close

Вход

Забыли?

вход по аккаунту

?

918.Бюллетень СО РАМН №6 2011

код для вставкиСкачать
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
МЕДИКО-БИОЛОГИЧЕСКИЕ НАУКИ
УДК 616.98:579.835.12
ГЕНЕТИЧЕСКИЕ ДЕТЕРМИНАНТЫ ПРОГНОЗА
ИНФИЦИРОВАНИЯ HELICOBACTER PYLORI
Елизавета Сергеевна АГЕЕВА1, Ольга Владимировна ШТЫГАШЕВА1,
Наталья Владимировна РЯЗАНЦЕВА2, Владимир Николаевич ХАРЬКОВ3,
Вадим Анатольевич СТЕПАНОВ3
1 Хакасский
государственный университет им. Н.Ф. Катанова
665017, г. Абакан, пр. Ленина, 92
2 ГБОУ
ВПО Сибирский государственный медицинский университет Минздравсоцразвития РФ
634050, г. Томск, Московский тракт, 2
3 НИИ
медицинской генетики СО РАМН
634050, г. Томск, Набережная реки Ушайки, 10
Изучено распределение генотипов полиморфных локусов генов С +3953Т IL-1β, IL-1Ra VNTR, –174 G>C
IL-6, –251 T>A IL-8 у коренных и пришлых жителей Республики Хакасия, больных язвенной болезнью и
хроническим гастритом, ассоциированных с Helicobacter pylori. Установлена взаимосвязь между генотипом
АА –251 IL-8 и риском развития язвенной болезни у хакасов. У европеоидов риск развития заболевания ассоциирован с генотипом СС +3953 IL-1β и R2R3 IL-1Ra.
Ключевые слова: полиморфизм генов, иммунный ответ, Helicobacter pylori, язвенная болезнь, хакасы.
На сегодняшний день имеется достаточно
фактов, свидетельствующих о значении генетических факторов макроорганизма в определении особенностей иммунного ответа и, следовательно, восприимчивости/резистентности организма к заболеваниям. Определенный интерес
представляют данные о роли полиморфных вариантов генов интерлейкинов в патогенезе гастродуоденальной патологии (злокачественные
новообразования, хронические воспалительные
заболевания, в том числе инфекционной природы). При этом особое значение придается популяционным особенностям.
В настоящее время накоплены данные о
роли аллельных вариантов ряда генов в патогенезе заболеваний, ассоциированных с Helicobacter pylori (НР). Так, показано, что аллельные
варианты кластера генов IL-1 (IL-1β –511Т, IL1Ra R2R2) связаны с высоким риском развития рака желудка у представителей корейской
популяции, инфицированных НР. В японской
популяции не было выявлено достоверной связи между аллельным вариантом IL-1β –511Т и
риском развития НР-ассоциированного рака желудка [1, 2]. В то же время было установлено,
что у японцев аллель А –251 IL-8 ассоциирован
с прогрессией атрофических изменений в слизистой оболочке желудка у пациентов с НР и
увеличивает риск развития язвенной болезни
и рака желудка [3, 4]. В китайской популяции
риск развития рака желудка связывают с наличием генотипа ТА –251 IL-8 [5]. Z. Gyulai et al.
показали существование зависимости между
носительством генотипа ТТ –251 IL-8 и риском
развития дуоденальной язвы [6]. Возможным
объяснением этому является наличие популяционно-зависимых ассоциаций между аллелями генов и клиническими особенностями инфекционного процесса [2, 7].
При проведении эпидемиологического исследования распространенности язвенной болезни у коренных и пришлых жителей Рес-
Агеева Е.С. – к.м.н., зав. кафедрой фундаментальной медицины и гигиены, е-mail: Ageevaeliz@rambler.ru
Штыгашева О.В. – д.м.н., проф., зав. кафедрой внутренних болезней, e-mail: olgashtygasheva@rambler.ru
Рязанцева Н.В. – д.м.н., проф., зав. кафедрой фундаментальных основ медицины, e-mail: nv_ryazan@mail.ru
Харьков В.Н. – к.б.н., старший научный сотрудник лаборатории эволюционной генетики,
e-mail: vladimir.kharkov@medgenetics.ru
Степанов В.А. – д.б.н., проф., руководитель лаборатории эволюционной генетики,
e-mail: vadim.stepanov@medgenetics.ru
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
5
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Агеева Е.С., Штыгашева О.В., Рязанцева Н.В. и др. Генетические детерминанты прогноза… /c. 5–9
публики Хакасия выявлено, что при высокой
инфицированности НР (95,4 % среди европеоидов и 95,2 % среди хакасов) заболеваемость
язвенной болезнью в двух популяциях, проживающих на территории Хакасии, различалась
(8,1 % у европеоидов и 4,5 % у хакасов) [8]. Установленная взаимосвязь между распространенностью НР и ассоциированностью бактерии
с язвенной болезнью у коренных и пришлых
индивидов свидетельствует о наличии популяционно-наследуемых особенностей, оказывающих, по всей видимости, влияние на характер
взаимодействия микроорганизма и организма
хозяина. В связи с этим интересным является
исследование молекулярно-генетических механизмов, реализация которых влияет на течение
инфекционного процесса.
