.Н. Самков, канд. биол. наук, доц. А.С. Сорокин,
Д.И. Игнатьев (техн. редактор)
Адрес редакции:
Россия, 170100, Тверь, ул. Желябова, 33.
Тел. РИУ: (4822) 35-60-63
Все права защищены. Никакая часть этого издания не может быть
репродуцирована без письменного разрешения издателя.
© Тверской государственный
университет, 2011
-1-
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Журнал «Вестник Тверского государственного университета.
Серия Биология и экология» решением Президиума ВАК включен в
Перечень российских рецензируемых научных журналов в редакции 2010
года, в которых должны быть опубликованы основные научные
результаты диссертаций на соискание ученых степеней доктора и
кандидата наук.
-2-
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
СОДЕРЖАНИЕ
ФИЗИОЛОГИЯ
Панов С.Ф., Ширяев А.В.
Реакция желудочных желез у спортсменов-борцов
на специальную тренировочную нагрузку ................................................ 7
Баранов В.М., Миняева А.В., Миняев В.И., Колесников В.И.,
Попова Ю.А., Суворов А.В.
Особенности произвольного управления дыхательными движениями
в условиях длительного космического полета ........................................ 17
Данилова Г.А., Александрова Н.П.
Влияние интерлейкина-1β на вентиляторную чувствительность
к гиперкапнии ............................................................................................. 29
ФИЗИОЛОГИЯ ТРУДА
Степанян И.В., Денисов Э.И.
Применение нейросетевых технологий в физиологии,
медицине труда и экологии человека ....................................................... 37
Галимов А.Р., Степанов Е.Г., Баязитова Г.И., Фасиков Р.М.
Место здоровья в структуре нравственных ценностей врачей
Башкортостана ............................................................................................ 48
БИОХИМИЯ
Толстых К.Ю., Панкрушина А.Н.
Динамика эстрона в крови в период беременности ................................ 60
Миллер Т.М., Петрова М.Б., Миллер Д.А., Некрасова И.Л.
Изменение биологических уровней щелочной фосфотазы сыворотки
крови при хроническом воспалении слизистой оболочки желудка ...... 69
Янов И.Ю., Быков А.В., Ожимкова Е.В., Сульман Э.М.
Рентгенофотоэлектронный анализ адсорбции фосфоротиоатных
олигомеров ДНК на поверхности золота ................................................. 74
БОТАНИКА
Головина Е.О.
Луговые степи юго-востока Тульской области ....................................... 83
-3-
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Ткачева Е.В.
Прогноз динамики расширения вторичного ареала
Lupinus polyphyllus в Средней России .................................................... 108
Дементьева С.М., Нотов А.А., Зуева Л.В., Иванова С.А.
О ботанико-географической специфике флоры
Валдайской возвышенности ................................................................... 114
БИОРАЗНООБРАЗИЕ И ОХРАНА ПРИРОДЫ
Коткова В.М.
Новые данные об афиллофоровых грибах Бологовского района
Тверской области ..................................................................................... 129
Степанчикова И.С., Куква М., Нотов А.А., Гимельбрант Д.Е.
Новые данные о лихенофлоре Тверской области ................................. 137
Тарунина Л.Г., Гимельбрант Д.Е., Науменко Н.И.
Виды лишайников, предлагаемые для внесения в Красную книгу
Курганской области ................................................................................. 143
МЕЖДИСЦИПЛИНАРНЫЕ ИССЛЕДОВАНИЯ
Мейсурова А.Ф., Хижняк С.Д., Пахомов П.М.
Анализ воздействия нитрата аммония на индикаторые лишайники
с помощью метода Фурье-ИК спектроскопии ...................................... 150
-4-
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
CONTENT
PHYSIOLOGY
Panov S.F., Shiryaev A.V.
Reaction of the gastric secretion of athlete-fighters to special
training loading .............................................................................................. 7
Baranov V.M., Minyaeva A.V., Minyaev V.I., Kolesnikov V.I., Popova U.A.,
Suvorov A.V.
Features of voluntary control of respiratory movements in the conditions
of long space flight ....................................................................................... 17
Danilova G.A., Aleksandrova N.P.
Influence interleukin-1β on ventilatory sensitivity to hypercapnia ............. 29
PHYSIOLOGY OF WORK
Stepanyan I.V., Denisov E.I.
Application of neural networks in physiology, occupational health
and human ecology ...................................................................................... 37
Galimov A.R., Stepanov E.G., Bayazitova G.I., Fasikov R.M.
Place of health and its self-assessment in the structure of moral values
of Bashkortostan physicians’ ....................................................................... 48
BIOCHEMISTRY
Tolstykh C.Yu., Pankrushina A.N.
Estrone dynamics in blood during pregnancy .............................................. 60
Miller T.M., Petrova M.B., Miller D.A., Necrasova I.L.
The change of biological levels of blood serum alkaline phosphotase
in chronic inflammation in mucosa of stomath ............................................ 69
Yanov I.Yu., Bykov A.V., Ozhimkova E.V., Sulman E.M.
X-ray photoelectron spectroscopy analysis of the phosphorothioate DNA
oligomeres adsoption on the gold surface .................................................... 74
BOTANY
Golovina E.O.
Meadow steppes of the south-eastern part of Tula region ........................... 83
-5-
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Tkacheva E.V.
Forecasting on the expansion of Lupinus polyphyllus in its secondary
distribution range in the Middle Russia ..................................................... 108
Dementyeva S.M., Notov A.A., Zueva L.V., Ivanova S.A.
About btanico-geofraphical specificity of the florae of Valdai hills ......... 114
BIODIVERSITY AND NATURAL CONSERVATION
Kotkova V.M.
New data on aphyllophoraceous fungi of Bologovskii district
of Tver region ............................................................................................ 129
Stepanchikova I.S., Kukwa M., Notov A.A., Himelbrant D.E.
New data on the lihen flora of Tver region ................................................ 137
Tarunina L.G., Himelbrant D.E., Naumenko N.I.
Lichen species, proposed for Red Data Book of Kurgan region .............. 143
INTERDISCIPLINARY STUDIES
Meysurova A.F., Khizhnyak S.D., Pakhomov P.M.
Effect of ammonium nitrate on indicator lichens studied by means
of FITR spectroscopy................................................................................. 150
-6-
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20. С. 7-16.
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
ФИЗИОЛОГИЯ
УДК 612.323
РЕАКЦИЯ ЖЕЛУДОЧНЫХ ЖЕЛЕЗ
У СПОРТСМЕНОВ-БОРЦОВ
НА СПЕЦИАЛЬНУЮ ТРЕНИРОВОЧНУЮ НАГРУЗКУ
С.Ф. Панов, А.В. Ширяев
Липецкий государственный педагогический университет
Обсуждаются вопросы адаптации желудочных желез к специальной
тренировочной нагрузке (соревновательные поединки) у спортсменовборцов. Установлены различия в адаптации к специальной нагрузке
желудочных желез в зависимости от весовой категории, стажа занятий и
возраста спортсменов. Обнаружена взаимосвязь в реакции на нагрузку
желудочных и эндокринных желез. Устойчивость к специальной
нагрузке желудочных желез у борцов средней весовой категории
сочетается с сохранением эндокринного гомеостаза. У борцов легкой и
полутяжелой весовой категории их высокая чувствительность сочетается
с увеличением в сыворотке крови гастрина, альдостерона и со
снижением кортизола.
Ключевые слова: желудочная секреция, специальная тренировочная
нагрузка, адаптация.
Введение. Показатели секреторной функции пищеварительных
желез у спортсменов различного возраста и уровня тренированности
изучались А.А. Плешаковым и продолжают исследоваться его
учениками [2; 5; 8; 11]. Большая часть исследований посвящена
изучению реакции пищеварительных желез у спортсменов различных
спортивных специализаций, с разным уровнем двигательной активности
[1–3; 5; 6; 8; 11]. Изучалась секреторная функция желудка у людей в
условиях покоя [2; 5; 7; 8; 11], в период эмоционального стресса (сдача
экзаменов в вузе) [3], после дозированной велоэргометрической
нагрузки различной мощности [1; 6; 8; 11] и после воздействия
термонагрузки (парная баня) [5], в условиях спортивного и
постспортивного онтогенеза [6; 7]. Данных по реакции желудочных
желез на специальную тренировочную нагрузку (соревновательные
поединки) в доступной нам литературе не обнаружены. В связи с этим,
изучение показателей желудочной секреции у спортсменов-борцов
после соревновательных поединков и явилось целью настоящего
исследования.
Материал и методика. В исследовании участвовало 87
спортсменов высокой спортивной квалификации (КМС, МС), давших
добровольное согласие на участие в эксперименте (совершеннолетние
-7-
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
испытуемые сами давали письменные информированные согласия;
несовершеннолетние испытуемые участвовали в исследованиях с
письменного информированного согласия родителей). Все испытуемые
относились к основной медицинской группе, состояли на учете в
областном врачебно–физкультурном диспансере, где проходили
медицинский осмотр ежегодно. При формировании групп испытуемых
учитывались результаты обследований, проводившихся на базе
Липецкого областного врачебно-физкультурного диспансера. При этом
учитывалось
следующее:
отсутствие
желудочно-кишечных
заболеваний; наличие нормального аппетита и стула; отсутствие какихлибо заболеваний других органов.
По условиям исследования желудочной секреции было
скомплектовано 4 группы испытуемых в зависимости от весовой
категории: легкая весовая категория (ЛВК) от 58–71 кг (n=19); средняя
весовая категория (СВК) от 72–80 кг (n=28); полутяжелая весовая
категория (ПТВК) свыше 80 кг (n=28), старшие подростки 15–16 лет
(n=12). В качестве тренировочной нагрузки использовались борцовские
поединки продолжительностью 5 минут (5 поединков). Отдых между
схватками был равен 5 минутам. Тренировочным схваткам на ковре
предшествовала
разминка
продолжительностью
25
минут.
Функциональное состояние желудочных желез в покое и после
соревновательных поединков изучалось методом гастрального
фракционного зондирования [4]. В качестве стимулятора желудочной
секреции использовали 10% отвар сухой капусты в количестве 200 мл.
Определяли объем базального и стимулированного секрета,
концентрацию и дебит-час НСl (титрационным методом), пепсиногена и
суммарной протеолитической активности (методом Хунта в
модификации Б.И. Сабсая) [9].
С целью изучения некоторых эндокринных механизмов
регуляции желудочной секреции в сыворотке крови определяли
содержание гастрина, кортизола, альдостерона, Т3, Т4 в покое и после
специальной тренировочной нагрузки. Концентрацию гормонов
определяли радиоиммуннологически с помощью отечественных и
импортных промышленных наборов в лаборатории радиоактивных
изотопов в Липецкой областной больнице.
Полученные данные обрабатывались методом вариационной
статистики с использованием критерия Стьюдента и расчета
коэффициента корреляции (r). Для статистической и графической
обработки полученных данных и вычисления производных параметров
использовали прикладной пакет программ Sigma/Scan Image, а также
программы Microsoft Graf 97 for Windows и Microsoft Excel.
Результаты и обсуждение. При изучении желудочной секреции
у подростков (15–16 лет), занимающихся спортивной борьбой и у
спортсменов-борцов (18–23 года) различных весовых категорий в
-8-
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
условиях покоя, обнаружено, что у спортсменов-борцов легкой весовой
категории (ЛВК) (табл. 1) самый высокий фоновый уровень в базальном
объеме секрета и базальной суммарной протеолитической активности. У
борцов полутяжелой весовой категории (ПТВК) самый высокий
фоновый уровень обнаружен в стимулированном объеме секрета,
дебитах HCl и пепсиногена (табл. 1). У борцов 15–16 лет самый
высокий фоновый уровень – в базальном дебите-часе HCl и
стимулированной суммарной протеолитической активности (табл. 1). У
борцов СВК обнаруженные нами показатели желудочной секреции
находятся в промежуточных значениях между показателями
желудочной секреции борцов ЛВК и ПТВК.
Специальная
тренровочная
нагрузка
(соревновательные
поединки) у борцов ЛВК достоверно (p<0,05) увеличила
стимулированный объем секрета, дебит-час пепсиногена и суммарную
протеолитическую активность, достоверно (p<0,05) снизила дебит-час
HCl (табл. 1). У борцов СВК достоверно (p<0,05) увеличился дебит-час
базального и стимулированного пепсиногена и базальной и
стимулированной суммарной протеолитической активности. У борцов
ПТВК достоверно (p<0,05) увеличился базальный дебит-час HCl,
базальный
и
стимулированный
пепсиноген
и
суммарная
протеолитическая активность натурального желудочного сока. У борцов
15–16 лет большинство показателей секреции снижались, но
достоверное (p<0,05) снижение обнаружено лишь в стимулированном
дебите-часе HCl, и лишь суммарная (базальная и стимулированная)
протеолитическая активность достоверно (p<0,05) увеличивалась. Такая
реакция желудочных желез у спортсменов-борцов различных весовых
категорий и юных борцов в условиях покоя говорит о степени
адаптации к долговременным факторам (продолжительность занятия
спортивной борьбой) и срочной адаптации (соревновательные
поединки) в зависимости от весовых категорий и возраста
занимающихся.
Данные, представлены в табл. 2, отражают индивидуальные
реакции в секреции различных компонентов желудочного сока у юных
спортсменов-борцов и спортсменов-борцов различных весовых
категорий в ответ на специальную нагрузку (соревновательные
поединки). В зависимости от направленности сдвигов базальной и
стимулированной желудочной секреции А.А. Плешаковым [8] было
выделено пять вариантов реакции желудочных желез на различные
воздействия: 1 – увеличение базальной и стимулированной секреции;
2 – увеличение базальной и угнетение стимулированной секреции;
3 – увеличение стимулированной и угнетение базальной секреции;
4 – отсутствие изменений базальной и стимулированной секреции;
5 – угнетение базальной и стимулированной секреции.
Наши исследования показали, что в процентном соотношении по
-9-
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
этому типу реакции наиболее частым вариантом реакции желудочных
желез у взрослых спортсменов-борцов различных весовых категорий и
юных борцов по показателям сокоотделения, секреции HCl и
пепсиногена является 4-й вариант. У борцов ЛВК по показателям
сокоотделения у 52% испытуемых желудочные железы ответили 4-м
типом реакции, у борцов СВК – 67%, у борцов ПТВК – 32%, у юных
борцов – 16%. По показателям секреции HCl по 4-му типу реакции у
борцов ЛВК отреагировало 42%, у борцов СВК – 75%, у борцов ПТВК –
28%, у юных борцов – 5%. По показателям секреции пепсиногена у
борцов ЛВК по 4-му типу отреагировали 42%, у борцов СВК – 50%, у
борцов ПТВК – 35%, у юных борцов – 58%. По показателям суммарной
протеолитической активности по 4-му типу у борцов ЛВК
отреагировали 10% испытуемых, у борцов СВК – 25%, у борцов ПТВК
– 14%, у юных борцов – 16%.
Таким образом, по показателям реакции желудочных желез
можно выстроить ряды (табл. 3) по степени устойчивости к
специальной нагрузке (соревновательные поединки) у всех групп
испытуемых. Анализируя полученные нами данные (табл. 3), можно
отметить, что наиболее устойчивым к воздействию специальной
тренировочной нагрузки оказались желудочные железы у борцов СВК,
на 2-й позиции – борцы ЛВК, на 3-й – борцы ПТВК, на последнем месте
оказались юные борцы.
В.Г. Сухотерин [10], анализируя удельный вес HCl и
пепсиногена в гидролизе пищевых белков, приходит к выводу о
большем удельном весе фермента, следовательно, адаптация за счет
относительно больших сдвигов секреции пепсиногена имеет некоторые
преимущества по сравнению с адаптацией за счет изменения в
секреции
HCl.
В
наших
исследованиях
(табл.
1)
ферментовыделительная функция желудка после специальной
тренировочной работы (соревновательные поединки) повысилась у всех
групп испытуемых, как в базальном, так и в стимулированном секрете.
Достоверное увеличение обнаружено у борцов СВК и ПТВК в обе фазы
секреции, а у борцов ЛВК только в стимулированном секрете.
Кислотовыделительная функция желудка в большинстве случаев у
борцов различных весовых категорий и юных борцов уменьшилась, а
увеличилась недостоверно (p>0,05) только у борцов СВК, и достоверно
в базальном секрете у борцов ПТВК.
По нашим данным в результате групповых исследований из всех
секреторных компонентов, входящих в состав желудочного сока, самым
устойчивым компонентом секреции к специальной тренировочной
нагрузке оказалась водовыделительная функция желудочной части
секрета. Увеличивается или уменьшается недостоверно (p>0,05) у всех
групп испытуемых за исключением борцов ЛВК, стимулированный
объем секрета у них достоверно (р<0,05) увеличивается.
- 10 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Таблица 1
Показатели желудочной секреции у спортсменов-борцов
в покое и после специальной тренировочной нагрузки (соревновательные поединки) (М±m)
Испытуемые
Условия
покой
Борцы ЛВК
(n=19)
нагрузка
достоверность (p)
покой
Борцы СВК
(n=28)
нагрузка
достоверность (р)
покой
Борцы ПТВК
(n=28)
нагрузка
достоверность (р)
Борцы 15–16 лет покой
(n=12)
нагрузка
достоверность (р)
Суммарная
протеолитическая
активность, мг/час
с
б
с
б
с
112,5±8,06 38,8±4,73 42,9±4,94 8,5±2,40 7,5±1,71
96,7±8,10 39,2±1,58 56,5±3,25 10,3±0,50 26,9±1,26
>0,05
>0,05
<0,05
>0,05
<0,01
103,2±7,74 34,9±5,31 43,2±4,90 4,4±0,81 10,4±1,74
106,9±9,11 50,7±2,94 54,8±3,20 7,2±0,36 15,7±0,82
>0,05
<0,05
<0,05
<0,05
<0,05
120,4±9,25 45,9±5,18 46,8±5,91 4,3±0,65 11,3±2,12
158,1±9,63 57,6±3,34 102,3±10,5 7,4±0,42 20,1±1,45
>0,05
<0,05
<0,01
<0,05
<0,01
119,7±8,83 39,9±3,18 36,1±7,12 4,2±0,78 17,9±2,82
70,3±6,60 46,3±5,24 39,4±2,76 10,6±0,93 24,9±2,10
<0,01
>0,05
>0,05
<0,01
<0,05
Объем секрета, мл/час Дебит-час HCl, мг/час
б
92,0±9,40
93,2±5,17
>0,05
72,9±5,61
76,3±5,30
>0,05
86,9±7,1
70,2±5,25
>0,05
90,1±14,13
79,3±8,14
>0,05
с
97,5±8,40
123,3±7,59
<0,05
91,5±7,51
88,9±6,21
>0,05
100,8±4,57
104,7±8,27
>0,05
91,3±7,83
85,5±7,16
р>0,05
б
53,9±9,70
40,9±2,24
<0,05
65,1±8,87
69,4±4,56
>0,05
66,0±9,4
101,2±7,85
<0,05
68,9±6,25
62,4±5,81
>0,05
Дебит-час
пепсиногена, мг/час
Примечание. б – в условиях базальной секреции; с – в условиях стимулированной секреции; ЛВК – легкая весовая категория (58–71 кг);
СВК – средняя весовая категория (71–80 кг); ПТВК – полутяжелая весовая категория (свыше 80 кг); n – количество участников.
- 11 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Таблица 2
Частота различных вариантов реакции желудочных желез борцов
(по показателям сокоотделения, кислотообразования, ферментовыделения протеолиза)
после специальной тренировочной нагрузки
1
2
3
4
5
1
2
3
Варианты реакций
4
5
1 2 3
Испытуемые
объем секрета, мл/кг
Борцы 15–16 лет
(n=12)
Борцы ЛВК
(n=19)
Борцы СВК
(n=28)
Борцы ПТВК
(n=28)
3
2
5
6
10
3
8
19
9
4
2
8
дебит-час HCl, мг/кг
5
1
2
6
дебит-час
пепсиногена, мг/кг
2
2
1
7
3
2
2
2
8
5
1
1
4
2
21
1
6
7
8
4
8
4
6
4
4
7
2
3
4 5
суммарная
протеолитическая
активность, мг/кг
3
6
12
10
6
2
6
14
16
5
4
8
10
6
5
2
1
2
1
7
12
4
1
Примечание. n – количество участников; ЛВК – легкая весовая категория (58–71 кг); СВК – средняя весовая категория (71–80 кг); ПТВК –
полутяжелая весовая категория (свыше 80 кг).
- 12 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Таблица 3
Устойчивость к воздействию специальной тренировочной нагрузки
борцов по показателям желудочной секреции
Адаптация по
показателям секреции
Сокоотделение
Кислотность
Ферментовыделение
Протеолиз
борцы
СВК
(n=19)
I
I
I
I
Группы испытуемых
борцы
борцы
ЛВК
ПТВК
(n=28)
(n=28)
II
III
II
III
III
IV
IV
III
юные
борцы
(n=12)
IV
IV
II
II
Самой
чувствительной
к
воздействию
специальной
тренировочной нагрузки оказалась секреция HCl, которая реагирует на
нагрузку у испытуемых всех групп. У борцов ЛВК уменьшается:
достоверно (р<0,05) в базальном секрете и недостоверно (p>0,05) – в
стимулированном. У борцов ПТВК повышается достоверно (р<0,05) в
базальном секрете и недостоверно (p>0,05) – в стимулированном. У
юных борцов уменьшается: в базальном – недостоверно, в
стимулированном – достоверно. У борцов СВК изменения не
достоверные.
Таблица 4
Содержание гормонов в сыворотке крови у спортсменов-борцов
в покое (в абсолютных показателях)
и после специальной тренировочной нагрузки
(в абсолютных показателях и в % к покою) (М±m)
Содержание гормонов в сыворотке крови
кортизол,
альдостерон,
Возраст Группы
Т3, пг/мл Т4, пг/мл
нмоль/мл
пг/мл
%
%
%
%
В покое
18–23
I (n=19) 36,5±3,7 1078,4±109,4
168,4±12,4
1,7±0,2
124,6±5,2
года
II (n=28) 42,6±5,6
802,7±115,6
141,7±12,0
1,4±0,1
135,4±10,5
III (n=28) 52,9±5,0
763,0±78,8
130,5±11,6
1,2±0,1
102,9±7,1
После выполнения специальной нагрузки
18–23
I (n=19) 36,8±3,1
723,5±34,1*
172,4±10,7
1,82±0,10 112,8±10,1
года
100,8%
67%
102%
107%
91%
II (n=28) 42,9±4,4
758,2±26,4
150,3±12,1
1,51±0,08 134,1±11,6
100,7%
94,4%
106%
107%
99%
III (n=28) 49,6±5,2
594,2±48,3*
154,2±14,4
1,08±0,08 110,5±9,4
93,7%
77,8%
118%
90%
107,3%
Примечание.* – p<0,05; достоверность различий по отношению к уровню покоя;
n - количествово испытуемых; I – борцы легкой весовой категории; II – борцы
средней весовой категории; III – борцы полутяжелой весовой категории.
гастрин,
пг/мл
%
- 13 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Высокая устойчивость характерна для секреции пепсиногена и
никогда не опускается ниже фонового уровня. Высокой устойчивости в
секреции пепсиногена оказалось достаточно, чтобы обеспечить
увеличение суммарной протеолитической активности у всех групп
спортсменов различной весовой категории, в том числе и у юных
борцов. Корреляционный анализ показал, что теснота связи между
различными показателями секреции после специальной тренировочной
нагрузки отражает уровень адаптации к данной выполненной работе.
Самая низкая согласованность между различными показателями
секреции обнаружена у юных борцов (r=0,19–0,37); самая высокая – у
борцов ПТВК (r=0,51–0,64). Средний уровень согласованности (r=0,41–
0,48) – у борцов ЛВК и СВК.
Устойчивость секреторного аппарата желудка к воздействию
специальной нагрузки у борцов СВК сочетается с отсутствием
достоверных сдвигов в концентрации гормонов в сыворотке крови
(табл. 4). Заметно чувствительнее к тренировочной нагрузке борцы
ЛВК: достоверное снижение дебит-час HCl (p<0,05) в базальном секрете
сочетается с недостоверным увеличением концентрации гастрина и
альдостерона и достоверным снижением кортизола. И лишь содержание
Т3 и Т 4 в сыворотке крови существенными сдвигами не отличается.
Более высокая чувствительность секреторного аппарата желудка
обнаружена у борцов ПТВК. Достоверное увеличение базального и
недостоверное увеличение стимулированного дебит-часа HCl и дебитчас пепсиногена (табл. 1) на воздействие специальной нагрузки
сочетается у них с достоверным снижением концентрации гастрина,
кортизола и Т3 в сыворотке крови и достоверным увеличением
альдостерона (табл. 4).
Заключение. Таким образом, наши исследования показывают,
что долговременная и срочная адаптация желудочных желез у
спортсменов-борцов на специальную тренировочную нагрузку
проявляется в многолетнем тренировочном процессе и находится в
прямой зависимости от веса спортсменов и стажа занятий.
Список литературы
1. Кузнецов А.П. Влияние мышечной нагрузки на секреторную
функцию желудка и поджелудочной железы // Физиология человека.
1983. Т. 9. № 69. С. 946–955.
2. Кузнецов А.П. Секреторная функция желудка и поджелудочной
железы у человека при гиперкинезии: автореф. дис. ... д-ра биол.
наук. Томск, 1986. 53 с.
3. Кузнецов А.П., Речкалов А.В. Смелышева Л.Н. Желудочно-кишечный
тракт и стресс: монография. Курган: Изд-во Курган. гос. ун-та, 2004.
- 14 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
254 с.
4. Мясоедов Е.С. Интероцептивные влияния с желудка и прямой кишки
на желудочную секрецию и их значение в диагностике заболеваний
желудочно-кишечного тракта: автореф. дис. ... д-ра мед. наук. Л.,
1954. 25 с.
5. Панов С.Ф. Желудочная секреция у юных и взрослых спортсменовборцов: автореф. дис. … канд. биол. наук. Томск, 1995. 35 с.
6. Панов С.Ф., Плешаков А.А. Реакция желез желудка у спортсменовборцов 7–32 лет на велоэргометрическую нагрузку пороговой
мощности // Физиология человека. 2008. Т. 35, № 4. С. 141–148.
7. Панов С.Ф., Плешаков А.А., Глазаткина М.С., Вакуло И.А.
Желудочная секреция у спортсменов-борцов 7–32 лет // Физиология
человека. 2009. Т. 35. № 2. С. 88–95.
8. Плешаков А.А. Желудочная секреция у спортсменов: автореф. дис. ...
д-ра биол. наук. Ярославль, 1974. 42 с.
9. Сабсай
Б.И.
Определение
протеолитической
активности
желудочного сока, крови и мочи единым методом // Лабораторное
дело. 1968. Вып. 4. С. 241–242.
10. Cухотерин В.Г. Ферментовыделительная деятельность желудка, ее
регуляция и роль в начальном гидролизе пищевых белков: автореф.
дис. … д-ра биол. наук. Томск, 1982. 42 с.
11. Ширяев А.В. Желудочная секреция у подростков при гипердинамии:
автореф. дис. … канд. биол. наук. Томск, 1993. 25 с.
REACTION OF THE GASTRIC SECRETION OF
ATHLETE-FIGHTERS TO SPECIAL TRAINING LOADING
S.F. Panov, A.V. Shiryaev
Lipetsk State Pedagogical University
This article is focusing on questions of adaptation gastric glands to special
training loading (competitive fights) at athlete-fighters. The differences in
adaptation to special loading of gastric glands in connection with a weight
category, the experience of and age of sportsmen are established. The
interrelation in reaction to loading of gastric and endocrine glands is found
out. Stability to special loading at fighters average weight category is
combined with preservation endocrine homeostasis. At fighters lightweight
and light-heavy weight category their high sensitivity is combined with
increase in blood whey gastrin, aldesterona, and with a reduction in cortisol.
Keywords: gastral pepsinogen, gastric secretion, special training loading,
adaptation.
- 15 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Об авторах:
ПАНОВ Сергей Федорович–кандидат биологических наук,
доцент кафедры спортивных дисциплин, ГОУ ВПО «Липецкий
государственный педагогический университет», 398020, Липецк, ул.
Ленина, д. 42, e-mail: kafedrasporta@mail.ru
ШИРЯЕВ Александр Васильевич–кандидат биологических наук,
профессор, проректор по учебной работе, заведующий кафедрой
физиологии человека, ГОУ ВПО «Липецкий государственный
педагогический университет», 398020, Липецк, ул. Ленина, д. 42
- 16 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20. С. 17-28.
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
УДК 612.2; 612-06
ОСОБЕННОСТИ ПРОИЗВОЛЬНОГО УПРАВЛЕНИЯ
ДЫХАТЕЛЬНЫМИ ДВИЖЕНИЯМИ
В УСЛОВИЯХ ДЛИТЕЛЬНОГО КОСМИЧЕСКОГО ПОЛЕТА
В.М. Баранов1, А.В. Миняева2, В.И. Миняев2, В.И. Колесников3,
Ю.А. Попова3, А.В. Суворов3
1
НИИ Общей патологии и патофизиологии РАМН
2
Тверской государственный университет
3
Институт медико-биологических проблем РАН
У двоих космонавтов исследована динамика способности к
произвольному управлению дыхательными движениями в условиях
длительного космического полета. Пребывание в невесомости
сопровождается замедлением произвольных дыхательных движений,
некоторым повышением точности, сокращением времени их коррекции
и уменьшением площади рассогласования между дыхательной кривой и
линией выполняемой программы.
Ключевые слова: дыхательные движения, произвольное управление,
невесомость.
Введение. В физиологии произвольными считаются такие
изменения дыхания, которые человек осуществляет по внешнему
приказу (инструкции) или самоприказу и о которых он может дать
словесный самоотчет [3]. Система произвольного управления
дыхательными движениями принципиально не отличается от системы
управления соматическими движениями [4]. Как произвольные, так и
непроизвольные дыхательные движения обусловлены деятельностью
дыхательной мускулатуры. Однако дыхательные мышцы являются
одновременно и эффекторами автоматической системы регуляции
дыхания. В определенных условиях произвольное управление
дыхательными мышцами ограничено в отличие от других скелетных
мышц. В условиях длительного пребывания в невесомости у
космонавтов
наблюдается
детренированность
дыхательной
мускулатуры [2]. Снижение работоспособности дыхательных мышц
может проявляться не только в нарушении их вентиляторной функции,
но и, возможно, в изменении способности к произвольному управлению
ими. Цель работы – выявление динамики способности человека
произвольно управлять дыхательными движениями в условиях
длительного космического полета и в период послеполетной
реабилитации.
Материал и методика. В исследовании приняли участие два
космонавта 15-й экспедиции на МКС. Временные, амплитудные,
точностные параметры произвольных дыхательных движений
- 17 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
регистрировались посредством пневмографа бортового комплекса
«Дыхание-1». Исследования включали шесть серий: до полета, во время
полета на МКС (1, 3 и 4 месяцы), а также в период восстановления
после полета (1 день и 1 месяц). В наземных условиях космонавты
находились в положении сидя, в невесомости – с зафиксированными
нижними конечностями. Исследования проводились в утренний период,
не менее чем через два часа после приема пищи. Исследования
проведены с соблюдением международных требований по
биомедицинской этике.
Для характеристики произвольных дыхательных движений
использовался метод спирокинографии. Спирокинография представляет
собой систему регистрации временных, скоростных и амплитудных
параметров произвольных (заданных) движений [4; 5]. Амплитуда и
последовательность произвольных дыхательных движений задается
специальной программой с сигналом прямоугольной формы, которую
обследуемый посредством инспираторных и экспираторных движений
воспроизводит в режиме слежения на мониторе пневмографа. В
соответствии с предварительной инструкцией обследумый быстро
реагирует на изгиб линии программы – за счет инспираторного (вдох)
или экспираторного (выдох) движения по возможности быстро
переводит курсор на новый уровень) и как можно точнее удерживает
дыхательную кривую на линии программы, добиваясь минимального
рассогласования между ними. Амплитудные и временные параметры
программы устанавливаются с учетом индивидуального паттерна
спонтанных дыхательных движений, которые регистрируются
непосредственно перед сеансом спирокинографии.
В исследовании применены три варианта программ: программа с
амплитудой, равной усредненной амплитуде спонтанных дыхательных
движений, программа с амплитудой равной 1,25 усредненной
амплитуды спонтанных дыхательных движений и программа с
амплитудой, равной 0,75 усредненной амплитуды спонтанных
дыхательных движений. В каждом варианте программы заложено 20
изменений положения линии программы (10 полных дыхательных
циклов), периоды времени между изменениями положения линии
программы в случайном порядке варьировали от 0,75 до 1,25 от
среднего времени спонтанного дыхательного цикла.
Оценивали следующие временные характеристики выполнения
движений: латентный период - время от подачи сигнала к началу
движения до начала движения (с), время движения - время от начала до
окончания движения (с), время коррекции - время от окончания
движения до момента стабильного удерживания дыхательной кривой на
линии программы (с). В качестве характеристик точности выполнения
задания использовались амплитуда движения (доля от спонтанного
дыхательного объема, VT), ошибка с преувеличением - положительная
- 18 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
разница между амплитудой выполненного движения и амплитудой
заданного движения (доля VT) и ошибка с преуменьшением отрицательная разница между амплитудой выполненного движения и
амплитудой заданного движения (доля VT). Также оценивались
скорость движения – изменение амплитуды во времени (VT/с),
успешность выполнения задания – доля успешно выполненных заданий
от общего их количества (%) и площадь рассогласования между
программой и дыхательной кривой (VT*с) (рисунок).
Результаты и обсуждение. В наземных условиях у космонавта
К-ва на первом сеансе исследования временные характеристики
произвольных дыхательных движений с заданной амплитудой, равной
спонтанной, были близкими к среднестатистическим [4; 5] (табл. 1).
Амплитуда произвольных инспираторных и экспираторных движений
существенно не отличалась от заданной программой (99±10 и 95±5%
соответственно). Скорость экспираторных движений была несколько
выше скорости инспираторных движений (табл. 1). Омечено большее
время коррекции движений на выдохе (2,99±0,49 с), чем на вдохе
(2,52±0,47). Успешность выполнения заданных инспираторных
движений была значительно выше, чем экспираторных (табл. 1,
рисунок). При этом площадь рассогласования дыхательных кривых с
линией программы на вдохе и выдохе практически не различалась
(37,55 и 37,88 VT*с).
Уже после месяца пребывания в невесомости было отмечено
статистически достоверное (P<0,05) снижение скорости произвольного
вдоха (до 1,25±0,11 VT/с) и достаточно выраженное снижение скорости
выдоха (до 1,37±0,12 VT/с) (рис. В). При этом время выполнения
движений, как на вдохе, так и на выдохе увеличилось. Снижение
скорости произвольных дыхательных движений сопровождалось
уменьшением времени коррекции (рис. Г). По данным М.А. Алексеева и
А.А. Аскназий [1], медленные точностные движения корригируются по
ходу их выполнения дополнительным усилием (или ослаблением
усилия) агониста на основании афферентной информации о степени
несоответствия начального усилия и его результата. В результате эти
движения выполняются с меньшей ошибкой и на их коррекцию
требуется меньшее время. В результате площадь рассогласования
дыхательных кривых с линией программы на вдохе и выдохе
значительно снизилась до 13,31 и 12,62 VT*с соответственно.
Успешность выполнения произвольных инспираторных движений
практически не изменилась, экспираторных – значительно возросла до
значений, соответствующих успешности инспираторных движений
(табл. 1, рис. А).
После трех месяцев пребывания в невесомости было отмечено
дальнейшее уменьшение площади рассогласования дыхательных
кривых с линией программы (на вдохе до 6,99 VT*с и на выдохе до 7,25
- 19 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
VT*с). При этом успешность выполнения задания на выдохе не
изменилась, на вдохе – снизилась. Продолжалось дальнейшее снижение
скорости движений, которое в сочетании с уменьшением времени
сопровождалось уменьшением амплитуды до 92% на вдохе и до 88% на
выдохе от заданных величин и, как следствие, увеличением ошибок с
преуменьшением. Вероятно, ошибки с преуменьшением легче
поддаются коррекции за счет дополнительного увеличения скорости
при сохранении направления движения. В результате время коррекции
движений продолжало статистически достоверно уменьшаться (P<0,05).
Через четыре месяца пребывания в невесомости отмечено
минимальное значение скорости произвольных движений на вдохе
(0,78±0,04 VT/с) и на выдохе (0,70±0,01 VT/с). Однако снижение
скорости компенсировалось достоверным увеличением времени
движения (табл. 1), в результате амплитуда произвольных движений на
вдохе и выдохе практически соответствовала заданной величине
(99±2% и 99±3%). Величина ошибок при воспроизведении заданных
движений уменьшалась (табл. 1) и, как следствие, уменьшалось время
коррекции (рисунок Г). На этом сеансе была отмечена минимальная
площадь
рассогласования
дыхательных
кривых.
Успешность
выполнения заданных инспираторных движений возросла до 80%,
экспираторных – до 70%.
Уже через сутки после приземления отмечено увеличение
скорости заданных дыхательных движений, причем скорость
инспираторных движений оказалась статистически достоверно (P<0,05)
больше скорости экспираторных. Несмотря на увеличение скорости,
уменьшение времени выполнения движений привело к уменьшению
амплитуды до 95±4% от заданной величины на вдохе и 95±2% на
выдохе (табл. 1). Рост величины ошибок с преуменьшением и времени
корректировочных движений привели к увеличению площади
рассогласования дыхательных кривых, как на вдохе, так и на выдохе до
7,09 VT*с (табл. 1, рис. Б). Успешность выполнения задания при этом
практически не изменилась (рис. А).
Через месяц после окончания космического полета отмечен
дальнейший рост скорости дыхательных движений. Так скорость
инспираторных движений увеличилась до 1,60±0,07 VT/с, что
практически соответствует исходному дополетному значению (табл. 1,
рис. В). Скорость экспираторных движений увеличилась до 1,29±0,08
VT/с, что достоверно меньше исходного значения и меньше скорости
произвольного инспираторного движения (табл. 1, рисунок В). Прирост
скорости произвольных движений на вдохе и выдохе сопровождался
значительным увеличением площади рассогласования дыхательных
кривых до 35,22 VT*с и 36,39 VT*с соответственно. Успешность
выполнения задания на вдохе увеличилась до 90%, а на выдохе не
изменилась (табл. 1, рис. А). Таким образом, у космонавта К-ва от
- 20 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
сеанса к сеансу отмечено повышение доли успешно выполненных
дыхательных движений на вдохе от 45 до 90%, на выдохе – от 25 до
70% , что говорит о формировании двигательного навыка [2].
Отличительной
особенностью
точностных
циклических
(повторяющихся) движений является повышение точности (коррекция)
последующих движений в процессе их многократного повторения, что
происходит в основном за счет стабилизации начального усилия
агониста [1; 6]. Эта особенность также присуща заданным точностным
инспираторным и экспираторным движениям [4]. В условиях
невесомости произвольные дыхательные движения характеризуются
меньшей скоростью и временем коррекции. Выявлено закономерное
снижение площади рассогласования дыхательных кривых на вдохе и
выдохе в условиях невесомости и полное восстановление их значений
уже через месяц после окончания космического полета.
У космонавта Ю-на, в связи с отсутствием фоновых (до полета)
обследований получить полную картину влияния невесомости на
выполнение произвольных дыхательных движений не удалось. Однако
у него можно отметить общую тенденцию снижения скорости
произвольных дыхательных движений, времени корректировочных
движений и площади рассогласования дыхательных кривых от сеанса к
сеансу в условиях космического полета и их прирост в течение первого
месяца послеполетного периода (табл. 1, 2).
Увеличение амплитуды задания (до 1,25 от спонтанной) у
космонавта К-ва сопровождалось типичными [5] изменениями
параметров произвольных дыхательных движений. Общая успешность
выполнения задания, как на вдохе, так и на выдохе была выше, чем при
амплитуде движений равной спонтанной, однако на первом сеансе
(перед полетом) была отмечена очень низкое значение успешности
(табл. 1, 2). Как экспираторные, так и инспираторные движения с
амплитудой 1,25 спонтанной характеризуются большей скоростью и
большим временем. Скорость движений на вдохе была значительно
больше, чем на выдохе. Увеличение амплитуды заданных
инспираторных
и
экспираторных
движений
сопровождалось
значительно более выраженными ошибками с преуменьшением. Также
было отмечено снижение площади рассогласования дыхательных
кривых, как на вдохе, так и на выдохе (табл. 1, 2).
От сеанса к сеансу отмечен значительный прирост успешности
выполнения задания. Так, у космонавта К-ва на вдохе она
увеличивается с 30% на первом, до 100% на 5 сеансе, а на выдохе – с
10% на первом до 100% уже на 4 сеансе (табл. 2). В условиях
космического полета наблюдалось синхронное снижение скоростей
инспираторных и экспираторных движений, в результате скорость
движений на вдохе оставалась выше, чем на выдохе (табл. 2).
- 21 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
100
%
у.е.
40
А
Б
80
30
60
20
40
10
20
0
0
до
полета
2,5
1 мес.
3 мес.
в полете
4 мес.
1 день
1 мес.
после полета
до полета 1 мес.
VT/c
3,5
В
3 мес.
в полете
4 мес.
1 день
1 мес.
после полета
с
Г
3
2
2,5
1,5
2
1,5
1
1
0,5
0,5
0
0
до полета
1 мес.
3 мес.
в полете.
4 мес.
1 день
1 мес.
после полета
до полета
1 мес.
3 мес.
в полете
4 мес.
1 день
после полета
1 мес.
Р и с у н о к . Динамика параметров заданных инспираторных (сплошная линия) и экспираторных (штриховая линия) движений с амплитудой
равной, усредненной амплитуде спонтанных дыхательных движений, в условиях длительного космического полета (M±m).
Испытуемый К-в. А – успешность выполнения задания, Б – площадь рассогласования, В – скорость движения, Г– время коррекции
- 22 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Таблица 1
Динамика параметров заданных дыхательных движений с амплитудой равной усредненной амплитуде
спонтанных дыхательных движений в условиях длительного космического полета (M±m)
Условия
До полета
1 месяц
В полете
3 месяца
4 месяца
1 сутки
После
полета
1 месяц
До полета
1 месяц
В полете
3 месяца
4 месяца
1 сутки
После
полета
1 месяц
Латентный
период
(с)
Время
движения
(с)
Амплитуда
движения
(VT)
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
0,83±0,07
1,04±0,09
0,80±0,05
0,92±0,06
0,45±0,30
0,79±0,05
0,74±0,06
0,90±0,07
0,68±0,12
0,97±0,06
0,62±0,10
0,62±0,08
0,78±0,04
0,65±0,08
0,68±0,03
0,67±0,30
1,28±0,04*
0,63±0,12
0,76±0,05
0,99±0,08
0,62±0,04
0,68±0,15
0,99±0,10
0,96±0,09
0,86±0,17
0,92±0,10
0,64±0,28
0,99±0,02
0,98±0,03
0,95±0,04
1,04±0,13
0,98±0,04
0,89±0,16
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
0,84±0,08
0,86±0,08
0,63±0,11
0,79±0,12
0,54±0,25
0,86±0,08
0,62±0,04
0,78±0,09
0,55±0,15
0,90±0,04
0,65±0,06
0,65±0,10
0,76±0,07
1,01±0,15
0,77±0,03
1,19±0,07
1,41±0,03*
0,59±0,15
0,93±0,06
1,07±0,21
0,73±0,05
0,82±0,08
0,95±0,05
1,03±0,10
0,79±0,16
0,88±0,06
0,99±0,12
0,99±0,03
0,81±0,11
0,95±0,02
0,89±0,17
0,92±0,05
0,86±0,07
Космонавт
Скорость
движения
(VT/c)
ВДОХ
1,80±0,19
1,25±0,11*
1,24±0,20
1,38±0,17
0,97±0,05
0,78±0,04*
2,05±0,42
1,29±0,07*
1,05±0,08
1,60±0,07
1,64±0,29
ВЫДОХ
1,94±0,27
1,37±0,12
0,75±0,09
1,13±0,07*
0,83±0,12
0,70±0,01*
1,70±0,23
1,06±0,08*
0,87±0,11
1,29±0,08*
1,13±0,14
Время
коррекции
(c)
Ошибка
(VT)
Успешность
(%)
Площадь
рассогласования
(VT*c)
2,52±0,47
1,51±0,27
1,62±0,34
0,74±0,16*
1,05±0,53
0,55±0,22*
0,72±0,26
1,31±0,38
0,92±0,27
0,95±0,33*
1,39±0,39
0,05±0,07
-0,03±0,07
-0,05±0,07
-0,07±0,05
-0,13±0,15
-0,03±0,02
-0,08±0,04
-0,04±0,03
-0,11±0,06
-0,02±0,04
-0,13±0,05
45
40
10
20
0
80
50
70
10
90
30
37,55
13,31
37,47
6,99
8,07
4,00
3,47
7,09
14,23
35,22
115,40
2,99±0,49
1,62±0,32*
1,58±0,27
0,97±0,23*
0,88±0,37
0,57±0,23*
1,37±0,15
0,70±0,21*
1,05±0,29
1,86±0,41
1,52±0,17
-0,02±0,05
0,03±0,08
-0,08±0,10
-0,10±0,06
0,15±0,06
0,00±0,02
-0,02±0,08
-0,02±0,02
0,04±0,09
-0,03±0,06
0,09±0,14
25
40
10
40
0
70
20
70
10
70
50
37,81
12,62
37,41
7,25
7,37
4,07
3,16
7,09
14,39
36,39
13,96
Примечание. В данной и последующих таблицах * – достоверность различий с параметрами движений до полета (P<0,05), курсив – достоверность различий
параметров движений на вдохе и выдохе (P<0,05), жирный шрифт – достоверность различий с параметрами движений с амплитудой спонтанного
дыхательного объема (P<0,05).