Целью работы послужило выявление иммуногенетических особенностей, детерминирующих исход инфицирования НР у коренных и
пришлых жителей Хакасии.
МАТЕРИАЛ И МЕТОДЫ
Объект исследования – больные язвенной
болезнью двенадцатиперстной кишки (21 европеоид и 25 хакасов), хроническим гастритом (59
европеоидов и 63 хакаса). Контрольную группу
составили здоровые доноры (60 европеоидов и
63 хакаса). Все обследованные – коренные (хакасы или монголоиды) и пришлые жители Республики Хакасия (русские или европеоиды). В
исследовании приняло участие сопоставимое
количество мужчин и женщин, средний возраст европеоидов был 43,6 года, хакасов – 42,9
года.
Наличие у пациентов НР диагностировали
с использованием четырех методов: морфологического, быстрого уреазного, серологического (определение уровня специфических IgG к
НР в сыворотке крови методом твердофазного
иммуноферментного анализа) и полимеразной
цепной реакции (ПЦР).
Для исследования аллельных полиморфизмов генов ДНК выделяли из венозной крови
методом фенол-хлороформной экстракции.
Амплификацию осуществляли методом ПЦР,
используя структуру следующих праймеров:
F: gttgtcatcagactttgacc и R: ttcagttcatatggaccaga
(С+3953Т IL-1β), F: ctcagcaacactcctat и R: tcctggtctgcaggtaa (IL-1Ra VNTR), F: tgacttcagctttactctttgt и R: ctgattggaaaccttattaag (–174 G>C
IL-6), F: tgttctaacacctgccactctagta и R: ttatgcaccctcatcttttcattat (–251 Т>А IL-8) («Сибэнзим», Новосибирск). Наличие полиморфных вариантов
аллелей формирует сайты для распознавания
6
соответствующей рестриктазой. К амплификатам добавляли смесь для рестрикции, содержащую один из ферментов (при генотипировании
С+3953Т IL-1β – Taq I, –174 G>C IL-6 – SfaNI,
–251 Т>А IL-8 – Mfe I) и BSA-буфер. Температурный режим и время соответствовали приложенной инструкции фирмы-производителя
(«Сибэнзим»). Продукты рестрикции анализировали с помощью электрофореза в 4 % агарозном геле. В качестве маркера размера ДНК
использовали плазмиду pUC19, расщепленную
рестриктазой MspI («Сибэнзим»).
В работе с пациентами опирались на этические принципы, отраженные в Конституции
РФ и Хельсинкской декларации всемирной медицинской ассоциации (2000). У всех пациентов было получено информированное согласие,
подтверждающее их добровольное участие в
исследовании.
Распределение генотипов по исследованным
полиморфным локусам проверяли на соответствие равновесию Харди–Вайнберга с помощью
критерия χ2, расчет проводили в пакете статистических программ GENDIST, разработанным
д.б.н. В.А. Степановым. Сравнение частот аллелей и генотипов проводили с помощью критерия χ2 с поправкой Йетса на непрерывность, анализ ассоциации полиморфизмов с хроническим
гастритом и язвенной болезнью – с помощью
критерия отношения шансов (ОШ).
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
Фактором, замыкающим на себе ключевые
звенья патогенеза НР-персистенции в слизистой оболочке желудка (воспаление, апоптоз, гипохлоргидрия), является IL-1β. Выраженность
эффектов интерлейкина зависит от уровня экспрессии как самого продукта, так и антагониста
рецептора интерлейкина IL-1Ra. В результате
проведенного нами исследования установлено,
что среди хакасов наиболее распространен низкопродуцирующий генотип СС +3953 IL-1β (см.
таблицу). У больных язвенной болезнью количество гомозигот СС было выше, чем у пациентов с хроническим гастритом и в группе контроля (р < 0,05). Гетерозиготы СТ встречались
чаще у пациентов с хроническим гастритом по
сравнению с больными язвенной болезнью и
здоровыми донорами (р < 0,05). Гомозиготы ТТ
(для которых характерен низкий уровень продукции IL-1β) в нашем исследовании являлись
редким генотипом (см. таблицу).
У европеоидов доминирующим генотипом
также являлся СС +3953 IL-1β, доля которого
была выше у больных хроническим гастритом
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Агеева Е.С., Штыгашева О.В., Рязанцева Н.В. и др. Генетические детерминанты прогноза… /c. 5–9
Таблица
Распределение частот генотипов (%) у европеоидов и хакасов, носителей Helicobacter pylori,
больных хроническим гастритом и язвенной болезнью
Хакасы
Полиморфизм генов
С +3953Т
IL-1β
ХГ
ЯБ
73,2
25,2
1,6
0,22, > 0,05 4
2,9
0,0
0,0
6,8
10,7
79,6
37,88, > 0,05 4
63,5
36,5
0,0
0,24, > 0,05 4
1,7
0,0
1,7
7,0
14,0
75,4
0,77, > 0,05 4
84,0 2
16,0 2
0,0
2,91, > 0,05 4
0,0
0,0
0,0
4,0
20,01
76,0
34,49, < 0,05
45,6 3
33,3
21,1 3
2,39, > 0,05 4
5,1
2,9
19,1
11,6
27,4 3
33,9 3
2,81, > 0,05 4
58,9 1
24,8
16,3
2,39, > 0,05 4
9,5 3
12,2 1
14,3 3
9,7
21,8
32,5 3
2,70, > 0,05 4
GG
GC
CC
70,0
27,1
2,9
0,05, > 0,05 4
75,0
25,0
0,0
0,25, > 0,05 4
73,9
21,7
4,4
1,12, > 0,05 4
38,8 3
49,6 3
11,6 3
0,29, > 0,05 4
36,2 3
28,9 3
3
47,1
52,7 3
16,7
18,4 3
4
0,002, > 0,05
0,02, > 0,05 4
ТТ
ТА
АА
42,8
44,4
12,8
0,07, > 0,05 4
45,4
43,7
10,9
9,06, < 0,05
44,8
24,1 1,2
31,0 1,2
0,00, > 0,05 4
36,1
45,8
18,1
0,02, > 0,05 4
34,4
46,8
18,8
0,89, > 0,05 4
СС
СТ
ТТ
R2R2
R2R3
R2R4
R3R3
R3R4
R4R4
χ², р
–174 G>C
IL-6
χ², р
–251 Т>А
IL-8
χ², р
Европеоиды
Больные
ХГ
ЯБ
Здоровые
доноры
χ², р
IL-1Ra
VNTR
Больные
Здоровые
доноры
70,6 1, 3
17,6 1
11,8
7,84, < 0,05
12,4
18,1 1
21,7
17,4 3
11,5 1,2
18,9 1,2,3
6,26, > 0,05 4
26,1 3
56,6 3
17,3 3
2,84, > 0,05 4
П р и м е ч а н и е . Достоверное (p < 0,05) отличие от величины соответствующего показателя: 1 – здоровых доноров,
– пациентов с хроническим гастритом, 3 − хакасов; 4 – распределение частот генотипов, соответствующее закону Харди–Вайнберга. ХГ – хронический гастрит, ЯБ – язвенная болезнь.
2
и язвенной болезнью по сравнению с контролем
(см. таблицу). Анализ показал, что у европеоидов риск развития язвенной болезни ассоциирован с генотипом СС +3953 IL-1β (ОШ = 2,9, 95 %
доверительный интервал ДИ 1,6–5,6). В отношении гетерозигот СТ +3953 IL-1β и гомозигот ТТ
+3953 IL-1β у европеоидов отмечалось снижение показателей по сравнению с контролем (см.
таблицу). У пациентов с язвенной болезнью генотипы СТ и ТТ +3953 IL-1β встречались реже,
чем у пациентов с хроническим гастритом и в
группе контроля (р < 0,05).
При межпопуляционном сравнении распространенности генотипов у здоровых коренных
и пришлых жителей обнаружено, что гомозиготы СС +3953 IL-1β чаще встречаются у хакасов,
чем у европеоидов, в то время как гомозиготы
ТТ +3953 IL-1β − напротив, существенно реже.
При изучении полиморфизма гена IL-1Rа
установлено, что во всех обследованных группах доминирует генотип R4R4 IL-1Rа, при этом
у хакасов его встречаемость в несколько раз
выше, чем у европеоидов. Вторым по частоте
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
являлся генотип R3R4 IL-1Rа, доля которого
была наибольшей у хакасов, больных язвенной
болезнью (р < 0,05). Редкими генотипами у хакасов были гомозиготы R3R3 и R2R2, а также
гетерозиготы R2R4 IL-1Ra (см. таблицу). У европеоидов, страдающих язвенной болезнью и
хроническим гастритом, встречаемость R2R2
и R2R3 IL-1Ra была выше, чем в контроле и
в аналогичных группах хакасов (см. таблицу).