- 23 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Таблица 2
Динамика параметров заданных дыхательных движений с амплитудой равной 1,25 усредненной амплитуды
спонтанных дыхательных движений в условиях длительного космического полета (M±m)
Условия
До полета
1 месяц
В полете
3 месяц
4 месяц
1 сутки
После полета
1 месяц
До полета
1 месяц
Невесомость
3 месяц
4 месяц
1 сутки
Восстановление
Латентный
период
(с)
Время
движения
(с)
Амплитуда
движения
(VT)
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
0,97±0,06
0,94±0,06
0,70±0,04
0,75±0,09
0,88±0,12
0,84±0,06
0,61±0,04
0,88±0,06
0,76±0,11
0,93±0,06
0,65±0,04
0,73±0,08
0,86±0,04
0,58±0,06
0,76±0,10
0,94±0,09
1,16±0,07*
0,44±0,08
0,95±0,06*
1,18±0,09
0,67±0,07
0,44±0,04
1,24±0,11
1,13±0,04
1,16±0,13
1,02±0,12
1,10±0,15
1,08±0,04
1,20±0,12
1,24±0,02
1,24±0,15
1,14±0,03
1,03±0,07
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
0,93±0,14
0,82±0,07
0,62±0,07
0,66±0,03*
0,79±0,11
0,74±0,05
0,66±0,06
0,85±0,07
0,65±0,10
0,98±0,05
0,73±0,04
0,82±0,18
1,02±0,11
1,02±0,15
0,83±0,06
0,84±0,16
1,43±0,05
0,43±0,07
1,02±0,10
1,25±0,07
0,79±0,07
0,41±0,05
1,02±0,12
1,13±0,07
1,24±0,12
1,15±0,04
0,87±0,12
1,20±0,02*
1,13±0,06
1,09±0,08
1,17±0,08
1,14±0,05
1,05±0,09
Космонавт
1 месяц
- 24 -
Скорость
движения
(VT/c)
ВДОХ
1,83±0,24
1,32±0,05
2,04±0,22
1,53±0,20
1,26±0,26
0,94±0,03*
3,40±0,61
1,35±0,08
1,07±0,12
1,87±0,20
2,39±0,17
ВЫДОХ
1,44±0,19
1,20±0,12
1,30±0,13
1,42±0,09
1,20±0,31
0,85±0,03*
3,13±0,60
1,10±0,06
0,96±0,10
1,49±0,10
2,86±0,46
Время
коррекции
(c)
Ошибка
(VT)
Площадь
Успешность
рассогласования
(%)
(VT*c)
2,44±0,54
1,09±0,26*
1,69±0,17
0,89±0,24*
0,56±0,17
0,72±0,23*
1,28±0,32
0,36±0,19*
0,93±0,13
1,29±0,41
1,64±0,24
-0,02±0,11
-0,14±0,05
-0,21±0,09
-0,27±0,18
-0,22±0,15
-0,19±0,04
-0,05±0,10
-0,02±0,02
-0,36±0,06
-0,10±0,02
-0,20±0,03
30
40
20
40
10
70
40
100
0
90
10
27,66
10,54
28,58
5,99
6,23
3,59
3,07
5,29
12,82
30,23
95,14
4,02±0,65
0,64±0,22*
1,54±0,19
0,24±0,04*
0,68±0,15
0,44±0,19*
1,14±0,28
0,72±0,19*
0,85±0,15
0,97±0,34*
1,63±0,23
-0,19±0,12
-0,08±0,02
-0,08±0,06
-0,08±0,02
-0,06±0,07
-0,04±0,02
-0,15±0,07
-0,06±0,03
0,26±0,04
-0,07±0,05
-0,05±0,08
10
70
0
70
20
100
40
90
0
60
20
30
9,74
28,34
5,43
5,80
3,28
2,76
4,85
11,91
27,84
90,93
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Таблица 3
Динамика параметров заданных дыхательных движений с амплитудой равной 0,75 усредненной амплитуды
спонтанных дыхательных движений в условиях длительного космического полета (M±m)
Условия
До полета
1 месяц
В полете
3 месяц
4 месяц
После
полета
1 сутки
1 месяц
До полета
1 месяц
В полете
3 месяц
4 месяц
После
полета
1 сутки
1 месяц
Латентный
период
(с)
Время
движения
(с)
Амплитуда
движения
(VT)
Скорость
движения
(VT/c)
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
1,12±0,07
1,12±0,08
0,73±0,06
0,93±0,03*
0,81±0,05
0,77±0,07*
0,45±0,08
1,04±0,07
0,94±0,16
0,97±0,12
0,55±0,07
0,69±0,12
0,64±0,05
0,56±0,06
0,64±0,04
0,58±0,12
0,85±0,05
0,47±0,08
0,66±0,04
1,04±0,07
0,41±0,06
0,56±0,15
0,72±0,05
0,81±0,03
0,76±0,09
0,85±0,07
0,69±0,04
0,74±0,02
0,61±0,06
0,75±0,05
0,79±0,04
0,68±0,07
0,76±0,07
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
К-в
Ю-н
1,10±0,10
0,78±0,08*
0,73±0,06
0,70±0,06*
0,73±0,12
0,64±0,06*
0,51±0,06
0,90±0,08*
0,60±0,14
0,86±0,10*
0,67±0,03
0,69±0,10
0,67±0,06
0,57±0,07
0,66±0,09
1,00±0,22
1,19±0,05*
0,49±0,10
0,88±0,12
1,04±0,17
0,58±0,07
0,49±0,08
0,64±0,03
0,72±0,03
0,75±0,08
0,77±0,08
0,97±0,29
0,76±0,02
0,63±0,06
0,70±0,05
0,72±0,05
0,76±0,06
0,83±0,09
1,20±0,14
1,32±0,10
1,44±0,17
1,39±0,13
1,54±0,40
0,89±0,05*
1,53±0,23
1,16±0,07
0,77±0,05
1,80±0,36
1,94±0,44
ВЫДОХ
1,06±0,14
1,12±0,08
1,58±0,31
1,22±0,10
1,04±0,16
0,64±0,04*
1,56±0,26
0,85±0,08
0,86±0,22
1,36±0,14
1,86±0,20
Космонавт
- 25 -
Время
коррекции
(c)
ВДОХ
4,06±0,48
1,34±0,21*
1,21±0,33
0,51±0,08*
0,96±0,20
1,50±0,24*
1,38±0,21
1,65±0,33*
0,76±0,19
2,32±0,36*
1,82±0,23
Ошибка
(VT)
Успешность
(%)
Площадь
рассогласования
(VT*c)
-0,04±0,05
0,04±0,02
0,05±0,05
-0,02±0,06
-0,11±0,07
-0,04±0,02
-0,07±0,07
-0,01±0,04
-0,18±0,04
-0,06±0,05
0,00±0,08
15
70
0
40
20
50
20
60
0
30
0
47,92
16,16
50,86
8,25
10,07
5,39
4,29
8,85
19,62
44,79
150,52
3,99±0,39
2,10±0,23*
1,05±0,36
1,00±0,20*
1,13±0,20
1,25±0,30*
1,18±0,24
1,17±0,30*
0,79±0,30
2,27±0,30*
1,89±0,22
-0,06±0,05
-0,01±0,03
-0,04±0,02
-0,09±0,07
-0,07±0,07
0,03±0,01
-0,09±0,04
0,01±0,04
0,21±0,04
-0,01±0,06
-0,01±0,02
30
30
20
50
0
60
20
70
0
50
0
46
17,17
50,23
8,94
10,89
5,34
4,16
8,39
16,92
44,79
154,86
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Отмечено снижение времени коррекции и площади
рассогласования дыхательных кривых. В течение первого месяца
послеполетного восстановления все характеристики произвольных
дыхательных движений возвращаются к исходным величинам.
Снижение амплитуды задания (до 0,75 от спонтанной) также
сопровождалось типичными [3; 5] изменениями характеристик
произвольных дыхательных движений. Так, инспираторные и
экспираторные произвольные движения характеризовались меньшей
скоростью, меньшим временем, более низкой успешностью и большей
площадью рассогласования (табл. 1, 3). Скорость движений на вдохе
была больше скорости движений на выдохе.
От сеанса к сеансу отмечено увеличение успешности выполнения
задания. Однако, по данным лучших в этом исследовании сеансов доля
успешно выполненных дыхательных движений не превышает 70%, как
на вдохе, так и на выдохе (табл. 3).
В условиях невесомости, на первом и третьем месяцах
космического полета отмечено увеличение скорости произвольных
инспираторных и экспираторных дыхательных движений (табл. 3). При
этом происходит достоверное уменьшение времени коррекции и
площади рассогласования дыхательных кривых (табл. 2). Однако на
четвертом месяце космического полета отмечено достоверное снижение
скорости
инспираторных
и
экспираторных
движений
сопровождающееся увеличением времени коррекции. При этом
площадь рассогласования дыхательных кривых продолжает снижаться.
Уже через сутки после окончания космического полета скорость
произвольных дыхательных движений начинает расти и через месяц
даже превышает исходные значения, полученные до полета. Также
отмечен прирост времени корректировочных движений и площади
рассогласования дыхательных кривых.
Заключение. Таким образом, независимо от условий повторное
выполнение сложнокоординированных дыхательных движений по
заданной программе сопровождается повышением успешности
(увеличением количества выполненных дыхательных движений)
Пребывание в условиях невесомости приводит к замедлению
произвольных дыхательных движений, сокращению времени их
коррекции и, как следствие, к уменьшению площади рассогласования
между дыхательной кривой и линией выполняемой программы. В
процессе послеполетной реабилитации характеристики произвольных
дыхательных движений возвращаются к дополетным значениям.
Воспроизведение увеличенных (относительно спонтанных)
дыхательных движений сопровождается значительным увеличением
скорости, некоторым увеличением времени, повышением успешности
движений и уменьшением площади рассогласования между
дыхательной кривой и линией выполняемой программы. Уменьшенные
- 26 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
(относительно спонтанных) дыхательные движения воспроизводятся
менее успешно, с несколько меньшей скоростью, за статистически
достоверно меньшее время.
Список литературы
1. Алексеев М.А., Аскназий А.А. Некоторые закономерности управления
точностными циклическими движениями человека // Управление
движениями. Л., 1970. С. 17.
2. Баранов В.М. Газоэнергообмен человека в космическом полете и
модельных исследованиях. М., 1993. 126 с.
3. Бреслав И.С. Произвольное управление дыханием у человека. Л.,
1975. 179 с.
4. Миняев В.И. Произвольное управление дыханием // Физиология
дыхания. Основы современной физиологии. СПб., 1994. С. 500–523.
5. Миняева А.В., Петушков М.Н., Морозов Г.И., Визирь Я.Г.,
Маркова К.Б. Особенности произвольного управления движениями
торакальной и абдоминальной дыхательной мускулатуры // Вопросы
экспериментальной и клинической физиологии дыхания. Тверь: Издво Твер. гос. ун-та, 2007. С. 150–154.
6. Рокотова Н. А., Шапков Ю.Т. Текущее управление движениями,
задаваемыми человеку изменениями внешнего сигнала // Некоторые
проблемы биологической кибернетки. Л., 1972. С. 26–37.
FEATURES OF VOLUNTARY CONTROL OF RESPIRATORY
MOVEMENTS IN THE CONDITIONS OF LONG SPACE FLIGHT
V.M. Baranov1, A.V. Minyaeva2, V.I. Minyaev2,V.I. Kolesnikov3,
U.A. Popova3, A.V. Suvorov3
1
Institute of General Pathology and Pathophysiology RAMS
2
Tver State University
3
Institute of Biomedical Problems RAS
Two of the astronauts were explored on the ability to voluntary control
respiratory movements under conditions of long space flight. It is revealed
that stay in weightlessness, is accompanied by delay of any respiratory
movements, some increase of accuracy, reduction of time of their correction
and, as consequence, reduction of the area of a mismatch between a
respiratory curve and a line of the carried out program.
Keywords: breathing movements, voluntary control, weightless.
- 27 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Об авторах:
БАРАНОВ Виктор Михайлович–доктор медицинских наук,
профессор, заведующий лабораторией физиологических проблем
невесомости, НИИ Общей патологии и патофизиологии РАМН, 125315,
Москва, ул. Балтийская, 8, e-mail: labmicrogravity@rambler.ru
МИНЯЕВА Арина Владимировна–кандидат биологических наук,
доцент кафедры анатомии и физиологии человека и животных, ФГБОУ
ВПО «Тверской государственный университет», 170100, Тверь, ул.
Желябова, 33, e-mail: physiol@tversu.ru
МИНЯЕВ Владимир Иванович–доктор биологических наук,
профессор, заведующий кафедрой анатомии и физиологии человека и
животных, ФГБОУ ВПО «Тверской государственный университет»,
170100, Тверь, ул. Желябова, 33, e-mail: physiol@tversu.ru
КОЛЕСНИКОВ Владимир Иванович–главный специалист
лаборатории физиологии и биомеханики кардиореспираторной системы,
УРАН ГНЦ РФ Институт медико-биологических проблем РАН, 123007,
Москва, Хорошевское шоссе, 76А, e-mail: kolesnikov@imbp.ru
ПОПОВА Юлия Александровна–кандидат медицинских наук,
старший научный сотрудник лаборатории физиологии и биомеханики
кардиореспираторной системы, УРАН ГНЦ РФ Институт медикобиологических проблем РАН, 123007, Москва, Хорошевское шоссе,
76А.
СУВОРОВ Александр Владимирович–доктор медицинских наук,
заведующий
лабораторией
физиологии
и
биомеханики
кардиореспираторной системы, УРАН ГНЦ РФ Институт медикобиологических проблем РАН, 123007, Москва, Хорошевское шоссе,
76А, e-mail: suvalex50@yandex.ru
- 28 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20. С. 29-36.
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
УДК 612.217+612.766
ВЛИЯНИЕ ИНТЕРЛЕЙКИНА-1 Β НА ВЕНТИЛЯТОРНУЮ
ЧУВСТВИТЕЛЬНОСТЬ К ГИПЕРКАПНИИ
Г.А. Данилова, Н.П. Александрова
Институт физиологии им. И.П. Павлова РАН
В экспериментах на наркотизированных, трахеостомированных,
спонтанно
дышащих
крысах,
изучались
эффекты
интрацеребровентрикулярного введения основного провоспалительного
цитокина интерлeйкина-1β (ИЛ-1β) на функцию дыхания. Установлено,
что ИЛ-1β вызывая увеличение минутной вентиляции легких и средней
скорости инспираторного потока, в тоже время снижает вентиляторный
ответ на прогрессирующую гипероксическую гиперкапнию. Сделан
вывод об ослаблении вентиляторной чувствительности к изменению
газового состава крови при повышении церебрального уровня
провоспалительных цитокинов.
Ключевые слова: цитокины, интерлейкин-1β, внешнее дыхание,
центральная хеморецепция, гиперкапния.
Введение. Как известно, в рефлекторной регуляции дыхания
важнейшая роль отводится центральным хеморецепторам. Их активация
при повышении содержания углекислого газа в артериальной крови
вызывает увеличение вентиляции легких, необходимое для удаления
избытка СО2 из организма и поддержания газового гомеостаза.
Недавние исследования показали, что оксидативный стресс и
антиоксиданты могут изменять вентиляторный ответ на гиперкапнию
[9]. Было обнаружено увеличение уровня провоспалительных
цитокинов
при
многих
заболеваниях
дыхательных
путей,
сопровождающихся увеличением сопротивления дыханию, таких как
астма, хроническая обструктивная болезнь легких (ХОБЛ), сонное
апноэ [7; 8]. Установлено, что и у здоровых людей и животных при
дыхании с добавочным инспираторным сопротивлением также
наблюдается рост уровня цитокинов в крови [6]. С другой стороны
известно что, резистивное дыхание оказывает влияние на центральную
хеморецепцию, уменьшая вентиляционный ответ на гиперкапническую
стимуляцию [3]. Однако механизмы этого влияния не известны. Мы
предполагаем,
что
повышение
церебрального
уровня
провоспалительных цитокинов, стимулированное оксидативным
стрессом во время резистивного дыхания, может быть одной из причин
вызывающей
ослабление
вентиляторной
чувствительности
к

Работа выполнена при поддержке РФФИ (грант № 09-04-01662)
- 29 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
гиперкапнии.
Цель данной работы – исследование влияния провоспалительных
цитокинов на хеморецепторный аппарат регуляции внешнего дыхания.
Для этого производился анализ вентиляторных ответов на гиперкапнию
до и после повышения церебрального уровня интерлейкина-1β (ИЛ-1β),
одного из главных провоспалительных цитокинов.
Материал и методика Эксперименты проводились на 10
трахеостомированных
крысах
линии
Wistar
(250-280г),
наркотизированных внутрибрюшинным введением уретана (1200 мг/кг).
Все эксперименты на животных были проведены с соблюдением
этических норм и правил работы на анестезированных животных.
Уровень анестезии был достаточен, чтобы устранить болевые рефлексы.
В ходе экспериментов осуществлялась пневмотахографическая
регистрация объемно-временных параметров внешнего дыхания.
Объемная
скорость
воздушного
потока
(пневмотахограмма)
регистрировалась при помощи миниатюрной пневмометрической
трубки (AD Insruments MLT1L), соединенной с трахеостомической
трубкой и пневмотахографом. По пневмотахограмме измерялась
максимальная скорость воздушного инспираторного и экспираторного
потока, рассчитывалась частота дыхания. Для определения
дыхательного
объема
производилось
интегрирование
пневмотахографической
кривой.
Минутный
объем
дыхания
рассчитывался как произведение величины дыхательного объема на
количество дыхательных движений за одну минуту. Средняя скорость
инспираторного потока – косвенный показатель центральной
инспираторной активности, расчитывалась как частное от деления
величины дыхательного объема на продолжительность вдоха.
Внутригрудное давление измерялось в нижней трети пищевода
катетером с латексным баллоном, заполненным воздухом, связанным с
преобразователем давления. Величина инспираторных колебаний
внутригрудного давления (Poes) использовалась как косвенный
показатель силы сокращений инспираторных мышц.
Повышение церебрального уровня ИЛ-1β производилось путем
микроинъекции раствора данного цитокина в боковой желудочек
головного мозга. Для интравентрикулярного введения вещества
использовался
стереотаксический
метод.
Голова
животного
закреплялась в стереотаксе. С поверхности черепа удалялись кожа и
соединительные ткани. С помощью бормашины рассверливалось
трепанационное отверстие, в которое вводилась микроканюля,
соединенная с микрошприцем, заполненным раствором интерлейкина.
Координаты для введения канюли определялись по стереотаксическому
атласу мозга крысы и составляли 0,8 мм каудальнее уровня bregma,
1,5 мм латерально от средней линии и 3,7 мм от поверхности черепа [4].
Затем при помощи шприца Гамильтона в боковой желудочек мозга
- 30 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
производилось медленное введение раствора интерлейкина (0,5 мкг
вещества в 10 мкл раствора) со скоростью 1–2 мкл/мин.
Для того чтобы исследовать влияние провоспалительных
цитокинов на хеморефлекторную регуляцию дыхания использовался
метод возвратного дыхания [5]. Суть метода состоит в том, что он
позволяет выявить зависимость между изменением газового состава
крови и регистрируемыми параметрами. Для возвратного дыхания была
смонтирована специальная замкнутая система, состоящая из мешка с
тонкими эластичными стенками и миниатюрной клапанной коробки.
Для регистрации ответа дыхательной системы на гиперкапническую
стимуляцию мешок, из которого дышало животное, заполнялся
гипероксически-гиперкапнической газовой смесью (60% О2, 7% СО2 в
азоте). Процентное содержание СО2 было близко по парциальному
давлению к РСО2 смешанной венозной крови. В результате РСО2 в
мешке, легких и крови быстро уравновешивалось, а дальнейшее его
нарастание в системе обуславливалось только продукцией СО2 в тканях.
Так как избыток кислорода, содержащийся в дыхательной смеси
устраняет
гипоксическую
стимуляцию
периферических
хеморецепторов,
то
регистрировалась
реакция
на
чистый
гиперкапнический стимул, который активирует медуллярные
(центральные) хеморецепторы.
Продолжительность проведения пробы с возвратным дыханием
составляла 4 минуты. Такие тестирующие пробы проводились до
интравентрикулярного введения ИЛ-1β, и через каждые 20 минут в
течении полутора часов после его введения. Изменение газового состава
крови оценивалось с помощью масс-спектрометрии альвеолярного газа.
Вентиляторные ответы на гиперкапнию анализировались в интервале
увеличения РСО2 от 50 до 85 ммHg в контроле и после
интравентрикулярного введения ИЛ-1β.
Вычислялась средняя величина регистрируемых параметров и
ошибка средней. Статистический анализ данных до и после
интравентрикулярного
введения
выполнен
с
применением
дисперсионного анализа. Различия считали статистически значимыми
при P<0,05.
Результаты и обсуждение. Интравентрикулярное введение
ИЛ-1β вызывало достоверное увеличение минутного объема дыхания и
средней скорости инспираторного потока. Была также обнаружена
тенденция к увеличению дыхательного объема, частоты дыхания и
внутригрудного давления под действием интерлeйкина. Однако
изменения этих параметров в данной серии экспериментов не были
статистически значимыми (таблица). Интравентрикулярное введение
физиологического раствора не оказывало влияние на паттерн дыхания.
Анализ вентиляторных ответов на гиперкапнию показал
существенное изменение чувствительности дыхательной системы к
- 31 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
гиперкапнической стимуляции после интравентрикулярного введения
ИЛ-1β. При возвратном дыхании по мере роста парциального давления
СО2 в крови наблюдалось увеличение минутного объема дыхания
(МОД) как до введения вещества, так и после его введения. Однако
сравнительный анализ вентиляторных кривых зарегистрированных до и
после введения ИЛ-1β выявил характерные различия. Графическая
обработка данных показала, что после введения препарата уменьшается
угол наклона линии тренда, усредняющей вентиляторные кривые,
зарегистрированные в нескольких экспериментах, что свидетельствует
об уменьшении вентиляторной чувствительности к гиперкапнии
(рис. 1). Респираторный эффект интерлейкина-1β отчетливо проявлялся
через 20 минут действия вещества, через 40 минут был выражен
максимально, через 60 минут снижался и исчезал через 90 минут (линии
тренда становились параллельными).
Таблица
Объемно-временные параметры дыхания
до и после введения интерлейкина-1β
Параметры
Фон
Интерлейкин-1β
103±5,3
126±3,8**
1,00±0,06
1,20±0,06
Частота дыхания, дых/мин
112±7,0
113±7,0
Средний инспираторный поток, мл/с
3,7±0,27
4,40±0,12*
Внутригрудное давление, ммH2O
1,60±0,36
2,50±0,49
34±3,0
30±3,0
Минутный объем дыхания, мл/мин
Дыхательный объем, мл
Напряжение углекислого газа, ммHg
Примечание. * – P<0,05; ** – P<,.01 по сравнению с исходными данными.
Проведение количественных расчетов показало достоверное
снижение величины прироста МОД, ДО и среднего инспираторного
потока в ответ на гиперкапническую стимуляцию на фоне действия ИЛ1β (рис. 2). Установлено, что прирост МОД при увеличении РСО2 на 1
мм рт. ст. через 40 минут действия интерлейкина снижался на 47%,
прирост ДО – на 40% и средней скорости инспираторного потока на
50% по сравнению с фоновыми величинами. В контрольных
экспериментах с интравентрикулярным введение физиологического
раствора не было обнаружено изменение угла наклона линии тренда и
величины прироста регистрируемых параметров при гиперкапнической
стимуляции на фоне действия ИЛ-1β.
Полученные данные свидетельствуют о снижении вентиляторной
чувствительности к гиперкапнии при повышении содержания ИЛ-1β в
цереброспинальной жидкости, что определяется влиянием этого
цитокина на механизмы центральной хеморецепции, так как
- 32 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
периферические хеморецепторы при дыхании
гиперкапнической газовой смесью не активируются.
гипероксически-
Р и с . 1 . Снижение вентиляторной чувствительности к СО2
после интравентрикулярного введения ИЛ-1β:
по оси абсцисс – парциальное давление углекислого газа (мм рт.ст.),
по оси ординат – минутный объем дыхания (мл/мин)
Известно, что афферентная импульсация от центральных
рецепторов поступает в дорсальную респираторную группу нейронов
дыхательного центра, расположенную в области ядра одиночного
тракта. Импульсы от хеморецепторов активируют расположенный здесь
пул α-инспираторных нейронов, который формирует центральную
инспираторную активность (ЦИА) и посылает эфферентную
импульсацию в спинной мозг к ядрам дыхательных мышц. Логично
предположить, что обнаруженный нами респираторный эффект
интерлейкина может проявляться через торможение α-инспираторных
нейронов дыхательного центра.
При анализе реакций на гиперкапнию нельзя исключить и
возможного влияния интерлейкина на центральные хеморецепторные
нейроны, которые расположены на вентральной поверхности
продолговатого мозга. Кроме того, респираторный эффект при
центральном введении интерлейкина мог реализовываться через
посредство вторичных мессенджеров, простагландина (РЕ2) и оксида
азота (NО), которые экспрессируются эпендимными клетками,
выстилающими желудочки мозга при активации имеющихся здесь
рецепторов ИЛ-1β [1]. Введенный в боковые желудочки ИЛ-1β мог
оказывать влияние даже на те нейроны, которые не имеют рецепторов
цитокинов.
- 33 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Р и с . 2 . Влияние ИЛ-1β на величину прироста
минутной вентиляции (А), средней скорости
инспираторного потока (Б), дыхательного объема (В)
при гиперкапнической стимуляции:
белые столбцы – до введения ИЛ-1β (фон);
черные – после 40 мин действия вещества
Полученные нами данные об ослаблении вентиляторной
чувствительности к изменению газового состава крови при действии
ИЛ-1β находятся в соответствии с результатами другого исследования,
в котором было показано, что прием антиоксидантов способствует
повышению вентиляторной чувствительности к гиперкапнии при
дыхании с инспираторной резистивной нагрузкой [9]. Авторы
объясняют этот эффект тем, что антиоксиданты уменьшают
оксидативный стресс, развивающийся при резистивном дыхании. Эти
данные косвенно подтверждают достоверность результатов нашего
исследования,
показывающих,
что
увеличение
уровня
провоспалительных цитокинов, которое характерно для оксидативного
стресса, вызывает противоположный эффект – снижение вентиляторной
- 34 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
чувствительности к СО2. Кроме того, полученные нами данные
подтверждаются исследованием, проведенным на мышах с мышечной
дистрофией, имеющих сниженный вентиляторный ответ на
гиперкапнию по сравнению с нормальными мышами. У таких животных
конкурентное устранение провоспалительного цитокина TNF-α
(посредством удаления гена для TNF-α) значительно улучшает
вентиляторный ответ на гиперкапнию, что указывает на то, что
эндогенно продуцируемый TNF-α угнетает этот ответ [2].
Заключение. Таким образом, результаты проведенного
исследования позволяют сделать вывод о возможном участии
провоспалительных цитокинов – медиаторов иммунной системы, в
модуляции хеморецепторных рефлексов. Повышенное содержание
провоспалительных цитокинов в цереброспинальной жидкости
ослабляет вентиляторную чувствительность к хеморецепторной
стимуляции, что может быть причиной снижения вентиляторного
ответа на гиперкапнию при дыхании с добавочным инспираторным
сопротивлением, которое сопровождается эндогенным повышением
системного уровня провоспалительных цитокинов. Ослабление
вентиляторной чувствительности к изменению газового состава крови
при действии провоспалительных цитокинов указывает на снижение
резервных возможностей дыхательной системы при развитии
системного остро фазового ответа на воспаление.
Список литературы
1. Graff G.R. Gosal D. Cardiorespiratory responses to inrerleukin-1beta in
adult rats: role of nitric oxide, eicosanoids and glucocorticoids // Arch.
Physiol. Biochem. 1999. Vol. 107, № 2. Р. 97–112.
2. Gosselin L.E., Barkley J.E., Spencer M.J., McCormick K.M., Farkas G.A.
Ventilatory dysfunction in mdx mice: impact of tumor necrosis factoralpha deletion // Muscle Nerve. 2003. Vol. 28. P. 336–343.
3. Mador J.M., Tobin M.J. The effect of inspiratory muscle fatigue on
breathing pattern and ventilatory response to CO2 // J. Physiol. 1992.
Vol. 455. P. 17–32.
4. Paxinos G., Watson C. The rat brain in stereotaxic coordinates. London.
Academic Press. 1982. 256 p.
5. Read D.J. A clinical method for assessing the ventilatory response to
carbon dioxide // Australas Ann. Med. 1967. Vol. 16. P. 20–22.
6. Vassilakopoulos T., Roussos C., Zakynthinos S. The immune response to
resistive breathing // Eur. Respir. J. 2004. Vol. 24. P. 1033–1043.
7. Vernooy J.H., Kucukaycan M., Jacobs J.A., Chavannes N.H., Buurman
W.A., Dentener M.A., Wouters E.F. Local and systemic inflammation in
patients with chronic obstructive pulmonary disease: soluble tumor
- 35 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
necrosis factor receptors are increased in sputum // Am. J. Respir. Crit.
Care Med. 2002. Vol. 166. P. 1218–1224.
8. Vgontzas A.N., Paranicolaou D.A., Bixler E.O., Hopper K., Lotsikas A.,
Lin H.M., Kales A., Chrousos G.P. Sleep apnoea and daytime sleepiness
and fatigue: relation to visceral obesity, insulin resistance and
hypercytokinemia // J. Clin. Endocrinol. Metab. 2000. Vol. 85.
P. 1151–1158.
9. Zakynthinos S., Katsaounou P., Karatza M-H., Roussos C.,
Vassilakopoulos T. Antioxidants increase the ventilatory response to
hyperocxic hypercapnia // Am. J. Respir. Crit. Care Med. 2007. Vol. 175.
P. 62–68.
INFLUENCE INTERLEUKIN-1 β ON VENTILATORY
SENSITIVITY TO HYPERCAPNIA
G.A. Danilova, N.P. Aleksandrova
Pavlov Institute of Physiology RAS
In experiments on anesthetized, tracheostomized, spontaneously breathing
rats, the effects of intracerebroventricular injection of the basic
proinflammatory cytokine interleukin-1β (IL-1β) on breath function were
studied. It is established that IL-1β causing increase in minute ventilation of
lungs and mean inspiratory flow, during too time reduces ventilatory the
answer on progressing hyperoxic hypercapnia. The conclusion is drawn on
easing ventilatory sensitivity to change of gas structure of blood at increase of
cerebral level proinflammatory cytokines.
Keywords: cytokines, interleukin-1β, external respiration, central
chemoreception, hypercapnia.
Об авторах:
ДАНИЛОВА Галина Анатольевна–аспирант лаборатории
физиологии дыхания, УРАН Институт физиологии им. И.П. Павлова
РАН, 199034, Санкт-Петербург, наб. Макарова, 6, e-mail:
galdanilova@rambler.ru
АЛЕКСАНДРОВА Нина Павловна–доктор биологических наук,
заведующая лабораторией физиологии дыхания, УРАН Институт
физиологии им. И.П. Павлова РАН, 199034, Санкт-Петербург, наб.
Макарова, 6, e-mail: breath@kolt.infran.ru
- 36 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20. С. 37-47.
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
ФИЗИОЛОГИЯ ТРУДА
УДК 616.037:617-089
ПРИМЕНЕНИЕ НЕЙРОСЕТЕВЫХ ТЕХНОЛОГИЙ
В ФИЗИОЛОГИИ, МЕДИЦИНЕ ТРУДА
И ЭКОЛОГИИ ЧЕЛОВЕКА
И.В. Степанян1, Э.И. Денисов2
Институт машиноведения им. А.А. Благонравова РАН
2
НИИ Медицины труда РАМН
1
Рассмотрены примеры применения нейросетевых технологий в
физиологии, медицине труда и экологии человека. Детально изложены
интеллектуальные алгоритмы выявления профессиональной патологии
легких горнорабочих. С помощью этого аппарата оценены
специфические эффекты шума, а также данные внутриутробных пороков
развития детей, матери которых проживали в экологически
неблагоприятных условиях. Рассмотрено моделирование высшей
нервной деятельности человека на примере зрительного и слухового
анализаторов.
Ключевые слова: искусственные нейронные сети, нейрофизиология,
профпатология, экология человека.
История развития нейросетевых технологий. В процессе
развития человек всегда познавал как окружающий мир, так и себя
самого. С давних времен сначала в медицине, а затем и в биологии
человека интересовала работа головного мозга. Основоположниками
нейрофизиологического направления были отечественные ученые –
И.М. Сеченов, И.П. Павлов, В.М. Бехтерев, А.А. Ухтомский и др.
Фундаментальным вкладом в мировую науку явилось открытие
И.М. Сеченовым рефлекторного механизма деятельности головного
мозга – органа психики. В дальнейшем их продолжателями П.К.
Анохиным, К.В.Судаков и др. была развита теория функциональных
систем; отметим, что П.К. Анохин контактировал с Н. Винером –
основателем кибернетики.
Вопросами моделирования деятельности мозга занимаются
специалисты по всему миру, пример – Институт мозга РИКЕН
(Япония). Аналогичные институты мозга имеются в Санкт-Петербурге и
Москве, они занимаются вопросами нейрокибернетики и др. Центр
оптико-нейронных технологий НИИ системных исследований РАН
(Москва) занимается исследованиями в области хранения и обработки
информации на принципах оптической памяти, голографии и
нейронных сетей. Все эти институты решают фундаментальные и
прикладные вопросы применения искусственных нейронных сетей в
- 37 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
биологии, медицине, технике и др. для исследований генетического
кода, природы рака и др.
Имеются примеры применения нейросетевых технологий для
исследований в области физиологии и экологии человека.
Характеристики неблагоприятных воздействий на человека и ответных
реакций,
подчиняющиеся
разным
видам
дозо-эффективных
зависимостей, во многих случаях поддаются математическому
моделированию. Имеются модели, описывающие различные проблемы
нарушений
здоровья
человека
и
потомства
от
действия
профессиональных, экологических и наследственных факторов риска [5;
9]. Такой же опыт накапливается и в практической медицине [7].
Математические модели в биологии и медицине обычно строят
на базе многокритериальных интеллектуальных информационных
систем. Перспективным подклассом таких систем являются
искусственные нейронные сети (ИНС). Одной из первых была работа по
логическому исчислению идей в области нервной активности,
опубликованная в «Бюллетене математической биофизики» в 1943 г.
[17]. Винер и Розенблатт совместно работали по биологическим
нейронам, и из этих работ родилась идея обучения автоматов Винера и
теория обучения сетей перцептронов Розенблатта [18].
Сегодня технологии ИНС успешно применяют не только для
математического моделирования каузальных связей в области
патологической физиологии и доказательной медицины, но и для
моделирования
нейрофизиологических
процессов,
часто
стохастического характера. В частности, технологии ИНС позволяют
моделировать процессы восприятия и анализа информации, а также
обучения и забывания. Свойства ИНС применяют для моделирования
когнитивных функций мозга, анализаторов в процессе приёма и анализа
сенсорной информации различной модальности и др.
Цель работы – рассмотреть некоторые примеры применения
нейросетевых технологий для решения кардинальных задач в
физиологии и экологии человека.
Интеллектуальные алгоритмы выявления профессиональной
патологии легких горнорабочих. Для оценки и прогнозирования
рисков была построена интеллектуальная система на базе
самоорганизующегося нейронного слоя Кохонена [16]. Эта архитектура
функционирует на принципе конкуренции нейронов и может также
применяться для моделирования анализаторов сенсорной информации.
Исходные данные представляют собой набор 250-мерных векторов,
каждый из которых описывает набор амплитуд соответствующего
спектра в диапазоне частот от 0 до 150 Гц. Моделирование нейронной
сети показало, что нейроны, которые имеют начальные весовые
векторы, значительно удаленные от спектральных портретов не
выигрывают конкуренции, независимо от того, как долго продолжается
- 38 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
самоорганизация. Для того что бы исключить появление таких нейронов
применялись положительные смещения b, которые добавлялись к
отрицательному расстоянию удаленного нейрона. При этом в начале
процедуры настройки всем нейронам конкурирующего слоя был
присвоен параметр активности:
c0=1/N,
где N – количество нейронов конкурирующего слоя Кохонена. В
процессе настройки этот параметр корректируется следующим образом:
Δ=β(ai1–c), Δb=e1-ln(c) – b,
где β – параметр скорости настройки смещений, ai1 – вектор, элемент i
которого равен 1, а остальные – 0. Таким образом, для всех нейронов,
кроме нейрона, выигравшего конкуренцию, приращения отрицательны.
В процессе настройки параметр c корректируют таким образом, чтобы
его значения для активных нейронов становились больше, а для
неактивных – меньше. Увеличение смещений для неактивных нейронов
позволило им начать формировать кластеры, т. е. притягивать новые
входные спирометрические спектры. В задаче распознавания
результатов акустической спирометрии смещения нейросети были
настроены так, чтобы подавить деятельность нейронов, которые не
несут никакой ценной информации для распознавания признаков
профзаболеваний.
Путем
визуализации
массивов
весовых
коэффициентов обученного слоя Кохонена были получены графические
представления центров кластеров.
Из всего массива данных сильно выделяются определенные
области кластеров, что подтверждается графиками их центров. Нельзя
сказать, что результаты акустической спирометрии обследованных,
имеющих признаки профзаболеваний, принадлежат одному кластеру.
Однако по принадлежности спектра к кластеру можно делать некоторые
выводы. Например, если спектр попал в восьмой или шестнадцатый
кластер, то он принадлежит больному с вероятностью 72,2% и 66,7%
соответственно, если в первый – здоровому с вероятностью 92%. Таким
образом, обученную нейронную сеть можно применять для
интеллектуального анализа спирометрических данных. Математическая
формализация спектральных портретов дыхательных процессов,
представляющая собой нейросетевой вариант проекции многомерных
спирометрических данных в пространство более низкой размерности,
позволяет выявить выраженную кластерную структурированность
спектрограмм. При этом два их подмножества можно отнести к
здоровым, одно к пораженным органам дыхания. Анализ результатов
математического моделирования нейронной сети позволяет выявить
выраженный минимум в области 10–150 Гц в 52% случаев нарушения
функции дыхания.
Идея другого подхода в применении интеллектуальных систем
для оценки результатов акустической спирометрии состоит в том, чтобы
- 39 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
классифицировать спектральные паттерны по заведомо установленным
нарушениям и обучить многослойную прямоточную нейронную сеть
выявлять эти признаки [6; 10; 14]. Многослойные прямоточные
нейросети можно также применять для моделирования высшей нервнопсихической деятельности человека, логического рассуждения и др.
Операцию кроссовера пары нейронных сетей c повторным
переобучением, учитывая общий вид многослойной нейросетевой
модели, можно записать в виде:
H
h
. .. s
[
[
10
∑
w
0
H
. .. s
10
20
∑
20
1
1
h ,h
h1 = 1
h =1
w
21
h ,h
20
]
]
1
∑
cross 3 y 1 ,y 2 =l s [
H
1k − 1
1
k 1− 1
=0
H
w
s[
1
1
h ,h k − 1
1
∑
1
k1
1k − 2
h
1
k 1− 2
H
w
1
h
=0
2k − 1
k 1− 1
2
H
∑
p .. . ] ψ 1 +s [
2 k 2− 1
h
=0
H
w
2
2k
h ,h
p . .. ] ψ 2 +b =f y 1 ψ 1
2k
2
−1
,h
2k
2
1k
1
2 k 2− 2
h
1
∑
s[
h
1
w
k 1− 3
=0
1
h
−2
∑
s[
−2
1k − 3
=0
k 1− 2
H
w
h
2k 2− 1
,h
,h
2k
1k
2
1
−3
−3
∑
2k − 2 s [
2
h
2k 2− 3
.. .
=0
w
2 k 2− 2
h
,h
2k
2
−3
. ..
y 2 ψ 2 +b =f f 1 p ψ 1 +f 2 p ψ 2 +b ,
где ψ 1 ,ψ 2 – весовые коэффициенты пары новых синаптических
h 1 ,H1 , k1 ,h 2 ,H 2 , k2 ,w –
соединений, подбираемые адаптивно,
параметры прямоточных слоистых подсетей (верхний индекс
соответствует номеру подсети, над которой выполняется операция), b –
смещение, l – линейная функция активации, s x - сигмоидальная
рациональная функция активации [10].
В ходе эволюционной оптимизации [6; 9] было перебрано более
4
10 вариантов нейронных сетей различной топологии. Начальная
популяция состояла из ста особей, представляющих собой различные
структуры (фенотипы) нейронных сетей. Ошибка сети на одном
примере определялась после того, как она обучалась на остальных
примерах. Каждая сеть оценивалась по сумме ошибок на всех примерах.
Прямоточная слоистая нейросетевая модель, позволяющая отличать
спектрограммы с вероятностью 73% для обследованных здоровых и
72% для больных, состоит из пяти слоев, имеет 9 нейронов в первом
слое, 6 во втором, 2 в третьем, 3 в четвертом, 1 в пятом. С учетом
топологии полученной сети были вычислены частоты, содержащие в
себе признаки профзаболеваний органов дыхания. Эти частоты лежат в
диапазоне от 4,8 от 150 Гц. Таким образом, участки спектра
форсированного выдоха, позволяющие распознавать нарушения
функции дыхания программно-аналитическим методом, достигают 74%
протяженности всего спектра. При этом вероятность верного
распознавания признаков нарушений составляет 72,5%.
Опыт оценки специфических эффектов шума с помощью
интеллектуальных систем. Свойства интеллектуальных систем на
основе нейронных сетей можно применить для прогнозирования
- 40 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
рисков, в частности, для оценки специфических эффектов шума. Для
решения этой задачи использовали показатели смещения порогов
слуховой чувствительности у работающих в условиях воздействия
постоянного и импульсного шума. Интеллектуальные системы
позволили установить структуру динамики развития специфических
эффектов шума для их оценки [9].
Р и с . 1 . Динамика развития тугоухости
от импульсного (слева) и постоянного (справа) шумов:
по оси абсцисс – номера групп, по оси ординат – стаж (в годах)
Были построены две модели: I модель формировала кластеры по
стажевым группам, II модель – по порогам слуха; в обеих моделях
критерием кластеризации было разделение по видам шума. В итоге
было
получено
разбиение
показателей
порогов
слуховой
чувствительности на кластеры. Кластеризация по стажевым группам
показана на рис. 1, кластеры по порогам слуха показаны в таблице.
Таблица
Распределение порогов слуха
для импульсного и постоянного шумов по четырем выделенным группам
Тип шума
Импульсный
Постоянный
1
125 Гц
250 Гц
500 Гц
1000 Гц
125 Гц
250 Гц
500 Гц
1000 Гц
2000 Гц
2
2000 Гц
Группа
3
4
3000 Гц
8000 Гц
4000 Гц
6000 Гц
3000 Гц
8000 Гц
4000 Гц
6000 Гц
Данные таблицы свидетельствуют о том, что структура кластеров
практически идентична для шумов разного вида. Исключение
- 41 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
составляют данные аудиометрии для импульсного шума на частоте 2000
Гц, которая формирует отдельную группу, в то время как при
постоянном шуме эта частота относится к первой группе, включающей
в себя также частоты 125, 250, 500 и 1000 Гц.
Нейросетевой кластерный анализ данных внутриутробных
пороков развития. Нейросетевой анализ, примененный для оценки
специфических эффектов шума, был апробирован нами позже для
анализа врожденных пороков развития (ВПР) у детей, матери которых
проживают в районах с разной экологической нагрузкой, и позволил
выявить характерные группы из обследованных детей. Для выделенных
групп были рассчитаны вероятности возникновения тех или иных видов
ВПР с учетом 40 различных факторов, в числе которых возраст матери,
различные медицинские показатели ее здоровья, течения беременности,
а также район проживания. Точность обнаружения ВПР нейросетевыми
методами для этих групп составила от 73,3% до 97,7%. Учитывая
высокую социальную значимость этих материалов, в настоящее время
продолжается углубленная их разработка.
Моделирование высшей нервной деятельности человека.