Следует отметить, что у европеоидов выявлена
ассоциативная взаимосвязь между генотипом
R2R3 IL-1Ra и риском развития язвенной болезни (ОШ = 7,1, 95% ДИ 1,9–31,4).
IL-6, ключевой медиатор Th2-пути, относится к цитокинам «первого уровня», которые
секретируются в ответ на антигенную стимуляцию НР. IL-6 способствует переключению
синтеза IgM на IgG, являясь фактором дифференцировки В-клеток. Распределение генотипов –174 G>C IL-6 среди хакасов показало, что
наиболее частыми были гомозиготы GG –174
G>C (см. таблицу). Доля гетерозигот GС 174
G>C IL-6 у больных была ниже, чем в контро7
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Агеева Е.С., Штыгашева О.В., Рязанцева Н.В. и др. Генетические детерминанты прогноза… /c. 5–9
ле, но различия не являлись достоверными. Генотип СС у хакасов встречался наиболее редко;
при хроническом гастрите в пределах нашего
исследования он выявлен не был.
При сравнении частоты распределения полиморфных вариантов –174 G>C IL-6 среди
европеоидов – пациентов с хроническим гастритом и язвенной болезнью – достоверных
различий по сравнению с контролем выявлено
не было. При этом распределение между генотипами у коренных и пришлых жителей имело
существенные различия (см. таблицу).
Известно, что для дифференцировки и рекрутирования клеток-эффекторов в очаг НР-ассоциированного воспаления необходим IL-8
[9]. При оценке распределения полиморфизма Т
– 251 А гена IL-8 во всех обследованных группах пациентов также обнаружены различия
встречаемости генотипов (см. таблицу).
Среди хакасов самым частым как в группе
больных, так и в группе здоровых людей являлся ТТ –251 IL-8. Доля ТА –251 IL-8 оказалась
существенно сниженной у больных язвенной
болезнью, относящихся к хакасской популяции. Частота встречаемости генотипа АА –251
IL-8 была выше у больных язвенной болезнью,
чем у пациентов с хроническим гастритом и в
контрольной группе (р < 0,05). Между генотипом АА –251 IL-8 и риском развития язвенной
болезни была выявлена взаимосвязь (ОШ = 3,1,
95 % ДИ 1,4–6,6). Необходимо отметить, что
уровень интерлейкинов зависит не только от
полиморфизма генов, но и от генотипа микроорганизма. В частности, известно, что наиболее высокое содержание IL-8 определяется при
инфицировании CagA-штаммами НР [10, 11]. В
этой связи интересным, на наш взгляд, является
обнаруженная взаимосвязь между CagA-генотипом НР и ассоциацией высокоэкспрессирующего генотипа АА –251 IL-8 с риском развития
язвенной болезни у хакасов [8].
В группе европеоидов – пациентов с хроническим гастритом – не было выявлено статистически значимых различий в распределении
гомозиготных и гетерозиготных генотипов по
сравнению с контролем (см. таблицу). В то же
время у пациентов с язвенной болезнью доля
гетерозигот ТА –251 IL-8 была выше, а ТТ –251
IL-8 – ниже, чем в контрольной группе. Частота
генотипа АА –251 IL-8 у больных язвенной болезнью – пришлых жителей – не имела достоверных различий с контролем (см. таблицу).
Интересно отметить, что при язвенной болезни у пациентов европеоидной популяции
генотип ТТ –251 IL-8 встречался сравнительно
реже, чем у хакасов (см. таблицу), в то время
8
как генотип ТА –251 IL-8 − напротив, достоверно чаще (р < 0,05). В отношении генотипа
АА –251 IL-8 происходила инверсия признака:
у хакасов чаще определялся генотип АА –251
IL-8 по сравнению с контролем, у европеоидов – реже.
ЗАКЛЮЧЕНИЕ
Проведенное исследование позволило выявить, что у хакасов, инфицированных НР, гомозиготный генотип АА полиморфного локуса
гена IL-8 в позиции –251 ассоциирован с риском
развития язвенной болезни (OR = 3,1, 95 % ДИ
1,4–6,6). Среди хакасов наиболее распространены варианты СС +3953 IL-1β и R4R4 IL-1Ra,
которые не характеризуются высоким уровнем
экспрессии соответствующих интерлейкинов.
Вероятно, именно эта особенность обеспечивает мягкий провоспалительный эффект у хакасов – носителей НР, отличающихся меньшим
риском развития язвенной болезни. Следовательно, комбинация генотипов СС +3954 IL-1β и
R4R4 IL-1Ra у хакасов может определять более
высокий уровень защиты от НР-ассоциированной патологии, чем у европеоидов. У европеоидов риск развития язвенной болезни ассоциирован с генотипом СС +3953 IL-1β (ОШ = 2,9,
95 % ДИ 1,6–5,6) и R2R3 IL-1Ra (OR = 7,1, 95 %
CI 1,9–31,4).
СПИСОК ЛИТЕРАТУРЫ
1. Hollegaard M.V., Bidwell J.L. Cytokine gene
polymorphism in human disease: on-line databases,
suppl. 3 // Genes Immun. 2006. 7. (4). 269–276.
2. Matsukura N., Yamada S., Kato S. et al. Genetic differences in interleukin-1β polymorphisms
among four Asian populations: an analysis of the
Asian paradox between H. pylori infection and gastric cancer incidence // J. Exp. Clin. Cancer Res.
2003. 22. 47–55.
3. Ohyauchi M., Imatani A., Yonechi M. et al.
The polymorphism interleukin 8 –251 A/T influences
the susceptibility of Helicobacter pylori related gastric disease in the Japanese population // Gut. 2005.
54. 330–335.
4. Taguchi A., Ohmia N., Shirai K. et al. Interkeukin-8 promoter polymorphism increases the risk
of atrophic gastritis and gastric cancer in Japan //
Cancer Epidemiol. Biomarkers Prev. 2005. 14. 2487–
2493.
5. Lu W., Pan K., Zhang L. et al. Genetic polymorphisms of interleukin (IL)-1B, IL-1RN, IL-8, IL10 and tumor necrosis factor α and risk of genetic
cancer in a Chinese population // Carcinogenesis.
2005. 26. 631–636.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Агеева Е.С., Штыгашева О.В., Рязанцева Н.В. и др. Генетические детерминанты прогноза… /c. 5–9
6. Gyulai Z., Klausz G., Tiszai A. et al. Genetic
polymorphism of interleukin-8 (IL-8) is associated
with Helicobacter pylori-induced duodenal ulcer //
Eur. Cytokine Netw. 2004. 15. (4). 353–358.
7. Chang Y.W., Jang Y., Kim N.H. et al. Interleukin-1B (IL-1B) polymorphisms and gastric mucosal
levels of IL-1β cytokine in Korean patients with gastric cancer // Int. J. Cancer. 2005. 114. 465–471.
8. Штыгашева О.В., Цуканов В.В. Ассоциация саgA и vacA штаммов Helicobacter pylori и
язвенной болезни в организованной популяции
г. Абакана // Рос. журн. гастроэнтерологии, гепатологии и колопроктологии. 2004. (2). 84–87.
Shtygasheva O.V., Tsukanov V.V. Association between саgA and vacA strains of Helicobacter pylori
and ulcer disease in Abakan organized population //
Ros. zhurn. gastroenterologii, gepatologii i koloproktologii. 2004. (2). 84–87.
9. Кононов А.В. Воспаление как основа Helicobacter pylori-ассоциированных болезней // Архив патологии. 2006. 68. (5). 3–10.
Kononov A.V. Inflammation as the basis of Helicobacter pylori associated diseases // Arkhiv patologii. 2006. 68. (5). 3–10.
10. Peek R.M., Moss F., Tham K.T. et al. Helicobacter pylori cagA+ strains and dissociation of gastric epithelial cell proliferation from apoptosis // J.
Natl. Cancer Inst. 1997. 89. (12). 863–868.
11. Rieder G., Einsiedl W., Hatz R.A. et al. Comparison of CXC chemokines ENA-78 and interleukin-8 expression in Helicobacter pylori-associated
gastritis // Infect. Immunity. 2001. 69. 81–88.
GENETIC DETERMINANTS OF PROGNOSIS FOR
HELICOBACTER PYLORI INFECTION
Elizaveta Sergeevna AGEEVA1, Olga Vladimirovna SHTYGASHEVA1,
Nathalia Vladimirovna RAYAZANTSEVA2, Vladimir Nikolaevich KHAR`KOV3,
Vadim Anatolyevich STEPANOV3
1 Khakas
State University named after N.F. Katanov
665017, Abakan, Lenin av., 92
2 Siberian
State Medical University
634050, Tomsk, Moskovsky tract, 2
3 Institute
of Medical Genetics SB RAMS
634050, Tomsk, Embankment of the river Ushaika, 10
Distribution of genotypes of С +3953Т IL-1β, IL-1Ra VNTR, -174 G>C IL-6, -251 T>A IL-8 has been studied in
patients with ulcer disease and chronic gastritis associated with Helicobacter pylori at Mongoloids and Caucasians
of Khakassia. The correlation between homozygous variant АА of the IL-8 gene in position -251 and risk of ulcer
disease development in Khakas population has been established. The risk of the disease development was associated
with СС +3953 IL-1β and R2R3 IL-1Ra at Caucasians.