Интеллектуальные системы применялись нами не только для оценки
высокоинтенсивных внешних факторов, влияющих на здоровье
человека, но и для моделирования различных анализаторов с целью
выявления патофизиологического воздействия на них при напряженном
умственном труде. Существуют зрительный, слуховой, обонятельный,
вкусовой, кожный, вестибулярный, двигательный анализаторы,
анализаторы внутренних органов. В анализаторе выделяют три отдела:
воспринимающий орган или рецептор, предназначенный для
преобразования энергии раздражения в процесс нервного возбуждения;
проводник, состоящий из афферентных нервов и проводящих путей, по
которому импульсы передаются к вышележащим отделам центральной
нервной системы; центральный отдел, состоящий из релейных
подкорковых ядер и проекционных отделов коры больших полушарий.
В теории искусственного интеллекта выделяют три основных
направления (рис. 2).
Р и с . 2 . Основные классы нейросетевых парадигм
Обучение с учителем основывается на математической модели
нейрона Мак-Калока и Питса [17], предложенной в 1943 г.; типичный
- 42 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
пример этого подхода – перцептрон Розенблата [18]. Обучение без
учителя – более современная и мощная парадигма, примером которой
является нейросетевая модель Кохонена [16]. Обе эти парадигмы
основываются на биофизическом законе Хебба. Подчеркнем, что эти
модели являются математическими моделями нейронов. Можно
выделить нейрофизиологический подход, являющийся творческим
наследием выдающихся ученых П.К. Анохина, И.М. Сеченова, А.А.
Ухтомского и других нейрофизиологов, которые рассматривали ВНД
человека на системном уровне. Примером служит знаменитая
Анохинская теория функциональных систем, которую применяют
сегодня в разных областях медицины и кибернетики [13].
В работе [8] интеллектуальный алгоритм был применен нами для
моделирования ВНД человека. В ответ на визуальный раздражитель
синтезировали модель поведения по Анохину [1–3] в виде набора
звуковых
композиционных
секвенций.
Затем
анализировали
полученные секвенции с точки зрения их влияния на психику человека.
Было установлено, что без применения базы знаний, содержащей
основные сведения о гармонических сочетаниях частот, в большинстве
случаев звуки носят хаотический характер. Однако в ряде случаев
полученные звуковые секвенции соответствуют человеческим эмоциям.
Данный подход может быть перспективен для профилактики нервнопсихических расстройств и в области функциональной музыки.
Аналогичная интеллектуальная система была применена нами
для моделирования зрительного анализатора. Зрение – сложный
биологический процесс, в котором участвует мозг посредством высшей
нервной деятельности. Известно, что сетчатка глаза воспринимает
световые лучи, которые в виде электрических импульсов по зрительным
нервам поступают в отдел мозга, ведающий зрением, где информация
анализируется. Повреждение любого звена этой цепочки чревато
потерей зрения и изменением электрической активности головного
мозга (нарушается альфа-ритм).
Для реализации машинного зрения можно подойти с позиции
нейрофизиологического подхода. Под руководством В. Цыганкова в
СССР был разработан и применен нейрокомпьютер [13], который
представляет собой электронную нейрофизиологическую модель мозга
человека. Особенностью этой модели мозга является реализованный в
ней нейрофизиологический «принцип экстренной мобилизуемости»,
известный из теории функциональных систем академика П.К. Анохина
[1]. Это возможность быстрого, в реальном времени создания и
перестройки сложной нейронной сети, состоящей из сотен тысяч и
более виртуальных нейронов (квазинейронов). При малом расходе
оборудования можно получать сотни тысяч нейронов с их быстро
образуемыми и перестраиваемыми связями, что приближает такой
подход к живому природному аналогу нейронной организации (рис. 3).
- 43 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Р и с . 3 . Пример ассоциативной нейронной сети на уровне кодов-слов:
по оси абсцисс – такты внутреннего времени
нейронной сети зрительного анализатора;
по оси ординат – коды виртуальных нейронов
Для нейросетевой обработки реальных образов требуется
высокая разрядность нейрокомпьютера, что сложно и дорого
реализуется на современной микроэлементной базе. В связи с этим,
были рассмотрены механизмы биологического зрения. В книге [12]
нейрофизиолог Хьюбел, лауреат Нобелевской премии, изложил
устройство нейронных структур зрительной системы, включая кору
головного мозга. На эту модель можно опираться при моделировании
зрительного анализатора. Схема зрения по Хьюбелу представлена на
рис. 4.
Р и с . 4 . Начальные уровни зрительной системы млекопитающих:
первые три уровня размещаются в сетчатке,
остальные в мозге – в наружных коленчатых телах и далее в коре мозга [по: 12]
- 44 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Типичный пример поведения человеческого зрачка в виде его
траектории при осмотре и узнавании предмета – картина Шишкина «В
лесу». Чаще всего глаз возвращается к смысловому центру – фигурке
человека [15]. Нейрофизиологическая модель мозга при моделировании
зрения дает аналогичный результат для каждого нейрокомпютера.
Коллектив нейросистем был объединен методом треугольнорадиального совмещения; каждый треугольник соответствует строке
сенсорной матрицы. Такое объединение позволяет моделировать
поведение зрачка при осмотре зрительного образа под воздействием
блока выдвижения гипотез нейрокомпьютера «Эмбрион» [13] как
модели доминанты Ухтомского [11]. Модель основана на природном
аналоге, из которого заимствован способ подачи сигнала
непосредственно с сетчатки в проекционную зону коры головного мозга
[12]. В результате была разработана параллельная информационная
система, которая в реальном времени обрабатывает сложные образы,
поступающие
на
общую
сенсорную
матрицу
коллектива
нейрокомпьютеров. Данная реализация нейрокомпьютерного зрения
позволяет наблюдать и идентифицировать единый образ неразрывно и
целостно коллективом нейрокомпьютеров. При этом поворот
наблюдаемого образа на 90° порождает новую по структуре, топологии
и спектральным характеристикам нейронную сеть. Таким образом,
техническая реализация зрительного анализатора основывается на
биологическом прототипе.
Интересны результаты нейросетевого моделирования в
трехзначной логике. По одной из теорий зрения, глаз человека
различает три цвета: красный, синий и зеленый (модель RGB). При
переходе в поле трех информационных единиц R, G, B наблюдаются
нейросети сложной организации и поведения, что позволяет
моделировать цветовое восприятие. Например, двухразрядный
трехзначный нейрокомпьютер порождает нейронные сети в
пространстве девяти кодов, в то время как трехразрядный двухзначный
нейрокомпьютер работает в пространстве 8 кодов. Готовая техническая
реализация нейрокомпьютерного зрения доступна через интерфейс на
сайте www.neurocomputer.ru.
Нами
рассмотрены
некоторые
примеры
применения
нейросетевых технологий в физиологии и экологии человека. Показано
что благодаря мощным вычислительным свойствам нейроподобных
структур, связанных с функциями и организацией их природного
аналога – естественных нейронных сетей, возможно применение
нейрокомпьютинга для изучения нейрофизиологии и когнитивных
функций человека, а также для выявления и профилактики ряда
заболеваний. Нейросетевой подход, уже применяемый в экономике,
энергетике, биологии, социологии и др., является перспективным и в
области физиологии и экологии человека. В частности, применение
- 45 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
интеллектуальных
алгоритмов
совместно
с
акустическим
спироанализатором для выявления патологии легких горнорабочих
позволяет обнаруживать на ранних стадиях признаки профзаболеваний,
вызванных воздействием пыли на бронхолегочную систему рабочего. С
помощью аппарата искусственных нейронных сетей оценены
специфические эффекты шума, а также данные внутриутробных
пороков развития детей, матери которых проживали в экологически
неблагоприятных условиях. Рассмотрено моделирование ВНД человека
на примере зрительного и слухового анализаторов. Эти примеры и
данные литературы свидетельствуют о перспективах развития данной
области знаний о человеке.
Список литературы
1. Анохин П.К. Методологическое значение кибернетических
закономерностей // Материалистическая диалектика и методы
естественных наук. М., 1968. С. 547–587.
2. Анохин П.К. Функциональная система, как методологический
принцип биологического и физиологического исследования //
Системная организация физиологических функций. М., 1968. С. 5–7.
3. Анохин П.К. Очерки по физиологии функциональных систем. М.:
Медицина, 1974. 446 с.
4. Медведев В. Нейронные сети // MATLAB 6. М.: Диалог-МИФИ,
2002. 496 с.
5. Профессиональный риск для здоровья работников / под ред. Н.Ф.
Измерова, Э.И. Денисова. М.: Тровант, 2003. 448 с.
6. Редько В.Г. Эволюция, нейронные сети, интеллект: модели и
концепции эволюционной кибернетики. М.: УРСС, 2005. 224 с.
7. Симахин В.А. Кластеризация медицинских данных с помощью
нейросетей: [Электрон. ресурс]. Режим доступа: http://neurocomp.ru/
klasterizaciya-medicinskix-dannyx-s-pomoshhyu-nejrosetej
(дата
обращения: 25.10.2011).
8. Степанян И.В., Цыганков В.Д., Игин Г.А. Нейрокомпьютерный
синтез звуковых композиционных секвенций // Нейрокомпьютеры:
разработка и применение. 2009. № 7. С. 79–84.
9. Степанян И.В., Денисов Э.И. Применение интеллектуальных
информационных систем для прогнозирования оценки рисков для
здоровья // Нейрокомпьютеры: разработка, применение. 2009. № 12.
С. 69–74.
10. Тархов Д.А. Нейронные сети // Модели и алгоритмы. М.:
Радиотехника, 2005. Кн. 18. 256 с.
11. Ухтомский А.А. Доминанта. М., Л.: Наука, 1966. 272 с.
12. Хьюбел Д. Глаз, мозг, зрение. М.: Мир, 1990. 239 с.
- 46 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
13. Цыганков В.Д. Нейрокомпьютер и мозг. М.: СИНТЕГ, 2001. 248 с.
14. Шкундин С.З., Степанян И.В. Возможность выявления признаков
профессиональных заболеваний органов дыхания с помощью
акустического спироанализатора и вероятностных нейронных сетей
// Медицина труда и промышленная экология. 2006. № 12. С. 27–31.
15. Ярбус А.Л. Роль движений глаз в процессе зрения. М.: Наука, 1965.
166 с.
16. Kohonen T. Self-organizing maps. 3d ed. Berlin, Heidelberg, N. Y.:
Springer, 2001. 501 p.
17. McCulloch W.S., Pitts W. A logical calculus of the ideas imminent in
nervous activity // Bulletin of Mathematical Biophysics. 1943. № 5.
P. 115–133.
18. Rosenblatt R. Principles of neurodynamics. N. Y.: Spartan Books, 1959.
62 р.
APPLICATION OF NEURAL NETWORKS IN PHYSIOLOGY,
OCCUPATIONAL HEALTH AND HUMAN ECOLOGY
I.V. Stepanyan1, E.I. Denisov2
1
Blagonravov Mechanical Engineering Institute RAS
2
Institute of Occupational Health RAMS
Examples of neural networks used in physiology, occupational health and
human ecology are described. Intellectual algorithms for identifying
occupational lung pathology of miners are considered in details. Using this
apparatus the specific effects of noise, as well as data on fetal malformations
of children whose mothers lived in ecologically tensed conditions were
assessed. On an example of auditory and visual analyzers the modeling of
higher nervous activity of a subject is considered.
Keywords: artificial neural networks, neurophysiology, occupational
pathology, human ecology.
Об авторах:
СТЕПАНЯН Иван Викторович–кандидат технических наук,
старший
научный
сотрудник
лаборатории
исследования
биомеханических систем, УРАН Институт машиноведения им. А.А.
Благонравова РАН, 101990, Москва, Малый Харитоньевский пер., 4,
e-mail: skwwwks@gmail.com
ДЕНИСОВ Эдуард Ильич–доктор биол. наук, профессор,
главный научный сотрудник, УРАМН НИИ медицины труда РАМН,
Москва, пр-т Буденного, 31, e-mail: denisov28@yandex.ru
- 47 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20. С. 48-59.
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
УДК 613.6
МЕСТО ЗДОРОВЬЯ И ЕГО САМООЦЕНКА
В СТРУКТУРЕ НРАВСТВЕННЫХ ЦЕННОСТЕЙ
ВРАЧЕЙ БАШКОРТОСТАНА
А.Р. Галимов1, Е.Г. Cтепанов2, Г.И. Баязитова2, Р.М. Фасиков3
Клиническая больница № 1 г.Стерлитамак
Уфимская государственная Академия экономики и сервиса
3
Филиал Центра гигиены и эпидемиологии
в Республике Башкортостан
1
2
Для
изучения социально-психологических аспектов трудовой
деятельности врачей-хирургов использованы результаты анкетирования
врачей по Республике Башкортостан. Представляется необходимым
проведение на старших курсах обучения в медицинских вузах
профессионального отбора, который бы учитывал тип нервной
системы будущего специалиста.
Ключевые слова: врачи-хирурги, анкета ВОЗ, болезни, самооценка
здоровья, структура хронических заболеваний.
В условиях современной России врачи, как и медицинские
работники в целом, оказались наименее социально защищенной
прослойкой общества. Это обусловлено низким уровнем заработной
платы, существенным снижением качества жизни, значительным ростом
профессиональных нагрузок, а также обострением противоречий между
профессиональным и нравственным долгом врача и его возможностями
оказания высококвалифицированной медицинской помощи населению
[6]. Однако проблема профессиональных рисков врачей актуальна не
только для России. В мировой литературе сегодня уделяется достаточно
большое внимание здоровью врачей высокоразвитых стран. Известно,
что частота скелетно-мышечных нарушений
у работников
здравоохранения и социального обеспечения в 1,2–1,6 раза выше
средних показателей и сопоставима с показателями в строительстве и на
транспорте, а число случаев временной нетрудоспособности в системе
здравоохранения, образования и социального обеспечения превышает
средние показатели вдвое [11]. Около 18% всех проблем со здоровьем
работающего населения приходится на стресс, депрессию и
беспокойство [12]. В отношении врачей авторов беспокоит широкое
распространения у них синдромов хронической усталости и
профессионального выгорания, которые специалисты связывают с
социальной сущностью профессии врача, то есть необходимостью
постоянной эмоциональной отдачи при работе с больными людьми [13].
Настоящие
исследования
выполнены
на
примере
- 48 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
многопрофильной клинической больницы (КБ) г. Стерлитамака
Республики Башкортостан (РБ) на 800 коек, достаточно типичной для
большинства городов РФ.
Для характеристики психосоциальных аспектов трудовой
деятельности врачей-хирургов использованы результаты анкетирования
врачей по Республике Башкортостан, выполненные в 2003 г. совместно
с В.Т. Кайбышевым и Г.Х. Мустафиной. Была использована анкета,
разработанная экспертами ВОЗ для европейской модели «Здоровье на
рабочем месте» и адаптированной авторами для условий России с
учетом специфики врачебного труда.
Из общего числа опрошенных хирургов (730 человек) свыше
85% составили рядовые врачи, около 10% – заведующие отделениями
или кабинетами и около 5% – руководители ЛПУ и их заместители.
Из числа опрошенных хирургов 55,0% проживали и работали в г.
Уфе с населением свыше 1 млн. человек, и 40,0% – в малых и средних
городах с населением от нескольких десятков (г. Агидель, 20,7 тыс.
чел.) до нескольких сотен тысяч человек (г. Стерлитамак, свыше 268,1
тыс. чел.) и только 5% – в сельской местности, преимущественно, в
районных центрах которые, соответственно, работали в центральных
районных больницах.
Из общего числа опрошенных врачей 33,0% составили мужчины
и 67,0% – женщины в возрасте от 23 до 72 лет, среди врачей
хирургических специальностей это соотношение было почти обратным:
65% мужчин и 35% женщин. Доля недавних выпускников медицинских
вузов (возраст до 24 лет) составляет чуть более 2,0%, лица в возрасте
старше 60 лет – около 3%.
Анкета включает 11 основных разделов, касающихся
социального статуса, самооценки здоровья, физической активности,
факторов стресса, нарушений сна, употребления лекарственных
препаратов и вредных привычек, питания, безопасности труда, проблем
межличностного общения, взаимоотношений с работодателем, круга
лиц, к которым респондент обращается за помощью. Анкета
апробирована в процессе пилотных исследований, выполненных в
Республики Башкортостан в 2002–2003 гг.
Всего от врачей республики получено 6077 анкет, что составило
свыше 60% от числа розданных анкет (10 000) и охватывает около 40%
от общего количества врачей, занятых в системе Минздрава РБ. Доля
врачей-хирургов в этой выборке составила 730 человек или 12%.
Проблемы со здоровьем в процессе труда актуальны в целом для
28% хирургов, при том, что 45% хирургов считает, что вредные условия
труда отрицательно влияют на его здоровье и для 31% здоровье мешает
выполнению трудовых обязанностей.
Отвечая на вопрос «Как бы вы оценили свое здоровье?», 67,3%
врачей РБ решили, что оно у них удовлетворительное, 17% –
- 49 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
«хорошее»; у 13% врачей, по их мнению, здоровье плохое и по одному
проценту распределилось на группы с «отличным», «очень хорошим» и
очень плохим» здоровьем. Хирурги еще более критично оценили свое
здоровье: никто не выбрал варианты ответов «отличное», «хорошее» и
«очень хорошее, у них меньше доля лиц с удовлетворительным и выше
– с плохим и очень плохим состоянием здоровья. Средневзвешенная
оценка из расчета 6 баллов у врачей РБ 3,1, у хирургов – 2,6.
Исходя их приведенного выше распределения врачей-хирургов
по группам самооценки здоровья, следует признать, прежде всего, что
абсолютное большинство из них больны. Это подтверждается и
ответами на вопрос о том, имеет ли хирург какое-либо хроническое
заболевание и какое именно.
Распространенность хронических болезней по данным
самооценки составила более двух заболеваний на одного опрошенного,
при этом в структуре заболеваемости на первом месте находятся
болезни органов пищеварения, которые занимают 29,5%, их отметили у
себя почти 77% хирургов. Далее следуют болезни системы
кровообращения, доля которых составила 20,2% и которые встречаются
у половины (52,5%) хирургов и реаниматологов. Почти столь же часто
хирурги отмечали у себя наличие болезней костно-мышечной системы
(17% в структуре, отмечены 44% хирургов) и нервной (14,4%; 37%
опрошенных). Прочие болезни составили 18,4%. В среднем на одного
хирурга приходится по данным самооценки 2,6 хронических
заболевания.
Распространенность основных хронических неинфекционных
заболеваний среди всех врачей РБ, согласно самооценке, несколько
ниже и составляет 210 на 100 опрошенных, т.е. в среднем на каждого
врача приходится как минимум два достаточно серьезных хронических
заболевания. В структуре хронических заболеваний врачей РБ примерно
поровну представлены болезни органов пищеварения, которые
занимают 21% и встречаются у 43,3% врачей, и болезни системы
кровообращения, на долю которых приходится 20% и которые отметило
у себя 42,4% опрошенных. Третье место занимают болезни костномышечной системы (18% в структуре, встречаются у 36,8% врачей),
болезни нервной системы (14 и 30,2% врачей), а за ними примерно в
равных долях следуют заболевания органов дыхания (9 и 19,7% врачей),
печени (9 и 18,7% врачей) и выделительной системы (6 и 11,6% врачей).
Значительная часть врачей, как правило, не обращается к врачу
по поводу собственного здоровья – среди опрошенных врачей РБ 34,0%
выбрали ответ «как врач я сам корректирую свое здоровье». Хирурги не
составляют в этом отношении исключения – почти половина из них
обращается к врачу лишь в чрезвычайных ситуациях – 48% выбрали
ответ «я сам корректирую свое здоровье». Однако треть хирургов
(32,1%) обращается к врачу от одного до шести раз в год, и почти 7,0%
- 50 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
вынуждено лечиться практически постоянно (число обращений к врачу
от 7 до 12 в год и более).
15,3% врачей РБ часто пользуется лекарствами и
медикаментозными препаратами, не имея для этого рекомендаций
врача, 30,0% делает это время от времени и еще 26,0% – очень редко.
Иными словами, свыше 70% врачей с той или иной степенью
регулярности используют лекарственные средства, среди которых, повидимому, ведущее место принадлежит болеутоляющим препаратам:
ежедневно, или почти ежедневно их употребляет почти 4,0% врачей,
два–три раза в неделю – 10,0%, один раз в неделю – 17,0% и два–три
раза в месяц – 14,0%, что в совокупности составляет более половины
всех врачей (55,0%), причем еще 45,0% опрошенных заявили, что
употребляют анальгетики один раз в месяц.
Среди хирургов и реаниматологов также широко (55,0%)
распространен прием болеутоляющих препаратов, которые около 3,5%
принимает ежедневно и 20,0% – от одного до трех раз в неделю. Почти
80,0% хирургов отметили наличие у них проблем со сном, причем у
44,0% они возникают более одного раза в неделю, а у 33,0% — один раз
в неделю или реже. Более половины хирургов (57,2%) за последний
месяц перед опросом, по меньшей мере, однократно употребляли
успокоительные, либо снотворные препараты и примерно 10,0% –
антидепрессанты, при этом более 5,0% хирургов вынуждены
пользоваться препаратами этих групп ежедневно, или почти ежедневно,
11,4% – 2–3 раза в неделю и еще 11,3%–не реже одного раза в неделю.
Практически все врачи, в том числе, хирурги, достаточно хорошо
представляют себе, что такое здоровый образ жизни и его значение для
сохранения здоровья: 88,0% полагает, что это такой образ жизни,
который способствует физического и духовному здоровью, 21,0%
считает необходимым добавить к этому отсутствие вредных привычек,
19,0% – занятие физической культурой и около 15,0% связывает
здоровый образ жизни с духовным самосовершенствованием. Однако
никто из хирургов не заявил, что делает все возможное для соблюдения
здорового образа жизни, только 28,0% отметили, что стараются
соблюдать его «по мере возможности», 56,0% полагает, что не имеет
реальных возможностей для его соблюдения, а еще 16,0% не придает
этому значения, либо полагает, что сегодня не время говорить о
здоровом образе жизни.
Как известно, труд значительного числа врачей характеризуется
гиподинамией. Для хирургов, большее значение имеет длительное
нахождение в фиксированной позе, что, фактически тоже может быть
расценено как элемент гиподинамии. Однако очень немногие из них
могут позволить себе компенсировать ее специальными физическими
нагрузками. Почти 45,0% врачей никогда (помимо работы) не позволяет
себе даже легкой физической нагрузки хотя бы на 30 минут в день, либо
- 51 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
делает это реже одного раза в неделю. Для умеренной физической
нагрузки этот показатель касается уже 55,0% врачей, интенсивной
физической нагрузкой хотя бы по 15 мин. в день фактически не
занимается 80% хирургов. Лишь 5% хирургов регулярно занимаются с
использованием интенсивных и лишь 10% – с использованием
умеренных физических нагрузок.
По результатам опроса оказалось, что лишь 20% врачей курит,
причем это, преимущественно, мужчины. Большинство из них (40,0%)
начало курить еще до поступления в ВУЗ, около трети (31,5%) — на
начальных курсах института, 10,8% — на последних курсах и примерно
столько же — 9,4% — через несколько лет после окончания ВУЗа.
Среди хирургов доля курящих существенно выше и достигает 65%,
причем интенсивно курят как мужчины, так и женщины. Большинство
вопросов анкеты, касавшиеся оценки употребления алкоголя, остались
без ответа, однако в ответах на вопрос о наиболее значимых бытовых
проблемах за последние 6 месяцев около 7,0% хирургов отметило
важность для них вопросов алкогольной или наркотической
зависимости как собственной, так и членов семьи.
Что касается места здоровья в структуре нравственных
ценностей, индивидуального и общественного сознания врачей, то оно
находится достаточно высоко: опасения по поводу собственного
здоровья занимают второе место (55,7%) после опасений за будущее
детей (62,9%), а вместе со значимостью здоровья близких людей
(43,0%) здоровье как ценностная категория прочно занимает первое
место среди проблем, которыми наиболее озабочены врачи.
Среди способов, благоприятствующих улучшению здоровья, на
первое место хирурги выставили курс лечения в санатории, хотя доля
таких респондентов среди хирургов существенно ниже, чем среди всех
врачей РБ (46,0% против 69,7%), что может свидетельствовать как о
высоком уровне доверия врачей к этому способу оздоровления, так и об
относительно низкой вероятности его осуществления (своего рода
«нереализованная мечта», на которую возлагаются большие надежды).
Следующее место (39,9%) в ранговом ряду принадлежит желанию
хирургов избавиться от основных источников беспокойства и
нервозности.
Почти для половины хирургов (46%) актуальной для
оздоровления оказалась смена режимов питания и его улучшение, что
хорошо соотносится с высокой распространенностью у них
хронических заболеваний органов пищеварения. Однако, если врачи РБ,
уточняя ответ на этот вопрос, в большинстве своем (73,4%) на первое
мест поставили необходимость увеличения в рационе питания овощей и
фруктов, то ответы хирургов не были столь однозначны — их, повидимому, больше волнует отсутствие на работе условий для здорового
питания.
- 52 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Общее психоэмоциональное состояние хирургов можно
проиллюстрировать с помощью ответов, выбранных ими в ответ на
вопрос о том, что мешает им осуществить намерения по улучшению
здоровья (табл. 1).
Таблица 1
Характер распределения врачей
по значимости препятствий к улучшению здоровья
Вариант ответа на вопрос:
«Что мешает поправить
или поддержать свое здоровье?»
Проблема несерьезная
Не остается на это времени
Нет для этого сил
Недостаточно для этого средств
Апатия, депрессивное состояние,
ничего не хочется делать
Не знаю, с чего начать
Нет поддержки со стороны семьи и друзей
Нет поддержки или помощи со стороны
предприятия, где я работаю (работодателя)
Это слишком трудно
Не хочу ничего менять
Не уверен, что могу что-либо изменить
Нахожусь в состоянии длительного
выраженного хронического стресса
Сдерживает страх перед неизвестным
Недостаток уверенности в себе
Не знаю
Доля опрошенных,
ответивших
утвердительно, %
врачи РБ хирурги
15,0
12,0
35,0
57,0
36,0
38,0
86,0
42,0
25,0
32,0
21,0
10,0
26,0
28,0
12,0
28,0
31,0
12,0
32,0
14,0
22,0
18,0
38,0
47,0
21,0
26,0
12,0
29,0
19,0
15,0
Проведено распределение врачей по вариантам ответов на другой
близкий по смыслу вопрос: «Что бы вы хотели сделать, чтобы лучше
справиться с овладевшим вами чувством беспокойства, нервозности или
стресса?» (табл. 2). Как следует из полученных данных, значительно
место среди способов и средств оздоровления врачей, по их
собственному признанию, занимает необходимость коррекции их
психо-эмоционального состояния и личностных качеств. Такие
личностные задачи, как научиться справляться с трудностями и
нервными срывами, быть уверенным в себе, научиться самообладанию
и управлению свои временем, научиться общаться с людьми и быть
более общительными в совокупности перекрывают 100%, то есть, в
- 53 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
сущности, являются чрезвычайно
большинства опрошенных.
важными
для
абсолютного
Таблица 2
Характер распределение врачей по предлагаемым способам преодоления
чувства беспокойства, нервозности или стресса
Вариант ответа на вопрос:
«Что лучше сделать, чтобы справиться
с овладевшим чувством беспокойства,
нервозности или стресса?»
Больше физической нагрузки (больше двигаться)
Чаще бывать на людях
(заводить новых друзей, общаться)
Коренным образом изменить свою жизнь
(например, сменить работу, переехать
на другую квартиру, уехать из данного
населенного пункта)
Употреблять меньше алкоголя
Уменьшить применение болеутоляющих,
снотворных, успокоительных препаратов
Уменьшить применение других медицинских
препаратов
Уменьшить применение
немедицинских препаратов
Пить меньше кофе
Лучше питаться
Проводить больше времени со своей семьей
Научиться управлять своим временем
Учиться лучше справляться
с чувством беспокойства
Научиться расслабляться
Больше и лучше спать
Получить профессиональную помощь психолога,
психотерапевта
Получить больше денег
Научиться расходовать деньги
Научиться быть более уверенным в себе
Повысить профессиональную квалификацию
Научиться контролировать себя
(свои эмоции, свой гнев)
Научиться лучше общаться с людьми
Уделять больше внимания своей внешности
Не знаю
Доля опрошенных,
ответивших
утвердительно, %
врачи РБ
хирурги
21,0
12,0
15,0
28,0
17,0
26,0
2,0
2,0
12,0
10,0
1,0
12,0
0
0
1,0
14,0
26,0
16,0
21,0
5,0
38,0
32,0
15,0
32,0
29,0
23,0
8,0
36,0
48,0
22,0*
56,
9,0
17,0
19,0
17,0
48,0
3,0
26,0
23,0
30,0
8,0
19,0
3,0
12,0
3,0
15,0
При этом объем соответствующих ответов согласуется с
описанной выше распространенностью среди хирургов употребления
- 54 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
успокоительных, снотворных препаратов и антидепрессантов, то есть
объективных нарушений психо-эмоциональной сферы.
Таким образом, результаты анализа материалов самооценки
здоровья хирургов Республики Башкортостан дает основание
утверждать, что их физическое и психо-эмоциональное состояние
находится на довольно низком уровне. Фактически, большинство
приведенных формулировок представляет собой классические жалобы,
характерные для врача, находящего в состоянии длительного
хронического стресса, а если учесть, что большинство хирургов в
приведенных выше перечнях выбирали одновременно несколько
вариантов ответов, то можно говорить о высокой вероятности
формирования у них синдрома профессионального выгорания,
следствием которого является глубокая апатия и убежденность в
бессилии что-либо изменить.
Данные самооценки были получены по результатам анализа
анонимных анкет врачей-хирургов, опрошенных на территории РБ. Для
уточнения полученной картины у врачей-хирургов и реаниматологов
изученной группы были проанализированы результаты именного
опроса по соматическому опроснику [4; 9]. По данным соматического
опросника свыше 70% врачей-хирургов имеют признаки вегетативной
дисфункции (15 и более баллов по вегетативному опроснику). Ведущее
место в структуре признаков вегетативных нарушений занимают
нарушения функции желудочно-кишечного тракта (склонность к
запорам, поносам, «вздутиям» живота, боли) и приступообразные
головные боли, которые отметили у себя 62% врачей-хирургов.
Почти половина хирургов (47,1%) характеризуется умеренным
рассогласованием суточного цикла «сон-бодрствование», тогда как
выраженное рассогласование суточного цикла зафиксировано у 14,7%, а
высокая степень – у 8,8%, что, по-видимому, обусловлено как
нерациональным режимом труда и отдыха в связи с многочисленными
суточными дежурствами, так и высокими психо-эмоциональными
нагрузками.
Свыше 65% врачей находятся в состоянии постоянного
утомления, которое для 44,1% характеризуется умеренной степенью,
для 11,8% является выраженным, и для 8,8% – высоким. Более трети
врачей-хирургов (35,3%) отмечает у себя наличие умеренных и 9,0% –
выраженных соматовегетативных нарушений. Две трети (61,8%)
жалуются на психосоматические нарушения в виде расстройств со
стороны желудочно-кишечного тракта, приступообразных головных
болей и нарушения сна, которые проявляются в виде затруднения
засыпания, поверхностного сна и ощущении чувства недосыпания.
При объективном неврологическом осмотре выявлена высокая
распространенность у врачей-хирургов жалоб на боли в спине (у 67,3%
осмотренных), повышенную утомляемость к концу рабочего дня и
- 55 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
дежурства (57,1%), головную боль (44,9%), нарушения сна (38,8%) и
боли в области сердца (28,6%). На онемение пальцев кисти и стоп
жаловалось 35,3% врачей-хирургов, изменение окраски кожных
покровов пальцев кистей и стоп выявлено у 23,5%, повышенная
потливость – у 38,2%. Ощущения сердцебиения и «замирание сердца»
отметили 17,6%. Каждый пятый (20,6%) испытывает затруднения при
дыхании – чувство нехватки воздуха, учащенное дыхание. На быструю
утомляемость жалуется 44,8% врачей. Среди вегетативных изменений у
половины врачей (50%) отмечены частые покраснения и у 11,8% –
побледнения лица. Неврологические заболевания, клинически значимые
на момент осмотра, выявлены у 16,3% осмотренных врачей-хирургов,
прошедших также инструментальные исследования (табл. 3).
Таблица 3
Распространенность у врачей-хирургов симптомов и заболеваний
по результатам инструментальных исследований
Симптомы и признаки по результатам
инструментального исследования
Электрокардиографические симптомы
нарушения сердечной деятельности, в том
числе:
синусовая аритмия
синусовая брадикардия
экстрасистолия
тахикардия
блокады (синусовые,
атриовентрикулярные,
ножек пучка Гиса)
гипертрофия миокарда левого
желудочка
Всего
Нарушения метаболизма сердечной
мышцы
Измененные показатели
реоэнцефалографии, в том числе:
ангиодистонический тип
гипертонический тип
Всего
Результаты ультразвукового
исследования:
холецистит
панкреатит
диффузные изменения печени
Распространенность,
на 100 обследованных
12,1
20,7
1,7
1,7
24,0
17,2
119,0
41,4
72,4
24,1
96,5
44,8
8,6
31,0
Анализ степени напряжения адаптации по морфологическому
составу крови [5] показал, что только у трети врачей (34,8%) ее уровень
- 56 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
соответствует критериям повышенной и спокойной активации, у 43,7%
выявлено выраженное напряжение адаптационных систем, причем у
15,2% из них – срыв адаптации, характеризуемый как длительное
состояние
хронического
стресса.
В
процессе
социального
взаимодействия
половина
врачей-хирургов
не
испытывает
дискомфорта, однако более чем для трети (38,2%) характерно
умеренное, а для 3,0% – значительное напряжение в процессе
межличностных отношений в коллективе.
Общий уровень дезадаптации умеренной степени выраженности
характерен для более половины врачей-хирургов (52,9%). Выявлена
прямая корреляционная связь высокой силы между уровнем нагрузки и
степенью дезадаптации (r=0,9), уровнем нагрузки и типом нервной
системы (r=0,8), а также степенью дезадаптации и типом нервной
системы (r=0,8). Наибольшая степень дезадаптации характерна для
хирургов, которые имеют самую высокую производственную нагрузку
(более 1,5 ставок), при том, что эта группа лиц обладает, как правило,
сильным, или напортив слабым типом нервной системы. Анализ
результатов
стандартизированного
многофакторного
метода
исследования личности показал, что лишь у 6,3% врачей-хирургов
профиль СМИЛ является линейным, т.е. все его показатели
укладываются в границы конкордантной нормы, что свойственно
гармоничным личностям. С признаками выраженного стресса и
дезадаптации личности (плавающий профиль СМИЛ) выявлен один
человек, однако еще у 16% врачей выявлен невротический профиль
СМИЛ с подъемом на первой, второй и третьей шкалах. 18% хирургов
имеет равновысокие показатели по шкалам 2 и 4, характерные для
неврастенического паттерна дезадаптации, что может служить основой
для развития алкоголизма, психосоматических и сердечно-сосудистых
заболеваний.
Заключение. Представляется необходимым проведение на
старших курсах обучения в медицинских вузах профессионального
отбора, где бы при выборе студентом специализации во внимание
принимался его тип нервной системы. Таким образом, около 70%
врачей-хирургов имеют признаки вегетативной дисфункции, что
проявляется, преимущественно, нарушениями функции желудочнокишечного тракта, приступообразными головными болями, чувством
невыспанности, усталости при пробуждении утром, снижением
работоспособности и быстрой утомляемостью, что свидетельствует о
повышенной вероятности формирования у них психических
расстройств и расстройств поведения.
Необходимо проведение диспансеризации врачей-хирургов с
учетом величин вероятности стресса и индивидуальной устойчивости к
стрессу.
- 57 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Список литературы
1. Агапова М.В. Социально-психологические аспекты эмоционального
выгорания и самоактуализации личности: дис. … канд. психол. наук.
Ярославль, 2004. 184 с.
2. Актуальные вопросы профессиональной патологии медицинских
работников: метод. рекоменд. Ростов н/Д: Изд-во Ростов. гос. унт-та,
2002. 35 с.
3. Величковский Б.Т. Социальный стресс, трудовая мотивация и
здоровье. М., Воронеж, 2002. 35 с.
4. Вейн А.М. Депрессия в неврологической практике. М., 2002. 208 с.
5. Гаркави Л.Х., Квакина Е.Б., Уколова М.А. Адаптационные реакции и
резистентность организма. Ростов н/Д: Изд-во Ростов. гос. ун-та,
1990. 223 c.
6. Измеров Н.Ф. Здоровье медицинских работников. М., 2004. 39 с.
7. Королева Е.П.
Условия труда и
риск возникновения
профессиональных заболеваний у медицинских работников // Бюл.
Научного Совета Медико-экологические проблемы здоровья
работающих. 2004. № 2. С. 48–52.
8. Минин Г.Д. Профессиональная заболеваемость работников
здравоохранения в Республике Башкортостан // Медицина труда и
промышленная экология. 2005. № 7. С. 34–37.
9. Нафиков Р.Г. Психосоциальный компонент формирования здоровья
трудоспособного населения // Проблемы оценки риска здоровью
населения от воздействия факторов окружающей среды. М., 2004.
С. 43–45.
10. Симонова Н.И. Концептуальная модель управления здоровьем,
охраной труда и окружающей средой на рабочем месте на примере
НГДУ «Южарланнефть» АНК «Башнефть» // Международное
рабочее совещание по проблеме управления здоровьем,
окружающей средой и безопасностью в условиях производства (13–
16 октября 2002 г., Уфа). Уфа, 2002. С. 37–58.
11. Froneberg B. Old and new problems in occupational health - challenges
to jccupational safety and health from the global market economy and
demographic
change
//
Медико-экологические
проблемы
работающих. 2005. № 4. С. 14–21.
12. Lehtinen S. Challenges to occupational health services in the regions: The
national and international responses. Helsinki: WHO, 2005. 56 p.
13. Orange C. Addiction help for physicians // Minnesotam medicine. 2002.
V. 85, № 7. P. 44–46.
- 58 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
PLACE OF HEALTH AND ITS SELF-ASSESSMENT
IN THE STRUCTURE OF MORAL VALUES
OF BASHKORTOSTAN PHYSICIANS’
A.R. Galimov1, E.G. Stepanov2, G.I. Bayazitova2, R.M. Fasikov3
Clinical hospital № 1 Sterlitamak
Ufa State Academy of Economy and Service
3
The branch of The centre of hygiene and epidemiology
in the Republic of Bashkortostan
1
2
For the purpose of study of socio-psychological aspects of operators’ labor
activity we used the results of the questionnaire poll of physicians of the
Republic of Bashkortostan. Carrying out on training older years in medical
high schools of professional selection where at a choice in attention its type of
nervous system would be accepted by the student of specialization is
obviously necessary.
Keywords: operators; questionnaire of the WHO, diseases, self-assessment of
one’s state of health, structure of chronic diseases.
Об авторах:
ГАЛИМОВ Артур Рамилиевич–кандидат медицинских наук,
заведующий хирургическим отделением, МБУЗ Клиническая больница
№ 1 г. Стерлитамак, e-mail: drgalimov@mail.ru
СТЕПАНОВ Евгений Георгиевич–кандидат медицинских наук,
доцент, ГОУ ВПО Уфимская государственная академия экономики и
сервиса (Салаватский филиал), 453260, Республика Башкортостан,
Салават, ул. Ленина, 32, e-mail: doctorse@mail.ru
БАЯЗИТОВА Гузелия Исмагиловна–кандидат филологических
наук, заведующая кафедрой, ГОУ ВПО Уфимская государственная
академия экономики и сервиса (Салаватский филиал), 453260,
Республика Башкортостан, Салават, ул. Ленина, 32, e-mail: guzelia77@
rambler.ru
ФАСИКОВ Рустем Мухтарович–кандидат медицинских наук,
главный врач, Филиал ФГУЗ «Центр гигиены и эпидемиологии в
Республике Башкортостан» в г. Салават, 453260, Республика
Башкортостан, Салават, ул. М. Джалиля, 42, e-mail: fasicov@yandex.ru
- 59 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20. С. 60-68.
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
БИОХИМИЯ
УДК 612.621.31+612.6
ДИНАМИКА ЭСТРОНА В КРОВИ В ПЕРИОД БЕРЕМЕННОСТИ
К.Ю. Толстых, А.Н. Панкрушина
Тверской государственный университет
В период беременности активизируется синтез эстрогенов. Это приводит
к повышению содержания в крови ряда промежуточных метаболитов,
обладающих андрогенной активностью. Эстрон является одним из
маркеров, отражающих естественную активность стероидогенеза,
сопровождающую беременность.
Ключевые слова: стероидогенез, эстрон, беременность.
Введение. Период беременности связан со значительными
гормональными изменениями в организме женщины. Наблюдается
усиленное
образование
эстрогенов,
которые
принимают
непосредственное участие в регуляции созревания плода, провоцируя
рост миометрия, способствуя улучшению кровоснабжения плода и
обмена веществ между ним и организмом матери [8]. В синтез
эстрогенов
активно
вовлечены
и
ферментные
системы
фетоплацентарного комплекса. Усиленный стероидогенез ведет к
повышению содержания ряда предшественников эстрогенов в крови
матери, обладающих андрогенной активностью. В результате данные
процессы ведут к формированию гиперандрогенного состояния в
период беременности, являющегося физиологически нормальным для
женщины, вынашивающей плод.
Однако в ряде случаев повышение уровня андрогенов, имеющее
место при беременности, диагностируется как патология. Возможно, это
связано с многопричинностью гиперандрогении (ГАГ) в период
беременности и трудностью их дифференциальной диагностики.
В ряде случаев причиной ГАГ является врожденная дисфункция
коры надпочечников (ВДКН). Заболевание
имеет аутосомнорецессивный тип наследования и вызвано ферментативным дефектом на
одном из уровней биосинтеза стероидных гормонов, приводящим к
снижению уровня кортизола и гиперпродукции, по принципу обратной
связи, некоторых промежуточных метаболитов стероидогенеза.
Собственно ВДКН не представляет трудностей в диагностике, тогда как
ее неклассическая форма (НК-ВДКН), характеризующаяся менее
выраженным проявлением, диагностируется гораздо сложнее. Частота
НК-ВДКН в общей популяции достаточно высока и достигает 0,3% [16].
При НК-ВДКН один из ферментов теряет свою активность на 40-70%
[10], что приводит к избыточному накоплению ряда промежуточных
- 60 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
соединений, среди которых дегидроэпиандростерон (ДГЭА) и 17гидроксипрогестерон (17-ОН-Про), обладающие слабой андрогенной
активностью [6]. Диагностику НК-ВДКН также осложняет отсутствие
признаков недостаточности кортизола, альдостерона или нарушений
минерального обмена, что было подтверждено проведенными
исследованиями [7].
Поскольку в настоящее время нет окончательно утвержденных
нормативов содержания андрогенов в период гестации, наблюдается
частая гипердиагностика ГАГ, что ведет к назначению супрессивной
терапии глюкокортикоидными (ГК) препаратами, в частности,
дексаметазоном и метипредом, подавляющими функцию коры
надпочечников. Следует отметить, что необоснованное применение
этих препаратов в период беременности несет угрозу здоровью матери
[10; 17], плода in utero [1; 13], а также нормальному функционированию
ряда органов по мере взросления ребенка [12]. Зарубежные авторы
отмечают, что семь из восьми случаев применения дексаметазона в
период гестации не обоснованы [18].
Следовательно, необходима дифференциальная диагностика
гиперандрогенных состояний, вызванных гормональной активностью
при беременности или патологическими изменениями синтеза
гормонов. В настоящее время в качестве маркеров гиперандрогенного
состояния активно используются 17-ОН-Про и сульфатированная форма
ДГЭА (ДГЭА-С). Их базальные значения колеблются в широких
пределах и не дают достаточной информации о природе
гиперандрогенного состояния. Более того, некоторые исследования
указывают, что определение 17-ОН-Про и ДГЭА-С для выявления НКВДКН в период гестации обладает низкой специфичностью: это связано
с особенностями метаболизма андрогенов при формировании
фетоплацентарного комплекса [9]. Наконец, имеющиеся в настоящее
время литературные данные об уровнях 17-ОН-Про и ДГЭА-С у
беременных и соответствующие им нормативы производителей
коммерческих наборов носят разноречивый характер [2; 4].
«Золотым стандартом» в диагностике НК-ВДКН признан тест с
1-24-АКТГ (синактен, синактен-депо), оказывающий стимулирующее
действие на активность стероидогенеза. Очевидно, что подобная
супрафизиологическая стимуляция чрезмерна и нежелательна для
клинического использования в период беременности.
В связи с вышесказанным актуальным является поиск альтернативных
маркеров, позволяющих проводить дифференциальную диагностику
физиологической гиперандрогении и НК-ВДКН, не прибегая к
диагностическим гормональным тестам.
В качестве альтернативного маркера был выбран эстрон – один
из трех основных естественных эстрогенов вместе с эстрадиолом и
эстриолом. Эстрон синтезируется прежде всего из андростендиона
- 61 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
надпочечникового или гонадного происхождения. С возрастом уровень
эстрона снижается [19], однако некоторые источники указывают на
обратное [5].