Key words: gene polymorphisms, immune response, Helicobacter pylori, ulcer disease, Khakas.
Ageeva E.S. – candidate of medical sciences, head of the chair for fundamental medicine and hygiene,
e-mail: Ageevaeliz@rambler.ru
Shtygasheva O.V. – doctor of medical sciences, professor, head of the chair for internal medicine,
e-mail: olgashtygasheva@rambler.ru
Rayazantseva N.V. – doctor of medical sciences, professor, head of the chair for fundamental basis of medicine,
e-mail: nv_ryazan@mail.ru
Khar`kov V.N. – candidate of biological sciences, senior researcher of laboratory of evolutionary genetics,
of e-mail: vladimir.kharkov@medgenetics.ru
Stepanov V.A. – doctor of biological sciences, professor, head of laboratory of evolutionary genetics,
e-mail: vadim.stepanov@medgenetics.ru
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
9
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК 616.72-007.17-08-036.838:615.83
ВЛИЯНИЕ МАЛЫХ ДОЗ ИОНИЗИРУЮЩЕГО ИЗЛУЧЕНИЯ НА ХРОМОСОМНЫЕ
АБЕРРАЦИИ И УРОВЕНЬ АНТИНУКЛЕАРНЫХ АНТИТЕЛ В КЛЕТКАХ
СИНОВИИ У БОЛЬНЫХ С ПОСТТРАВМАТИЧЕСКИМ ОСТЕОАРТРОЗОМ
Евгений Юрьевич УДАРЦЕВ1, Николай Николаевич ИЛЬИНСКИХ2,
Екатерина Николаевна ИЛЬИНСКИХ2
1 Санаторий
«Алтай-WEST»
659900, г. Белокуриха, ул. Славского, 39
2 ГБОУ
ВПО Сибирский государственный медицинский университет Минздравсоцразвития РФ
634050 г. Томск, Московский тракт, 2
В настоящем исследовании представлены данные хромосомного анализа и определения уровня антинуклеарных антител к клеткам синовии у 28 больных в возрасте 35–50 лет с посттравматическим остеоартрозом
коленных суставов. Было установлено, что в синовии больных посттравматическим остеоартрозом возрастает – в зависимости от титра антинуклеарных антител – на 80,6–84,4 % количество клеток с цитогенетическими нарушениями в виде различных хромосомных аберраций с прямо пропорциональной связью между
этими показателями, что подтверждает непосредственное влияние антинуклеарных антител на изменения
ядерного аппарата синовиоцитов. После проведения радонотерапии в эквивалентной дозе альфа-излучения
280 мкЗв зафиксировано снижение на 50–75 % титра антинуклеарных антител к клеткам синовии, уменьшение на 48,9 % количества хромосомных аберраций синовиоцитов и числа аномалий в их ядерном аппарате.
Ключевые слова: посттравматический остеоартроз, синовиоциты, ионизирующее излучение, хромосомные аберрации, антинуклеарные антитела.
Воспалительный процесс, сопровождающий
развитие посттравматического остеоартроза
(ПТОА), приводит к существенному изменению
состава клеток синовии [1, 2]. В лечении этого
заболевания широко используется радонотерапия, спецификой терапевтического эффекта которой является ионизирующее альфа-излучение
дочерних продуктов радона – радия А, В, С, С1.
Одним из обоснований к применению радонотерапии при лечении ПТОА считается ее способность стимулировать репаративные процессы в
синовии, что в конечном итоге, по-видимому,
оказывает лечебный эффект при остеоартрозах
[3−5]. Однако данные о влиянии радонотерапии
на морфофункциональное состояние клеток синовиальной среды сустава получены визуально,
без морфометрии и без привлечения компьютерных методов анализа этих клеток. Практически отсутствуют также данные по цитологическому количественному изучению ядерного
аппарата синовиоцитов, изменения в котором
может свидетельствовать о внутриклеточных
процессах на уровне генетических структур. В
исследованиях, проведенных нами ранее, было
установлено, что под влиянием малых доз ионизирующего излучения у больных с посттравматическими остеоартрозами существенно изменяется морфология ядерного аппарата клеток
синовии, что мы связывали с их полиплоидизацией и, возможно, с изменением активности
апоптотических процессов и ДНК-репарации
[6]. Также имеются данные о том, что при некоторых заболеваниях суставов наблюдается
повышенный уровень клеток с нарушениями
в числе и структуре хромосом, что коррелируют с увеличением содержания антинуклеарных
антител в сыворотке крови больных [7−9]. Так
как для ряда дегенеративно-дистрофических
заболеваний суставов характерно возрастание
концентрации антинуклеарных антител [10−13],
закономерно предположить, что их проникновение в ядра клеток синовии обусловливает наблюдаемые нами при посттравматических остеоартрозах изменения ядерного аппарата, что
способствует появлению различных аномалий
ядра синовиоцитов. Данные такого рода могут
Ударцев Е.Ю. – к.м.н., врач-ортопед-травматолог, e-mail: orthoped2@yandex.ru
Ильинских Н.Н. – д.б.н., проф., зав. кафедрой биологии и генетики, e-mail: nauka-tomsk@yandex.ru
Ильинских Е.Н. – д.м.н., проф. кафедры инфекционных болезней, e-mail: nauka-tomsk@yandex.ru
10
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Ударцев Е.Ю., Ильинских Н.Н., Ильинских Е.Н. Влияние малых доз ионизирующего излучения… /c. 10–16
представлять особое значение при постановке
точного диагноза, степени изменений синовия
и эффективности терапии остеоартрита.
Цель исследования − изучить влияние малых доз ионизирующего альфа-излучения на
уровень антинуклеарных антител и хромосомные аберрации в клетках синовии больных
пост травматическим остеоартрозом.
МАТЕРИАЛ И МЕТОДЫ
Под наблюдением находилось 28 больных
в возрасте 31–58 лет с посттравматическим остеоартрозом коленных суставов I–II стадии по
классификации Келлгрена − Лоуренса. Больных
для исследования отбирали методом сплошной
выборки при добровольном письменном согласии в соответствии с решением Департамента
государственной аттестации научных и научно-практических работников Минобразования
России «О порядке проведения биомедицинских исследований у человека» (2002 г.) и «Правилами клинической практики» (Приказ МЗ РФ
№ 266 от 19.06.03). Исследование одобрено Этическим комитетом Алтайского государственного медицинского университета (протокол № 26
от 30.04.08).
Пациентам назначали общие радоновые ванны с концентрацией радона 0,19 кБк/л, температурой 36 °С, экспозицией 15 минут, на курс 14
процедур, эквивалентная доза α-излучения за
курс составила 280 мкЗв.
Синовиальную жидкость получали пункцией коленного сустава в объеме 0,1–0,2 мл до лечения при поступлении больного в санаторий и
через 3 недели (по окончании лечения). Культивирование синовиоцитов проводили по методу
P.S. Moorhead et al. [14] с некоторыми модификациями. Культуры инкубировали в термостате
при 37 °С в течение 48–55 часов. За 3 часа до
приготовления препаратов во флаконы с культурами синовиоцитов вводили колхицин в конечной концентрации 0,5 мкг на 1 мл среды. Гипотоническую обработку 0,56 % раствором KCl
производили в течение 6 минут. Фиксировали
клетки в трех сменах смеси ледяной уксусной
кислоты с метанолом (1 : 3). В последней смене
фиксатора оставляли 0,5 мл надосадочной жидкости, в которой тщательно ресуспендировали
клетки, наносили по 1–2 капли на охлажденные
предметные стекла, высушивали. Через 1–2 недели хранения препаратов проводили дифференциальное окрашивание хромосом, используя технику G-окраски. Препараты помещали в
0,025 % раствор трипсина, подогретый до 37 °С,
на 1–2 минуты, ополаскивали в 2xSSC (стандартном солевом растворе), в трех сменах этиБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
лового спирта (70o, 96o, 100o), наносили краситель Романовского − Гимзы, разведенный 1 : 50
фосфатным буфером Зеренсена (рН 6,8) в течение 5–15 минут. Изучение хромосом проводили
при увеличении 10 × 90, используя микроскоп
Reichert NP-1640 (Австрия). Для анализа отбирали метафразы с учетом предложений [15].
Для идентификации хромосом человека использовали систему классификации хромосом,
принятую в 1971 году на Парижской конференции по цитогенетике человека [16]. У каждого
человека изучено не менее 100 метафаз, при
использовании микроядерного теста – 3000 клеток, при использовании компьютерного метода − 250–300 интерфазных клеток. Кроме того,
визуально на препаратах просматривали у каждого больного в каждом случае (до и после лечения) не менее 10 000 клеток, отмечая особенности морфологии ядра, наличие апоптотически измененных клеток, митозов, патологически
измененных делящихся клеток согласно критериям, представленным нами ранее [11].
Из структурных нарушений хромосом учитывали хроматидные и хромосомные разрывы,
ацентрические одиночные и парные фрагменты
и обмены. Критерием отличия разрыва от пробела считали обязательное его смещение, а не
расстояние неокрашенного участка, поскольку
длина пробела может варьировать. Кроме того,
учитывали аномалии в числе хромосом: отмечали анеуплоидные (гипо- и гиперплоидные) и
полиплоидные клетки, а также частоту ассоциаций ядрышкообразующих хромосом.