В период беременности большие его количества образуются в
плаценте из материнского ДГЭА-С и ДГЭА-С, синтезированного
надпочечниками плода [19]. Логично предположить, что в
гестационный период уровень эстрона увеличивается. Однако работ,
описывающих динамику уровня эстрона в период беременности, нами
не обнаружено. В клинической практике эстрон как диагностический
показатель встречается редко, что связано с недостаточностью сведений
о его биологической функции. Таким образом, актуальным является
определение динамики концентрации гормона в период беременности и
разработка на основании проведенного исследования референтных
значений для последующей оценки уровня эстрона в крови у женщин,
страдающих гиперандрогенией.
Цель настоящего исследования – определить динамику
концентрации эстрона в крови у женщин Тверской обл. в период
беременности при ее физиологическом течении. Для выполнения
исследования были поставлены следующие задачи:
1. Определить концентрацию гормона в крови женщин,
вынашивающих плод;
2. Выявить особенности содержания эстрона в зависимости от
возраста обследуемых;
3. Разработать показатели региональной динамической нормы
содержания эстрона в крови, характерные для гестационного
периода, при отсутствии репродуктивных нарушений и
прочих заболеваний;
Материал и методика. Исследование проводили на базе
лаборатории иммуноферментного анализа коммерческого лечебнодиагностического центра «Вера» и женской консультации МУЗ
«Родильный дом № 5», расположенных в г. Твери. В течение 15 месяцев
было обследовано 93 женщины, вынашивающие плод. Возраст
обследуемых варьирует в пределах от 20 до 39 лет. Женщины
включались в исследование при условии информированного согласия
Для определения динамики и расчета референтных интервалов уровня
эстрона в крови при благоприятном течении беременности и отсутствии
осложнений была отобрана группа из 79 женщин. Беременность у этих
обследуемых протекала без осложнений, репродуктивные нарушения,
анемии, токсикоз и прочие заболевания не выявлены. Данная группа
была разделена на две возрастные подгруппы (табл. 1): 20–29 лет (43
человека) и 30–39 лет (36 человек).
Гормональные исследования проводили на высокоскоростном
автоматическом анализаторе третьего поколения «Alisei Q.S.» (Radim,
Италия) методом твердофазного иммуноферментного анализа (ELISA).
- 62 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Уровень эстрона определяли с использованием наборов реагентов
производства «DRG Instruments GmbH», Германия (DRG Estrone ELISA
Kit). Аналитические характеристики используемых реагентов: а)
чувствительность метода не более 6,3 пг/мл; б) специфичность
(перекрестная реактивность) к эстрону составляет 100%. Перекрестная
реактивность к эстриолу, эстрадиолу, тестостерону и прогестерону
менее 0,1%; в) коэффициент вариации внутрисерийной и межсерийной
воспроизводимости не превышает 10%; г) референтные значения для
небеременных женщин располагаются в пределах от 18 пг/мл (5%-ный
процентиль) до 183 пг/мл (95%-ный процентиль). Таким образом, набор
реагентов для определения эстрона в сыворотке крови отвечает
требованиям аналитической точности и пригоден для определения
референтного интервала.
Таблица 1
Средний возраст и средний срок гестации обследуемых
с благоприятным течением беременности
Группа
Средний
возраст, лет
1-я возрастная
подгруппа
25,8±3,4
2-я возрастная
подгруппа
34,7±4,2
Триместр
I
II
III
I
II
III
Средний срок
гестации, нед.
6,1±2,1
17,3±2,5
25,7±3,8
7,2±2,8
15,3±2,4
28,5±3,9
Материал – сыворотка крови; пробы забирали в вакуумные
пробирки с активатором свертывания. Получение материала для
исследования осуществлялось согласно общепринятым стандартам.
Забор крови проводился натощак из локтевой вены с 8:00 до 10:00 ч.
Сыворотку получали после ретракции сгустка и последующего
центрифугирования при 1500 об/мин в течение 15 минут. До проведения
исследования сыворотка замораживалась и хранилась при температуре 20°С не более четырех недель.
Концентрацию
рассматриваемых
показателей
в
крови
определяли у всех обследуемых на протяжении трех триместров: 2–12
недель (I триместр), 13–24 недели (II триместр), 25–36 недель (III
триместр).
Статистическую обработку материала проводили с применением
программы статистического анализа Statistica 8.0. При расчете среднего
значения разброс данных оценивали с помощью показателя
стандартного отклонения.
Для оценки распределения данных и сравнения значений,
полученных для обследуемых в разных триместрах, использовали
- 63 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
коробчатую диаграмму. Для определения среднего значения данных
рассчитали медиану – значение признака, делящего выборку на две
равные части. Для анализа разброса данных рассчитали процентили: 25и 75%-ные, ограничивающие значения у 50% обследуемых. Для
определения границ референтного интервала согласно общепринятым
рекомендациям [3] был отобран 95%-ный процентильный интервал.
Результаты и обсуждение. В соответствии с первой задачей
провели измерение концентрации эстрона в крови женщин,
беременность которых протекала без осложнений и сопутствующих
заболеваний. Результаты представлены на рис.1.
2000
пг/мл
1800
1600
1400
1200
1000
800
600
400
200
0
триместр
I
II
III
Р и с . 1 . Содержание эстрона в крови обследуемых
с физиологической беременностью:
без штриховки – первая, со штриховкой – вторая возрастная группа
Анализируя содержание эстрона в крови беременных женщин,
выявили достоверное увеличение концентрации с течением
беременности (p<0,05), что соответствует литературным данным [11].
Эстрон наряду с эстриолом является продуктом преобразования
ряда андрогенов, основной из которых ДГЭА-С, синтезированный
надпочечниками матери и плода. Последовательный рост концентрации
эстрогенов с течением беременности сопровождается истощением пула
ДГЭА-С в крови женщин, что было подтверждено ранее проведенными
исследованиями [7]. Данные результаты характерны для нормально
протекающей беременности, не обозначенной аномально высокими
концентрациями андрогенов.
- 64 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Таблица 3
Концентрация эстрона при физиологической беременности
Триместр
Уровень эстрона, пг/мл
медиана
2,5% процентиль
97,5% процентиль
I
177
83
656
II
772
450
1312
III
1043
705
1932
пг/мл
Анализируя возрастные особенности содержания эстрона,
обнаружили, что достоверные различия для периода беременности не
характерны. Это является дополнением к литературным данным [11;
15], указывающим, что вне беременности уровень эстрона меняется с
возрастом. Полученные данные позволяют использовать для расчета
референтных интервалов значения из всей выборки.
Проанализировав результаты, полученные при определении
уровня эстрона в группе женщин с благоприятным течением
беремнности, без учета возрастных изменений, были получены
следующие данные (табл. 3). Распределение концентрации эстрона по
триместрам при физиологической беременности отражено на рис.2.
2200
2000
1800
1600
1400
1200
1000
800
600
400
200
0
I
II
III
Медиана
25%-75%
2,5%-97,5%
Выпадающие
значения
триместр
Р и с . 2 . Распределение уровня эстрона по триместрам
при физиологической беременности
Анализируя результаты определения концентрации эстрона в
крови обследуемых в первый триместр беременности, наблюдали рост
- 65 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
уровня гормона. У половины беременных получили значения в
пределах от 121 пг/мл до 460 пг/мл. Можно отметить стремление
медианы к 25%- и 5%-ному процентилю, что говорит о высокой
концентрации значений в пределах от 83 пг/мл до 177 пг/мл. Таким
образом, содержание гормона меняется незначительно по сравнению с
догестационным периодом. Однако у ряда женщин получены высокие
значения эстрона, в т. ч. выпадающие за пределы 97,5%-ного
процентиля. Выше медианы разброс данных более выражен, что также
демонстрирует высокое значение 97,5%-ного процентиля, но плотность
данных снижается. Высокие значения эстрона получены у женщин,
находящихся на 9–12 неделе беременности, и являются следствием
постепенного роста уровня гормона к концу первого триместра. Можно
сделать вывод, что в течение первого триместра 95% значений,
характерных
для женщин
с физиологически
протекающей
беременностью, укладываются в пределы от 83 пг/мл до 656 пг/мл.
Во втором триместре 2,5%-ный процентиль составляет 450 пг/мл,
медиана – 772 пг/мл, что говорит о резком увеличении концентрации
гормона по сравнению с первым триместром. Тенденция к смещению
медианы в сторону низких значений менее выражена, таким образом,
данные распределены более равномерно относительно самой медианы.
У половины обследуемых значения располагались в интервале от 614
пг/мл до 1070 пг/мл. В целом для второго триместра при нормально
протекающей беременности характерны значения гормона в пределах от
450 пг/мл до 1312 пг/мл.
Для второго и третьего триместров характерно близкое
расположение медиан и 25%-ных процентилей, что говорит о
постепенном замедлении темпов роста концентрации эстрона в крови
беременных. Однако для третьего триместра характерен высокий
разброс данных, находящихся выше медианы, в результате для
половины обследуемых были получены значения эстрона в интервале от
771 пг/мл до 1494 пг/мл. Рассчитанные референтные значения
располагаются в широких пределах и составляют 705 – 1932 пг/мл.
На основании проведенного исследования можно сделать вывод,
что в период беременности концентрация эстрона растет от первого к
третьему триместру. Возраст не влияет на уровень гормона, что сужает
набор референтных значений и облегчает трактовку результатов. При
установлении
референтных
величин
необходимо
учитывать
региональные особенности обследуемых, а также производителя
используемых реагентов [14].
По результатам исследования были предложены следующие
референтные интервалы концентрации эстрона при беременности для
женщин, проживающих в Тверской обл.: 83–656 пг/мл (первый
триместр), 450 – 1312 пг/мл (второй триместр), 705 – 1932 пг/мл (третий
триместр).
- 66 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Заключение. Таким образом, в связи с выраженной динамикой
концентрации эстрона в период беременности можно предположить его
диагностическую значимость как одного из маркеров гестационного
периода.
Список литературы
1. Башмакова
Н.В., Дерябина Е.Г. Неклассическая врожденная
дисфункция коры надпочечников в практике акушера-гинеколога //
Российский вестник акушера-гинеколога. 2005. № 3. С. 115–119.
2. Клиническая оценка лабораторных тестов / под ред. Н.У. Тица. М.,
1986. 432 с.
3. Методические рекомендации по разработке референтных величин
лабораторных показателей / под ред. В.В. Меньшикова. М., 1983.
4. Репродуктивная эндокринология / под ред. С.С.К. Йена, Р.Б.
Джаффе. В 2 т. Т. 1. М., 1998.
5. Серов В.Н., Прилепская В.Н., Овсянникова Т.В. Гинекологическая
эндокринология. М., 2004. 528 с.
6. Толстых К.Ю., Панкрушина А.Н. Значение гормональных
показателей для выбора адекватной тактики ведения беременности //
Вестн. ТвГУ. Сер. Биология и экология. 2009. Вып. 15. С. 104–111.
7. Толстых К.Ю., Панкрушина А.Н. Особенности стероидогенеза в
коре надпочечников при физиологическом течении беременности и
диагностируемой гиперандрогении // Вестн. Твер. гос. ун-та. Сер.
Биология и экология. 2011. Вып. 22, № 12. С. 77–86.
8. Тришкин А.Г., Артымук Н.В., Николаева Л.Б., Тимощук Г.И.
Концентрация эстриола у первобеременных первородящих женщин,
осложненных аномалиями родовой деятельности // Успехи
современного естествознания. 2004. № 12. С.78–79.
9. Чагай Н.Б., Фадеев В.В. Сложности дифференциальной диагностики
и терапии неклассической формы врожденной дисфункции коры
надпочечников у пациенток репродуктивного возраста // Проблемы
репродукции. 2009. № 3. С. 93–98.
10. Эндокринология / под. ред. Н. Лавина: Пер. с англ. М., 1999. 1128 с.
11. Baird D.T., Fraser I.S. Blood production and ovarian secretion rates of
estradiol-17β and estrone in women throughout the menstrual cycle // J.
Clin. Endocrinol. Metab. 1974. Vol. 38. P. 1009–1017.
12. Celsi G., Kistner A., Aizman R., Ekluf A., Ceccatelli S., Santiago A.
Prenatal dexamethasone causes oligonephronia, sodium retention, and
higher blood pressure in the offspring // Pediatric Research. 1998. Vol.
44. P. 317–322.
13. Dawes G.S., Serra V., Moulden M., Redman C.W.G. Dexamethasone and
fetal heart rate variation // An. Intern. J. Obstetr. Gynaecol. 1994. Vol.
- 67 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
101. P. 675–679.
14. Folan J. et al. Solid-phase Enzymoimmunoassay of estrone in serum //
Clin Chem. 1988. Vol. 34. P. 1843–1846.
15. Haddad V., Ketchel M.M. Termination of pregnancy and occurrence of
abnormalities following estrone administration during early pregnancy //
Int. J. Fertil. 1969. Vol. 14. P. 56–63.
16. New Maria I. Nonclassical 21-Hydroxylase Deficiency // J. Clin.
Endocrinol. Metab. 2006. Vol. 91. P. 4205–4214.
17. Pang S., Clark A.T., Freeman L.C., Dolan L.M., Immken L., Mueller
O.T., Stiff D., Shulman D.I. Maternal side effects of prenatal
dexamethasone therapy for fetal congenital adrenal hyperplasia // J. Clin.
Endocrinol. Metab. 1992. Vol. 75. P. 249–253.
18. Ritzen E.M. Prenatal dexamethasone treatment of fetuses at risk for
congenital adrenal hyperplasia: benefits and concerns // Seminars in
Neonatology. 2001. Vol. 6. P. 357–362.
19. Tulchinsky D., Hobel C.J., Yeager E., Marshall J.R. Plasma estrone,
estradiol, estriol, progesterone, and 17-hydroxyprogesterone in human
pregnancy // Am. J. Obstet. Gynecol. 1972. Vol. 112. P. 1095–1100.
ESTRONE DYNAMICS IN BLOOD DURING PREGNANCY
C.Yu. Tolstykh, A.N. Pankrushina
Tver State University
Estrogen synthesis activates during pregnancy. It leads to increase of some
androgenic intermediates in blood. Estrone is one of clinical markers,
correlating with steroidogenesis activity.
Keywords: steroidogenesis, estrone, pregnancy.
Об авторах:
ТОЛСТЫХ
Константин
Юрьевич–аспирант
кафедры
биомедицины, ФГБОУ ВПО «Тверской государственный университет»,
170100, Тверь, ул. Желябова, 33, e-mail: corvus_ct86@mail.ru
ПАНКРУШИНА Алла Николаевна–доктор биологических наук,
профессор кафедры биомедицины, ФГБОУ ВПО «Тверской
государственный университет», 170100, Тверь, ул. Желябова, 33, e-mail:
alla.pankrushina@mail.ru
- 68 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20. С. 69-73.
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
УДК: 616.33-002.2-092:616.15
ИЗМЕНЕНИЕ БИОЛОГИЧЕСКИХ УРОВНЕЙ
ЩЕЛОЧНОЙ ФОСФАТАЗЫ СЫВОРОТКИ КРОВИ
ПРИ ХРОНИЧЕСКОМ ВОСПАЛЕНИИ
СЛИЗИСТОЙ ОБОЛОЧКИ ЖЕЛУДКА
Т.М. Миллер, М.Б. Петрова, Д.А. Миллер, И.Л. Некрасова
Тверская государственная медицинская академия
Изучалось содержание щелочной фосфатазы в динамике хронического
воспаления в слизистой оболочке желудка кинетическим методом с
помощью стандартизированной тест-системы Fluitest®ALD. Материалом
исследования служила сыворотка крови людей. Максимальные значения
уровня содержания щелочной фосфатазы соответствуют высокой
степени активности воспаления слизистой оболочки желудка. Уровень
содержания щелочной фосфатазы отражает не только активность
воспалительных реакций, но и структурные повреждения слизистой
оболочки желудка в виде поверхностных повреждений (эрозий), которые
связаны с распадом (лизисом) клеточных мембран и состоянием
репаративных процессов.
Ключевые слова: щелочная фосфатаза, сыворотка крови, хроническое
воспаление слизистой оболочки желудка.
Введение. Распространенность щелочной фосфатазы (ЩФ) в
клетках различных органов и тканей человека свидетельствует о том,
что этот фермент ответственен за фундаментальные биохимические
процессы [6], а определение ЩФ является одним из наиболее часто
применяемых тестов клинической биохимии [5]. В основном этот
фермент сосредоточен в слизистой оболочке желудочно-кишечного
тракта [10]. ЩФ продуцируется клетками поверхностного слоя
слизистой оболочки кишечника, но её роль в пищеварении вторична, а
базовые ее функции связаны с процессами общего метаболизма [8].
Известно, что по уровню содержания ЩФ можно судить о
степени тяжести течения воспалительного процесса [4]. Однако для
такой распространенной в популяции патологии как хроническое
воспаление слизистой оболочки желудка сведения о содержании ЩФ в
сыворотке крови в динамике течения этого процесса отсутствуют. Цель
исследования состояла в установлении изменений содержания ЩФ в
сыворотке крови при хроническом течении воспаления слизистой
оболочки желудка в связи с морфологическим ремоделированием его
внутренней стенки.
Материал и методика. Определение содержания ЩФ
проводили в сыворотке крови, полученной у 88 человек хроническим
гастритом (52,3% женщин и 47,7% мужчин средним возрастом 30 лет) и
- 69 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
26 здоровых добровольцев (женщин 53,8% и 46,2% мужчин) в возрасте
от 18 до 24 лет для установления нормативных показателей. В первую
группу исследования включались люди с нетяжелыми сопутствующими
заболеваниями в период их ремиссии.
Определение уровня ЩФ в сыворотке крови проводилось с
помощью готовой (стандартизированной) тест-системы Fluitest®ALD
(R1-R2) фирмы Biocon (Германия) на приборе Screen Master (LIHD113)
фирмы Hospitex Diagnostics (Италия) кинетическим методом [12; 13].
Технология проведения исследования активности ЩФ представлена
фирмой, выпускающей тест-систему.
Диагноз хронического воспалительного процесса устанавливался
на основании результатов инструментального исследования состояния
слизистой оболочки желудка (гастроскопия) с гистологическим
изучением ее биоптатов, а также рутинных клинических и
биохимических исследований крови.
Полученный в процессе исследований цифровой материал
представлен в международных единицах системы «СИ». Для создания
электронной базы данных применена электронная таблица Exel Office
Microsoft
2000.
Обработка
полученных
данных
проведена
статистической программой Biostat 4.03 с применением критериев
непараметрической статистики: дескриптивный анализ, однофакторный
дисперсионный анализ (F), методика множественных сравнений критерий Ньюмена-Кейлса (q). При этом X SD обозначали величину
средней арифметической и стандартного отклонения. Критерием
достоверности (Р) нулевой гипотезы служила величина ≤ 0.05 [3].
Результаты и обсуждение. Исследование крови, полученной у
доноров-добровольцев, показали, что уровень ЩФ в сыворотке
составляет 52,23±7,61 E/л, что не противоречит данным других авторов
[7].
Таблица 1
Содержание щелочной фосфатазы в период обострения и ремиссии
хронического воспаления слизистой оболочки желудка человека
[ X ± SD; P(F; q)≤0,05]
Показатели
Норма
Период
Период
обострения ремиссии
Щелочная фосфатаза, Е/л 52,27,61 84,324,9
Р(q)
F
P (q1)
Р(q)2
82,013,2
0,05 >0,05 0,05
Число обследованных
26
88
26
Примечание. Р – достоверность различий между показателями в период обострения и
нормы; Р1 – периодом обострения и ремиссии; P2 – периодом ремиссии и нормы.
Обнаружено, что в период обострения хронического
воспалительного процесса в слизистой оболочке желудка определяются
существенно высокие уровни ЩФ в сыворотке крови. Этот показатель
- 70 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
уменьшался в период ремиссии хронического воспалительного
процесса. Однако оставался достоверно увеличенным по сравнению с
группой здоровых лиц (табл. 1).
Таблица 2
Содержание щелочной фосфатазы
при обострении хронического воспаления
в зависимости от структурного ремоделирования слизистой оболочки желудка
[ X ± SD; P(F; q) ≤0,05]
Показатели
Щелочная
фосфaтаза, Е/л
Число
обследованных
F
Неатрофическая Атрофическая Эрозивная
форма
форма
форма
Р(q) Р(q)2 P(q)3
78,919,02
88,723,6
100,518,01
20
68
30
0,05 0,05 0,05
Примечание. Р – достоверность различий показателей при неатрофической и
атрофической формах хронического воспаления слизистой оболочки желудка;
Р2 – неатрофической и эрозивной форме; P3 – атрофической и эрозивной форме.
Сопоставление уровней ЩФ сыворотки крови при обострении
хронического воспаления в слизистой оболочке с особенностями ее
морфологических изменений выявило, что наиболее значительное
повышение уровня ЩФ определялось при обострении хронического
воспаления желудка, протекающего с эрозиями. Наименьшие значения
определяемого фермента отмечались в начальных проявлениях
ремоделирования слизистой оболочки: неатрофической форме и
наблюдалась тенденция к возрастанию содержания фермента при
прогрессировании воспаления и появления атрофических процессов
собственно слизистой оболочки (табл. 2).
Заключение. Установлено, что хроническое воспаление
слизистой оболочки желудка сопровождается увеличением содержания
ЩФ в сыворотке крови. Более высокими указанные изменения были в
период обострения хронического воспалительного процесса. Но в
период ремиссии отмечалась тенденция к нормализации изучаемых
показателей. Однако и в этот период хронического воспаления по
сравнению с нормальным состоянием слизистой оболочки желудка
величина ЩФ оставалась существенно повышенной. Содержание ЩФ в
зависимости от степени активности воспалительного процесса носило
характер прямой зависимости: количественное содержание фермента
было максимальным при обострении хронического воспалительного
процесса и при морфологических изменениях, протекающих с эрозиями
слизистой оболочки желудка.
Сопоставляя полученные данные с имеющимися в литературе
сведениями, можно утверждать, что хронический воспалительный
- 71 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
процесс слизистой оболочки желудка сопровождается распадом
клеточных мембран [1; 2], а ЩФ является достоверным индикатором
метаболических клеточных и внутриклеточных расстройств, связанных
с нарушением в ней репаративных процессов [9; 11].
Список литературы
1. Вахрушев
Я.М.
Никишина
Е.В.
Комплексное
изучение
патогенетических механизмов эрозивного поражения желудка и
двенадцатиперстной кишки // Рос. гастроэнтерол. журн. 1998. № 3.
С. 22–29.
2. Воспаление: руководство для врачей / ред. В.В. Серов, В.С. Пауков.
М.: Медицина, 1995. 640 с.
3. Гланц С. Медико-биологическая статистика. М.: Практика, 1998.
459 с.
4. Камышников В.С. Справочник по клинико-биохимическим
исследованиям и лабораторной диагностике. М.: МЕДпресс-информ,
2004. 920 с.
5. Кишкун А.А. Руководство по лабораторным методам диагностики.
М.: ГЭОТАР-МЕДИА, 2007. 771 с.
6. Клиническая биохимия: учебное пособие / ред. В.А. Ткачук. 2-е изд.,
испр. и доп. М.: ГЭОТАР-МЕДИА, 2006. 512 с.
7. Лифшиц В.М., Сидельникова В.И. Лабораторные тесты при
заболеваниях человека. М.: Триада-Х, 2003. 352 с.
8. Балябина М.Д., Слепышева В.В., Козлов А.В. Методы определения
активности щелочной фосфатазы // Терра Медика нова. 2007. № 3
(15). С. 7–16.
9. Патология: руководство / ред. М.А. Пальцев, В.С. Пауков,
Э.Г. Улумбекова. М.: ГЭОТАР-МЕДИА, 2002. 960 с.
10. Функциональная диагностика в гастроэнтерологии: учебнометодическое пособие / О.А. Саблин и др. СПб., 2002. 88 с.
11. Элементы патологической физиологии и биохимии: учебное
пособие / ред. И.П. Ашмарин. М.: Изд-во МГУ, 1992. 192 с.
12. Bablok W.A. General regression procedure for method transformation // J.
Clin. Chem. Clin. Biochem. 1988. № 26. P. 783–790.
13. Glick M.R., Ryder K.W., Jackson S.A. Graphical comparisons of
interferences in clinical chemistry instrumentation // Clin. Chem. 1986.
Vol. 32. P. 470–474.
- 72 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
THE CHANGE OF BIOLOGICAL LEVELS OF BLOOD SERUM
ALKALINE PHOSPHATASE IN CHRONIC INFLAMMATION
IN MUCOSA OF STOMACH
T.M. Miller, M.B. Petrova, D.A. Miller, I.L. Necrasova
Tver State Medical Academy
The concentration of alkaline phosphatase in dynamic activity of chronic
inflammation in mucosa of stomach by kinetic method with helping of
standard FluitestR ALD test-system was studied. The material for
investigation was blood serum of men. The maximal indices of alkaline
phosphatase correspond to high activity of inflammation of stomach mucosa.
The level of alkaline phosphatase reflects activity of inflammation reactions
and the structural damages of stomach mucosa in form of erosions as well.
The erosions are cased by lysis of cell membranes and processes of
regeneration.
Keywords: alkaline phosphatase, blood serum, chronic inflammation of
stomach mucosa.
Об авторах:
МИЛЛЕР Татьяна Михайловна–младший научный сотрудник
НИЦ ГБОУ ВПО «Тверская ГМА Минздравсоцразвития России»,
170100, Тверь, ул. Советская, 4.
ПЕТРОВА Маргарита Борисовна–доктор биологических наук,
профессор, заведующая кафедрой биологии, ГБОУ ВПО «Тверская
ГМА Минздравсоцразвития России», 170100, Тверь, ул. Советская, 4,
e-mail: pmargo-2612@mail.ru
МИЛЛЕР Дмитрий Анатольевич–доктор медицинских наук,
профессор кафедры факультетской терапии, ГБОУ ВПО «Тверская
ГМА Минздравсоцразвития России», 170100, Тверь, ул. Советская, 4,
e-mail: miller-47@mail.ru
НЕКРАСОВА Инесса Львовна–кандидат медицинских наук,
старший преподаватель кафедры гистологии и эмбриологии, ГБОУ
ВПО «Тверская ГМА Минздравсоцразвития России», 170100, Тверь, ул.
Советская, 4.
- 73 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20. С. 74-82.
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
УДК 577.29
РЕНТГЕНОФОТОЭЛЕКТРОННЫЙ АНАЛИЗ АДСОРБЦИИ
ФОСФОРОТИОАТНЫХ ОЛИГОМЕРОВ ДНК
НА ПОВЕРХНОСТИ ЗОЛОТА
И.Ю. Янов, А.В. Быков, Е.В. Ожимкова, Э.М. Сульман
Тверской государственный технический университет
В работе представлены результаты РФЭС исследований адсорбции
фосфоротиоатных олигомеров ДНК на поверхности золота. На основе
полученных данных предложена модель адсорбции указанных
олигомеров. Показано, что разработанная методика позволяет получить
близкий
к
мономолекулярному
слой
модифицированных
олигонуклеотидов ДНК на поверхности золота.
Ключевые слова: рентгенофотоэлектронная спектроскопия, олигомеры
ДНК, фосфоротиоаты, молекулярная электроника, биосенсоры.
Введение. Способность атомов серы и золота образовывать
прочную ковалентную связь широко используется в современной
нанотехнологии. В частности, тиолирование применяется в
молекулярных электронных устройствах в качестве интерфейса между
органическими молекулами и металлическими (золотыми) электродами.
Тиолированные олигонуклеотиды ДНК применяются также при
создании биочипов.
В настоящее время большая часть исследований в этой области
ориентирована на олигонуклеотиды ДНК с одной тиолированной
группой на конце, в которых атом серы соединяет поверхность золота с
ДНК (как правило с помощью алкантиоловых или меркаптановых
спейсеров), т.е. на системы типа золото-сера-углерод (Au-S-C-). В
данной работе нами проведен рентгенофотоэлектронный анализ
адсорбции фосфоротиоатных олигомеров ДНК на поверхности золота
(систем типа Au-S-P-).
Фосфоротиоаты являются вариантом нормальной ДНК, в
котором один из немостиковых атомов кислорода в каждой
фосфодиэфирной
группе
заменен
атомом серы (рис.
1).
Фосфоротиоатная
модификация
олигонуклеотидов
широко
используются в антисмысловых исследованиях для блокировки
экспрессии нежелательных генов из-за ее стабильности в цитоплазме с
высоким содержанием экзонуклеазы и способности проникать через
двойной липидный слой клеточных мембран [6].

Работа выполнена при поддержке Министерства образования и науки Российской
Федерации (грант № P978)
- 74 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
В отличие от одноцепочечных ДНК с одной тиолированной
группой на конце, широко применяемых в биочипах, фосфоротиоаты
способны образовывать многочисленные ковалентные связи с золотой
поверхностью, т. е. они располагаются параллельно поверхности
подложки. Данная возможность представляет интерес для многих
практических приложений, таких, как разработка нового поколения
полностью электронных биосенсоров и нанофлюидика.
Подготовка образцов. Для обеспечения упорядоченной
адсорбции ДНК и получения воспроизводимых результатов необходимо
высокое качество золотой подложки.
Золотая подложка была приготовлена с помощью вакуумного
испарения золота и его конденсации на предварительно очищенной
стандартной 8 дюймовой кремниевой пластине, используемой в
микроэлектронике. Для лучшей адгезии золота с подложкой и
предотвращения отслаивания золота в течение последующей обработки
между кремниевым субстратом и слоем золота был нанесен слой титана
в 5 нм. Толщина золотого покрытия составила около 100 нм. Исходная
пластина была разрезана на образцы размером 53 мм.
Р и с . 1 . Модель адсорбции
фосфоротиоатных олигомеров ДНК на поверхности золота
Золото является химически инертным веществом, но оно
мгновенно покрывается слоем углеводородов после контакта с
- 75 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
воздухом. Если рентгенофотоэлектронный анализ показывает, что на
поверхности содержатся только атомы углерода, золота и кислорода, то
такая подложка считается пригодной для нанесения исседуемых
образцов. Если же на поверхности присутствуют другие элементы, то
необходима дополнительная очистка поверхности золота.
Нами были исследованы различные химические и физические
способы очистки. С помощью рентгенофотоэлектронного анализа было
установлено, что наилучшие результаты дает применение раствора
«Пиранья». Для этого золотой образец помещался на несколько секунд
(до начала бурного кипения) в раствор 30% перекиси водорода (H2O2) и
концентрированной серной кислоты (H2SO4) (30:70 по объему). Затем
образец несколько раз промывался в деионизированной воде MilliQ.
После такой обработки, обзорные РФЭ-спектры не показывали
содержание посторонних примесей на образце.
Остальные из исследованных методов не позволили полностью
избавиться от загрязнения образцов органическими соединениями.
Также было обнаружено, что существенно снизить загрязнение
поверхности позволяет вакуумная сушка образцов.
Для анализа использовались следующие образцы:
1. Чистый золотой образец, помещенный на несколько секунд (до
начала бурного кипения) в раствор «Пиранья». Затем, образец три раза
промывался в деионизированной воде MilliQ и высушивался в вакууме.
2. Золотой образец, подготовленный согласно п.1, с нанесенным
раствором модифицированных олигонуклеотидов в деионизированной
воде MilliQ (концентрация 9.25 мкг/мл). После инкубации в течение 12
часов образец промывался MilliQ водой и высушивался в вакууме.
Выбор тестовой последовательности олигонуклеотидов. В
качестве объекта исследования нами была выбрана одноцепочечная
последовательность нуклеотидов, комплементарная специфическому
участку промотора 35S вируса мозаики цветной капусты (CaMV).
Уникальность CaMV 35S промотора заключается в том, что он
используется практически во всех генетически модифицированных
сельскохозяйственных культурах выращиваемых или исследуемых в
настоящее время [3] CaMV 35S промотор и NOS терминатор содержатся
в
большинстве
коммерчески
используемых
генетически
модифицированных растений). Поэтому, наличие в пробах
нуклеотидных последовательностей, характерных для 35S промотора
является наиболее универсальным признаком ГМО (за исключением тех
растений, которые могут быть поражены природным вирусом мозаики
цветной капусты, например, относящийся к семейству крестоцветных
рапс).
CaMV 35S промотор был впервые выделен и исследован в начале
1980-х годов Chua Nam-Hai и соавт. из университета Рокфеллера [5].
Чтобы определить наличие в пробах ГМО, созданных с использованием
- 76 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
промотора вируса мозаики цветной капусты необходимо синтезировать
одноцепочечные зондовые олигонуклеотиды, комплементарные каким
либо специфическим его участкам.
Для обеспечения эффективной и селективной гибридизации с
CaMV 35S промотором, нами была выбрана следующая
последовательность, состоящая из 26 нуклеотидов и предложенная в
работе [4]:
– оригинальная последовательность CaMV 35S в области
«минимального промотора», содержащая TATA и TCACC боксы:
CAGTAGGGAATGCAGTCACCTCTATA
– комплементарная ей последовательность зонда:
5’-GTCATCCCTTACGTCAGTGGAGATAT-3’
Фосфоротиоаты ДНК. Для решения задачи прочного и
упорядоченного присоединения ДНК параллельно поверхности золота,
мы
использовали
фосфоротиоатный
аналог
нашего
зонда,
комплементарного к выбранной последовательности CAMV 35S
промотера.
Синтез
тиофосфатных
олигонуклеотидов
осуществлялся
амидофосфитным методом с использованием содержащего серу
окислителя на стадии окисления [1]. Метод позволяет синтезировать
олигонуклеотиды, содержащие фосфотиоатную связь в любом
положении олигонуклеотидной цепи. В результате синтеза получается
2n диастереоизомеров (где n – число фосфотиоатных связей). Данный
синтез был проведен по нашему заказу научно-производственной
компанией СИНТОЛ [1].
Рентгенофотоэлектронная спектроскопия образцов. Спектры
были получены в ИНБТ ТГТУ с помощью спектрометра ЭС 2403 М-Т
СКБ АП РАН с анализатором энергий PHOIBOS 100 (производство
SPECS, Германия). Для фотоэлектронного возбуждения использовалось
характеристическое излучение Mg K (h=1253.6 эВ). Условия съемки:
– энергия анализатора: 7 эВ для спектров высокого разрешения
40 эВ для обзорных спектров;
– мощность рентгеновского источника: 100 Вт;
– вакуум: 10-7 Па.
Спектры были записаны с предварительно дегазированных в
сверхвысоком вакууме образцов. Спектры высокого разрешения были
получены путем накопления и усреднения соответствующих спектров.
В качестве референтного пика был использован пик Au 4f7/2 (84,00 эВ).
При моделировании 2р подуровня серы учитывалось, что расстояние
между компонентами 2p3/2 и 2p1/2 равно 1.3 эВ; соотношение
интенсивностей этих компонент 2:1.
Во всех моделях фон определялся по методу Ширли. Сравнение
обзорных спектров до и после нанесения олигонуклеотидов однозначно
свидетельствует о присутствии олигонуклеотидов ДНК на поверхности
- 77 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
золота. Для того, чтобы детально исследовать характер данного
взаимодействия, нами были получены спектры высокого разрешения
для отдельных элементов. Наибольший интерес для целей нашего
исследования представляют спектры серы, фосфора и азота (рис. 2–4).
Р и с . 2 . Спектр высокого разрешения S 2p
после нанесения олигонуклеотидов:
по оси абсцисс – энергия связи, эВ,
по оси ординат – интенсивность сигнала, с
Наиболее релевантная математическая модель (дающая
минимальное среднеквадратичное отклонение от экспериментального
спектра) для спин-разрешенного дублета подуровня S 2p состоит из
четырех компонентов, соответствующих разным химическим
состояниям серы. Известно, что для алкантиолов энергия связи S 2p3/2
электронов около 162 eV характерна для связи S-Au, тогда как наличие
пиков S 2p3/2 между 163–164 eV свидетельствует о том, что алкантиол
не связан с золотой подложкой (и находится на поверхности монослоя
связанных алкантиолов) [2].
Учитывая эти данные, можно предположить, что пики 162,23 eV
и 163,46 eV соответствуют связанным и несвязанным с подложкой тиолмодифицированным нуклеотидам, соответственно. В отличие от
алкантиолов, у нас остаются еще две компоненты, дающие
значительный вклад в спектры.
Расположенный ниже всех пик 161,53 eV можно
интерпретировать как результат гидролиза связи S-P и образования
- 78 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
поверхностных сульфидов (донирование электронной плотности
атомами золота понижает энергию связи S 2p электронов). Известно
также, что золото является катализатором окисления органических
соединений. Поэтому оставшийся пик (164,55 eV) может
соответствовать более окисленному (по сравнению с исходным)
состоянию серы тиолированного олигонуклеотида.
Р и с . 3 . Спектр высокого разрешения P 2p
после нанесения олигонуклеотидов:
по оси абсцисс – энергия связи, эВ,
по оси ординат – интенсивность сигнала, с
РФЭ-спектры фосфора, золота и азота свидетельствуют в пользу
данного
предположения.
Компьютерная
обработка
спектров
показывает, что наибольшую статистическую значимость имеют
трехкомпонентные модели для фосфора и двухкомпонентная модель
для азота (рис. 3, 4).
Наименьшую энергию связи P 2p электронов (132.93 eV) можно
ожидать для структур, где лишенные в результате гидролиза атомов
серы олигонуклеотиды ковалентно присоединяются к поверхности
золота через атомы фосфора. Тогда оставшиеся компоненты будут
соответствовать свободным олигонуклеотидам и олигонуклеотидам,
ковалентно связанным с золотом через атомы серы.
РФЭ-спектр азота хорошо описывается двухкомпонентной
моделью (рис. 4). Можно предположить, что эти достаточно близко
расположенные пики соответствуют двум различным состояниям азота
- 79 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
в основаниях ДНК (в аминогруппах и пятичленных циклах). В случае
наличия неспецифического взаимодействия азота напрямую с
подложкой или ее дефектами, более предпочтительной была бы трех- (и
более) компонентная модель.
N 1s
2
x 10
Name
238
236
P os.
%Area
N 1s_1
399.68
42.696
Sat
391.28
0.000
Sat
389.68
0.000
N 1s_2
400.90
57.304
Sat
392.50
0.000
Sat
390.90
0.000
CPS
234
232
230
228
226
224
408
406
404
402
400
398
396
394
392
390
Binding Energy (eV)
Р и с . 4 . Спектр высокого разрешения подуровня N 1s и его модель:
C asaXPS (T ver T echnical Univ ersity )
по оси абсцисс – энергия связи, эВ,
по оси ординат – интенсивность сигнала, с
Приведенные данные позволяют окончательно сформулировать
модель адсорбции фосфоротиоатных олигомеров ДНК на поверхности
золота. С поверхностью золота ковалентно взаимодействуют:
– неповрежденные фосфоротиоатные нуклеотиды;
– лишенные в результате гидролиза S-P связи серы нуклеотиды
(присоединяющиеся к поверхности золота через фосфор);
– образовавшиеся в результате гидролиза S-P связи поверхностные
сульфиды.
Выводы. 1. Энергия связи S 2p электронов подразделяется на
четыре уровня, соответствующих: поверхностным сульфидам (27,88%)
– гидролиз S-P связи; олигонуклеотидам, ковалентно связанным с
золотом
с
помощью
фосфоротиоатных
групп
(38,75%);
олигонуклеотидам со свободным фосфоротиоатным группами (23,23%);
олигонуклеотидам
с
различными
формами
окисленных
фосфоротиоатных групп (10,12%). Наименьшая энергия связи
соответствует поверхностным сульфидам, а наибольшая – окисленным
состояниям фосфоротиоатных групп олигонуклеотидов.
- 80 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
2. Минимальная энергия связи P 2p подуровня соответствует
структурам, в которых лишенные серы олигонуклеотиды ковалентно
присоединяются к поверхности золота (31,13%). Оставшиеся 68,86%
(28,73%+40,13%) соответствуют свободным олигонуклеотидам и
олигонуклеотидам, ковалентно связанным с золотом через атомы серы.
3. Сравнение процентного содержания соответствующих атомов
в спектрах S 2p и P 2p подуровней позволяет сделать вывод, что 69,88%
(38,75%+31,13%) нуклеотидов в рассматриваемых ДНК ковалентно
связано с золотой подложкой. Доля образовавшихся поверхностных
сульфидов (27,88%) хорошо соответствует количеству ковалентно
связанных с золотом нуклеотидов без серы (31,13%, результат
гидролиза S-P связи). Поэтому оставшиеся ~ 30% неспецифических
связей следует отнести к нуклеотидам с непровзаимодействовавшими с
золотом
свободными,
окисленными
и
гидролизованными
фосфоротиоатным группами.
Таким образом, разработанная нами методика позволяет
получить близкий к мономолекулярному (около 70% связей
олигонуклеотидов являются прямыми ковалентными связями с золотом)
слой модифицированных олигонуклеотидов ДНК на поверхности
золота.
Список литературы
1. СИНТОЛ. Модифицированные олигонуклеотиды: [Электрон.
ресурс]. 2011. Режим доступа: http://www.syntol.ru/productf.htm (дата
обращения: 23.06.2011).
2. Castner D.G., Hinds K., Grainger D.W. X-ray photoelectron
spectroscopy sulfur 2p study of organic thiol and disulfide binding
interactions with gold surfaces // Langmuir. 1996. Vol. 12. P. 5083–5086.
3. Chaouachi M., Fortabat M. N., Geldreich A., Yot P., Kerlan C., Kebdani
N., Audeon C., Romaniuk M., Bertheau Y. An accurate real-time PCR test
for the detection and quantification of cauliflower Mosaïc virus (CaMV):
applicable in GMO screening // European Food Research and
Technology. 2008. Vol. 227, № 3. P. 789–798.
4. Morisset D., Dobnik D., Hamels S., Zel J., Gruden K. NAIMA: target
amplification strategy allowing quantitative on-chip detection of GMOs //
Nucleic Acids Research. 2008. Vol. 36. P. 1–11.
5. Odell J.T., Nagy F., Chua N.H. Identification of DNA sequences required
for activity of the cauliflower mosaic virus 35S promoter // Nature. 1985.
Vol. 313. P. 810–812.
6. Shaw J.P., Kent K., Bird J., Fishback J., Froehler B. Modified
deoxyoligonucleotides stable to exonuclease degradation in serum //
Nucleic Acids Research. 1991. Vol. 19, № 4. P. 747–750.
- 81 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
X-RAY PHOTOELECTRON SPECTROSCOPY ANALYSIS OF THE
PHOSPHOROTHIOATE DNA OLIGOMERS ADSORPTION ON THE
GOLD SURFACE
I.Yu. Yanov, A.V. Bykov, E.V. Ozhimkova, E.M. Sulman
Tver State Technical University
We present here the results of XPS studies of the phosphorothioate DNA
oligomers adsorption on the gold surface. Based on the obtained data, the
model of adsorption of such oligomers is proposed. It is shown that the
developed technique allows to obtain a near monomolecular layer of modified
DNA oligonucleotides on the gold surface.
Keywords: X-ray photoelectron spectroscopy, phosphorothioate DNA
oligomers, molecular electronics, biosensors.
Об авторах:
ЯНОВ Илья Юрьевич–кандидат физико-математических наук,
старший научный сотрудник кафедры биотехнологии и химии, ФГБОУ
ВПО «Тверской государственный технический университет», 170026,
Тверь, наб. А. Никитина, 22, e-mail: science@science.tver.ru
БЫКОВ Алексей Владимирович–кандидат химических наук,
доцент кафедры биотехнологии и химии, ФГБОУ ВПО «Тверской
государственный технический университет», 170026, Тверь, наб. А.
Никитина, 22, e-mail: science@science.tver.ru
ОЖИМКОВА Елена Владимировна–кандидат химических наук,
доцент кафедры биотехнологии и химии, ФГБОУ ВПО «Тверской
государственный технический университет», 170026, Тверь, наб. А.
Никитина, 22, e-mail: science@science.tver.ru
СУЛЬМАН Эсфирь Михайловна–доктор химических наук,
профессор, заведующая кафедрой биотехнологии и химии, старший
преподаватель кафедры гистологии и эмбриологии, ФГБОУ ВПО
«Тверской государственный технический университет», 170026, Тверь,
наб. А. Никитина, 22, e-mail: science@science.tver.ru
- 82 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20. С. 83-107.
17-22.
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
БОТАНИКА
УДК 581.526.53(470.312)
ЛУГОВЫЕ СТЕПИ ЮГО-ВОСТОКА ТУЛЬСКОЙ ОБЛАСТИ
Е.О. Головина
Ботанический институт им. В.Л. Комарова РАН
Доминантно-детерминантным методом выделено 6 ассоциаций (2 из них
с 2 вариантами) и 2 безранговых сообщества луговых степей юговостока Тульской обл. Перистоковыльные степи распространены
наиболее широко и отличаются максимальным синтаксономическим
разнообразием. Красивейшековыльные, тырсовые и разнотравные степи
более редки и представлены 1–2 синтаксонами.
Ключевые слова: луговые степи, классификация растительности,
Тульская область.
Введение. Юго-восток Тульской обл. расположен в северовосточной части Среднерусской возвышенности. Геологический
фундамент района образуют докембрийские граниты и гнейсы,
перекрытые осадочными породами разного возраста и состава.
Девонские и меловые отложения (известняки, мергели, мел и др.)
местами – по склонам речных долин и балок – выходят на поверхность.
На водоразделах их покрывает слой четвертичных лессовидных
суглинков. Ведущую роль в формировании рельефа играет эрозионная
деятельность поверхностных вод. В целом территория представляет
собой полого-волнистую равнину, расчлененную речными долинами,
балками и оврагами [22]. Климат умеренно континентальный,
среднемесячная температура воздуха января составляет -10°С, июля
+18°С. Среднегодовое количество осадков – 525 мм [3]. В почвенном
покрове водоразделов преобладают оподзоленные и выщелоченные
черноземы, чередующиеся с участками серых лесных почв. По склонам
долин рек, к которым приурочены исследуемые растительные
сообщества, распространены эродированные карбонатные черноземы,
часто с примесью известнякового щебня.
Согласно схеме ботанико-географического районирования юговосток Тульской обл. лежит в пределах лесостепи, близ ее северной
границы [10]. В прошлом на водоразделах здесь господствовали
остепненные луга, северные разности луговых степей и дубравы, в
настоящее же время водораздельные пространства распаханы
практически полностью. Луговые степи сохранились лишь на склонах
долин рек; площадь степных участков, большинство из которых имеет
статус особо охраняемых природных территорий, нередко не превышает
нескольких гектаров.
- 83 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Степной флоре и растительности юго-восточной части Тульской
обл. посвящено много работ [5–8; 12; 16], однако большинство
исследователей основное внимание уделяли бассейну р. Красивой
Мечи, расположенному к югу от изучаемой территории. В 2009 г.
луговые степи региона были обследованы Е. А. Авериновой, которой
выполнена классификация сообществ на основе метода Й. Браун-Бланке
[18]. К сожалению, эти данные пока не опубликованы, поэтому при
упоминании в тексте статьи выделенных Е.А. Авериновой синтаксонов
не указан год их обнародования. Автору статьи удалось посетить
степные участки, неописанные Е.А. Авериновой, и, кроме того,
представляется интересным сравнить результаты классификаций
луговых степей, выполненных разными методами.
Материал и методика. В 2010 г. было проведено исследование
луговых степей, распространенных в юго-восточной части Тульской
обл., а именно на территории музея-заповедника «Куликово поле» и
нескольких памятников природы в его окрестностях. Обследованы
степные участки на склонах долин рек Дон, Рыхотка, Непрядва и малых
притоков последней – Среднего и Нижнего Дубиков. Выполнено 62
описания луговых степей.
Классификация растительности проведена в базе данных ИБИС
[9] на основе доминантно-детерминантного метода, предполагающего
уточнение объема синтаксонов, выделенных по доминантам, с помощью
детерминантных групп видов сходной экологии [4; 15]. Данный
алгоритм классификации представляется оптимальным, поскольку он
учитывает одновременно как роль доминантов в сложении
растительного покрова, так и флористические особенности
растительности в условиях конкретных типов экотопов.
В работе, наряду с такими синтаксономическими единицами, как
ассоциация и вариант, использована безранговая единица – сообщество,
выделяемая, если геоботанического материала недостаточно для
установления ассоциации. Как правило, названия синтаксонов даны по
доминирующему виду и одному из видов детерминантной группы. В
случае, когда синтаксон не имеет собственных детерминантных видов,
название дано по доминанту и субдоминанту.
Для ассоциаций и вариантов рассчитаны константность и (путем
усреднения данных по отдельным описаниям) среднее значение
проективного покрытия каждого вида. При расчетах средних значений
проективного покрытия видам с покрытием «+» присваивалось 0,1%.
Данные о константности и среднем проективном покрытии видов в
упомянутых синтаксонах представлены в таблице 1; в ней же отражена
флористическая дифференциация синтаксонов. Данные о безранговых
сообществах (геоботанические описания) сведены в табл. 2.
Экологические характеристики детерминантных групп видов основаны
на шкалах Л.Г. Раменского [20].
- 84 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Результаты и обсуждение. Наиболее широко в исследуемом
регионе распространены степные фитоценозы с господством Stipa
pennata – основного доминанта восточно-европейских луговых степей
[13]. Выделено 3 ассоциации (одна с двумя вариантами) и 1 безранговое
сообщество перистоковыльных степей.
1. Ассоциация Centaureo ruthenicae-Stipetum pennatae –
Руссковасильково-перистоковыльная (табл. 1, № 1)
Сообщества ассоциации описаны на правом склоне долины р.
Непрядвы к югу от устья р. Нижний Дубик. Крутизна склона 13–25°,
экспозиция западная. Почва со значительной примесью известнякового
щебня. Фитоценозы занимают в основном верхнюю и среднюю части
склона, иногда спускаясь почти до подножья.
Общее проективное покрытие травостоя около 70 %, его
основная масса достигает высоты 20–30 см, генеративные побеги
ковыля и некоторых видов разнотравья (Anthericum ramosum, Gypsophila
altissima) – 50–65 см, Centaurea ruthenica и Echinops ruthenicus – до 1 м
и немного более.
Облик сообществ определяет доминант Stipa pennata, к которому
местами примешивается S. pulcherrima. Заметную фитоценотическую
роль играют обычные в лугово-степных фитоценозах региона
мезоксеро- и ксеромезофиты Carex humilis, Salvia pratensis, Adonis
vernalis, Amoria montana, Stachys recta, и мезофильный Galium boreale,
также нередкий в луговых степях юго-востока Тульской области.
Отличительная черта – участие, иногда существенное, Centaurea
ruthenica, степного вида, произрастающего в Тульской области на
северной границе ареала [23]. Значительное содержание известнякового
щебня в почве обуславливает повышенную роль степных петро- и
кальцефильных Centaurea sumensis и Gypsophila altissima, а также
Anthericum ramosum, Vincetoxicum hirundinaria и Helianthemum
nummularium. В сравнении с первыми двумя, фитоценотическая
амплитуда последних видов более широка [14; 23]. Но в то же время
они являются константным и нередко весьма обильным компонентом
степей, развитых на участках со слаборазвитым почвенным покровом и
выходами на поверхность карбонатных пород не только в изучаемом
районе, но и в других регионах Центральной России и Украины [1; 11;
19; 21]. Типично присутствие малочисленных особей кустарника
Chamaecytisus ruthenicus.
Интересная особенность ассоциации – высокое постоянство, а
иногда и проективное покрытие некоторых луговых мезофитов
(Sanguisorba officinalis, Prunella vulgaris), а также растений, чей
эколого-фитоценотический оптимум охватывает как луговые степи, в
том числе на известняковых склонах, так и светлые разреженные леса,
преимущественно лесостепной зоны либо соответствующего высотного
пояса.
- 85 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Таблица 1
Фитоценотическая характеристика ассоциаций луговых степей юго-востока Тульской области
Синтаксоны
Вид
1
2
2
Centaurea sumensis Kalenicz.
Anthericum ramosum L.
Vincetoxicum hirundinaria Medik.
1
5
4
100
100
100
13
25
Galium octonarium (Klok.) Soó
Galium tinctorium (L.) Scop.
1
67
100
25
10
17
17
-
50
13
-
20
-
33
-
-
10
Gentiana cruciata L.
Pilosella bauhini (Bess.) Arv.-Touv.
Picris hieracioides L.
Hypericum elegans Steph. ex Willd.
Silene chlorantha (Willd.) Ehrh.
Centaurea jacea L.
Solidago virgaurea L.
Stipa pulcherrima C. Koch
Carlina biebersteinii Bernh. ex Hornem.
5
1
13
25
13
25
4
Centaurea ruthenica Lam.
Campanula altaica Ledeb.
Polygonatum odoratum (Mill.) Druce
Helianthemum nummularium (L.) Mill.
Prunella vulgaris L.
Sanguisorba officinalis L.
1
83
100
83
50
67
50
3
30
30
5
3
1
60
70
100
- 86 -
2
2
5
6
13
20
13
25
20
20
100
88
88
63
38
38
38
13
44
7
8
-
-
100
100
33
33
-
-
-
86
57
60
40
20
40
20
-
50
17
-
14
29
29
100
100
17
-
100
100
5
2
30
14
4
14
57
29
-
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Продолжение табл. 1
Синтаксоны
Вид
1
Astragalus austriacus Jacq.
Allium podolicu
(Aschers. et Graebn.) Blocki ex Racib.
Campanula glomerata L.
Trifolium pratense L.
Senecio jacobaea L.
Salvia verticillata L.
Linum flavum L.
Astragalus onobrychis L.
Malus sp. (juv.)
Scorzonera taurica Bieb.
Polygala sibirica L.
Pedicularis kaufmannii Pinzger
Stipa pennata L.
Stipa capillata L.
Carex humilis Leyss.
Salvia pratensis L.
Galium verum L.
Agrimonia eupatoria L.
Medicago falcata L.
Amoria montana (L.) Soják
Scabiosa ochroleuca L.
Filipendula vulgaris Moench
Fragaria viridis Duch.
18
8
10
2
2
3
4
5
6
7
-
-
-
-
-
-
-
-
-
-
-
-
13
13
-
25
17
-
25
50
-
10
30
10
10
13
13
25
100
100
100
100
83
100
100
100
100
83
22
6
12
12
5
2
1
3
4
4
100
75
88
100
100
100
100
100
88
100
100
15
1
17
9
1
2
1
2
1
1
2
100
60
100
100
100
80
70
80
90
60
90
- 87 -
23
7
9
3
2
1
2
1
5
1
100
75
100
100
100
100
100
100
100
88
3
3
8
3
6
1
1
5
1
8
83
43
-
67
-
40
-
-
50
50
50
14
20
-
-
33
-
11
3
1
100
86
86
86
71
57
43
100
60
80
100
100
100
100
100
60
80
100
100
100
100
100
100
33
100
100
33
17
100
100
100
100
100
100
100
100
67
50
7
2
6
2
1
3
1
3
1
2
1
71
100
86
86
71
100
100
86
86
86
100
7
6
1
2
1
27
8
2
5
4
1
4
1
2
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Продолжение табл. 1
Синтаксоны
Вид
1
Bromopsis inermis (Leyss.) Holub
Astragalus danicus Retz.
Euphorbia virgata Waldst. et Kit.
Thalictrum minus L.
Echinops ruthenicus Bieb.
Potentilla heptaphylla L.
Poa angustifolia L.
Veronica austriaca L.
Galium boreale L.
Adonis vernalis L.
Festuca valesiaca Gaudin
Jurinea ledebourii Bunge
Thymus marschallianus Willd.
Stachys recta L.
Centaurea scabiosa L.
Knautia arvensis (L.) Coult.
Scorzonera purpurea L.
Eremogone micradenia (P.Smirn.) Ikonn.
Campanula sibirica L.
Convolvulus arvensis L.
Artemisia marschalliana Spreng.
Gypsophila altissima L.
Onobrychis arenaria (Kit.) DC.
Cichorium intybus L.
2
5
1
4
1
2
83
67
33
33
33
83
33
100
100
100
100
67
50
67
33
17
67
67
50
100
-
8
1
2
1
1
3
100
88
63
88
63
63
100
100
50
75
63
25
63
38
50
75
88
88
38
50
25
13
88
50
2
2
4
1
1
1
4
70
70
70
100
40
70
70
60
50
70
80
80
30
70
60
30
40
30
40
60
50
60
20
70
- 88 -
1
3
1
1
1
2
1
5
88
100
88
63
75
88
63
88
75
25
50
100
50
25
88
75
100
50
88
13
100
88
100
63
8
4
1
1
6
40
100
80
100
100
60
60
20
100
40
20
60
80
60
40
100
80
40
40
100
40
80
40
10
2
2
3
7
33
33
100
100
100
100
100
33
100
33
33
33
67
33
-
5
7
2
1
8
50
67
83
33
67
83
67
33
33
100
67
67
100
100
67
100
67
1
4
8
4
2
100
29
71
86
100
57
86
71
43
100
43
43
86
100
100
57
71
29
29
29
57
29
29
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Продолжение табл. 1
Синтаксоны
Вид
1
Eryngium planum L.
Chamaecytisus ruthenicus
(Fisch. ex Woloszcz.) Klaskova
Koeleria cristata (L.) Pers.
Achillea millefolium L.
Veronica spicata L.
Pimpinella saxifraga L.
Seseli annuum L.
Allium flavescens Bess.
Phlomoides tuberosa (L.) Moench
Allium oleraceum L.
Lotus corniculatus L.
Asperula cynanchica L.
Verbascum lychnitis L.
Securigera varia (L.) Lassen
Campanula rapunculoides L.
Nonea rossica Stev.
Trommsdorfia maculata (L.) Bernh.
Euphorbia subtilis Prokh.
Vicia cracca L.
Anemone sylvestris L.
Elytrigia intermedia (Host) Nevski
Phleum phleoides (L.) Karst.
Campanula rotundifolia L.
3
2
2
3
-
25
100
25
33
17
67
33
33
33
17
67
67
17
50
67
17
100
50
-
50
75
50
63
63
38
75
63
38
38
13
25
63
63
63
50
25
25
38
25
1
1
4
40
1
2
30
70
20
20
20
10
60
10
10
20
50
40
10
20
40
20
40
20
40
10
60
30
- 89 -
11
1
5
6
7
8
75
60
-
83
57
100
60
33
-
14
25
63
88
38
100
63
50
63
63
13
50
50
63
38
38
25
63
13
38
60
40
80
80
40
60
60
60
40
20
100
20
60
33
33
33
33
33
100
33
100
33
67
-
100
50
17
100
50
50
83
50
33
33
17
33
29
29
14
43
57
86
71
14
71
100
57
14
57
29
14
14
71
-
2
1
2
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Продолжение табл. 1
Синтаксоны
Вид
1
Viola hirta L.
Iris aphylla L.
Falcaria vulgaris Bernh.
Ranunculus polyanthemos L.
Echium vulgare L.
Viola rupestris F.W.Schmidt
Plantago media L.
Genista tinctoria L.
Taraxacum officinale Wigg.
Inula hirta L.
Potentilla argentea L.
Achillea nobilis L.
Echium maculatum L.
Veronica teucrium L.
Allium rotundum L.
Artemisia campestris L.
Plantago lanceolata L.
Betonica officinalis L.
Hypericum perforatum L.
Trinia multicaulis (Poir.) Schischk.
Pilosella vaillantii
(Tausch) Soják sensu Schljak.
Rumex thyrsiflorus Fingerh.
Festuca rubra L.
2
67
50
50
17
50
17
17
3
4
5
25
25
38
75
25
25
13
63
13
38
13
38
13
13
25
13
13
50
-
10
20
10
20
10
10
10
10
30
10
20
30
20
63
13
25
63
38
25
25
13
13
25
13
25
25
13
13
-
38
10
33
-
13
38
10
-
1
- 90 -
6
7
8
60
20
40
20
60
20
20
20
20
40
40
20
100
33
67
67
33
-
33
17
17
33
50
33
29
-
57
57
14
14
14
43
17
-
-
-
-
-
-
-
-
-
14
-
1
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Продолжение табл. 1
Вид
Orobanche alba Steph.
Scorzonera stricta Hornem.
Anthemis tinctoria L.
Pilosella officinarum F.Schultz et Sch.Bip.
Scorzonera glastifolia Willd.
Anthyllis vulneraria L.
Tragopogon dubius Scop.
Helictotrichon desertorum (Less.) Nevski
Rosa cf. gorinkensis Bess.
Rosa rubiginosa L.
Campanula bononiensis L.
Centaurea pseudophrygia C.A.Mey.
Astragalus cicer L.
Artemisia absinthium L.
Leontodon hispidus L.
Leucanthemum vulgare (L.) Lam.
Carex montana L.
Primula veris L.
Melilotus officinalis (L.) Pall.
Poa compressa L.
Agrostis tenuis Sibth.
Acinos arvensis (Lam.) Dandy
Pinus sylvestris L. (juv.)
Inula salicina L.
Синтаксоны
1
2
33
33
-
3
13
25
25
13
-
4
10
20
20
20
-
- 91 -
5
13
-
6
20
20
20
20
20
20
20
20
20
20
20
20
20
20
7
33
33
33
-
8
43
14
-
33
-
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Окончание табл. 1
Вид
Briza media L.
Pyrethrum corymbrosum (L.) Scop.
Chrysaspis aurea (Poll.) Greene
Cirsium setosum (Willd.) Bess.
Abietinella abietina (Hedw.) Fleisch.
Число описаний
Общее проективное покрытие, %
Синтаксоны
1
2
-
6
70–80
3
-
8
65–95
4
-
10
60–75
5
-
8
65–95
6
20
20
20
20
5
70–98
7
33
-
3
60–75
8
-
6
50–90
7
60–85
Число видов на 100 м²
40–49
(36)41–60
28–45
42–52
37–59
26–35
(26)30–45
37–51
Примечания. Синтаксоны: 1 – асс. Centaureo ruthenicae-Stipetum pennatae; 2–3 – асс. Carici humilis-Stipetum pennatae: 2 – var. typicum, 3 – var. Centaurea sumensis;
4 – асс. Gentiano cruciatae-Stipetum pennatae; 5–6 – асс. Echinopo ruthenicae-Stipetum pulcherrimae: 5 – var. typicum, 6 – var. Centaurea sumensis; 7 – асс. Astragalo
austriaci-Stipetum capillatae; 8 – асс. Echinopo ruthenicae-Salvietum verticillatae. Для видов приводятся: в левой части колонок – среднее проективное покрытие, в
правой – постоянство. Детерминантные группы видов выделены полужирной рамкой. Исключены из таблицы виды со встречаемостью не более 20% в каждом
из синтаксонов.
- 92 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Это Anemone sylvestris и Galium tinctorium [17], сходными
экологическими предпочтениями обладает и Polygonatum odoratum,
также константная в руссковасильково-перистоковыльной степи.
К детерминантным видам, наряду с уже упомянутыми Centaurea
ruthenica, Helianthemum nummularium, Polygonatum odoratum, Prunella
vulgaris и Sanguisorba officinalis, относится находящаяся в регионе на
северо-западной границе ареала [23] степная Campanula altaica. Кроме
того,
от
большинства
прочих
синтаксонов
ассоциацию
дифференцируют Galium tinctorium и тяготеющий в Центральной
России к щебнистым почвам [2] Galium octonarium.
Данные сообщества были описаны Е. А. Авериновой в составе
асс. Gypsophilo altissimae-Centauretum ruthenici Averinova, при этом блок
диагностических видов этой ассоциации почти полностью совпадает с
выделенной нами детерминантной группой асс. Centaureo ruthenicaeStipetum pennatae [18].
2. Ассоциация Carici humilis-Stipetum pennatae –
Низкоосоково-перистоковыльная (табл. 1, № 2–3)
Сообщества описаны на левом склоне долины р. Непрядвы
вблизи северной окраины д. Монастырщино, на правом склоне долины
р. Нижний Дубик и на правом склоне долины Непрядвы к северу от
места слияния Нижнего Дубика и Непрядвы. Они развиты
преимущественно в верхней и средней частях склонов южных (от югозападной до юго-юго-восточной) экспозиций либо, на правом берегу
Непрядвы – западной экспозиции. Несколько реже встречаются в
прибровочной части придолинных склонов.
Собственных детерминантных видов у ассоциации нет, от
прочих типов лугово-степных сообществ она дифференцируется
негативно. Экологическая и флористическая дифференциация внутри
ассоциации позволяет выделить в ее составе два варианта.
2.1. Var. typicum объединяет фитоценозы пологих и
слабопокатых (3–10°) склонов с почвой, содержащей незначительное
количество щебня.
В
сравнении
со
степями
предыдущей
ассоциации
рассматриваемые сообщества развиваются в условиях более
благоприятного увлажнения и минерального питания растений за счет
меньшей крутизны склонов и большего содержания мелкозема в почве.
Что сказывается на сомкнутости травостоя – его общее проективное
покрытие обычно 80–90 %. Основная масса травостоя достигает высоты
20–35 см, генеративные побеги ковыля – 70 см, а отдельных видов
разнотравья, например, Phlomoides tuberosa – 1 м.
Доминирует Stipa pennata, в большинстве сообществ участвует и
S. capillata, как правило, в небольшом обилии. Характерна
существенная фитоценотическая роль Carex humilis. По сравнению с
фитоценозами асс. Centaureo ruthenicae-Stipetum pennatae возрастают
- 93 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
разнообразие и проективное покрытие разнотравья. Наряду с Salvia
pratensis, Adonis vernalis, Amoria montana, Fragaria viridis,
субдоминантами
выступают
лугово-степные
и
луговые
ксеромезофильные Thalictrum minus, Galium verum, Filipendula vulgaris,
Agrimonia eupatoria, Phlomoides tuberosa. Малочисленны, но постоянны
в фитоценозах луговые мезо- и ксеромезофильные Achillea millefolium,
Ranunculus polyanthemos, Knautia arvensis, типична повышенная
встречаемость луговых мезофитов Hypericum perforatum, Pilosella
vaillantii, Campanula bononiensis.
Собственных детерминантных видов у этого варианта нет, его
дифференциация от второго варианта ассоциации негативна.
2.2. Var. Centaurea sumensis объединяет сообщества,
формирующиеся на склонах крутизной 7–20° с щебнистой почвой.
Нередко они занимают наиболее выпуклые участки в средней трети
склонов и окаймлены только что описанными фитоценозами.
Травостой относительно разрежен – его общее проективное
покрытие около 70 %. Вертикальная структура близка к таковой
«типичного» варианта.
В сообществах снижается фитоценотическая роль Stipa pennata,
иногда он выступает лишь субдоминантом, а доминирующее положение
занимает Carex humilis. Уменьшается обилие, а в некоторых случаях и
постоянство видов разнотравья (Galium verum, Thalictrum minus,
Phlomoides tuberosa, Achillea millefolium, Ranunculus polyanthemos,
Knautia arvensis и др.), характерных для рассмотренного выше варианта.
На первый план в фитоценозах выходят петро- и кальцефиты Centaurea
sumensis, Gypsophila altissima, а также Anthericum ramosum, в меньшей
степени Vincetoxicum hirundinaria. Эти виды, особенно василек и
венечник, наряду с ковылем и осокой, определяют облик сообществ. По
сравнению с «типичным» вариантом, несколько возрастает обилие
Adonis vernalis, Echinops ruthenicus и Festuca valesiaca, увеличивается
встречаемость Jurinea ledebourii и Stachys recta.
Детерминантными видами являются Centaurea sumensis,
Anthericum ramosum и Vincetoxicum hirundinaria, константные также в
сообществах асс. Centaureo ruthenicae-Stipetum pennatae.
Степи рассматриваемой ассоциации без разделения на
подчиненные синтаксоны были описаны Е. А. Авериновой в составе
субасс. typicum асс. Lino flavi-Stipetum capillatae Averinova,
охватывающей и некоторые другие степные сообщества исследуемого
региона, вошедшие в состав второй субассоциации [18].
Дифференциация субасс. typicum негативна, в то же время на нашем
материале не удалось выделить группу видов, близкую к
диагностической группе всей асс. Lino flavi-Stipetum capillatae
Averinova, включающей Echium russicum, Leucanthemum vulgare, Linum
flavum, Polygala sibirica, Stipa capillata, Echinops ruthenicus. В выборке
- 94 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
описаний, имеющихся у автора, эти виды распределены несколько
иначе.
3. Ассоциация Gentiano cruciatae-Stipetum pennatae –
Крестовидногоречавково-перистоковыльная (табл. 1, № 4)
Фитоценозы ассоциации описаны в 1.5 км к востоку от д.
Татинки на левом склоне долины и придолинном склоне р. Дон южной
и юго-западной экспозиции крутизной 1–10° и на правом западно-югозападном пологом (5°) склоне долины р. Средний Дубик.
Распространены преимущественно в верхней части склонов. Почва с
небольшой примесью известнякового щебня.
Общее проективное покрытие травостоя варьирует от 65 до 90%,
чаще – около 70%. Его основная масса достигает высоты 30–40 см,
генеративные побеги ковыля и некоторых видов разнотравья – 60–
70 см.
По флористическому составу в целом и по набору
господствующих видов сообщества близки к фитоценозам варианта
typicum асс. Carici humilis-Stipetum pennatae. Среди отличительных черт
– отсутствие Stipa capillata, заметное снижение фитоценотической роли
Carex humilis, а из разнотравья – Adonis vernalis и Thalictrum minus.
Постоянными, хотя и малообильными компонентами становятся
Gypsophila altissima, Centaurea scabiosa и Jurinea ledebourii. Типично
участие Gentiana cruciata, местами входящей в число субдоминантов.
Возрастает встречаемость некоторых луговых мезофильных видов –
Plantago media, Lotus corniculatus, Centaurea jacea. Часто развит
кустарниковый ярус из Chamaecytisus ruthenicus, (высота достигает 1 м,
а проективное покрытие – 10–30%), что свидетельствует о достаточно
длительном отсутствии сенокошения и интенсивного выпаса на этом
степном участке.
Детерминантами
ассоциации
являются
ксеромезои
мезофильные Gentiana cruciata, Centaurea jacea, Picris hieracioides,
Pilosella bauhini, Hypericum elegans, Solidago virgaurea и Silene
chlorantha, тяготеющие не столько к степям, сколько к сухим и отчасти
свежим лугам, опушкам, осветленным лесам [14; 23]. Высокое
постоянство этих растений может быть связано как с тем, что
сообщества контактируют с нагорной дубравой, так и с отсутствием
сенокошения и выпаса, что обычно обусловливает мезофитизацию
(олуговение) травостоя луговых степей [13].
Сообщества данного типа Е. А. Авериновой описаны в составе
двух субассоциаций асс. Gentiano cruciatae-Stipetum pennatae Averinova:
субасс. solidagetosum virgaurea и субасс. typicum [18]. Имеющегося у
автора материала недостаточно для выделения подчиненных
синтаксонов. В состав детерминантной группы описанной нами
ассоциации вошли виды, диагностические как для асс. Gentiano
cruciatae-Stipetum pennatae Averinova в целом (Gentiana cruciata), так и
- 95 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
для субасс. solidagetosum virgaurea (Solidago virgaurea, Centaurea jacea).
4.
Сообщество Скученноколокольчиково-перистоковыльное
(Stipa pennata, Campanula glomerata) (табл. 2, № 1)
Сейчас у автора имеется всего лишь 3 описания фитоценозов
этого типа, выполненные в непосредственной близости друг от друга.
При дальнейшем накоплении материала сообщества, вероятно, смогут
быть описаны в качестве ассоциации.
Отмечены на левом придолинном склоне р. Дон в 1 км к востоку
от д. Горки. Экспозиция склонов южная, уклон – 1–2°. Почва –
карбонатные черноземы с незначительной примесью известнякового
щебня.
Травостой очень густой – общее проективное покрытие 80–
100%, высота основной его массы – 50–60 см. Горизонтальная
структура травостоя неоднородна: наряду с участками с диффузным
распределением видов наблюдаются пятна обилия разнотравья,
главным образом лугового мезофита Campanula glomerata. Можно
предположить, что описываемые фитоценозы представляют собой одну
из поздних стадий восстановления залежи.
Помимо Stipa pennata и Campanula glomerata заметную
фитоценотическую роль играют Poa angustifolia, Agrimonia eupatoria,
Galium verum, Fragaria viridis и Thymus marschallianus. В отличие от
прочих типов лугово-степных сообществ региона, участие Carex humilis
нехарактерно. Обычны несвойственные подавляющему большинству
исследуемых фитоценозов Senecio jacobaea, Pilosella officinarum,
Potentilla argentea. Это, наряду с обилием Campanula glomerata, также,
видимо, свидетельствует о том, что сообщества восстанавливаются
после нарушения.
Скученноколокольчиково-перистоковыльная
степь
по
флористическому составу, в частности по присутствию Astragalus
austriacus, Stipa capillata, Campanula glomerata и некоторых других
видов, близка к описанной здесь же асс. Astragalo austriaci-Stipetum
capillatae (см. ниже), и, вероятно, связана с ней в сукцессионном ряду.
Помимо Sitpa pennata, доминантами степных сообществ,
встречающихся на исследуемой территории, выступают и другие виды
ковыля: ковыль красивейший (Stipa pulcherrima) и тырса (S. capillata).
Красивейшековыльные степи представлены 1 ассоциацией, в составе
которой выделены 2 варианта, тырсовые – 1 ассоциацией и 1
безранговым сообществом.
- 96 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Таблица 2
Скученноколокольчиково-перистоковыльное (Stipa pennata, Campanula glomerata)
и мордовниково-низкоосоково-тырсовое (Stipa capillata, Carex humilis, Echinops ruthenicus) сообщества
Сообщество
Экспозиция склона
Часть склона
Крутизна склона, град.
ОПП, %
Высота основной массы травостоя, см
Число видов
№ описания
авторский
табличный
Географические координаты:
широта (северная)
долгота (восточная)
Вид
Stipa pennata L.
Stipa capillata L.
Carex humilis Leyss.
Salvia pratensis L.
Galium verum L.
Agrimonia eupatoria L.
Medicago falcata L.
Amoria montana (L.) Sojak
Scabiosa ochroleuca L.
Filipendula vulgaris Moench
Fragaria viridis Duch.
Bromopsis inermis (Leyss.) Holub
Astragalus danicus Retz.
ю
в
2
98-100
60
42
77
4
1
ю
в
2
75-80
50
45
78
5
53°34´34,2´´
38°54´54,2´´
53°34´35,0´´
38°54´56,3´´
57
+
+
3
4
12
1
+
+
+
7
1
1
35
1
+
4
10
1
+
+
+
8
+
1
- 97 -
ю
в
2
90-95
25
49
79
6
ююз
с
7
95
30
25
33
1
53°34´35,0´´
53°35´42,6´´
38°54´52,4´´
38°32´18,4´´
Проективное покрытие, %
35
+
35
15
+
10
5
2
8
4
+
+
8
12
1
1
+
+
10
+
+
2
ююз
с
10
95
30
33
34
2
ю
в
3
95
25
40
35
3
53°35´40,3´´
38°32´21,5´´
53°35´35,0´´
38°32´32,4´´
10
25
15
4
12
+
+
+
4
2
3
+
15
30
15
1
4
+
3
+
7
+
+
+
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Продолжение табл. 2
Вид
Euphorbia virgata Waldst. et Kit.
Thalictrum minus L.
Echinops ruthenicus Bieb.
Potentilla heptaphylla L.
Poa angustifolia L.
Veronica austriaca L.
Galium boreale L.
Adonis vernalis L.
Festuca valesiaca Gaudin
Jurinea ledebourii Bunge
Thymus marschallianus Willd.
Vincetoxicum hirundinaria Medik.
Gentiana cruciata L.
Pilosella bauhini (Bess.) Arv.-Touv.
Picris hieracioides L.
Hypericum elegans Steph. ex Willd.
Carlina biebersteinii Bernh. ex Hornem.
Linum flavum L.
Malus sp. (juv.)
Astragalus austriacus Jacq.
Campanula glomerata L.
Senecio jacobaea L.
Centaurea scabiosa L.
Knautia arvensis (L.) Coult.
Scorzonera purpurea L.
Eremogone micradenia (P.Smirn.) Ikonn.
1
+
+
+
+
7
+
+
+
+
+
+
3
+
5
+
+
1
+
+
+
+
5
3
12
+
+
+
2
+
2
17
+
+
+
+
17
+
3
+
+
+
+
+
1
+
+
+
+
+
+
+
+
+
+
2
+
+
+
+
+
+
15
1
+
+
+
+
10
+
2
+
+
- 98 -
+
+
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Продолжение табл. 2
Вид
Campanula sibirica L.
Convolvulus arvensis L.
Artemisia marschalliana Spreng.
Onobrychis arenaria (Kit.) DC.
Cichorium intybus L.
Eryngium planum L.
Chamaecytisus ruthenicus
(Fisch. ex Woloszcz.) Klaskova
Koeleria cristata (L.) Pers.
Achillea millefolium L.
Veronica spicata L.
Pimpinella saxifraga L.
Seseli annuum L.
Allium flavescens Bess.
Phlomoides tuberosa (L.) Moench
Allium oleraceum L.
Lotus corniculatus L.
Asperula cynanchica L.
Verbascum lychnitis L.
Campanula rapunculoides L.
Nonea rossica Stev.
Vicia cracca L.
Anemone sylvestris L.
Campanula rotundifolia L.
Viola hirta L.
+
+
+
+
1
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
2
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
- 99 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Окончание табл. 2
Вид
Ranunculus polyanthemos L.
Viola rupestris F.W.Schmidt
Plantago media L.
Genista tinctoria L.
Taraxacum officinale Wigg.
Potentilla argentea L.
Veronica teucrium L.
Allium rotundum L.
Plantago lanceolata L.
Hypericum perforatum L.
Trinia multicaulis (Poir.) Schischk.
Orobanche alba Steph.
Scorzonera stricta Hornem.
Anthemis tinctoria L.
Pilosella officinarum F.Schultz et Sch.Bip.
Linaria vulgaris Mill.
Centaurea pseudomaculosa Dobrocz.
Carduus acanthoides L.
Cirsium polonicum (Petrak.) Iljin
Tanacetum vulgare L.
Melilotus officinalis (L.) Pall.
Poa compressa L.
Pastinaca sativa L.
Inula britannica L.
+
1
+
2
+
+
+
7
+
+
+
+
+
1
+
+
+
+
+
+
+
+
+
+
3
+
+
+
+
+
+
+
+
+
+
+
+
Примечание. Сообщества: 1 – скученноколокольчиково-перистоковыльное (Stipa pennata, Campanula glomerata); 2 – мордовниково-низкоосоково-тырсовое
(Stipa capillata, Carex humilis, Echinops ruthenicus).
- 100 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
5. Ассоциация Echinopo ruthenicae-Stipetum pulcherrimae –
Мордовниково-красивейшековыльная (табл. 1, № 5–6).
Сообщества ассоциации распространены на правом склоне
долины (преимущественно в верхней и средней частях склона, реже
спускаются почти до подножья) и придолинном склоне р. Средний
Дубик юго-западной экспозиции. Крутизна склонов – от 2 до 25°. Почва
– эродированные черноземы, иногда с существенной примесью
известнякового щебня.
Детерминантами ассоциации являются ее доминант Stipa
pulcherrima и Carlina biebersteinii. Учитывая экологическую и
флористическую дифференциацию внутри синтаксона, сходную с той,
что наблюдается внутри асс. Carici humilis-Stipetum pennatae, в его
составе можно выделить 2 варианта.
5.1. Var. typicym объединяет фитоценозы склонов крутизной не
более 10–12° с почвой, содержащей незначительное количество щебня.
Сообщества выделяются очень густым и относительно
высокорослым травостоем – общее проективное покрытие 95–100 %,
высота его основной массы – около 40 см, а генеративные побеги
ковыля и Echinops ruthenicus достигают 80–100 см.
Облик сообществ определяют Stipa pulcherrima и Echinops ruthenicus.
Постоянен, но, как правило, малообилен Stipa pennata, реже встречается
и Stipa capillata. Участие Festuca valesiaca в фитоценозах как этого, так
и следующего варианта ассоциации нетипично, что отличает ее от
прочих описываемых типов степных сообществ. Фитоценотическая
роль Carex humilis невелика. Помимо мордовника, из разнотравья
обильны Galium verum, Salvia pratensis, Agrimonia eupatoria, Filipendula
vulgaris и Galium boreale. В состав сообществ часто входит
Chamaecytisus ruthenicus, однако выраженного кустарникового яруса не
формируется.
Характерна повышенная встречаемость некоторых луговых и
опушечных ксеромезо- и мезофитов (Lotus corniculatus, Veronica
teucrium, Betonica officinalis, Campanula rotundifolia), что сближает
синтаксон с асс. Gentiano cruciatae-Stipetum pennatae (см. табл. 1). Их
близость подчеркивает и присутствие в «типичном» варианте
мордовниково-красивейшековыльной степи (хотя и с заметно
сниженным постоянством) видов, детерминантных для асс. Gentiano
cruciatae-Stipetum pennatae, например Gentiana cruciata, Picris
hieracioides, Solidago virgaurea, Pilosella bauhini. Фитоценозы обоих
синтаксонов развиваются в контакте с нагорными дубравами и, видимо,
в сходных экологических условиях, главным образом, это касается
степени увлажнения.
5.2. Var. Centaurea sumensis объединяет сообщества,
формирующиеся на склонах крутизной 10–25° с щебнистой почвой.
- 101 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Травостой относительно разреженный (общее проективное
покрытие 60–75 %) и менее высокорослый.
Господствующее положение Stipa pulcherrima и Echinops
ruthenicus сохраняется, наряду с этим существенно увеличивается роль
Carex humilis и падает – разнотравья, характерного для «типичного»
варианта. Субдоминантом становится тяготеющий к щебнистым почвам
Centaurea sumensis. Возрастает участие Anthericum ramosum, Adonis
vernalis, Stachys recta.
Детерминантные виды – Centaurea sumensis, Anthericum ramosum
и Vincetoxicum hirundinaria, константные также в сообществах
асс. Centaureo ruthenicae-Stipetum pennatae и var. Centaurea sumensis асс.
Carici humilis-Stipetum pennatae.
Степи рассматриваемой ассоциации без разделения на
подчиненные синтаксоны были описаны Е. А. Авериновой в составе
субасс. stipetosum pulcherrimae асс. Gentiano cruciatae-Stipetum pennatae
Averinova [18]. В диагностическую группу субасс. stipetosum
pulcherrimae вошли Stipa pulcherrimae, Carlina biebersteinii, а также
Veronica teucrium, Phleum pratense и Echinops ruthenicus. Phleum
pratense, возможно, при описании сообществ автором был пропущен, в
то время как Veronica teucrium и Echinops ruthenicus в имеющейся
выборке описаний распределены иначе, в том числе и в связи с тем, что
автором посещены степные участки, которые не были обследованы Е.
А. Авериновой.
6. Ассоциация Astragalo austriaci-Stipetum capillatae –
Австрийскоастраголово-тырсовая (табл. 1, № 7)
Сообщества описаны в 1 км к востоку от д. Горки, где они
распространены в верхней половине левого склона (крутизной 10°)
долины р. Дон и на придолинном склоне (1–2°). Экспозиция южная.
Почва различается по гранулометрическому составу: на склоне долины
примесь известнякового щебня существенна, на придолинном склоне –
незначительна.
Фитоценозы, формирующиеся на придолинном склоне,
отличаются довольно густым и высоким травостоем (общее
проективное покрытие 85–90 %, высота основной массы травостоя
около 40 см). На более крутом и щебнистом склоне долины общее
проективное покрытие и высота растений заметно снижаются (50–60 %
и 15–20 см, соответственно). Судя по несколько неоднородной
горизонтальной структуре (встречаются отдельные пятна обилия
разнотравья и Poa angustifolia), сообщества на придолинном склоне
представляют собой позднюю стадию восстановления залежи, вероятно,
выпасаемой в прошлом, о чем говорит господство тырсы,
доминирование которой чаще всего связано с довольно сильным
пастбищным использованием степей [13].
На пологом придолинном склоне доминирующее положение
- 102 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Stipa capillata выражено наиболее ярко. Ковылю в небольшом обилии
сопутствуют Galium verum, Fragaria viridis, Amoria montana, Salvia
pratensis, Agrimonia eupatoria, Campanula sibirica. Характерно заметное
участие Poa angustifolia, что, наряду с относительно малой ролью
разнотравья, отличает описываемые фитоценозы от большинства
прочих исследуемых типов степных сообществ. Еще одним отличием
служит отсутствие обычных в луговых степях региона Jurinea
ledebourii, Scorzonera purpurea, Adonis vernalis, Stachys recta, Centaurea
scabiosa, что, по-видимому, также подтверждает то, что сообщества в
прошлом были нарушены. Carex humilis и Festuca valesiaca постоянны,
но проективное покрытие их невелико.
В сообществах, занимающих склон долины, фитоценотическая
роль Stipa capillata и большинства видов разнотравья снижается, а Carex
humilis и Festuca valesiaca – резко возрастает. Увеличивается обилие
Allium podolicum, создающего во время цветения розовато-белый аспект.
Как видно из описания, фитоценозы, формирующиеся на
придолинном склоне и склоне долины, различаются как по
экологической приуроченности, так и по соотношению доминирующих
видов. В то же время достоверных флористических отличий между
ними установить не удалось. Вероятно, при накоплении
геоботанического материала станет возможным выделение в составе
рассматриваемой ассоциации подчиненных синтаксонов.
К детерминантным видам относятся степные Astragalus
austriacus и Allium podolicum, находящиеся в Тульской области на
северной границе ареала [23]. В состав группы вошли также луговые
ксеромезо- и мезофиты Campanula glomerata, Trifolium pratense, Senecio
jacobaea, присутствие которых в сообществах, вероятно, связано с тем,
что последние в прошлом были нарушены.
7. Сообщество Мордовниково-низкоосоково-тырсовое
(Stipa capillata, Carex humilis, Echinops ruthenicus) (табл. 2, № 2)
Отмечено на правом склоне долины р. Средний Дубик южной и
юго-юго-западной экспозиции, крутизной 3–12°. Характеризуется
густым травостоем (общее проективное покрытие 95%), в составе
которого, помимо упомянутых видов, обильны Salvia pratensis,
Agrimonia eupatoria, Filipendua vulgaris, Galium verum. В контакте с
мордовниково-низкоосоково-тырсовой степью развиты разнотравнонизкоосоковые (Carex humilis, Echinops ruthenicus, Salvia pratensis,
Agrimonia eupatoria) и разнотравные (Echinops ruthenicus, Salvia
pratensis, Agrimonia eupatoria) фитоценозы, приуроченные к крутым и
покатым (10–35°) щебнистым участкам склона, в прошлом, видимо,
нарушенным добычей камня. Здесь же по пологим мелкоземистым
участкам встречаются степи асс. Gentiano cruciatae-Stipetum pennatae.
Возможно, все упомянутые типы сообществ связаны в сукцессионном
ряду, и представляют собой стадии одной серии.
- 103 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Наряду с ковыльными степями в регионе встречаются и
разнотравные степи, в которых степные злаки – ковыли и типчак, хотя и
являются постоянными компонентами, занимают подчиненное
положение. Выделена 1 ассоциация разнотравных степей, отнести
которую к какой-либо конкретной формации степного типа
растительности пока сложно, поскольку для этого необходимы
исследования, охватывающие более обширную территорию.
8. Ассоциация Echinopo ruthenicae-Salvietum verticillatae –
Мордовниково-шалфейная (табл. 1, № 8)
Фитоценозы ассоциации распространены на левом склоне
долины р. Рыхотки, преимущественно в верхней его половине.
Крутизна склона колеблется от 3 до 12°, экспозиция южная. Почва
представлена черноземами с примесью известнякового щебня, которая
может быть как обильной, так и незначительной.
Общее проективное покрытие, как правило, 60–70 %, на пологих
(3–5°) участках с почвой, практически не содержащей щебень, оно
увеличивается до 80–85 %. Высота основной массы травостоя – 25–40
см, генеративные побеги ковыля достигают 70–80 см, а некоторых
видов разнотравья (Echinops ruthenicus) – 1 м.
Сообщества полидоминантны. Основу травостоя составляют
мезоксеро- и ксеромезофильные Salvia verticillata, Linum flavum, изредка
Astragalus onobrychis, что служит отличительной чертой фитоценозов, а
также обычные Echinops ruthenicus, Agrimonia eupatoria, Amoria
montana, Filipendula vulgaris, Carex humilis. Заметное участие
принимают Adonis vernalis и Stachys recta. Постоянен Stipa capillata.
Stipa pennata встречается несколько реже, однако на пологих участках с
почвой без примеси щебня он входит в число доминантов. В таких
разнотравно-ковыльных фитоценозах резко возрастает обилие
Thalictrum minus. На сильнощебнистых участках одним из доминантов
становится Anthericum ramosum, а в составе сообществ появляются
петро- и кальцефиты Gypsophila altissima и Centaurea sumensis. Как
видно, внутри ассоциации наблюдается экологическая дифференциация,
но недостаток материала не позволяет выделить подчиненные
синтаксоны.
Детерминантными для ассоциации являются лесостепные виды,
находящиеся в Тульской области на северной границе ареала [23]:
Salvia verticillata, Linum flavum, Astragalus onobrychis, Scorzonera taurica,
Polygala sibirica. В состав группы вошли также Pedicularis kaufmannii и
Malus sp. (juv.). Присутствие последнего вида в сообществах, вероятнее
всего связано с тем, что они соседствуют с нагорной дубравой в составе
которой обычны яблони. Кроме того, характерно высокое постоянство
Galium tinctorium и Galium octonarium, константных также для асс.
Centaureo ruthenicae-Stipetum pennatae.
Степи рассматриваемой ассоциации были описаны Е. А.
- 104 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Авериновой в составе субасс. astragaletosum onobrychis асс. Lino flaviStipetum capillatae Averinova [18]. Блок диагностических видов этой
субассоциации
отчасти
совпадает
с
выделенной
автором
детерминантной группой асс. Echinopo ruthenicae-Salvietum verticillatae.
В то же время в его состав вошли виды (Allium flavescens, Hypericum
elegans, Iris aphylla, Astragalus austriacus, Lithospermum officinale L.),
которые в нашей выборке описаний распределены иначе.
Заключение. Таким образом, в исследуемом регионе
распространены перистоковыльные, красивейшековыльные, тырсовые и
разнотравные степи, представленные 6 ассоциациями (две из них с
двумя
вариантами)
и
двумя
безранговыми
сообществами.
Перистоковыльные
степи
отличаются
максимальным
синтаксономическим
разнообразием
и
наиболее
широким
распространением, что соответствует положению территории в
лесостепной зоне [13].
При сравнении результатов классификаций с помощью
доминантно-детерминантного метода и метода Й. Браун-Бланке видно,
что типы сообществ (рангом не выше ассоциации), выделенные тем и
другим способом, во многом совпадают. При этом ассоциации
доминантно-детерминантной
классификации,
как
правило,
соответствуют субассоциациям, выделенным методом Й. Браун-Бланке.
В то же время детерминантные и диагностические группы видов могут
в большей или меньшей степени различаться, что, вероятно, в первую
очередь связано с различиями между выборками описаний, имеющихся
у разных исследователей, и, возможно, с флуктуационной
изменчивостью видового состава сообществ.
Работа выполнена при поддержке Государственного военноисторического и природного музея-заповедника «Куликово поле». Автор
благодарен О. В. Буровой (музей-заповедник «Куликово поле») и Е. М. Волковой
(ТГПУ им. Л. Н. Толстого) за помощь при проведении полевых исследований,
И. О. Бузуновой, А. А. Коробкову, А. К. Сытину, Н. Н. Цвелеву, (БИН РАН) и А.
П. Серегину (МГУ им. М. В. Ломоносова) за определение гербарных
материалов.
Список литературы
1. Аверинова Е.А. Кальцефитные степные сообщества бассейна реки
Сейм (в пределах Курской области) // Растительность России. 2005.
№ 7. С. 39–49.
2. Агафонов В.А. Степные, кальцефильные, псаммофильные и
галофильные
эколого-флористические
комплексы
бассейна
Среднего Дона: их происхождение и охрана. Воронеж: Изд-во
Воронеж. гос. ун-та, 2006. 250 с.
- 105 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
3. Агроклиматический справочник по Тульской области. Л.,
Гидрометеоиздат, 1958. 128 с.
4. Василевич В.И. Доминантно-флористический подход к выделению
растительных ассоциаций // Ботан. журн. 1995. Т. 80, № 6. С. 28–39.
5. Виноградов Н.П., Голицын С.В. «Сниженные альпы» и тимьянники
Среднерусской возвышенности // Ботан. журн. 1954. Т. 39, № 3.
С. 423–430.
6. Виноградов Н.П., Голицын С.В., Денисова Л.В. Ботанические
памятники природы Центрально-Черноземных областей // Охрана
природы и заповедное дело в СССР. 1960. Бюл. № 5. С. 3–37.
7. Данилов В.И. Кизильник алаунский (Cotoneaster alaunicus Goltis.) на
северо-востоке Среднерусской возвышенности и вопросы его
охраны // Вопр. охраны редких видов растений и фитоценозов: сб.
науч. тр. М., 1987. С. 111–117.
8. Данилов В.И. Редкие степные фитоценозы в верховьях Окского и
Донского бассейнов (Тульская область) // Вопр. охраны и рац.
использ. растит. мира. М., 1988. С. 35–45.
9. Зверев
А.А.
Программно-информационное
обеспечение
исследований растительного покрова: автореф. дис. … канд. биол.
наук. Томск, 2007. 24 с.
10. Исаченко
Т.И.,
Лавренко
Е.М.
Ботанико-географическое
районирование // Растительность европейской части СССР. Л.:
Наука, 1980. С. 10–20.
11. Коротченко I.A., Дiдух Я.П. Степова рослиннiсть пiвденноi частини
лiвобережного лiсостепу Украiни. II. Класс Festuco-Brometea // Укр.
фiтоцен. сб. Сер. А. 1997. № 1 (6). С. 20–42.
12. Курнаев С.Ф. Куликово поле в прошлом и настоящем // Живая
природа. 1980. № 9. С. 4–13.
13. Лавренко Е.М. Степи // Растительность европейской части СССР. Л.:
Наука, 1980. С. 203–272.
14. Маевский П.Ф. Флора средней полосы европейской части России. –
М.: Т-во научных изданий КМК, 2006. 600 с.
15. Миркин Б.М. Критерии доминантов и детерминантов при
классификации фитоценозов // Ботан. журн. 1968. Т. 53, № 6. С. 767–
776.
16. Нижников В.С. Amygdalus nana L. (Rosaceae) в Тульской области //
Ботан. журн. 1979. Т. 64, № 3. С. 446–448.
17. Носова Л.М. Флоро-географический анализ северной степи
европейской части СССР. М.: Наука, 1973. 187 с.
18. Отчет «Степная растительность Куликова поля» / автор
Аверинова Е.А. № 276. – Государственный военно-исторический и
природный музей-заповедник «Куликово поле», 2009. 27 с.
19. Полуянов А.В. Петрофитные ковыльные и тимьянниковые степи
юго-востока Курской области (в пределах бассейна р. Оскол) //
- 106 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Растительность России. 2009. № 14. С. 49–62.
20. Раменский Л.Г., Цаценкин И.А., Чижиков О.Н., Антипин Н.А.
Экологическая оценка кормовых угодий по растительному покрову.
М.: Сельхозгиз, 1956. 472 с.
21. Ромащенко К.Ю., Дiдух Я.П., Соломаха В.А. Синтаксономiя класу
Helianthemo-Thymetea cl. nov. рослинностi крейдяних вiдслонень
пiвденно-схiдноi Украiни // Укр. фiтоцен. зб. Сер. А. 1996. № 1. С.
49–62.
22. Федотов В.И., Васильев В.М. Земля Тульская. Тула: Приок. кн. издво, 1979. 222 с.
23. Шереметьева И.С., Хорун Л.В., Щербаков А.В. Конспект флоры
сосудистых растений Тульской области. Тула: Гриф и Кº, 2008.
276 с.
MEADOW STEPPES OF THE SOUTH-EASTERN PART
OF TULA REGION
E.O. Golovina
Komarov Botanical Institute RAS
Following the dominant-floristic approach to vegetation 6 associations (2 of
them with 2 variants) and 2 communities of meadow steppes are distinguished
in the south-eastern part of Tula region. The Stipa pennata steppe is the most
widely spread and syntaxonomic diverse type. The Stipa pulcherrima, the
Stipa capillata and the herbous steppes are more rare ones, that are
represented by 1–2 syntaxa.
Keywords: meadow steppes, classification of vegetation, Tula region.
Об авторах:
ГОЛОВИНА Екатерина Олеговна–кандидат биологических наук,
научный сотрудник лаборатории географии и картографии
растительности, УРАН Ботанический институт им. В.Л. Комарова РАН,
197376, Санкт-Петербург, ул. проф. Попова, 2, e-mail: capitata@
yandex.ru
- 107 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20. С. 108-113.
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
УДК 581.524.2+582.736
ПРОГНОЗ ДИНАМИКИ РАСШИРЕНИЯ
ВТОРИЧНОГО АРЕАЛА LUPINUS POLYPHYLLUS
В СРЕДНЕЙ РОССИИ
Е.В. Ткачева
Библиотека по естественным наукам РАН
Исследована успешность проникновения Lupinus polyphyllus Lindl. в
лесные сообщества. Не выявлено различия по плотности популяций,
произрастающих в затененных и в освещенных местообитаниях.
Высказано предположение, что при инвазии вида в естественные ценозы
фактор освещенности нельзя считать лимитирующим.
Ключевые слова: биологические инвазии, Lupinus polyphyllus, вторичный
ареал, освещенность.
Введение. Распространение чужеродных видов становится в
Европе серьезной угрозой биоразнообразия [1]. Источниками широкого
распространения фитоинвазий являются как случайно занесенные виды,
так и виды-«беглецы» из культуры. В качестве одной из причин инвазий
чужеродных видов растений можно отметить развитие торговых связей
между разными странами в ХХ в., что благоприятно сказалось на
быстром переселении растений с одних континентов на другие, и
сельскохозяйственная деятельность [2; 3]. Культурные растения в своих
вторичных ареалах преднамеренно или же случайно распространяются
все шире. Это в полной мере относится и к некоторым представителям
семейства Fabaceae.
Центральное место среди отечественных сводок, посвященных
проблемам биологических инвазий растений, занимает «Чёрная книга
флоры Средней России» [2]. Наиболее агрессивным инвазионным
видом семейства Fabaceae, включенным в Черную книгу России, стал
Lupinus polyphyllus Lindl. Это травянистый двулетник или
короткоживущий многолетник высотой 0,8–1,5 м. Цветки (до 80 шт.)
синих оттенков, реже розовые или белые, собраны в терминальное
прямостоячее соцветие.
L. polyphyllus является «беглецом» из культуры. Он получил
широкое распространение в Средней России, расселился в странах
Европы. В некоторых районах L. polyphyllus практически полностью
вытесняет аборигенные виды растений и формирует крупные
одновидовые сообщества [3].
Естественный ареал L. polyphyllus находится на западе Северной
Америки – Канада (Британская Колумбия) и США (штат Аляска, запад
штатов Орегон и Вашингтон, северная часть Калифорнии). Вид
- 108 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
встречается по берегам рек, на лугах и обочинах и других нарушенных
местообитаниях [6].
L. polyphyllus отмечен в большинстве регионов Средней России.
В целом, уровень его инвазивности изменяется с севера на юг от
агриофита до эпекофита. Очевидно, что выводы по уровню
инвазивности вида в конкретном регионе являются усреднением
наблюдений по разным ландшафтам, а зачастую и природным зонам.
Цель работы – рассмотрение способности L. polyphyllus
проникать из открытых местообитаний в лесные сообщества.
Материал и методика. Материалом для исследования
послужили данные по трём популяциям L. polyphyllus на территории
Смоленской обл., для которых известен период дичания.
Популяция 1. Инвазионная популяция. Расположена в
Хиславичском р-не Смоленской обл. в 4 км на юго-восточнее пгт.
Хиславичи под пологом смешанного (елово-лиственного) леса,
проникая вглубь леса на расстояние около 300 м. Точную площадь
территории, которую занимает популяция, определить сложно, т. к. L.
polyphyllus распространен диффузно и не образует сплошных зарослей.
Популяция 2. Одичавшая популяция. Находится в Сафоновском
р-не Смоленской обл. в 15 км от г. Сафоново на заброшенном с/х поле.
Площадь 1000×500 м.
Популяция 3. Одичавшая популяция. Расположена в
Хиславичском р-не Смоленской обл. в 12 км от пгт. Хиславичи вдоль
кромки поля, в настоящее время засеянного зерновыми культурами.
Площадь 300×100 м.
Продолжительность существования всех изученных популяций
L. polyphyllus около 40 лет. В каждой популяции было заложено по 25–
30 экспериментальных площадок размером 1×1 м, на которых
подсчитывали число генеративных побегов и измеряли интенсивность
освещенности с помощью люксметра «ТКА-ЛЮКС» производства НТП
«ТКА». Измерение интенсивности освещенности проводили в одно и то
же время между 12–14 часами дня, в ясную безоблачную погоду.
Средние величины приведены с указанием ошибки средней. Для
наблюдений по градиенту «поле–лес» рассчитан коэффициент
корреляции Спирмена и оценена его достоверность. Это послужило
критерием для оценки влияния затенения под пологом леса на
плотность произрастания L. polyphyllus. Анализ осуществлен в
программе PAST 2.10 [5].
Результаты
и
обсуждение.
Анализ
освещённости
местообитаний и показателей плотности размещения особей L.
polyphyllus не позволил обнаружить достоверных корреляций во всех
изученных местонахождениях. Если освещённость в двух типах
местообитаний (затененные и освещенные) имеет разрывы в
распределении значений, то показатели плотности популяций
- 109 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
распределены равномерно (рис. 1, 2). Результаты такого распределения
величин продемонстрированы на диаграммах рассеяния двумерных
данных «освещённость–плотность популяции» (рис. 3–5).
Р и с . 1 . Интенсивность светового потока для затененных («лес»)
и освещенных («поле») местообитаний
Р и с . 2 . Плотность популяций
в затененных («лес») и освещенных («поле») местообитаниях
- 110 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Число генеративных побегов на кв.м
45
40
35
30
25
20
15
10
5
0
0
16
32
48
64
Освещенность, клк
80
96
112
Р и с . 3 . Диаграмма рассеяния двухмерных данных
(плотность популяции–интенсивность освещения) для популяции 1:
□ число эксперментальных площадок в затенённых («лес») местообитаниях;
+ число эксперментальных площадок в освещённых («поле») местообитаниях;
эллипсы на диаграмме соответствуют 95% доверительным интервалам.
Число генеративных побегов на кв.м
72
64
56
48
40
32
24
16
8
0
0
16
32
48
64
80
Освещенность, клк
96
112
128
144
Р и с . 4 . Диаграмма рассеяния двухмерных данных
(плотность популяции–интенсивность освещения) для популяции 2.:
условные обозначения такие же, как на рис. 3
- 111 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Число генеративных побегов на кв.м
36
32
28
24
20
16
12
8
4
0
0
16
32
48
64
80
Освещенность, клк
96
112
128
144
Р и с . 5 . Диаграмма рассеяния двухмерных данных
(плотность популяции–интенсивность освещения) для популяции 3:
условные обозначения такие же, как на рис. 3.
Плотность второй популяции на затененных участках оказалась
даже выше, чем в открытых местообитаниях
В «Чёрной книге флоры Средней России» указан как
потенциально опасный ещё один травянистый многолетник из
семейства Fabaceae – Galega orientalis Lam. В отношении этого вида
нами было проведено аналогичное исследование [5], которое показало
снижение плотности популяций G. orientalis по градиенту «поле–лес».
Характер произрастания L. polyphyllus несколько иной:
плотность его популяций не зависит от степени освещенности
местообитания. Это обеспечивает способность L. polyphyllus осваивать
сомкнутые растительные сообщества и произрастать под пологом крон.
Заключение. Таким образом, не обнаружено статистически
значимых различий по плотности популяций L. polyphyllus под пологом
леса и в открытых местообитаниях. Этот вид способен внедряться в
биотопы с разным уровнем освещенности.
Список литературы
1. Биологические инвазии в водных и наземных экосистемах. М.; СПб:
КМК, 2004. 436 с.
2. Виноградова Ю.К., Майоров С.Р., Хорун Л.В. Черная книга флоры
Средней России. М.: ГЕОС, 2010. 512 с.
3. Ткачева Е.В. Внимание: Люпин. М.: ГЕОС, 2010. 12с.
4. Ткачева Е.В. Перспектива расширения вторичного ареала Galega
- 112 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
orientalis Lam. (козлятника восточного) в Средней России // Изв.
ПГПУ им. В.Г. Белинского. 2011 (в печати).
5. Hammer O., Harper D.A.T., Ryan P.D. PAST: Paleontological statistics
software package for education and data analysis // Palaeontologia
Electronica. 2001. Vol. 4, № 1. P. 1–9.
6. Scoggan H.J. The flora of Canada. 3. Dicotyledonae (Saussuraceae to
Violaceae). National Muséum of Natural Sciences, Publications in
Botany 7-3. 1978. 1115 p.
FORECASTING ON THE EXPANSION
OF LUPINUS POLYPHYLLUS IN ITS SECONDARY
DISTRIBUTION RANGE IN THE MIDDLE RUSSIA
E.V. Tkacheva
Library for Natural Sciences RAS
Lupinus polyphyllus invasion’s success under wood curtains was investigated.
There is not revealed distinctions on plant number between populations
growing in shaded and in shined habitats. It is assumed that light influence
isn't the limiting factor during invasive process.
Keywords: biological invasions, Lupinus polyphyllus, secondary distribution
range, illumination.
Об авторах:
ТКАЧЕВА Екатерина Васильевна–главный библиотекарь отдела,
УРАН Библиотека по естественным наукам РАН, отдел в УРАН
Главный ботанический сад РАН, 119991, Москва, ул. Знаменка, 11/11,
e-mail: katyusha_2009@mail.ru
- 113 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20. С. 114-128.
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
УДК 581.9 (234.81)
О БОТАНИКО-ГЕОГРАФИЧЕСКОЙ СПЕЦИФИКЕ
ФЛОРЫ ВАЛДАЙСКОЙ ВОЗВЫШЕННОСТИ
С.М. Дементьева, А.А. Нотов, Л.В. Зуева, С.А. Иванова
Тверской государственный университет
Дана ботанико-географическая характеристика флоры Валдайской
возвышенности. Выявлены специфические особенности флоры. На
территории Валдайской провинции зарегистрировано 886 видов и 145
микровидов сосудистых растений. Показатели видового богатства и
таксономического разнообразия для флоры юга Валдайской
возвышенности больше, чем аналогичные характеристики флоры
северной части Валдайской провинции. Обсуждается проблема
флористического районирования территории на основе системы физикогеографических единиц. Флоры физико-географических районов
Валдайской возвышенности характеризуются относительно высоким
сходством видового состава. Корреляционные связи между флорами
северо-восточных районов южной части сильнее, чем связи в группе
юго-западных районов, что обусловлено значительным своеобразием
флоры Верхнемстинского района. Целесообразна группировка югозападных и северо-восточных районов в более крупные хорионы, в
пределах которых следует выделять единицы более низкого ранга.
Ключевые слова: Валдайская возвышенность, флора, сосудистые
растения, флористическое районирование, физико-географические
районы, сравнительный анализ флор.
Введение. Анализ флоры целостных с физико- и ботаникогеографической точек зрения территорий имеет особое значение для
выяснения закономерностей флорогенеза. К таким территориям можно
отнести Валдайскую возвышенность, расположенную на границе
северо-запада и центра Русской равнины в краевой зоне Валдайского
оледенения [38; 39]. Валдайская возвышенность является частью
Валдайской провинции. Эта провинция включает также Тихвинскую и
Вепсовскую возвышенности [10; 39]. На территории Валдайской
возвышенности расположен Балтийско-Каспийский водораздел,
являющийся наиболее важным гидроузлом Европейской России. По
территории
возвышенности
проходят
границы
ботаникогеографических подзон [11; 38]. Растительный покров Валдайской
провинции сохранился лучше, чем на смежных территориях СевероЗападной и Средней России. Все это позволяет рассматривать
Валдайскую возвышенность в качестве удобной модельной территории
для флористического анализа. Ее значительная мозаичность в
геоморфологическом
отношении
обусловила
формирование
оригинальной флоры [3–5; 16; 28]. С флористической точки зрения
- 114 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
территория изучена неравномерно. Исследования в северной части
начаты еще в XIX в. [5]. Публикация Х.Я. Гоби была первой обзорной
работой, посвященной флоре Валдайской возвышенности, в которой
были затронуты важные ботанико-географические проблемы. Позднее
были обобщены материалы об особенностях распространения
представителей разных флористических элементов, выяснены основные
этапы флорогенеза, предложены подходы к ботанико-географическому
районированию Северо-Западной России [17; 28; 22–28; 41].
Дальнейшие флористические исследования проводились в основном на
территории Новгородской и Псковской областей [16; 42 и др.].
Опубликованы обзорные работы по флоре Северо-Западной России и
дополнительные материалы по флористическому районированию ее
территории [3; 4; 36; 37; 40].
Сбор данных о флоре южных районов возвышенности начат в
70-е гг. XX в. [1; 2; 12–14; 18; 28; 29 и др.]. Информация об этой части
возвышенности имеет особое значение для понимания основных этапов
генезиса флоры. Актуален специальный анализ флоры южной части и
Валдайской возвышенности в целом. Цель нашей работы – выявление
ботанико-географической
специфики
флоры
Валдайской
возвышенности.
Природные условия. Валдайская возвышенность является
фрагментом Валдайской физико-географической провинции, которая
занимает часть древней Восточноевропейской платформы [6–9].
Значительные размеры территории, расчлененность ее на три
фрагмента, соответствующих Валдайской, Тихвинской и Вепсовской
возвышенностям,
формирующим
Валдайско-Онежскую
гряду,
обусловили не только разнообразие природных комплексов, но и
неоднородность во флористическом отношении. Южную часть гряды
занимает Валдайская возвышенность. Это приподнятая территория с
холмистым рельефом. От смежных провинций Валдайская отличается
степенью континентальности климата, геоморфологическим строением
и структурой растительного покрова. Специфика Валдайской
возвышенности проявляется в наличии на ее территории сложных
озерных комплексов, участков с крупнохолмистым рельефом, густой
сети глубоких оврагов, речных долин Западной Двины, Мсты,
кальцетрофных и минеротрофных болот.
В настоящее время в пределах Валдайской возвышенности
выделено 8 физико-географических районов: Среднемежский, ТоропоЗападнодвинский, Шейно-Бологовский, Охватский, Селигерский,
Шлино-Цнинский, Верхнемстинский, Леснинский [6–9].
Районы
отличаются по абсолютным высотам, особенностям геоморфологии,
типам почв и структуре растительного покрова. В Селигерском и
Верхнемстинском районах имеются крупные озерные системы,
встречаются олиготрофные и мезотрофные озера. В Шейно- 115 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Бологовском
районе
преобладает
крупнохолмистый
рельеф,
наблюдается обилие ручьев, мелких речек, глубоких сырых оврагов,
встречаются
лесные
массивы
со
значительным
участием
широколиственных пород. В Охватском и Шлино-Цнинском районах
встречаются значительные отложения зандровых песков, крупные
болотные массивы. В Шлино-Цнинском районе в долине реки Цны
имеются участки с обнажениями карбонатных пород. Специфику
Торопо-Западнодвинского, Среднемежского и Верхнемстнинкого
районов определяет наличие крупных рек – Западной Двины, Межи,
Мсты. В первых двух районах сформировались крупные зандровые
равнины, в последнем – моренные равнины, на водоразделах
преобладает холмисто-грядовый рельеф.
Материал и методика. В 1998–2011 гг. нами были обследованы
все физико-географические районы юга Валдайской возвышенности.
Использован маршрутный метод, который сочетался с работой на
стационарах. Особое внимание уделено озерным комплексам, участкам
с крупнохолмистым рельефом, густой сетью глубоких оврагов, речным
долинам Западной Двины, Мсты, кальцетрофным и минеротрофным
болотам [31]. Обработаны все собранные гербарные материалы.
Критически проанализированы коллекции региональных (гербарии
кафедры ботаники и экологии ТвГУ, Ботанического сада ТвГУ (TVBG),
Тверского государственного объединенного музея (ТГОМ), гербарий
ИБВВ РАН (IBIW)) и центральных гербариев (LE, LECB, MW, MHA).
Изучены данные литературы и гербарные материалы по сопредельным
областям.
Составлена база данных по Валдайской провинции в целом и
Валдайской возвышенности в формате Microsoft Excel, а также
точечные цифровые карты распространения видов в формате системы
Arc View. Применены традиционные способы математического анализа
флористических данных.
Ботанико-географическая специфика флоры
В общей сложности на территории Валдайской провинции
выявлено 886 видов сосудистых растений природной флоры из 96
семейств. Отмечено 146 микровидов и гибридов, относящихся в
основном к семействам Asteraceae, Ranunculaceae, Rosaceae, Fabaceae.
[14].
Специфические особенности флоры Валдайской провинции (ВП)
особенно четко выявляются при ее сравнении с флорами смежных
физико-географических провинций. Среди них Смоленско-Московская
(СМП), Верхневолжская (ВВП), Прибалтийская (ПП). Для понимания
направленности трендов важен также материал по некоторым другим
близко расположенным территориям. Среди них – Мещерская
провинция (МП) [30; 34]. Во флоре Валдайской провинции (ВП)
отмечен самый низкий уровень видового богатства по сравнению со
- 116 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
смежными провинциями. Анализ географических спектров показал, что
большее дифференцирующее значение имеют средне-атлантическоевропейская и степная-лесостепная фракции. Доля степных и
лесостепных видов меняется следующим образом: ВП – 1,2%, СМП –
7,6%, ВВП – 2,9%, МП – 12,8%. Прослеживается тенденция
уменьшения доли среднеевропейских и атлантическо-европейских
видов с запада на восток [30; 34].
Выявленные тенденции изменения географической структуры
флор более контрастно проявляются при качественном анализе
специфических компонентов флор. Среди дифференциальных видов ВП
представлены только микровиды. Среди них Hieracium carboneum
Sennik.. Они отмечены и в составе кодифференциального компонента, в
котором преобладают общие для ВП и Прибалтийской провинции (ПП)
микровиды. Среди них Hieracium albocastanum (Norrl.) Juxip, H.
chlorellum Norrl., H. karelorum (Norrl.) Norrl., H. linifolium T. Sael.,
Ranunculus aggr. biformis Walo Koch. Выявлено 3 общих
кодифференциальных вида для ВП и ПП (Actaea erythrocarpa Fisch.,
Rubus humulifolius C.A. Mey., Atragene sibirica L.). Они представляют
евросибирскую группу. Общим кодифференциальным видом для ВП и
СМП является Aspenium viride Huds.
В ПП встречаются дифференциальные виды с субокеаничсекими
связями. Среди них Ruppia brachypus J. Gay, Potamogeton × bottnicus
Hagstr, Batrachium fluitans (Lam.) Wimm., Caldesia parnassifolia (L.)
Parrl. Отмечены некоторые среднеевропейские (Melittis carpatica Klok.,
Potentilla wiemanniana Gunth. et Schummel, Vicia incana Gouan, Gladiolus
palustris Gaud.) и скандинавские (Artemisia oelandica (Bess.) Krasch.,
Lonicera baltica Pojark., Rubus wahlbergii Arrhen.) виды. Среди
дифференциальных видов СМП обнаружены виды с монтанными
связями и редкие для Центральной России растения (Cortusa matthioli
L., Festuca filiformis Pourr., Hedysarum alpinum L., Salvia nemorosa L.).
Во флоре ВВП практически нет специфических видов с
атлантическими связями, но появляются восточноевропейскосибирские. Среди дифференциальных видов ВВП отмечены
евросибирские растения – Cacalia hastatа L., Calamagrostis obtusata
Trin., Schizahne callosa (Turcz. ex Griseb.) Ohwi, Anemonoides altaica
(C.A. Mey.) Holub.
При сравнении флоры Валдайской возвышенности и севера
Валдайской провинции четко прослеживается тенденция увеличения
уровня видового богатства и объема специфического компонента флор в
южном направлении. Уровень видового богатства и степень
специфичности флоры Валдайской возвышенности значительно выше,
чем для севера Валдайской провинции (753 вида и 103 микровида). На
территории Валдайской возвышенности представлено 99,4% флоры
провинции и выявлено 133 дифференциальных вида (171 с учетом
- 117 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
микровидов). Дифференциальный компонент севера провинции
составляет 11 видов (16 с учетом микровидов).
Основу флоры Валдайской возвышенности составляют
покрытосеменные растения, насчитывающие 840 видов (95,3%). Среди
них преобладают двудольные растения
– 597 видов (67,8%).
Сосудистые споровые и голосеменные растения составляют 4,7% от
общего числа видов флоры (41 вид), однако их роль в сложении
растительного покрова возвышенности достаточно велика. Средний
уровень видового богатства в семействе составляет около 2 видов.
Десять ведущих семейств объединяют 58,0% всех видов. Наиболее
крупными семействами, как и в других регионах Центральной России,
являются Asteraceae, Cyperaceae, Poaceae, Rosaceae, Ranunculaceae,
Scrophulariaceae, Brassicaceae, Fabaceae, Lamiaceae, Apiaceae.
Подавляющее большинство видов флоры - травянистые растения
(93,5%), из которых многолетники составляют 76,8%, одно-, двулетники
- 16,7%. На долю древесных растений приходится 6,5%, из них деревья
– 2,2%, кустарники – 3,3%, кустарнички и полукустарнички 1%.
Большая протяженность и достаточное разнообразие в
геоморфологическом отношении способствовали формированию на
территории Валдайской возвышенности разнообразных типов
растительности: лесной, луговой, болотной, лесо-луговой, луговоболотной, лесо-болотной. Преобладают виды лесных (26,1%) и луговых
(22,2%) сообществ. Велика роль болотных видов (16,3%). Наличие на
территории Валдая крупных озерных комплексов и сети речных долин
обусловило значительную долю водных и прибрежно-водных растений
(10,1%). Большая доля сорных растений связана с сильной антропной
нарушенностью растительного покрова на некоторых территориях
(9,6%).
Флора Валдайской возвышенности неоднородна в отношении
составляющих географических элементов (рис. 1). На территории
возвышенности преобладают виды со значительным широтным
распространением. Ведущую роль играют бореальные (49,2%) и
плюризональные (24,4%) виды. Плюризональные и бореальные виды
имеют, как правило, обширные ареалы (евроазиатские, европейские,
евросибирские, евроамериканские). Сюда отнесены представители
хвощевидных, плауновидных, папоротниковидых, виды семейств
Cyperaceae, Ericaceae, Juncaceae, Salicaceae, Apiaceae и многие другие,
играющие важную роль в сложении растительного покрова Валдайской
возвышенности.
Уровень видового богатства и степень специфичности флор
Валдайской
возвышенности
значительно
выше
аналогичных
показателей для севера Валдайской провинции. Эти особенности
позволяют при флористическом районировании рассматривать отдельно
южную и северную части Валдайской провинции. Спектры широтных
- 118 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
групп юга (Валдайской возвышенности) и севера Валдайской
провинции существенно различаются (рис. 1). Специфика флоры
Валдайской возвышенности определяется бóльшим уровнем видового
богатства лесостепных (6,8%), неморальных и бореально-неморальных
(14,7%) растений. Дифференциальными лесостепными видами являются
Eremogone saxatilis (L.) Ikonn., Koeleria glauca (Spreng.) DC., Melica
picta C. Koch, Silene chlorantha (Willd.) Ehrh., Arabis gerardii (Bess.)
Koch, Hylotelephium maximum (L.) Holub, Agrimonia procera, Lathyrus
pisiformis L., Daucus carota L., Vincetoxicum hirundinaria Medik.,
Veronica incana L. и др., многие из которых имеют европейский ареал.
Дифференциальные неморальные и бореально-неморальные виды
имеют преимущественно европейские ареалы. Среди них Trapa natans
L., Dentaria bulbifera (Warnst.) Warnst., Astragalus glycyphyllos L., Carex
paniculata L., C. remota L., Peucedanum oreoselinum (L.) Moench,
Aconitum lasiostomum Reichenb., Lathyrus niger (L.) Bernh., L. linifolius
(Reichard) Bassler, L. laevigatus (Waldst. et Kit.) Gren. и др.
Несмотря на то, что Валдайская возвышенность удалена от
океанического побережья, наличие крупных озерных комплексов
обусловило распространение некоторых видов с океаническими и
субокеаническими связями – Lobelia dortmanna L., Isoёtes setacea auct.
non Lam., I. lacustris L., Potamogeton filiformis Pers., Carex lepidocarpa
Tausch, Armeria vulgaris Willd., Callitriche hamulata Kutz. ex Koch,
Tillaea aquatica L., Subularia aquatica L., Montia fontana L., Botrychium
matricariifolium A. Br. ex Koch.
На юге Валдайской возвышенности не встречаются некоторые
евросибирские и гипоарктические виды, которые в Восточной Европе
имеют ограниченное распространение и приурочены преимущественно
к северным территориям. Из этих групп на севере Валдайской
провинции отмечены Actaea erythrocarpa, Picea obovata Ledeb., Atragene
sibirica L., Rubus humulifolius, Baeothryon caespitosum (L.) A. Dietr. и др.
В долготных спектрах Валдайской возвышенности по сравнению с
северной частью Валдайской провинции увеличивается доля
европейских (21,5 и 16,3%) и уменьшается доля евросибирских видов
(14,9 и 15,8%). Дополнительную информацию о флористической
специфике территории юга дает материал о распространении
микровидов рода Hieracium L. По Валдайской возвышенности проходят
восточные
и
юго-восточные
границы
ареалов
некоторых
фенноскандских и балтийских видов ястребинок [37]. Среди них
Hieracium chlorellum, H. prolixum Norrl., H. chlorelliceps Norrl., H.
chloromaurum Johanss., H. ahtii, H. karelorum, H. carboneum, H.
dispansiforme Norrl., H. hjeltii Norrl., H. vulgatum Fr.
- 119 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
100
40
90
129
80
60
40
87
33
70
60
203
211
Н, Б-Н
ЛС
50
ПЗ
40
30
ГА
Б
432
390
Юг
A
Север
Б
20
10
0
Р и с . 1 . Спектры широтных групп географических элементов
флоры Валдайской возвышенности в целом (А)
и северной части Валдайской провинции (Б):
ГА – гипоарктическая; Н и Б-Н – неморальная и бореально-неморальная;
ЛС – лесостепная и степная; ПЗ – плюризональная; Б – бореальная группы;
приведено абсолютное число видов,
в спектрах указано долевое участие групп в %
Таким
образом,
при
значительном
общем
сходстве
таксономических, биоморфологических, географических спектров,
соответствующих спектрам умеренных бореальных флор, выявляются
некоторые специфические особенности в структуре географических
спектров Валдайской возвышенности и севера Валдайской провинции.
Флористическое и физико-географическо районирование
При анализе материала по отдельным территориям Валдайской
возвышенности за основу взята схема физико-географического
районирования, предложенная А.А. Дорофеевым [6–9]. Выявлен общий
уровень видового богатства и объем специфического компонента флор
физико-географических районов (табл. 1). Оценена степень сходства
флор районов с использованием индекса Отиаи, который позволяет
корректно сравнивать флоры различных по площади территорий [19–
21] (табл. 2).
Максимальный уровень видового богатства и специфичности
отмечен для флоры Верхнемстинского района. Сопоставимы с ними
- 120 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
показатели, полученные для Селигерского и Торопо-Западнодвинского
районов (табл. 1). Высокий уровень разнообразия обусловлен большей
неоднородностью и мозаичностью территории районов, наличием
крупных речных долин (Западная Двина, Волга, Мста).
Среди дифференциальных видов Торопо-Западнодвинского и
Шейно-Бологовского районов отмечены среднеевропейские горные,
европейские неморальные и преимущественно лесостепные растения
(Lathyrus laevigatus, Carex remota, Peucedanum oreoselinum, Aconitum
lasiostomum Reichenb., Epilobium collinum C.C. Gmel.). Их встречаемость
обусловлена более южным положением территории и наличием лесных
массивов с участием широколиственных пород. Привлечение материала
по бриофлорам и лихенофлорам дополняет специфику этих районов [29;
33; 35]. Среди дифференциальных лишайников и мохообразных можно
отметить Dermatocarpon luridum (With.) J.R. Laundon, D. rivulorum
(Arnold) Dalla Torre et Sarnth., Metzgeria furcata (L.) Dumort., Frullania
bolanderi Austin.
Таблица 1
Уровень видового богатства и объем специфического компонента
флор физико-географических районов Валдайской возвышенности
Районы
Общее число
видов
виды
мкв
Среднемежский
686 (77,9) 10
Торопо-Западнодвинский 715 (81,2) 28
Шейно-Бологовский
704 (80,0) 19
Охватский
697 (79,1) 24
Селигерский
745 (84,6) 48
Шлино-Цнинский
675 (76,6) 12
Верхнемстинский
770 (87,4) 62
Леснинский
657 (74,6) 11
Примечание: В скобках указана доля в
возвышенности; мкв – микровиды.
Дифференциальные Кодифференциальные
виды
виды
мкв
виды
мкв
виды
1 (0,1)
–
1
16
8 (1,1)
11
5
22
9 (1,3)
3
6
17
5 (0,7)
9
3
13
14 (1,9)
19
18
45
1 (0,2)
1
2
16
38 (4,9)
27
25
51
1 (0,2)
1
1
4
% от общего числа видов Валдайской
Распространение
некоторых
кодифференциальных
видов
обусловлено особенностями гидрологии.
В озерных системах
Селигерского и Верхнемстинского районов зарегистрированы
некоторые виды с океаническими и субокеаническими связями (Lobelia
dortmanna, Potamogeton filiformis, Montia fontana, Subularia aquatica). В
Селигерском и Верхнемстинском районах отмечены фенноскандские и
балтийские микровиды рода Hieracium.
При выяснении степени сходства видового состава флор физикогеографических районов по индексу Отиаи получены высокие значения
показателей (индекс варьирует от 0,91 до 0,99), что свидетельствует об
определенном флористическом единстве Валдайской возвышенности.
- 121 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Таблица 2
Степень сходства видового состава флор физико-географических районов
Валдайской возвышенности (по индексу Отиаи)
Районы
ТЗ ШБ О
С ШЦ ВМ Л
Среднемежский (СМ)
0,98 0,99 0,96 0,94 0, 97 0,91 0,96
Торопо-Западнодвинский (ТЗ)
0,96 0,95 0,91 0,93 0,92 0,94
Шейно-Бологовский (ШБ)
0,96 0,94 0,91 0,92 0,96
Охватский (О)
0,94 0,96 0,93 0,96
Селигерский (С)
0,93 0,94 0,94
Шлино-Цнинский (ШЦ)
0,92 0,97
Верхнемстинский (ВМ)
0,92
Примечание. Л – Лесницкий р-н.
Р и с . 2 . Основные количественные характеристики
флор физико-географических районов Валдайской возвышенности
и степень сходства их видового состава (по индексу Отиаи):
на столбчатых диаграммах показан общий уровень видового богатства флор,
дифференциальный (заливка) и кодифференциальный (штриховка) компоненты;
условные обозначения физико-географических районов такие же, как в табл. 2;
ВВП – Верхневолжская; ПП – Прибалтийская;
СМП – Смоленско-Московская провинции
Хорошо выявляется группа районов более сходных по видовому
составу
флор
(Шейно-Бологовский,
Торопо-Западнодвинский,
Среднемежский), расположенных на юго-западе возвышенности.
Районы, занимающие северо-восточную часть возвышенности,
- 122 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
отличаются более низкими показателями индекса по сравнению с югозападными районами. Корреляционные связи между флорами северовосточных районов слабее, чем связи в группе юго-западных районов.
Меньший уровень корреляционных связей в группе северо-восточных
районов определяется высоким уровнем видового богатства и
специфичности флоры Верхнемстинского района, которые обусловлены
своеобразием долинных комплексов реки Мсты и более сложной
ландшафтной структурой территории.
При флористическом районировании целесообразно проводить
границы между юго-западными и северо-восточными группами районов
и выделять более мелкие единицы в пределах этих групп. В общих
чертах границы этих единиц совпадают с границами выделяемых
физико-географических районов (рис. 2).
Наши
данные
согласуются
с
представлениями
о
целесообразности более широкого понимания границ Восточной
Фенноскандии. Полученный фактический материал существенно
расширяет представления о закономерностях географического
распространения основных флорогенетических комплексов на разных
по геоморфологической структуре территориях.
Заключение.
На
территории
Валдайской
провинции
зарегистрировано 886 видов и 145 микровидов сосудистых растений.
Уровень видового богатства и степень специфичности флоры
Валдайской возвышенности (879 видов, 136 микровидов, 171
дифференциальный вид) выше, чем аналогичные показатели для флоры
северной части провинции (756, 103 и 16 видов соответственно).
Различия флористических показателей обусловлены климатическими
особенностями и структурой растительного покрова.
Общие
структурные
особенности
флор
Валдайской
возвышенности (таксономические, биоморфологические, экологофитоценотические и географические спектры) типичны для умеренных
бореальных флор. Специфику флоры возвышенности определяют
приуроченные к озерным ландшафтам субокеанические виды, редкие
для северо-запада Русской равнины среднеевропейские горные виды и
микровиды
рода
Hieracium
с
преимущественно
с
восточнофенноскандскими и балтийскими ареалами.
Спектр широтных элементов флоры Валдайской возвышенности
характеризуется по сравнению со спектром северной части Валдайской
провинции бóльшим долевым участием лесостепных, неморальных,
бореально-неморальных видов и видов с европейским типом ареала. Во
флоре
севера
Валдайской
провинции
увеличивается
роль
гипоарктических видов, представлены редкие восточно-европейскосибирские
виды,
распространенные
в
северных
районах
преимущественно на возвышенных территориях.
- 123 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Флоры
физико-географических
районов
Валдайской
возвышенности характеризуются относительно высоким сходством
видового состава (индекс Отиаи от 0,91 до 0,99), что свидетельствует об
определенном флористическом единстве Валдайской возвышенности.
Более сходны юго-западные районы (Шейно-Бологовский, ТоропоЗападнодвинский, Среднемежский). Корреляционные связи между
флорами северо-восточных районов слабее, чем связи в группе югозападных районов. Эти различия определяются высоким уровнем
видового богатства и специфичности флоры Верхнемстинского района,
которые обусловлены своеобразием долинных комплексов реки Мсты и
более сложной ландшафтной структурой территории. При
флористическом районировании целесообразно сгруппировать югозападные и северо-восточные районы в более крупные хорионы и
выделить в их составе единицы более низкого ранга. Границы
последних в общих чертах совпадают с границами физикогеографических районов.
Авторы благодарят Н.Н. Цвелева, С.Р. Майорова, А.Н. Сенникова,
А.В. Щербакова за помощь в определнии материала.
Список литературы
1. Белышева Т.Н. Редкие растения верхнего и среднего течения реки
Цны // Флора и растительность южной тайги. Калинин: Изд-во КГУ,
1988. С. 73–76.
2. Белышева Т.Н. Охраняемые природные объекты Селигерского края
и их флористическое исследование // Флора и растительность
южной тайги. Калинин: Изд-во КГУ, 1989. С. 100–104.
3. Бубырева В.А. Флористическое районирование Северо-Запада и
Севера европейской части России: подходы и методы: автореф. дис.
… канд. биол. наук. СПб., 1992. 17 с.
4. Бубырева
В.А.
Флористическое
районирование
северного
макросклона Русской равнины на основе сгущений границ ареалов //
Вестн. Санкт-Петерб. гос. ун-та. Сер. 3. 2004. Вып. 1. С. 35–68.
5. Гоби Х.Я. О влиянии Валдайской возвышенности на географическое
распространение растений в связи с очерком флоры западной части
Новгородской губернии. СПб.: Демаков, 1876. 168 с.
6. Дорофеев А.А. Природные комплексы // География Тверской
области. Тверь, 1992а. Гл. 7. С. 80–93.
7. Дорофеев А.А. Физико-географические районы Тверской области и
их природоохранная характеристика // Экологические проблемы
природопользования. Тверь: Изд-во Твер. гос. ун-та, 1992б
С. 86–106.
8. Дорофеев А.А. Опыт картографирования индивидуальных
- 124 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
ландшафтов Тверской области // Вестн. Твер. гос. ун-та. Сер.
География и геоэкология. 2004. Вып. 1, № 1 (3). С. 34–43.
9. Дорофеев А.А. Физико-географическое районирование и ландшафты
Тверской области // Вестн. Твер. гос. ун-та. Сер. География и
геоэкология. 2009. Вып. 2 (7), № 36. С. 19–42.
10. Жучкова В.К., Шульгин А.Н. Русская равнина // Физикогеографическое районирование СССР. М., 1968. Гл. 5. С. 55–117.
11. Исаченко А.Г., Дашкевич З.В., Каранаухова Е.В. Физикогеографическое районирование Северо-Запада РСФСР. Л., 1965.
248 с.
12. Колосова (Зуева) Л.В. О ботанико-географической специфике
Валдайской провинции // Изучение флоры Восточной Европы:
достижения и перспективы: тр. Междунар. конф., 23–28 мая 2005 г.,
Санкт-Петерб. СПб., 2005. С. 62.
13. Колосова (Зуева) Л.В. Роль Тверского участка Валдайской
возвышеноости в выявлении ботанико-георгафической специфики
флоры Средней России // Флористические исследования Средней
России: материалы VI науч. совещ. по флоре Средней России (Тверь,
15–16 апр. 2006 г.). М.: КМК, 2006. С. 88–90.
14. Колосова (Зуева) Л.В. Флора Валдайской возвышенности: дис. …
канд биол. наук. М., 2007. 231 с.
15. Конечная Г.Ю., Цвелев Н.Н. Флористические находки в СевероЗападной России // Ботан. журн. 2001. Т. 86, № 6. С. 165–171.
16. Крупкина Л.И. Флора Новгородской области и ее анализ: автореф.
дис… канд биол. наук. Л., 1987. 22 с.
17. Лавренко Е.М., Исаченко Т.И. Зональное и провинциальное
ботанико-геоботаническое разделение европейской части СССР //
Изв. ВГО. 1976. Т. 108, № 6. С. 469-483.
18. Лисицына Л.И. Флора Волжских водохранилищ // Тр. Ин-та биол.
внутр. вод АН СССР. Л., 1990. Вып. 59 (62): Флора и
продуктивность пелагических и литоральных фитоценозов водоемов
бассейна Волги. С. 3–49.
19. Малышев Л.И. Количественный анализ флоры: пространственное
разнообразие, уровень видового богатства и репрезентативность
участков обследования // Ботан. журн. 1975. Т. 60, № 11. С. 1537–
1550.
20. Малышев Л.И. Биологическое разнообразие в пространственной
перспективе // Биологическое разнообразие: подходы к изучению и
сохранению. СПб., 1992. С. 41–52.
21. Малышев Л.И. Моделирование флористического деления Европы с
помощью кластерного анализа // Ботан. журн. 2002. Т. 87, № 7.
С. 16–33.
22. Миняев Н.А. Флористическое районирование северо-запада
европейской части СССР // Тр. Ленингр. о-ва естествоиспыт. Т. 70,
- 125 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
вып. 1. Л., 1959. С. 35–37.
23. Миняев Н.А. Гипоарктические (аркто-бореальные) элементы во
флоре северо-запада европейской части СССР // Ареалы растений
флоры СССР. Л.: Изд-во ЛГУ, 1969а. Вып. 2. С. 34–46.
24. Миняев Н.А. Горные среднеевропейские элементы во флоре северозапада европейской части СССР // Ареалы растений флоры СССР.
Л.: Изд-во ЛГУ, 1969б. Вып. 2. С. 5–33.
25. Миняев Н.А. Сибирские таежные элементы во флоре северо-запада
европейской части СССР // Ареалы растений флоры СССР. Л.: Издво ЛГУ, 1965а. С. 50-92.
26. Миняев Н.А. Умеренные восточноевропейские (сарматские) во флоре
северо-запада европейской части СССР // Вестн. ЛГУ. Сер. биол.
1965б. № 21, вып. 4. С. 44–56.
27. Миняев Н.А. История развития флоры Северо-Запада европейской
части РСФСР с конца плейстоцена: докл. о работах, представленных
к защите на соискание уч. степени д-ра биол. наук Л., 1966. 38 с.
28. Миняев Н.А., Конечная Г.Ю. Флора Центрально-Лесного
государственного заповедника. Л.: Наука, 1976. 104 с.
29. Нотов А.А. Материалы к флоре Тверской области. Ч. 1: Высшие
растения. 4-я версия, перераб. и доп. Тверь: ГЕРС, 2005. 214 с.
30. Нотов А.А. О проблеме сопряженного биогеографического анализа
разных компонентов биоты // Вестн. Твер. гос. ун-та. Сер. Биология
и экология. 2009. Вып. 14, № 18. C. 195–220.
31. Нотов А.А., Волкова О.М., Спирина У.Н., Колосова (Зуева) Л.В.,
Рыбкина В.А. О флористическом разнообразии некоторых физикогеографических районов Тверской области // Вестн. Твер. гос. ун-та.
2005. Вып. 1, № 4 (10). Сер. Биология и экология. Вып. 1.
С. 122–150.
32. Нотов А.А., Нотов В.А., Павлов А.В. Ботанико-географическая
специфика флоры природных комплексов Верхневолжья с
обнажениями карбонатных пород // Окская флора: материалы
Всерос. школы-семинара по сравнительной флористике, посвящ.
100-летию «Окской флоры» А.Ф. Флерова (23–29 мая 2010 г.,
Рязань) / под ред. М.В. Казаковой. Рязань, 2010. С. 173–182. (Тр.
Рязан. отделения РБО; Вып 2, Ч. 1).
33. Нотов А.А., Спирина У.Н., Игнатов М.С., Игнатова Е.А.
Листостебельные мхи Тверской области (Средняя полоса
Европейской России) // Arctoa. 2002. Т. 11. С. 59–65.
34. Нотов А.А., Спирина У.Н., Колосова (Зуева) Л.В. О некоторых
результатах сопряженного анализа флор мхов и сосудистых
растений в южнотаежных и подтаежных районах Русской равнины //
Успехи сравнительной флористики в России: вклад школы А.И.
Толмачева: материалы VI раб. совещ. по сравнительной флористике,
посвящ. 100-летию со дня рождения А.И. Толмачева, Сыктывкар,
- 126 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
16–21 июня 2003 г. СПб., 2004. С. 208 –211.
35. Нотов А.А., Урбанавичюс Г.П., Катаускайте Л.А. Материалы к
лихенофлоре Валдайской и смежных физико-географических
провинций // Флора лишайников России: состояние и перспективы
исследований: тр. Междунар. совещ., посвящ. 120-летию со дня
рождения В.П. Савича (Санкт-Петерб., 24–27 окт. 2006 г.). СПб.:
Изд-во СПб ГЭТУ, 2006. С. 167–175.
36. Нотов А.А., Шубинская Н.В. Материалы к ботаникогеографическому анализу природной флоры сосудистых растений
Тверской области // Флористические исследования в Центральной
России на рубеже веков: материалы науч. совещ. (Рязань, 29–31 янв.
2001г.). М.: Изд-во Ботан. сада МГУ, 2001. С. 100–103.
37. Сенников А.Н. Фитогеографическое районирование Северо-Запада
Европейской части России (Ленинградская, Псковская и
Новгородская области) // Биогеография Карелии. Петрозаводск:
Изд-во КНЦ РАН. 2005. С. 206–243. (Тр. Карел. науч. центра РАН;
Вып. 7).
38. Физико-географическое районирование Нечерноземного Центра /
под ред. Н.А. Гвоздецкого, В.К. Жучковой. М., 1963. 451 с.
39. Физико-географическое районирование СССР: Характеристики
региональных единиц / под ред. Н.А. Гвоздецкого, В.К. Жучковой.
М., 1968. 287с.
40. Цвелев Н.Н. Определитель сосудистых растений Северо-Запада
России (Ленинградская, Псковская и Новгородская области). СПб.:
Изд-во СПХФА, 2000. 781 с.
41. Цинзерлинг Ю.Д. География растительного покрова северо-запада
СССР. Л.: Изд-во АН СССР, 1934. 377 с.
42. Юрова Э.А., Конечная Г.Ю., Крупкина Л.И. Кадастр флоры
Новгородской области. Новгород: Изд-во НовГУ, 1998. 142 с.
ABOUT BOTANICO-GEOGRAPHICAL SPECIFICITY
OF THE FLORAE OF VALDAI HILLS
S.M. Dementyeva, А.А. Notov, L.V. Zueva, S.A. Ivanova
Tver State University
The botanico-geographical characteristic of flora of Valdai hills is given.
Specific features of flora are revealed. In territory of the Valdai province 886
species and 145 microspecies of vascular plants are registered. Indicators of
specific riches and taxonomy diversion for flora of the south of Valdai hills
more than similar characteristics of flora of its northern part. The problem of
floristic division into districts of territory on the basis of system of
physicogeographical units is discussed. Florae of physicogeographical areas
of Valdai hills are characterized by rather high similarity of specific structure.
- 127 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Correlation communications between florae of northeast areas of a southern
part more than communications in group of southwest areas that is caused by
a considerable originality of flora of Verhnemstinsky area. The grouping of
southwest and northeast areas in larger chorions, in which limits probably
allocation of units more a low rank, physicogeographical areas corresponding
to borders is expedient.
Ключевые слова: Valdai hills, flora, vascular plants, floristic division,
phytochoriones, comparative floristic analysis.
Об авторах:
ДЕМЕНТЬЕВА Светлана Михайловна–кандидат биологических
наук, профессор, заведующая кафедрой ботаники, ФГБОУ ВПО
«Тверской государственный университет», 170100, Тверь, ул. Желябова,
д. 33, e-mail: Dementyeva@tversu.ru
НОТОВ Александр Александрович–кандидат биологических
наук, доцент кафедры ботаники ФГБОУ ВПО «Тверской
государственный университет», 170100, ул. Желябова, д. 33, e-mail:
anotov@mail.ru
ЗУЕВА Людмила Викторовна–кандидат биологических наук,
заведующая гербарием кафедры ботаники, ФГБОУ ВПО «Тверской
государственный университет», 170100, Тверь, ул. Желябова, д. 33,
e-mail: dmitrievas@mail.ru
ИВАНОВА Светлана Алексеевна–кандидат биологических наук,
доцент кафедры ботаники, 170100, Тверь, ул. Желябова, д. 33, e-mail:
dmitrievas@mail.ru
- 128 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20. С. 129-136.
17-22.
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
БИОРАЗНООБРАЗИЕ И ОХРАНА ПРИРОДЫ
УДК 582.28(470.331)
НОВЫЕ ДАННЫЕ ОБ АФИЛЛОФОРОВЫХ ГРИБАХ
БОЛОГОВСКОГО РАЙОНА ТВЕРСКОЙ ОБЛАСТИ
В.М. Коткова
Ботанический институт им. В.Л. Комарова РАН
Представлен аннотированный список афиллофоровых грибов,
выявленных автором в Бологовском районе Тверской обл. Список
включает 89 видов, в том числе 35 новых для области видов.
Разновидность Piloderma byssinum var. grandinellum Bourdot et Galzin
отмечена впервые в России.
Ключевые
слова:
афиллофоровые
грибы,
Basidiomycetes,
биоразнообразие, микобиота, Тверская область.
История изучения микобиоты Бологовского района Тверской
области насчитывает уже более 110 лет. Первые исследования по
выявлению разнообразия грибов на данной территории проводил в
конце XIX века В. А. Траншель. В опубликованном «Списке грибов,
собранных в Валдайском уезде Новгородской губернии» [5] он
приводит около 40 видов афиллофоровых грибов для территории,
относящейся в настоящее время к Тверской области. Большая часть
этих материалов была собрана им в Бологовском районе. При изучении
образцов, собранных В. А. Траншелем в Тверской области и
хранящихся в Микологическом гербарии Ботанического института им.
В. Л. Комарова РАН (БИН РАН), было выявлено еще 3 вида грибов
данной группы: Pseudomerulius aureus (Fr. : Fr.) Jülich – окр. Бологое,
25.VIII 1897, на гнилом стволе, LE 166086; Trametes trogii Berk. – окр.
оз. Азеровка, 9.VIII 1897, на осине, LE 33699; Trichaptum pargamenum
(Fr.) G. Cunn. – окр. Бологое, 17.VIII 1897, LE 21262. В XX веке
микологические исследования, проводимые на территории этого
района, касались преимущественно агарикоидных и гастероидных
базидиомицетов [3].
В июле–августе 2010 г. автором было проведено изучение
афиллофоровых грибов некоторых лесных территорий Бологовского
района Тверской области. Помимо видов, хорошо узнаваемых в
полевых условиях (которые преимущественно не гербаризировались)
было собрано около 60 образцов макромицетов для идентификации в
лабораторных условиях. В результате проведенных исследований
выявлено 89 видов и одна разновидность афиллофоровых грибов, в том

Работа выполнена при частичной поддержке РФФИ (проект № 09-04-01064а)
- 129 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
числе 35 видов, впервые отмеченных на территории Тверской обл. Для
вида Pycnoporellus fulgens, занесенного в Красную книгу Тверской обл.,
зарегистрировано
новое
местонахождение.
Некоторые
виды,
относящиеся к ежовиковым грибам, были включены ранее в сводный
список данной группы грибов Тверской обл. [4].
Ниже следует аннотированный список афиллофоровых грибов,
отмеченных автором на территории Бологовского р-на. Все таксоны
расположены в алфавитном порядке. Звездочкой (*) отмечены виды,
выявленные впервые в Тверской обл., двумя (**) – впервые в
Бологовском р-не. Для каждого вида указываются местонахождения,
субстрат, местообитания, а для видов, образцы которых
гербаризированы, также ссылка на образец в Микологическом гербарии
БИН РАН (LE). Места сбора обозначены цифрами: 1 – окрестности пос.
Лыкошино (58°06′46′′ с. ш., 33°43′02′′ в. д.), 30.VII – 1.VIII 2010; 2 –
окрестности р. Званка (58°07′23′′–58′′ с. ш., 33°39′31′′–42′′ в. д.), 3.VIII
2010; 3 – окрестности оз. Плотичное (57°50′15′′ с. ш., 33°52′19′′ в. д.), 4.
VIII 2010; 4 – окрестности оз. Шаровое (57°55′01′′–14 с. ш., 33°51′34′′–
52′04′′ в. д.), 7.VIII 2010; 5 – окрестности оз. Долгое (57°50′53.1′′ с. ш.,
33°53′01.1′′ в. д.), 1.VIII 2010, cобр. А. А. Нотов.
**Antrodia sinuosa (Fr.) P. Karst. – 1: на валежных стволах сосны
в сосновых лесах.
**Antrodia xantha (Fr. : Fr.) Ryvarden – 1: на валежных стволах
сосны в сосновых лесах.
**Antrodiella serpula (P. Karst.) Spirin et Niemelä – 4: на валежном
стволе ольхи в смешанном лесу; LE 283964.
Bjerkandera adusta (Willd. : Fr.) P. Karst. – 2, 4: на валежных
стволах осины и березы в ельнике с осиной травяном и в смешанном
лесу.
**Bjerkandera fumosa (Pers. : Fr.) P. Karst. – 4: на пне березы в
смешанном лесу; LE 283960.
*Botryobasidium intertextum (Schwein.) Jülich et Stalpers – 1: на
валежных стволах сосны в сосняке черничном; LE 284013.
*Botryobasidium laeve (J. Erikss.) Parmasto – 4: на валежном
стволе ольхи в смешанном лесу; LE 283960.
*Botryobasidium pruinatum (Bres.) J. Erikss. – 2: на валежном
стволе березы в смешанном лесу; LE 283987.
*Botryobasidium subcoronatum (Höhn. et Litsch.) Donk – 2: на
валежных стволах ели и ольхи в ельнике с осиной травяном и в
смешанном лесу; LE 284003.
*Botryobasidium vagum (Berk. et M.A. Curtis) J. Erikss. – 1, 2, 4: на
валежных стволах ели и сосны в ельнике травяном и сосняке черничном
и на валежных стволах ольхи в смешанном лесу; LE 284021, LE 283958.
**Сeraceomyces serpens (Tode : Fr.) Ginns – 2: на валежном
- 130 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
стволе осины в ельнике с осиной травяном; LE 283976.
Chondrostereum purpureum (Pers. : Fr.) Pouzar – 2: на валежных
стволах осины в ельнике с осиной травяном; LE 283979.
*Clavulina cinerea (Bull. : Fr.) J. Schröt. – 1: на почве в
смешанном лесу; LE 283962.
Coltricia perennis (L. : Fr.) Murrill – 3: на почве в сосновом лесу;
LE 283996.
**Corticium roseum Pers. : Fr. – 2: на валежных стволах осины в
ельнике с осиной травяном; LE 283981.
**Datronia mollis (Sommerf. : Fr.) Donk – 1, 2: на валежных
стволах ольхи и осины в ельнике с осиной травяном и в смешанном
лесу; LE 283982.
Fomes fomentarius (L. : Fr.) Fr. – 1, 2, 3, 4: на пнях, сухостойных
и валежных стволах березы в лиственных и смешанных лесах.
Fomitopsis pinicola (Sw. : Fr.) P. Karst. – 1, 2, 4: на пнях,
валежных и сухостойных стволах ели, березы, ольхи и сосны в
смешанных лесах, сосняках и ельниках черничных и травяных;
LE 283970.
Ganoderma applanatum (Pers.) Pat. – 2: на валежных стволах
осины в ельнике с осиной травяном; LE 283983.
*Gloeocystidiellum luridum (Bres.) Boidin – 4: на валежном стволе
ольхи в смешанном лесу; LE 283957.
*Gloeocystidiellum porosum (Berk et M.A. Curtis) Donk – 2: на
валежном стволе ели в ельнике с осиной травяном; LE 284004.
**Gloeophyllum odoratum (Wulfen : Fr.) Imazeki – 2: на валежных
стволах ели в ельнике с осиной травяном; LE 284008.
Gloeophyllum sepiarium (Wulfen : Fr.) P. Karst. – 1, 2: на
валежных стволах ели и сосны в ельниках и сосняках травяных.
Hapalopilus rutilans (Pers. : Fr.) P. Karst. – 1: на валежных стволах
березы в смешанном лесу.
**Heterobasidion annosum (Fr.) Bref. – 2: на валежных стволах
ели в ельнике с осиной травяном; LE 284012.
Hydnellum ferrugineum (Fr. : Fr.) P. Karst. – 1: на почве в сосняке
брусничном; LE 283912.
Hymenochaete tabacina (Fr.) Lév. – 4: на валежных ветвях ольхи в
смешанном лесу.
*Hyphoderma praetermissum (P. Karst.) J. Erikss. et Å. Strid – 4: на
валежном стволе осины в смешанном лесу; LE 283959.
*Hyphoderma puberum (Fr.) Wallr. – 4: на валежных стволах
ольхи в смешанном лесу; LE 283968.
*Hyphodontia abieticola (Bourdot et Galzin) J. Erikss. – 1, 2: на
валежных стволах сосны и ели в сосняке черничном и ельнике с осиной
травяном; LE 284018, LE 284010.
*Hyphodontia alienata (S. Lundell) J. Erikss. – 1: на валежном
- 131 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
стволе ели в смешанном лесу; LE 283992.
*Hyphodontia alutacea (Fr.) J. Erikss. – 1: на валежных стволах
сосны в сосняке черничном; LE 284017.
*Hyphodontia aspera (Fr.) J. Erikss. – 2: на валежных стволах ели
в ельнике с осиной травяном; LE 284005.
*Hyphodontia breviseta (P. Karst.) J. Erikss. – 1, 2: на валежных
стволах сосны и березы в сосняке черничном и в смешанном лесу;
LE 284015, LE 283986.
*Hyphodontia crustosa (Pers. : Fr.) J. Erikss. – 4: на валежных
стволах ольхи в смешанном лесу; LE 283967.
*Hyphodontia floccosa (Bourdot et Galzin) J. Erikss. – 1: на
валежных стволах сосны в сосняке черничном; LE 284022.
*Hyphodontia pallidula (Bres.) J. Erikss. – 1, 2: на валежных
стволах ели в ельнике с осиной травяном и в смешанном лесу;
LE 283993, LE 284011.
**Inonotus obliquus (Pers. : Fr.) Pilát – 1, 2: на живых стволах
березы в смешанных лесах.
Inonotus radiatus (Sowerby : Fr.) P. Karst. – 2, 3, 4: на
сухостойных и валежных стволах ольхи в смешанных лесах.
Lenzites betulinus (L. : Fr.) Fr. – 1, 2, 4: на валежных стволах
березы в смешанных лесах; LE 283988.
**Oxyporus corticola (Fr.) Ryvarden – 2: на валежных стволах
осины в ельнике с осиной травяном; LE 283974.
**Oxyporus populinus (Schumach. : Fr.) Donk – 1: на стволе живой
березы в смешанном лесу; LE 284001.
*Peniophora cinerea (Pers. : Fr.) Cooke – 2: на ветвях валежного
ствола березы в смешанном лесу; LE 283984.
*Peniophora incarnata (Pers. : Fr.) P. Karst. – 1: на сухой ветви
ирги в поселке; LE 284000.
**Peniophora rufa (Fr.) Boidin – 2: на валежном стволе осины в
ельнике с осиной травяном; LE 283978.
*Phanerochaete laevis (Pers. : Fr.) J. Erikss. et Ryvarden – 4: на
валежных стволах ольхи в смешанном лесу; LE 283966.
*Phanerochaete sordida (P. Karst.) J. Erikss. et Ryvarden – 1: на
валежных стволах сосны в сосняке черничном; LE 284019.
*Phanerochaete tuberculata (P. Karst.) Parmasto – 4: на валежном
стволе осины в смешанном лесу; LE 283961.
**Phellinus alni (Bondartsev) Parmasto – 1, 4: на живых стволах
ольхи в долинных лесах.
**Phellinus chrysoloma (Pers. : Fr.) Donk – 1: на пнях и валежных
стволах ели в ельнике черничном.
Phellinus igniarius (L. : Fr.) Quél. – на живых стволах ивы в
ивняке приручейном в окрестности дер. Мшенское.
**Phellinus nigricans (Fr.) P. Karst. – 1, 3: на пнях и сухостойных
- 132 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
стволах березы в смешанных лесах.
**Phellinus populicola Niemelä – 2: на живом стволе осины в
ельнике с осиной травяном.
**Phellinus pini (Brot.: Fr.) A. Ames – 1: на живом стволе сосны в
сосняке травяном.
**Phellinus punctatus (P. Karst.) Pilát – 1: на сухостойном стволе
ивы козьей в долине реки Валдайка.
Phellinus tremulae (Bondartsev) Bondartsev et P.N. Borisov – 2: на
живых стволах осины в ельнике с осиной травяном.
**Phlebia radiata Fr. : Fr. – 4: на валежном стволе ольхи в
смешанном лесу; LE 283971.
*Phlebia rufa (Pers. : Fr.) M. P. Christ. – 2: на валежном стволе
ольхи в ельнике с осиной травяном; LE 283972.
*Phlebia subulata J. Erikss. et Hjortstam – 1: на валежном стволе
ели в ельнике черничном; LE 283989.
**Phlebiella sulphurea (Pers. : Fr.) Ginns et Lefebvre – 4: на
гнилом валежном стволе ольхи в смешанном лесу.
*Piloderma byssinum (P. Karst.) Jülich – 2: на валежном стволе
ели в ельнике с осиной травяном; LE 284002.
*Piloderma byssinum var. grandinellum Bourdot et Galzin – 2: на
валежном стволе осины в ельнике с осиной травяном; LE 283977.
Данная разновидность, имеющая регулярно мелкобородавчатый –
грандиниоидный гименофор, впервые отмечена на территории России.
Ранее образцы с таким морфотипом среди российских материалов не
отмечались [2].
**Piloderma fallax (Liberta) Stalpers – 1: на гнилом валежном
стволе сосны в смешанном лесу.
Piptoporus betulinus (Bull. : Fr.) P. Karst. – 1, 4: на сухостойных и
валежных стволах березы в смешанных лесах.
**Polyporus ciliatus Fr. – 1: на валежном стволе рябины в
смешанном лесу.
**Pycnoporellus fulgens (Fr.) Donk – 2: на валежном стволе ели в
ельнике с осиной травяном; LE 284009.
Pycnoporus cinnabarinus (Jacq. : Fr.) P. Karst. – 3: на валежном
стволе березы в смешанном лесу; LE 283998.
*Resinicium bicolor (Alb. et Schwein. : Fr.) Parmasto – 1, 2: на
валежных стволах сосны, осины и ели в сосняке черничном и ельнике с
осиной травяном; LE 284014, LE 283975.
*Rigidoporus undatus (Pers. : Fr.) Donk – 5: на валежном стволе
сосны; LE 283963. В последней сводке по трутовым грибам России М.
А. Бондарцева [1] относит этот вид к синонимам Physisporinus vitreus
(Pers. : Fr.) P. Karst. В настоящей работе, вслед за рядом европейских
специалистов [6, 7], мы признаем эти виды самостоятельными.
Основным различием между представителями родов Rigidoporus и
- 133 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Physisporinus является толщина стенок базальных гиф [6]. Четкими
отличиями Rigidoporus undatus от упомянутого выше вида являются
более мелкие поры (7–9 против 4–6 на 1 мм), очень толстостенные
базальные гифы и наличие толстостенных цистид с головчатой
инкрустацией.
**Schizophyllum commune Fr. : Fr. – 2: на валежном стволе
осины в ельнике с осиной травяном; LE 283980.
**Schizopora paradoxa (Schrad.: Fr.) Donk – 2, 3: на валежных
стволах березы и ольхи в смешанных лесах; LE 283985.
*Scytinostroma galactinum (Fr.) Donk – 2: на валежном стволе
осины в ельнике с осиной травяном; LE 283973.
*Sistotrema raduloides (P. Karst.) Donk – 1: на валежном стволе
ели в смешанном лесу; LE 283994.
**Skeletocutis amorpha (Fr. : Fr.) Kotl. et Pouzar – 2: на валежном
стволе ели в ельнике с осиной травяном.
*Skeletocutis biguttulata (Romell) Niemelä – 1: на валежных
стволах сосны в сосняке черничном; LE 284023.
*Skeletocutis kuehneri A. David – 2: на валежном стволе ели в
ельнике с осиной травяном; LE 284007.
*Skeletocutis odora (Sacc.) Ginns – 1: на валежном стволе ели в
ельнике черничном; LE 283991.
**Skeletocutis stellae (Pilát) Domański – 1: на валежном стволе ели
в ельнике черничном; LE 283990.
Steccherinum ochraceum (Pers. ex J. F. Gmel. : Fr.) Gray – 4: на
валежном стволе ольхи в смешанном лесу; LE 283965.
Stereum hirsutum (Willd. : Fr.) Gray – 1: на валежных стволах
березы в смешанном лесу.
**Stereum rugosum (Pers. : Fr.) Fr. – 1, 2, 4: на сухостойных и
валежных стволах ольхи в смешанных лесах.
**Stereum subtomentosum Pouzar – 2, 3, 4: на валежных стволах
ольхи в смешанных лесах; LE 283995.
Thelephora terrestris Ehrh. : Fr. – 2, 3: на почве и гнилых корнях
сосны в сосновых лесах; LE 283997.
*Tomentella radiosa (P. Karst.) Rick – 2: на валежных стволах ели
в ельнике с осиной травяном; LE 284006.
**Trametes hirsuta (Wulfen : Fr) Pilát – 2, 3: на валежных и
сухостойных стволах березы и осины в смешанных лесах; LE 283999.
Trametes ochracea (Pers.) Gilb. et Ryvarden – 2, 4: на валежных
стволах березы и осины в смешанных лесах.
**Trametes versicolor (L. : Fr.) Pilát – 1: на валежных стволах
березы в смешанных лесах.
Trichaptum abietinum (Dicks. : Fr.) Ryvarden – 1, 2: на валежных
стволах ели и сосны в смешанных лесах, ельниках и сосняках травяных
и черничных.
- 134 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
**Trechispora mollusca (Pers. : Fr.) Liberta – 1: на валежных
стволах сосны в сосняке черничном; LE 284016.
*Tubulicrinis subulatus (Bourdot) Donk – 1: на валежных стволах
сосны в сосняке черничном; LE 284020.
Таким образом, в настоящее время на территории Бологовского
района Тверской обл. в общей сложности достоверно выявлено 106
видов афиллофоровых грибов.
Автор признателен А.А. Нотову, В.А. Нотову (ТвГУ) и
А.Б. Оболенской (БИН РАН) за помощь в организации и проведении полевых
исследований в Бологовском районе Тверской области.
1.
2.
3.
4.
5.
6.
7.
Список литературы
Бондарцева М.А. Определитель грибов России. Порядок
афиллофоровые. Вып. 2: Семейства альбатрелловые, апорпиевые,
болетопсиевые, бондарцевиевые, ганодермовые, кортициевые (виды
с порообразным гименофором), лахнокладиевые (виды с трубчатым
гименофором), полипоровые (роды с трубчатым гименофором),
пориевые, ригидопоровые, феоловые, фистулиновые. СПб.: Наука,
1998. 391 с.
Змитрович И.В. Семейства ателиевые и амилокортициевые. М.,
СПб.: КМК, 2008. 278 с. (Определитель грибов России. Порядок
афиллофоровые; Вып. 3).
Кравченко П.Н., Дементьева С.М., Курочкин С.А. К изучению
макромицетов Бологовского района // Вестн. Твер. гос. ун-та. Сер.
Биология и экология. 2008. Вып. 7, № 7 (67). С. 122–125.
Курочкин С.А., Коткова В.М. Ежовиковые грибы Тверской области
// Вестн. Твер. гос. ун-та. Сер. Биология и экология. 2011. Вып. 22,
№ 12. С. 142–148.
Траншель В.А. Список грибов, собранных в Валдайском уезде
Новгородской губернии // Тр. пресновод. биологической станции
императорского Санкт-Петерб. о-ва естествоиспыт. СПб., 1901. Т. 1.
С. 160–203.
Bernicchia A. Polyporaceae s. l. Fungi Europaei 10. 2005. 808 p.
Niemelä T. Polypores, lignicolous fungi // Norrlinia. 2005. Vol. 13. 320 p.
- 135 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
NEW DATA ON APHYLLOPHORACEOUS FUNGI
OF BOLOGOVSKII DISTRICT OF TVER REGION
V.M. Kotkova
Komarov Botanical Institute RAS
The list of 89 species of aphyllophoraceous fungi from Bologovskii District of
Tver Region is presented, among them 35 species are new for the region.
Piloderma byssinum var. grandinellum Bourdot et Galzin is recorded for a
first time in Russia.
Keywords: aphyllophoraceous fungi, Basidiomycetes, biodiversity, mycobiota,
Tver region.
Об авторах:
КОТКОВА Вера Матвеевна–кандидат биологических наук,
старший научный сотрудник Лаборатории систематики и географии
грибов, УРАН Ботанический институт им. В.Л. Комарова РАН, 197376,
Санкт-Петербург, ул. Проф. Попова, 2, e-mail: Vera.Kotkova@mail.ru
- 136 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20. С. 137-142.
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
УДК 581.92 (470.331)
НОВЫЕ ДАННЫЕ О ЛИХЕНОФЛОРЕ
ТВЕРСКОЙ ОБЛАСТИ
И.С. Степанчикова1, М. Куква2, А.А. Нотов3, Д.Е. Гимельбрант1
1
Санкт-Петербургский государственный университет
1
Ботанический институт им. В.Л. Комарова РАН
2
Гданьский университет
3
Тверской государственный университет
Описаны местонахождения новых и редких для территории Тверской
обл. видов лишайников. Часть материалов определена с использованием
тонкослойной хроматографии. Впервые для флоры Центральной России
приводится вид Cetrelia monachorum. Находка в Центральной России
Ochrolechia androgyna s. str. впервые подтверждена данными
хроматографии.
Ключевые слова: лишайники, лихенофлора, Тверская область,
флористические находки.
В ходе обработки материалов уточнена видовая принадлежность
некоторых образцов лишайников, собранных А.А. Нотовым на
территории Тверской обл. Выявлены не отмеченные ранее для области
виды и новые местонахождения редких в регионе лишайников. Ацетонрастворимые вторичные метаболиты лишайников идентифицированы
М. Куквой и И.С. Степанчиковой 22–25 октября 2011 г. с применением
метода тонкослойной хроматографии [1; 11; 16] на базе лаборатории
таксономии растений и охраны природы Гданьского университета
(Польша). Использованы системы растворителей A, B и C.
Собранные нами гербарные образцы хранятся в гербарии
Ботанического сада Тверского государственного университета (TVBG),
дублеты переданы в гербарий Ботанического института им. В.Л.
Комарова РАН (LE) и гербарий Ботанического музея при музее
Естественной Истории университета г. Хельсинки (H). Номенклатура
дана по последней сводке лишайников Фенноскандии [15; 17]. Границы
видов внутри рода Ochrolechia A. Massal. приняты в соответствии с
монографией «The lichen genus Ochrolechia in Europe» [13]. Виды
расположены в алфавитном порядке. Авторы таксонов процитированы
согласно работе P.M. Kirk, A.E. Ansell [12]. Приведены сведения о
распространении видов в смежных с Тверской областях. Для редких в
Центральной России лишайников дана информация об их находках в

Работа выполнена при частичной финансовой поддержке РФФИ (гранты 11-04-00023
и 11-04-00901-а) и Программы фундаментальных исследований президиума РАН
«Биологическое разнообразие»
- 137 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
других регионах. Названия новых для Тверской обл. видов выделены
полужирным шрифтом. Новый для Центральной России вид отмечен
звездочкой (*). При цитировании этикеток указаны индексы квадратов,
принятые в «Atlas Florae Europaeae».
Biatora efflorescens (Hedl.) Räsänen: Нелидовский р-н,
Центрально-Лесной
государственный
природный
биосферный
заповедник (ЦЛГПБЗ), 56º28'57" с.ш., 32º55'53" в.д., кв. 77, старый
ельник с вязом и осиной вдоль ручья, впадающего в р. Межа, на коре
старой осины, 12.X 2011, А. Нотов (далее – А.Н.), опр. Д. Гимельбрант
(далее – Д.Г.), № 811 – WH1.
Ближайшие местонахождения отмечены в Ленинградской обл.
[14] и Республике Карелия [9].
*Cetrelia monachorum (Zahlbr.) W. L. Culb. et C. F. Culb.:
1) Кувшиновский р-н, между деревнями Сокольники и Лещилово,
верховья р. Трясна, старый смешанный лес с вязом и осиной, на коре
старого вяза, 1.VIII 1994, А.Н., опр. М. Куква, И. Степанчикова (далее –
М.К., И.С.), № 50 – WJ4; 2) Кувшиновский р-н, окрестности дер.
Володово, старовозрастный елово-осиновый лес с неморальными
видами в подлеске и травяном ярусе, на коре старой осины, 1.VIII 1994,
А.Н., опр. М.К., И.С., № 51 – WJ4; 3) Удомельский р-н, окрестности дер.
Ивановское, старинный усадебный парк Голубые Озера, на стволе
старой липы, вместе с Lobaria pulmonaria (L.) Hoffm., 8.VII 2006, А.Н.,
опр. М.К., И.С., № 100 – XK2 (см. таблицу).
Распространение этого вида изучено недостаточно. Он отмечен
для Кавказа, Южной Сибири, Юга Дальнего Востока [8].
Lecanora thysanophora R. C. Harris: Нелидовский р-н, ЦЛГПБЗ,
56º29'39,8" с.ш., 32º58'13,7" в.д., кв. 80, старый приручьевой
неморальный ельник с вязом, кленом и папоротниками, на коре старого
вяза, 9.VI 2011, А.Н., опр. М.К., И.С., № 370 – WH1 (см. таблицу).
Ранее был отмечен в ЦЛГПБЗ [2]. По-видимому, этот вид
достаточно широко распространен в заповеднике.
Loxospora elatina (Ach.) A. Massal.: 1) Нелидовский р-н, ЦЛГПБЗ,
56º27'53,7" с.ш., 32º57'52,7" в.д., кв. 95, топкий березняк с елью и черной
ольхой в пойме р. Межа, на коре старого экземпляра черной ольхи,
5.IX 2011, А.Н., опр. И.С., М.К., № 592 – WH1; 2) Торопецкий р-н,
окрестности дер. Серово, 56º36'17,9" с.ш., 31º19'14,5" в.д.,
старовозрастный сероольшаник с вязом и елью, на левом берегу
р. Ноша, на коре старой ели в нижней части ствола, 28.VII 2011, А.Н.,
опр. М.К., И.С., № 219 – VH1 (см. таблицу).
Вид приводился ранее для ЦЛГПБЗ без учета данных
тонкослойной хроматографии [3–6].
- 138 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Таблица
Данные хроматографического исследования
некоторых образцов лишайников
Вид
Состав
вторичных метаболитов
Образец*
Cetrelia monachorum
50
атранорин, перлатоловая, анциаевая,
имбрикаровая
и 4-О-деметилимбрикаровая кислоты
C. monachorum
51
атранорин, перлатоловая, анциаевая,
имбрикаровая
и 4-О-деметилимбрикаровая кислоты
C. monachorum
100
атранорин, перлатоловая, анциаевая,
имбрикаровая
и 4-О-деметилимбрикаровая кислоты
Lecanora thysanophora
370
атранорин, зеорин, усниновая кислота,
а также группа характерных для вида
терпеноидов неизвестной структуры
«thysanophora unknowns» [10]
Loxospora elatina
219
тамноловая и элатиновая кислоты
L. elatina
592
тамноловая и элатиновая кислоты
Ochrolechia androgyna
600
леканоровая и гирофоровая кислоты,
а также три характерных для вида жирных
кислоты неизвестной структуры
«androgyna B unknowns» [13; 19]
Примечание. * – указан данный А.А. Нотовым авторский коллекционный номер
образца.
Menegazzia terebrata (Hoffm.) A. Massal.: 1) Калининский р-н
национальный парк «Завидово», окрестности дер. Савино, 56º26'14,1"
с.ш., 35º52'54,3" в.д., кв. 60 Тургиновского лесничества, топкий
черноольшаник с елью и березой по краю крупного болотного массива,
на коре березы пушистой, 25.X 2011, А.Н., опр. А.Н., Д.Г. № 83 – XH3;
2) там же 56º26'14,4" с.ш., 35º52'52,8" в.д., кв. 60 Тургиновского
лесничества, топкий черноольшаник с елью по краю крупного
болотного массива, на коре черной ольхи, 25.X 2011, А.Н., опр. А.Н., №
117 – XH3; 3) Торопецкий р-н, окрестности дер. Серово, 56º36'16,5" с.ш.,
31º19'19,0" в.д., старовозрастный смешанный лес с примесью
широколиственных пород, на правом коренном берегу р. Ноша, на коре
сломанного ствола старой серой ольхи, 28.VII 2011, А.Н., опр. А.Н.,
№213 – VH1.
Исчезающий во многих районах России вид [7], регулярно
встречающийся на территории ЦЛГПБЗ [4; 6; 7]. На юго-востоке
- 139 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
области отмечен впервые. С учетом того, что известное ранее в
Московской обл. местообитание утрачено [7], выявленное в
национальном парке «Завидово» местонахождение в настоящее время
является практически единственной в пределах Верхневолжской
провинции точкой, где вид достоверно зарегистрирован.
Ochrolechia androgyna (Hoffm.) Arnold s. str.: Нелидовский р-н
ЦЛГПБЗ, 56º27'53,0" с.ш., 32º56'42,8" в.д., кв. 94, приручьевой ельник с
березой и широколиственными породами, на коре старой ели в нижней
части ствола, 6.IX 2011, А.Н., опр. М.К., И.С., № 600 – WH1 (см.
таблицу).
Ближайшие местонахождения выявлены в Ленинградской обл. и
Республике Карелия [13]. Представители сложного таксономического
комплекса Ochrolechia androgyna s. lat. [19] отмечены неоднократно в
Нелидовском р-не [2]. Впервые подтверждено наличие в составе
лихенофлоры области вида O. androgyna s. str. Распространение видов
комплекса на территории России нуждается в дальнейшем изучении.
Таким образом, выявлено три новых для Тверской обл. вида. Из
них Cetrelia monachorum впервые приведена для Центральной России, а
встречаемость в Центральной России Ochrolechia androgyna s. str.
впервые подтверждена данными хроматографии. Уточнена видовая
принадлежность некоторых образцов, представляющих сложные
таксономические комплексы, точная идентификация которых возможна
только с использованием хемотаксономических методов. Необходимо
дальнейшее выяснение состава и особенностей распространения в
Тверской обл. видов из комплексов Ochrolechia androgyna s. lat. и
Cetrelia olivetorum s. lat. C. olivetorum s. str. характеризуется розовокрасной реакцией сердцевины с гипохлоритом кальция, которая
обусловлена содержанием в талломе оливеторовой кислоты [18]. По
имеющимся в настоящее время материалам, C. olivetorum s. str.
встречается в области редко. Известно только 6 образцов из
Нелидовского и Калининского районов. Остальной материал (более 100
образцов) может быть точно идентифицирован только с использованием
хроматографических методов.
Список литературы
1. Вайнштейн Е.А., Равинская А.П., Шапиро И.А. Справочное пособие
по хемотаксономии лишайников. Л.: Изд-во БИН, 1990.
152 с.
2. Гимельбрант
Д.Е.,
Нотов
А.А.,
Степанчикова
И.С.
Лихенофлористические находки в Тверской области // Вестн. Твер.
гос. ун-та. Сер. Биология и экология. 2011. Вып. 22, № 12.
С. 125–141.
- 140 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
3. Истомина Н.Б. Эпиксильные лишайники разновозрастных вырубок
Калининской области // Новости сист. низш. раст. Т. 26. Л.: Наука,
1989. С. 116–118.
4. Истомина Н.Б. Новое местонахождение Menegazzia terebrata
(Hypogymniaceae, Lichenes) в европейской части России // Ботан.
журн. 1993а. Т. 78, №6. С. 139–141.
5. Истомина Н.Б. Особенности формирования эпиксильных
лишайниковых группировок в ходе восстановительной сукцессии на
вырубках // Ботан. журн. 1993б. Т. 78, № 3. С. 104–109.
6. Истомина Н.Б. Эпифитные лишайниковые синузии в бореальных
ельниках Центрально-Лесного биосферного заповедника // Экология
таежных лесов: материалы Междунар. конф. Сыктывкар, 1998.
С. 30–31.
7. Красная книга Российской Федерации (растения и грибы). М.: КМК,
2008. 855 с.
8. Список лихенофлоры России / сост. Г.П. Урбанавичюс. СПб.: Наука,
2010. 194 с.
9. Фадеева М.А., Голубкова Н.С., Витикайнен О., Ахти Т. Конспект
лишайников и лихенофильных грибов Республики Карелия.
Петрозаводск: Изд-во КНЦ РАН, 2007. 192 с.
10. Harris R. C., Brodo I. M., Tønsberg T. Lecanora thysanophora, a
common leprose lichen in North America // Bryologist. 2000 [2001].
Vol. 103(4). P. 790–793.
11. Huneck S., Yoshimura I. Identification of lichen substances. Berlin; N. Y.,
1996. 493 p.
12. Kirk P.M., Ansell A.E. Authors of fungal names. [Electronic resourse].
Version 2: Jan. 2003. Mode of access: http://www.speciesfungorum.
org/FungalNameAuthors.doc (дата обращения: 3.11.2010).
13. Kukwa M. The lichen genus Ochrolechia in Europe. Gdańsk: Fundacja
Rozwoju Uniwersytetu Gdańskiego, 2011. 309 p.
14. Kuznetsova E., Ahti T., Himelbrant D. Lichens and allied fungi of the
Eastern Leningrad Region // Norrlinia. 2007. Vol. 16. P. 1–62.
15. Nordin A., Moberg R., Tønsberg T., Vitikainen O., Dalsätt Å., Myrdal M.,
Snitting D., Ekman S. Santesson's Checklist of Lichen-forming and
Lichenicolous Fungi. [Electronic reourse]. Version 29 April 2011. Mode
of access: http://130.238.83.220/santesson/home.php (дата обращения:
7.11.2011).
16. Orange A., James P.W., White F.J. Microchemical methods for the
identification of lichens. London: British Lichen Society, 2001. 101 p.
17. Santesson R., Moberg R., Nordin A., Tønsberg T., Vitikainen O. Lichenforming and lichenicolous fungi of Fennoscandia. Uppsala, 2004. 359 p.
18. The lichens of Great Britain and Ireland / eds. C.W. Smith, A. Aptroot,
B.J. Coppins, A. Fletcher, O.L. Gilbert, P.W. James, P.A. Wolseley.
London: The British Lichen Society, 2009. 1046 p.
- 141 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
19. Tønsberg T. The sorediate and isidiate, corticolous, crustose lichens in
Norway // Sommerfeltia. 1992. Vol. 14. P. 1–331.
NEW DATA ON THE LICHEN FLORA OF TVER REGION
I.S .Stepanchikova1, M. Kukwa2, А.А. Notov3, D.E. Himelbrant1
1
Saint-Petersburg State University
Komarov Botanical Institute RAS
2
University of Gdańsk
3
Tver State University
1
The localities of lichen species new and rare for the Tver’ Region are
presented. Some specimens were identified by thin-layer chromatography.
Cetrelia monachorum is reported for the first time for Central Russia. The
record of Ochrolechia androgyna s. str. in Central Russia is for the first time
confirmed by TLC data.
Keywords: lichens, lichen flora, Tver region, new records.
Об авторах:
СТЕПАНЧИКОВА
Ирина
Сергеевна–аспирант
кафедры
ботаники биолого-почвенного факультета, ФГБОУ ВПО «СанктПетербургский государственный университет», 199034, СанктПетербург, Университетская наб., д. 7-9, старший лаборант лаборатории
лихенологии и бриологии УРАН Ботанический институт им. В.Л.
Комарова РАН, e-mail: stepa_ir@mail.ru
КУКВА Мартин–доктор биологических наук, преподаватель,
научный сотрудник, куратор гербария лишайников кафедры таксономии
растений и охраны природы Гданьского университета (Польша), 9 PL80-441, Poland, Gdańsk, Al. Legionów, e-mail: dokmak@ug.edu.pl
НОТОВ Александр Александрович–кандидат биологических
наук, доцент кафедры ботаники, ФГБОУ ВПО «Тверской
государственный университет», 170100, Тверь, ул. Желябова, д. 33,
e-mail: anotov@mail.ru
ГИМЕЛЬБРАНТ Дмитрий Евгеньевич–старший преподаватель
кафедры ботаники биолого-почвенного факультета, ФГБОУ ВПО
«Санкт-Петербургский государственный университет», 199034, СанктПетербург, Университетская наб., д. 7-9, научный сотрудник
лаборатории лихенологии и бриологии УРАН Ботанический институт
им. В.Л. Комарова РАН, e-mail: d_brant@mail.ru
- 142 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20. С. 143-149.
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
УДК 582.29 (470.58)
ВИДЫ ЛИШАЙНИКОВ, ПРЕДЛАГАЕМЫЕ ДЛЯ ВНЕСЕНИЯ
В КРАСНУЮ КНИГУ КУРГАНСКОЙ ОБЛАСТИ
Л.Г. Тарунина1, Д.Е. Гимельбрант2, Н.И. Науменко3
Региональный центр по обеспечению контроля и экологического
мониторинга объекта по хранению и уничтожению химического оружия
по Курганской области
2
Санкт-Петербургский государственный университет
2
Ботанический институт им. В.Л. Комарова БИН РАН
3
Курганский государственный университет
1
На основании анализа гербарных материалов и публикаций для
включения во второе издание Красной книги Курганской обл.
предложены четыре вида лишайников – Heterodermia speciosa, Lobaria
pulmonaria, Nephroma parile и Xanthoparmelia camtschadalis. Приведены
данные о местонахождениях видов, особенностях их экологии, статусе и
рекомендуемых мерах охраны. Все предлагаемые к охране виды впервые
приведены для территории области.
Ключевые слова: Красная книга, лишайники охраняемых территорий,
новые находки, Курганская область.
Введение. Курганская обл. располагается на юге приуральской
части Западно-Сибирской равнины и лежит в пределах лесостепной
области Западной Сибири [2; 14]. Согласно принятой схеме ботаникогеографического районирования [5] на рассматриваемой территории
последовательно с севера на юг расположены подтаежная полоса
бореальной зоны, северная и южная полосы лесостепи (рассматривается
в ранге подзоны степной зоны) и подзона разнотравнодерновиннозлаковых степей (рисунок). Площадь области 71,1 тыс. км2.
Протяженность её с запада на восток 430 км (от 61°58′ до 68°43′ в. д.), с
севера на юг – 290 км (от 54°11′ до 56°50′ с. ш.). Область граничит на
северо-западе со Свердловской, на северо-востоке – с Тюменской, на
западе – с Челябинской областями, на юге – с Кустанайской и СевероКазахстанской областями Республики Казахстан.
Зональный растительный покров представлен колками берёзовоосинового и берёзового леса, окруженными пространствами полей и
залежной растительности на месте практически полностью распаханных
луговых степей. Обширные площади занимают солончаковые и луговосолонцовые сообщества, которые сочетаются с многочисленными

Работа выполнена при поддержке РФФИ (грант № 11-04-00901), Департамента
природных ресурсов и охраны окружающей среды Курганской области и
Государственного Экологического фонда Курганской области
- 143 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
тростниковыми, осоковыми и разнотравными болотами, пресными и
солеными озерами, приуроченными к плоскодонным блюдцевидным и
вытянутым понижениям рельефа. Сфагновые болота редки и невелики
по занимаемой площади; они сосредоточены, главным образом, на
севере рассматриваемой нами территории. На песчаных наносах
олигоцена, приуроченных к пересекающим Курганскую обл. долинам
Тобола и его притоков, сформировались островные лесостепные боры, в
наши дни значительно сократившиеся в результате рубок и лесных
пожаров. На северо-западной оконечности области долина р. Синары,
правого притока реки Исети, вскрывает кристаллические горные
породы, характерные для Зауральского пенеплена (граниты, базальт).
Здесь, близ сел Зырянка и Чернушка Катайского р-на, расположен
единственный в Курганской обл. скальный участок – урочище «Иванов
камень».
Р и с у н о к . Местонахождения редких видов лишайников,
рекомендуемых к внесению в Красную книгу Курганской области,
и границы ботанико-географических зон и подзон Южного Зауралья
[по схемам: 5, 13]:
Бореальная (таежная) зона: А – подтаежная подзона.
Степная зона: В – лесостепная подзона (широтные полосы: В1 – северная лесостепь,
В2 – южная лесостепь); С – разнотравно-дерновиннозлаковая степь.
1 – границы зон и подзон; 2 – граница степи и лесостепи по С.И. Коржинскому [6; 7],
В.И. Баранову [1], И.М. Крашенинникову [10].
Местонахождения редких видов:
(H) – Heterodermia speciosa; (L) – Lobaria pulmonaria;
(N) – Nephroma parile; (X) – Xanthoparmelia camtschadalis
- 144 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Курганская обл. – один из наиболее освоенных регионов
Западной Сибири. Хозяйственная деятельность, ставшая одним из
ведущих экологических факторов, привнесла значительные изменения в
картину распределения растительного покрова, местами привела к
видимым ландшафтным изменениям. В пределах области практически
не осталось нераспаханных степных участков и малонарушенных
лесных сообществ. В связи с этим мы считаем необходимым
предложить для включения в готовящееся второе издание Красной
книги Курганской обл. нескольких видов лишайников, единично
отмеченных
на
территории
области
и
связанных
своим
распространением с наиболее ценными и редкими в регионе
растительными сообществами или ландшафтами. Мы надеемся, что
такая мера позволит не только сохранить эти виды, но и обеспечить
более надежную защиту их уникальных местообитаний, включенных
или рекомендуемых к включению в число особо охраняемых
природных территорий [11].
Материал и методика. Материалами для анализа предлагаемых
к охране видов стали сборы лишайников, выполненные в различных
районах Курганской обл. в ходе экспедиции 2000 г. в составе Д.Е.
Гимельбранта, А.А. Заварзина, Л.Е. Курбатовой и Н.И. Науменко
(гербарий кафедры ботаники Санкт-Петербургского государственного
университета, LECB), а также сборы, сделанные Л.Г. Таруниной в 2009–
2011 гг. в окрестностях г. Кургана и на территории Щучанского р-на
области (гербарий лаборатории биомониторинга и биоиндикации РЦ
СГЭКиМ). Кроме того, проанализированы материалы разных лет,
хранящиеся в гербарии Курганского государственного университета.
Были использованы следующие критерии отбора видов для
внесения в региональную Красную книгу: а) вид относится к числу
редко встречающихся в мире или на территории России (в Курганской
обл. таких видов нами не обнаружено); б) вид связан в своем
распространении с наиболее ценными и редкими в пределах Курганской
обл. растительными сообществами или ландшафтами; в) вид внесен в
Красную книгу РФ [9]. Достаточно соответствия по одному из этих
критериев. Дополнительным критерием может быть редкая
встречаемость вида в пределах Курганской обл. и (или) прохождение
границы его распространения через территорию области. Последний
критерий мы не считаем достаточным для отбора видов, т. к.
объективные и полные данные о распространении и встречаемости
большинства лишайников в Курганской обл., как и во многих регионах
России, отсутствуют. Встречаемость сама по себе не является прямой
оценкой состояния вида и его связи с биологически ценными
местообитаниями в регионе, но зависит от степени изученности и
особенностей его биологии.
Результаты и обсуждение. Согласно имеющимся в нашем
- 145 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
распоряжении
неопубликованным
материалам
и
данным
немногочисленных публикаций с указаниями видового состава
региональной лихенофлоры [3; 4; 12] к настоящему времени для
территории области известно около 120 видов лишайников. Вследствие
слабой выявленности состава лихенофлоры в первое издание Красной
книги Курганской обл. [8] не было внесено ни одного вида лишайников.
Проанализировав имеющиеся данные о лишайнках Курганской обл., мы
установили, что подавляющее большинство зарегистрированных для
этой территории видов не отвечает избранным нами критериям. Многие
виды являются широко распространенными, способны успешно
выживать в условиях умеренно и значительно антропогенно
измененной среды. Необходимость охраны таких видов, с нашей точки
зрения, отсутствует. Вероятно, такой состав выявленной части
лихенофлоры хорошо согласуется с очень высоким уровнем
антропогенных изменений в природной среде региона, который был
достигнут за последние 40–50 лет. Сохранившиеся немногочисленные
фрагменты естественных фитоценозов (степные участки, еловые леса,
приречные скальные обнажения, пойменные леса, боры) крайне малы
по площади, сильно расчленены и удалены друг от друга, а также несут
явные черты антропогенной модификации. Они уже давно не способны
обеспечить сохранение всего характерного и специфичного комплекса
видов лишайников, изначально с ними связанных.
Виды, предлагаемые для внесения в Красную книгу Курганской обл.
Heterodermia speciosa (Wulfen) Trevis. – вид, приуроченный к
малонарушенным лесным скальным местообитаниям, где поселяется во
влажных затененных условиях на мхах поверх скал и стволов старых
деревьев. В Курганской обл. такой комплекс обнаружен только на
территории памятника природы «Иванов камень» (площадь 43 га), где и
выявлено единственное местонахождение вида (всего один экземпляр).
На территории России вид широко распространен. Предлагаемый
статус: 1 (Е) – вид, находящийся под угрозой исчезновения. Меры
охраны: необходим строгий запрет на любые виды лесохозяйственной и
горнодобывающей деятельности, а также строительных работ в
пределах местообитаний вида. Местонахождения: Катайский р-н, к
западу от с. Зырянка, правый берег р. Синара, памятник природы
«Иванов камень», березовый лес, борт небольшого ручья, замшелый
камень, 18.V 2000, Д. Гимельбрант (LECB);
Lobaria pulmonaria (L.) Hoffm. – вид, приуроченный к
малонарушенным зрелым и старовозрастным еловым и смешанным
лесам, а также пойменным лесам, где поселяется на коре старых и
средневозрастных деревьев и на замшелых субстратах в затененных и
более или менее влажных условиях. В области известен из Шатровского
р-на. В России вид широко распространен, но крайне редок в
Курганской обл. Предлагаемый статус: 2 (V) – уязвимый вид. Меры
- 146 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
охраны: строгий запрет на любые виды лесохозяйственной и
горнодобывающей деятельности, а также строительных работ и
прокладки дорог в пределах местообитаний вида. Внесен в Красную
книгу РФ с категорией 2б – уязвимый вид. Местонахождения:
Шатровский р-н, окрестности с. Бединка, памятник природы
«Ирюмские ельники», зеленомошный ельник, на коре ели, 12.V 1991, Н.
Науменко (Гербарий Курганского государственного университета);
Nephroma parile (Ach.) Ach. – вид, приуроченный к
малонарушенным лиственным и смешанным лесам, а также к лесным
скальным местообитаниям, где поселяется в затененных и более или
менее влажных условиях на мхах поверх скал и стволов старых
деревьев, а также непосредственно на каменистых обнажениях и коре
деревьев. Выявлен только в пределах памятника природы «Иванов
камень». На территории России вид широко распространен, но крайне
редок в Курганской обл. Предлагаемый статус: 2 (V) – уязвимый вид.
Меры охраны: необходим строгий запрет на любые виды
лесохозяйственной и горнодобывающей деятельности, а также
строительных
работ
в
пределах
местообитаний
вида.
Местонахождения: Катайский р-н, к западу от с. Зырянка, правый берег
р. Синара, памятник природы «Иванов камень», березовый лес и
приречные скальные обнажения, на замшелых кочках, бортах
небольшого ручья и на камнях, 17–18.V 2000, Д. Гимельбрант (LECB);
Xanthoparmelia camtschadalis (Ach.) Hale – вид, приуроченный к
малонарушенным нераспаханным участкам ковыльно-типчаковых
степей, где поселяется на почве в сухих и открытых местообитаниях.
Широко распространен в степных и лесостепных районах Европейской
России, Южного Урала, Кавказа и Сибири, но очень редок в Курганской
обл., где отмечен лишь на наиболее сохранившихся участках степной
растительности в долине р. Тобол. Предлагаемый статус: 2 (V) –
уязвимый вид. Меры охраны: строгий запрет на любые виды
сельскохозяйственных работ (кроме умеренного выпаса скота),
строительство (включая прокладку дорог) и организацию карьеров,
ограничение рекреационного использования местообитаний вида и
организации палов. Местонахождения: окрестности дер. Заборское
(между деревнями Темляково и Нагорское) в 35 км к югу от г. Курган,
склон холма, на почве на участке слабонарушенной ковыльнотипчаковой степи, 21.V 2000, Д. Гимельбрант (LECB); степной склон
правого высокого берега р. Алабуга между с. Верхняя Алабуга и пос.
Краснознаменка Звериноголовского р-на Курганской обл., 17.V 2011, Н.
Науменко (Гербарий Курганского государственного университета).
Виды, предлагаемые нами для включения в планируемое в
2012 г. второе издание Красной книги обл., в пределах региона, повидимому, являются отдельными, в настоящее время разобщенными
компонентами характерных зональных и интразональных сообществ.
- 147 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Эти фитоценозы в настоящее время во многих районах области сильно
трансформированы. Актуален дальнейший поиск и изучение
малонарушенных биологически ценных сообществ.
Список литературы
1. Баранов В.И. Растительность черноземной полосы Западной Сибири.
Опыт ботанико-географической сводки и районирования // Записки
Зап.-Сиб. отд. РГО. Омск, 1927. Т. 39. С.1–162.
2. Бахарева А.Ф. Почвы Курганской области. Курган: Красный Курган,
1959. 153 с.
3. Завьялова (Тарунина) Л.Г. Об учете лишайников-эпифитов единой
зоны защитных мероприятий объектов по хранению и уничтожению
химоружия // VII Зыряновские чтения: Материалы всерос. научпракт. конф. Курган, 10–11 дек. 2009 г. Курган: Изд-во Курган. гос.
ун-та, 2008. С. 197–198.
4. Завьялова (Тарунина) Л.Г., Максимовских С.Ю. Исследования
лишайников санитарно-защитной зоны объекта уничтожения
химического оружия Щучанского района Курганской области //
Антропогенная трансформация природной среды: Сб. материалов
междунар. конф. Пермь, 2010. Т. 1, ч. 1. С. 299–302.
5. Ильина
И.С.
Основные
географические
закономерности
растительного покрова Западно-Сибирской равнины // Растительный
покров Западно-Сибирской равнины. Новосибирск: Наука, 1985.
С. 8–18.
6. Коржинский С.И. Флора востока Европейской России, в ее
систематических и географических отношениях. I // Изв. Императ.
Томск. ун-та, 1892. № 5. Отд. 2. С. 81–299.
7. Коржинский С.И. Флора востока Европейской России, в ее
систематических и географических отношениях. II // Изв. Императ.
Томск. ун-та, 1893. Кн. 5. С. 71–299.
8. Красная книга Курганской области. Курган: Зауралье, 2002. 424 с.
9. Красная книга Российской Федерации (растения и грибы). М.: КМК,
2008. 855 c.
10. Крашенинников И.М. Физико-географические районы Южного
Урала. Ч. 1. Предгорья восточного склона и прилегающие части
пенепленов. М; Л.: АН СССР, 1939. Вып. 7. 109 с.
11. Науменко Н.И., Зырянов А.В., Огнева Н.А. Особо охраняемые
природные территории Курганской области. Курган: Зауралье, 2001.
150 с.
12. Науменко Н.И., Суханов Д.В. Список растений Южного Зауралья
(Курганская область и сопредельные территории России и
Казахстана). Курган: Изд-во Курган. гос. ун-та, 1999. 36 с.
- 148 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
13. Растительность Западной Сибири. М: 1:1500000. М., 1976.
14. Ступина Н.М. Геоморфология Зауральской лесостепи // Природные
условия и леса лесостепного Зауралья. Свердловск, 1960. С. 5–22.
(Тр. ин-та биологии Уральского филиала АН СССР; Т. 19).
LICHEN SPECIES, PROPOSED
FOR RED DATA BOOK OF KURGAN REGION
L.G. Tarunina1, D.E. Himelbrant2, N.I. Naumenko3
1
Regional Centre for Ecological Control and Monitoring under the Objects
of Storage and Distraction of Chemical Weapons in Kurgan region
2
Saint-Petersburg State University
2
Komarov Botanical Institute RAS
3
Kurgan State University
Four species proposed for Red Data Book of Kurgan region on the base of
reviewing herbarium materials and literature records – Heterodermia
speciosa, Lobaria pulmonaria, Nephroma parile and Xanthoparmelia
camtschadalis. Information on localities, ecology, protection status and
proposed protection measures are given. All mentioned species are firstly
recorded for Kurgan Region.
Keywords: lichens of protected areas, Red Data Book, new records, Kurgan
region.
Об авторах:
ТАРУНИНА
Елена
Геннадьевна–научный
сотрудник
лаборатории биомониторинга, Региональный центр по обеспечению
контроля и экологического мониторинга объекта по хранению и
уничтожению хмимического оружия по Курганской области, 640022,
Курган, ул. Сибирская, д. 8, e-mail: ZavyalovaL2006@yandex.ru
ГИМЕЛЬБРАНТ Дмитрий Евгеньевич старший преподаватель
кафедры ботаники биолого-почвенного факультета ФГОУ ВПО «СанктПетербургский государственный университет», 199034, СанктПетербург, Университетская наб., д. 7-9, научный сотрудник
лаборатории лихенологии и бриологии УРАН «Ботанический институт
им. В.Л. Комарова РАН», e-mail: d_brant@mail.ru
НАУМЕНКО Николай Иванович–доктор биологических наук,
доцент, заведующий кафедрой ботаники и генетики, ГОУ ВПО
«Курганский государственный университет», 640000, Курган, ул.
Гоголя, 25, e-mail: naumenko-nik@yandex.ru
- 149 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20. С. 150-162.
17-22.
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
МЕЖДИСЦИПЛИНАРНЫЕ ИССЛЕДОВАНИЯ
УДК 582.29:543.42
АНАЛИЗ ВОЗДЕЙСТВИЯ НИТРАТА АММОНИЯ
НА ИНДИКАТОРНЫЕ ЛИШАЙНИКИ С ПОМОЩЬЮ
МЕТОДА ФУРЬЕ-ИК СПЕКТРОСКОПИИ
А.Ф. Мейсурова, С.Д. Хижняк, П.М. Пахомов
Тверской государственный университет
С помощью метода Фурье-ИК спектроскопии проанализировано
несколько видов индикаторных лишайников, испытавших воздействие
нитрата аммония (NH4NO3). Установлено, что под влиянием этого
вещества в лишайниках образуются три типа соединений –
алкилнитраты (R–O–NO2), аммонийные соли (R–COONH4) и амины
(R–NH2). Их количественная оценка и изучение морфологических
изменений слоевищ позволили определить уровень чувствительности
исследованных видов лишайников к воздействию NH4NO3.
Ключевые слова: Фурье-ИК спектроскопия, индикаторные виды,
лишайники, поллютант, нитрат аммония, аммиак, азотная кислота.
Введение. Лишайники являются удобным объектом для изучения
динамики состояния окружающей среды. Благодаря особенностям
строения они способны реагировать на загрязнение атмосферы. В ответ
на действие загрязняющих компонентов у лишайников преобразуются
физиолого-биохимические процессы и анатомо-морфологические
особенности. Возможно изменение видового состава и структуры
эпифитных лихеносинузий. Хорошо исследованы реакции лишайников
на такие полютанты как диоксид серы (SO2), озон (O3), фтороводород
(HF) [1]. Сведения о воздействии азотсодержащих соединений
фрагментарны [14]. Азотсодержащие поллютанты разнообразны и
способны вызвать как кислотное (диоксид азота, NO2), так и щелочное
(аммиак, NH3) загрязнения воздуха. Особое внимание заслуживает
нитрат аммония (NH4NO3), который образуется в атмосфере из аэрозоля
азотной кислоты (HNO3) и аммиака (NH3) [6]. Его присутствие в
атмосфере связывают, прежде всего, с развитием сельского хозяйства,
поскольку главный источник аммиака – азотные удобрения, почва, моча
животных. Характер воздействия нитрата аммония на лишайники
изучен не в полной мере [19]. Исследованы особенности поглощения
NH4NO3 в зависимости от температуры и времени экспонирования [16].
Выявлено, что ассимиляция NO3- тормозится ассимиляцией NH4+,

Работа выполнена при поддержке Гранта Президента РФ № 02.120.11.1385-МК от
28.06.2010
- 150 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
поэтому содержание NH4+ в клетках микобионта по сравнению с NO3бывает больше на 50%. Лишайники с сине-зелеными водорослями
поглощают NO3- в среднем на 20% меньше, чем виды, фотобионт
которых представлен зелеными водорослями [21]. Листоватые
лишайники (Hypogymnia physodes (L.) Nyl., Parmelia sulcata Taylor)
адсорбируют аммоний быстрее, чем кустистые виды (Evernia
mesomorpha Nyl.) [16]. Высказано предположение о возможном
превращении большей части поглощенного лишайниками аммиака в
амины [22] или аминокислоты [16].
В связи с этим необходимо дополнительное экспериментальное
изучение реакции лишайников на действие NH4NO3. При его
организации
целесообразно
использовать
метод
Фурье-ИК
спектроскопии. Данный метод активно применяют при исследовании
разных компонентов древесины (целлюлозы, лигнина, гемицеллюлозы)
и их производных [5; 9]. Возможности спектрального анализа
лишайников, в которых обнаружено высокое содержание углеводов
(лихенина [3]), близких по составу к целлюлозе исследованы не в
полной мере. Фурье-ИК спектральный анализ лишайников, испытавших
воздействие NH4NO3, будет способствовать дальнейшему развитию
лихеноиндикационного подхода. Метод позволит идентифицировать
поллютант, оценить изменения в химическом составе лишайников в
условиях
загрязнения,
выяснить
механизм
взаимодействия
экотоксиканта с его компонентами (лихенином), определить
индикаторные способности различных видов лишайников, эффективно
осуществлять
мониторинг
состояния
атмосферы
в
сельскохозяйственных и других районах.
Цель работы – с помощью метода Фурье-ИК спектроскопии
установить характер воздействия NH4NO3 на некоторые индикаторные
виды лишайников.
Материал и методика. В качестве объектов исследования были
выбраны 4 вида лишайников, которые встречаются повсеместно. Эти
лишайники различаются степенью чувствительности к действию
поллютантов. Среди них есть виды среднеустойчивые к загрязнению
(Hypogymnia physodes, Parmelia sulcata), гемерофобные (Evernia
mesomorpha) и гемерофильные (Xanthoria parietina) лишайники [12].
Образцы были собраны в зоне с наименьшим антропогенным
воздействием – в окрестностях деревни Большие Борки (Калининский
р-н Тверской обл.). Лишайники снимали со стволов деревьев острым
скальпелем вместе с тонким слоем субстрата, не нарушая целостности
коры деревьев.
Воздействие NH4NO3 на лишайник в лабораторных условиях
моделировали двумя способами: 1) фумигация (аэрозоль аммиака и
азотной кислоты); 2) искусственный дождь.
В первом случае, влажные образцы лишайников выдерживали в
- 151 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
аэрозоле NH3 и HNO3 в течение 7 дней при комнатной температуре (22–
240С) (табл. 1). При этом образцы (1–4) прикрепляли к внутренней
поверхности крышки эксикатора (V=1л) над 30 мл 1% раствора
NH4NO3. Известно, что в воде NH4NO3 подвергается гидролитической
диссоциации [10] по схеме:
NH4NO3 + H2O  NH4OH + HNO3
(1)
Являясь слабым основанием NH4OH диссоциирует с выделением NH3:

или NH 4 OH  NH 3   H 2 O
(2)
NH 4 OH  NH 4  OH
Раствор кислоты подвергается диссоциации:
HNO3  H+ + NO3(3)
Таблица 1
Схема проведения эксперимента по воздействию NH4NO3 на лишайники
Способ воздействия
Фумигация
(аэрозоль NH3 и HNO3)
Искусственный дождь
Hypogymnia
physodes
Вид
Parmelia
Evernia
Xanthoria
sulcata mesomorpha parietina
1*
2
3
4
5
6
7
8
Примечание. * – № образцов.
Во втором случае (искусственный дождь) – увлажненные
образцы 5–8 ежедневно опрыскивали 1% раствором NH4NO3 в течение
7 дней (табл. 1). В общей сложности за весь период эксперимента было
израсходовано 25–30 мл раствора.
Для контроля образцы каждого вида лишайника выдерживали в пустом
герметично закрытом эксикаторе при комнатной температуре в течение 7 дней.
Для записи ИК спектров прессовали таблетки, приготовленные
из образцов 1–8 (по 24 мг слоевищ) с бромидом калия (0,7 г) по
стандартной методике [11]. Спектры регистрировали на Фурье-ИК
спектрометре «Equinox 55» фирмы «Bruker» в диапазоне 400–4000 см-1,
разрешение составляло 4 см-1, количество сканов – 32. С целью
исключения влияния толщины образца на результаты количественных
расчетов определили отношение Аν/Ас, где Аν и Ас – оптическая
плотность анализируемой полосы поглощения и полосы стандарта
соответственно. В качестве полосы стандарта выбрали полосу,
характеризующую асимметричные валентные колебания CH2-группы с
максимумом ~2925 см-1 [17; 18]. Отношение Аν/А2925 дает представление
об относительном содержании анализируемых функциональных групп и
позволяет оценить динамику этой характеристики при воздействии
поллютанта.
Результаты и обсуждение. Фурье-ИК спектральный анализ
лишайников, испытавших воздействие NH4NO3, позволил установить
- 152 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
основные изменения в химическом составе под действием поллютанта.
ИК спектры образцов индикаторных видов отличаются в зависимости
от способа воздействия экотоксиканта и видовой принадлежности.
Лишайники, экспонированные в аэрозоле NH3 и HNO3,
поглотили поллютанты в результате физико-химического процесса,
происходящего внеклеточно и связанного с компонентами клеточных
стенок гиф. В ИК спектрах образцов 1–4 выявлен ряд новых полос
поглощения, связанных с появлением новых функциональных групп.
Анализируя спектры можно отметить, что основные изменения
происходят с полосами поглощения ОН-групп лихенина (реакции
окисления, этерификации и О-алкилирования – синтеза простых
эфиров). В диапазоне 1375–1410 см-1 для спектров образцов 1–4
зарегистрирована широкая полоса с двумя асимметричными вершинами
(рис. 1). Данная полоса образована частичным наложением двух полос
поглощения, находящихся в близких частотных областях (1340–1410 и
1390–1430 см-1). В ИК спектре образца 1 – это полосы при 1385 νs(-О–
NO2) [17; 18] и 1400 см-1 δ(N-H) [15], 2 – 1376 и 1401 см-1, 3 – 1379 и
1398, 4 – 1384 и 1401. Отнесение полосы при 1385 см-1 к νs(-О–NO2)
уточнено путем сопоставления спектра образца 1 с нашими ранее
полученными данными [7; 18]. Сравнение ИК спектра образца 1 со
спектром лишайника H. physodes, экспонированного в аэрозоле HNO3
подтверждает корректность интерпретации (рис. 2). Сопоставление ИК
спектра образца 1 со спектром хлорида аммония указывает на верное
отнесение полосы при 1400 см-1 к δ(N-H) (рис. 2). Широкая полоса в ИК
спектре соли NH4NO3 в интервале 1367-1426 см-1 свидетельствует о
близком расположении полос поглощения, обусловленных колебаниями
νs(-О–NO2) и δ(N-H).
Появление полос в образцах 1–4 в диапазоне 1375–1410 см-1
указывает на образование в слоевищах двух типов соединений –
алкилнитратов (R–O–NO2) и органических аммонийных солей (R–
COONH4) [15]. Алкилнитраты – это сложные эфиры, которые
образуются в лишайниковом слоевище в результате взаимодействия
HNO3 со свободными ОН-группами лихенина (L):
L 1-OH + OH-NO2 = HOH + L 1-O-NO2
(4)
Процесс образования алкилнитратов связан с окислением OH-групп
лихенина до карбонильных (C=O) и карбоксильных групп (COOH)
[4]. В результате осуществляется детоксикация ядовитого для
лишайников NH3 путем присоединения его к COOH-группе с
образованием аммонийной соли согласно реакции:
R-COOH + NH3 = R-COONH4
(5)
У лишайников, как и у растений, образование аммонийных солей
химическим путем – это один из способов детоксикации NH3. Благодаря
этому в слоевище лишайника ядовитый аммиак не накапливается [1].
- 153 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Р и с . 1 . ИК спектры образцов лишайников из фоновой зоны (1,3,5,7) и испытавших воздействие NH4NO3 (2,4,6,8):
а – Hypogymnia physodes, б – Parmelia sulcata, в – Evernia mesomorpha, г – Xanthoria parietina
по оси ординат – поглощение, отн. ед.; по оси абсцисс – волновое число, см-1
- 154 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Р и с . 2 . ИК спектры образцов Hypogymnia physodes:
1 – из фоновой зоны, 2 – испытавших воздействие HNO3, 3 – NH4NO3; ИК спектры солей: 4 – NH4Cl, 5 – NH4NO3.
по оси ординат – поглощение, отн. ед.; по оси абсцисс – волновое число, см-1.
- 155 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
В спектрах образцов 1–2 (рис. 1), кроме появления полос
связанных с образованием R–O–NO2 и R–COONH4, отмечены изменения
в диапазоне 1580–1610 см-1 (рис. 1). Новая полоса поглощения в этом
диапазоне вызвана δ(NH2+) и может указывать на алифатические амины
(СH3–N<) [15]. Она сильно размыта, перекрывается с полосой ~1625 см1
, образуя широкое плечо на частотах 1602 (1), 1603 (2), 1607 (3) и 1604
(4) см-1. Амины – это ядовитые вещества, которые могут присутствовать
в малых количествах в грибах и растениях [1]. При неблагоприятных
условиях их содержание возрастает, вызывая некроз. Основной путь
синтеза аминов – декарбоксилирование аминокислот. В лишайниках
содержание белков низкое (2–3% от сухой массы вещества), а
изменение в ИК спектрах образцов 1–4, связанное с их образованием
заметное. Можно предположить, что декарбоксилирование аминокислот
– не единственный путь образования аминов в лишайниках.
Поглощенный лишайниками аммиак может превращаться в амины [22].
Возможны следующие варианты образования аминов в лишайниках:
1. Аммонолиз ОН-групп лихенина:
R–OH+NH3 = R–NH2 + H2O
(6)
2. Восстановительное аминирование карбонильных групп
каталитическим гидрированием. В литературе описан механизм этой
реакции, он включает две важные стадии – образование имина и
восстановление имина в амин [1]:
R-COH + NH3RH-C=NH + H2ORH2-C-NH2
CH3(CH2)5CHO + NH3CH3(CH2)6-NH2
(7)
Количественные расчеты спектров образцов 1–4 позволили
выявить отличия в содержании алкилнитратов, аммонийных солей и
аминов в зависимости от видовой принадлежности (табл. 2). Среди
лишайников, выдержанных в аэрозоле NH3 и HNO3 значительное
содержание алкилнитратов и аммонийных солей характерно для H.
physodes (А1385/D2925 – 1,52; А1400/А2925 – 1,18). У E. mesomorpha и P.
sulcata зафиксировано больше аминов. В спектрах образцов 3–4
величина А1604/А2925 выше, чем в остальных образцах 1–2 (1,52 и 1,77
соответственно). Наименьшее содержание алкилнитратов, аммонийных
солей и аминов в образцах X. parietina. В спектре образца 4 величины
А1384/А2925, А1401/А2925 и А1604/А2925 колеблются от 0,9 до 1,00.
В образцах P. sulcata и X. parietina отмечено повышенное
содержания групп С=О (ν(С=О) – при 1735 см-1) и N-H (Амид III – 1252
и 1265 см-1). В образце 2 А1735/А2925 – 1,4, 4 – 0,63. Значение А1252/А2925 в
образцах 2 равно 0,63, 4 – 0,82. С одной стороны, существенное
увеличение содержания групп С=О указывает на интенсивные
окислительные процессы, приводящие к деструкции слоевища. С
другой стороны, действие поллютанта вызывает увеличение содержания
белкового компонента.
- 156 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Таблица 2
Значения отношений Аν /А2925 в ИК спектрах образцов лишайников,
экспонированных в аэрозоле NH3 и HNO3
№
образца
1
2
3
4
Тип соединения
R–COONH4
R–NH2
ν, см-1
1376 1379 1384 1385 1398 1400 1401 1602 1603 1604 1607
–
–
– 1,52 – 1,18 –
1,34
–
–
–
1,32
–
–
–
–
– 1,11
–
1,52
–
–
–
0,97 –
– 1,02 –
–
–
–
–
1,77
–
– 0,90 –
–
– 0,90
–
–
1,00
–
R–O–NO2
Примечание. «–» – нет полосы поглощения в ИК спектре образца лишайника.
ИК спектры образцов 5–8, которые опрыскивали водным
раствором NH4NO3, отличаются от спектров образцов, выдержанных в
аэрозоле NH3
и HNO3. В спектрах образцов 5–8 проявляются
интенсивные полосы поглощения самой соли (NH4NO3), которую
адсорбировал лишайник (рис. 3). В спектрах образцов обнаружены
изменения при 3137, 3027, 1402 δ(N-H), 1378 νs(-О–NO2), 835 и 825 см-1
δ(О–N–O) [15]. Сравнение спектров образцов 5–8 с ИК спектром
NH4NO3 показывает идентичность вышеописанных полос (рис. 3). В
связи с наложением полос поглощения NH4NO3 на спектры
лишайников, сложно оценить какая часть поллютанта прореагировала с
его компонентами. Однако можно констатировать, что большая ее часть
не вступила во взаимодействие с компонентами клеточной стенки гиф
при данных условиях эксперимента. Адсорбированная лишайниками
соль (NH4NO3) могла попасть в значительные по объему межклеточные
пространства, чему имеются достоверные свидетельства в литературе
[20].
По сравнению с экспонированием лишайников в аэрозоле NH3 и
HNO3, методика модельного эксперимента с целью воссоздания
искусственного дождя (опрыскивание водным раствором NH4NO3)
оказывается несовершенной. Даже при многократном опрыскивании
трудно воспроизвести природные условия, когда в течение суток
меняется влажность, температура и т.д. В лабораторных условиях
целесообразно выдерживать лишайники в аэрозолях NH3 и HNO3. При
этом взаимодействие поллютанта с компонентами лишайника
происходит более эффективно.
Изменения в химическом составе лишайников (1–8)
сопровождались морфологическими изменениями. Оказалось, что
лишайники, обработанные водным раствором NH4NO3, повреждены в
меньшей степени, чем образцы, экспонированные в аэрозоле NH3 и
HNO3. У лишайников 1–4 обнаружены ярко выраженные видимые
- 157 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
изменения. Объяснением может быть, во-первых, разное содержание
поллютанта. В газообразной среде NH3 и HNO3 гораздо меньше, чем в
растворе. Действие низких концентраций экотоксикантов для
лишайников, в отличие от растений, более опасно, чем воздействие
высоких [6; 17]. Во-вторых, поглощенный из аэрозоля поллютант (в
первую очередь NH3) реагирует с компонентами лишайника, вызывая
образование ядовитых аминов. У лишайников, которые опрыскивали,
большая
часть
адсорбированного
поллютанта,
по-видимому,
локализуется в межклеточном пространстве и оказывается
изолированым.
Р и с . 3 . ИК спектры образцов Hypogymnia physodes
в диапазонах 3700–2700 (а) и 1850–780 см-1 (б):
1 – из фоновой зоны, 2 – обработанные раствором NH4NO3;
3 – спектр соли NH4NO3
по оси ординат – поглощение, отн. ед.; по оси абсцисс – волновое число, см-1
В предварительных модельных экспериментах по исследованию
влияния HNO3 [18] и NH3 [8] были установлены основные
морфологические изменения в лишайниках. Если под действием
кислоты слоевища лишайников приобретали желтоватый цвет, то
аммиак вызывал ярко выраженную некротическую реакцию. В
результате воздействия NH4NO3 у индикаторных видов лишайников
обнаружены некротические изменения, что подтверждает токсичность
воздействия, прежде всего, аммиака. Степень выраженности
некротических изменений и скорость их проявления зависит от видовой
- 158 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
принадлежности. Среди индикаторных видов в большей степени
повреждены слоевища P. sulcata и E. mesomorpha. При этом сероватозеленые слоевищные лопасти E. mesomorpha становятся коричневобордовыми. Складчатая поверхность приобретает сильный блеск.
Голубовато-серая верхняя поверхность слоевищных лопастей P. sulcata
приобретает коричневую, а серые соредии – бежевую окраску.
Поверхность слоевища – гладкая, блестящая, местами с
микротрещинами. Некротическая реакция у E. mesomorpha и P. sulcata
может быть связана с образованием аминов, которые вызывают
отравление лишайников [1]. В меньшей степени повреждены слоевища
H. physodes. Под воздействием NH4NO3 у гемерофильного вида X.
parietina на наружных участках верхнего корового слоя слоевища в
некоторых местах обнаружены микротрещины.
Анализ изменений в химическом составе, а также скорость
проявления некротической реакции, позволяют уточнить степень
чувствительности лишайников к действию NH4NO3. По степени
чувствительности к действию NH4NO3 индикаторные виды лишайников
образуют следующий ряд, в котором чувствительность увеличивается:
Xanthoria parietina – Hypogymnia physodes – Parmelia sulcata, Evernia
mesomorpha.
Заключение. С помощью метода Фурье-ИК спектроскопии
идентифицированы основные изменения в химическом составе
индикаторных видов лишайников под воздействием NH4NO3. В
лишайниковых слоевищах образуются три типа соединений –
алкилнитраты (R–O–NO2), аммонийные соли (R–COONH4) и ядовитые
амины (R–NH2). Процессы образования алкилнитратов и аммонийных
солей
химически
сопряжены,
поллютант
накапливается
и
взаимодействует со структурными компонентами клеточной стенки
гиф. Наиболее токсично для лишайников воздействие поллютантов
низких концентраций. Некротическую реакцию у лишайников вызывает
в первую аммиак, который может превращаться в ядовитые амины,
вызывая отравление. Наиболее чувствительны к действию NH4NO3
лишайники P. sulcata, E. mesomorpha. Гемерофильный вид X. parietina
проявляют высокую степень устойчивости к воздействию поллютанта.
Сведения об изменениях в химическом составе индикаторных
лишайников в результате воздействия NH4NO3 могут быть
использованы в экологическом мониторинге. В практике оценки
состояния
атмосферы
сельскохозяйственных
районов
важна
интерпретация полос поглощения, ответственных за содержание
алкилнитратов и органических аммонийных солей в лишайниках.
Обнаружение полос поглощения в диапазоне 1375–1410 см-1 в спектрах
образцов
лишайников из сельскохозяйственных районов путем
сопоставления с ИК спектрами экспериментальных образцов позволит
подтвердить загрязнение воздуха аэрозолем аммиака и азотной кислоты,
- 159 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
осуществлять эффективно мониторинг и прогнозирование состояния
атмосферы. Данные спектроскопического анализа об образовании в
лишайниках аминов (R–NH2) интересны с точки зрения методологии
биотестирования. Ядовитые амины, могут вызывать сильную
некротическую реакцию. Их раннее обнаружение в лишайниках
сельскохозяйственных
районов
позволит
проводить
раннюю
диагностику их жизнеспособности, прогнозировать их состояние. В
дальнейшем целесообразно провести оценку состояния атмосферы в
сельскохозяйственных районах. Особую значимость лихеноиндикационные
исследования на основе спектроскопии приобретают при мониторинге
состояния атмосферы в районах свиноводческих комплексов, где
доминирующим поллютантом выступает аммиак, выделяемый из лагун
(прудов-накопителей) и навозохранилищ, при разложении мочи
животных [13].
Список литературы
1. Биохимия растений / под. ред. Л.А. Красильниковой. Ростов н/Д:
Феникс; Харьков: Торсинг, 2004. 224 с.
2. Бязров Л.Г. Лишайники в экологическом мониторинге. М.: Научный
мир, 2002. 336 с.
3. Вайнштейн А.О. О лишайниковых углеводах // Новости сист. низш.
раст. Л.: Наука, 1993. Т. 29. С. 72–83.
4. Гальбрах Л.С. Целлюлоза и ее производные // Соросов. образоват.
журн. 1996. № 11. С. 47–53.
5. Геньш К.В., Колосов П.В., Базарнова Н.Г. Количественный анализ
нитратов целлюлозы методом ИК-Фурье-спектроскопии // Химия
растительного сырья. 2010. № 1. С.63–66.
6. Гольдовская Л.Ф. Химия окружающей среды. М.: Мир, 2005. 296 с.
7. Мейсурова А.Ф., Хижняк С.Д., Пахомов П.М. Спектроскопическое
изучения воздействия окислов азота на слоевище лишайника
Hypogymnia physodes (L.) Nyl. // Экологическая химия. 2007. Т. 16,
вып. 4. С. 27–35.
8. Мейсурова А.Ф., Хижняк С.Д., Пахомов П.М. Характер воздействия
азотсодержащих поллютантов на химический состав Hypogymnia
physodes // Вестник ТвГУ. Сер. Биология и экология. 2010. Вып. 18,
№ 18. С. 130–137.
9. Методы исследования древесины и ее производных / под ред. Н.Г.
Базарновой. Барнаул: Изд-во Алт. гос. ун-та, 2002. 160 с.
10. Неницеску К. Общая химия. М.: Мир, 1968. 816 с.
11. Смит А. Прикладная ИК спектроскопия. М: Мир, 1982. 328 с.
12. Трасс
Х.Х.
Классы
полеотолерантности
лишайников
и
экологический
мониторинг
//
Проблемы
экологического
- 160 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
мониторинга и моделирования экосистем. Л.: Гидрометеоиздат,
1985. Т. 7. С.122–137.
13. Ammonia in the UK – the Highlights. Department for environment, foods
& rural affairs (DEFRA). 2002. 91p.
14. Houck М. Ammoniac saltpeter and tolerance in lichens // Environ. pollut.
2010. Vol. 158, № 5. Р. 1127–1133.
15. Infrared characteristic group frequencies. Tables and Charts / ed. G.
Socrates. London: Jorn Wiley & Sons., 1994. 256 p.
16. Lang G.E, Reiners W.A., Heier R.K. Potential alteration of precipitation
chemistry by epiphytic lichens // Oecologia. 1976. Vol. 25. P. 229–241.
17. Meisurova A.F., Khizhnyak S.D., Pakhomov P.M. IR spectral analysis of
the chemical composition of the lichen Hypogymnia physodes to assess
atmospheric pollution // J. of applied spectroscopy. 2009. Vol. 76, Iss. 3.
P. 420–426.
18. Meysurova A.F., Khizhnyak S.D., Pakhomov P.M. IR spectroscopic study
on indicator species of lichens for detection of nitrogen dioxide in
atmosphere // Book of abstracts: 11th European Meeting on
Environmental Chemistry – EMEC, Portoroz, Slovenia, December 8–11.
Nova Gorica: University, 2010. P. 30.
19. Millbank J.W, Kershaw K.A. Nitrogen metabolism in the lichens / ed. V.
Ahmadjian, M.E Hale. N. Y.: Academic Press, 1973. P. 289–307.
20. Nieboer E., Richardson D.H.S., Tomassini F.D. Mineral uptake and
release by lichens: an overview // Briologist. 1978. Vol. 81, № 2. P. 226–
246.
21. Smith D.C: Studies in the physiology of lichens. 1.1. The effects of
starvation and of ammonia absorption upon the nitrogen content of
Pehigera polydactyla // Ann. Bot. 1960a. Vol. 24. P. 52–62.
22. Smith D.C: Studies in the physiology of lichens. 3.3. Experiments with
dissected discs of Peltigera polydactyla // Ann. Bot. 1960b. Vol. 24. P.
186–199.
EFFECT OF AMMONIUM NITRATE ON INDICATOR LICHENS
STUDIED BY MEANS OF FTIR SPECTROSCOPY
A.F. Meysurova, S.D. Khizhnyak, P.M. Pakhomov
Tver State University
Several kinds of indicator lichens undergone to interaction with ammonium
nitrate (NH4NO3) have been studied by means of FTIR spectroscopy. It has
been established that three types of compounds – alkylnitrate (R–O–NO2),
ammonium salts (R–COONH4) and amines (R–NH2) are formed in lichens
under the influence of this substance. Their qualitative estimation and
investigation of morphological changes in the lichens allow us to define the
sensitivity of the studied species to NH4NO3 treatment.
- 161 -
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Вестник ТвГУ. Серия "Биология и экология". 2011. Выпуск 23. № 20.
Keywords: FTIR-spectroscopy, indicator species, lichen, pollutant, nitrate of
ammonium, ammonia, nitric acid.
Об авторах:
МЕЙСУРОВА Александра Федоровна–кандидат биологических
наук, доцент кафедры ботаники, ФГБОУ ВПО «Тверской
государственный университет», 170100, Тверь, ул. Желябова, 33, e-mail:
alexandrauraz@mail.ru
ХИЖНЯК Светлана Дмитриевна–кадидат химических наук,
заведующая
межфакультетской
учебно-исследовательской
лабораторией спектроскопии Центра коллективного пользования
уникальным оборудованием, ФГБОУ ВПО «Тверской государственный
университет», 170100, Тверь, ул. Желябова, 33, e-mail: sveta_khizhnyak
@mail.ru
ПАХОМОВ Павел Михайлович–доктор химических наук,
профессор кафедры физической химии, ФГБОУ ВПО «Тверской
государственный университет», 170100, Тверь, ул. Желябова, 33,
e-mail: Pavel.Pakhomov@tversu.ru
- 162 -
1/--страниц
Пожаловаться на содержимое документа