Активность эксцизионной ДНК-репарации
оценивали по методу Г.Д. Засухиной [17]. Репаративный синтез, индуцированный 4-нитрохинолин-1-оксидом, определяли с помощью метода сцинтилляционной радиометрии по включению Н3-тимидина в общую массу клеток при
подавлении репликативного синтеза ДНК гидроксимочевиной (10 мкмоль/мл). Для индукции
репаративного синтеза использовали 4-нитрохинолин-1-оксид в концентрации 2,5·10-6 М при
экспозиции 30 мин. Н3-тимидин (10 мкКи/мл)
добавляли сразу после обработки мутагенами
и инкубировали 2 часа в среде роста. Клетки промывали и определенное их количество
осаждали на миллипоровые фильтры (диаметр
пор 0,3 мкм) в 5 % трихлоруксусной кислоте.
Радиоактивность просчитывали в толуольном
сцинтилляторе на счетчике Mark III (США). Об
интенсивности репаративного синтеза судили
по величине индекса стимуляции, представляющего собой соотношение радиоактивности в обработанных мутагеном и контрольных клетках.
11
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Ударцев Е.Ю., Ильинских Н.Н., Ильинских Е.Н. Влияние малых доз ионизирующего излучения… /c. 10–16
Антитела к ядерной ДНК (ANA) в сыворотке крови обнаруживали с помощью реакции
связывания комплемента по методу и при использовании тестовых систем, разработанных
Lahey Hitchcock Medical Center (США). В зависимости от уровня антител всех обследованных
больных разделяли на 3 группы: больные 1-й
группы имели титр антител 1 : 80 и менее, 2-й –
1 : 160−1 : 320, 3-й − более 1 : 320.
Все количественные показатели исследования обрабатывали статистически с применением t-критерия Стъюдента для независимых выборок, поскольку тестирование закона распределения при помощи критерия Колмогорова–
Смирнова не выявило отличий от нормального,
и представляли в виде X ± m, где X − выборочное среднее арифметическое, m – ошибка среднего арифметического. Анализ статистических
различий качественных признаков производили с использованием теста χ2 с поправкой Йейтса на непрерывность. Различия сравниваемых
показателей считали достоверными при уровне
значимости p < 0,05.
Критерий χ2 употребляли для сравнения эмпирического распределения частоты хроматидных и хромосомных разрывов и анеуплоидии
по группам хромосом и по отдельным хромосомам набора с ожидаемым теоретическим распределением цитогенетических нарушений по
группам хромосом и отдельным хромосомам.
При этом предполагалась равная вероятность
моносомий или трисомий для любой хромосомы генома, а также равная вероятность индукции повреждения для любого участка у любой
хромосомы набора, т. е. пропорционально ее
длине. Корреляционный анализ проведен с использованием коэффициента корреляции Пирсона r.
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
Установлено, что у больных с ПТОА увеличена – в зависимости от уровня антинуклеарных антител – частота клеток синовии с цитогенетическими нарушениями (табл. 1).
Таблица 1
Частота клеток с цитогенетическими нарушениями в культурах синовиоцитов у больных ПТОА
коленных суставов и титра антинуклеарных антител в синовии до и после радонотерапии
Регистрируемый
показатель
Число клеток со структурными нарушениями
хромосом
Число хромосом с нарушениями
В том числе:
хромосомные
разрывы
хроматидные разрывы
обмены
прочие
Число клеток с
измененным числом
хромосом
В том числе:
гипоплоидных
гиперплоидных
полиплоидных
Всего клеток с цитогенетическими нарушениями
До лечения После лечеДо лечения После лечения До лечения
После лечения
(титр анти- ния (титр
(титр антител (титр антител (титр антител (титр антител
тел 1:80 и
антител
1:160–1:320) ниже 1:160) 1:320 и выше)
ниже 1:160)
ниже)
ниже 1:80)
3,5 ± 0,4
2,9 ± 0,4
21,6 ± 1,5
18,5 ± 1,6
29,6 ± 0,9
15,8 ± 2,2*
3,9 ± 0,4
3,3 ± 0,4
27,5 ± 2,1
20,8 ± 1,2
34,1 ± 2,2
17,2 ± 2,4*
0,3 ± 0,2
0,2 ± 0,2
2,6 ± 0,8
1,6 ± 0,4
3,9 ± 0,7
1,2 ± 0,3**
2,5 ± 0,3
0,3 ± 0,2
0,8 ± 0,2
4,6 ± 0,7
2,4 ± 0,4
0,1 ± 0,1
0,6 ± 0,2
4,2 ± 0,6
19,1 ± 1,6
1,4 ± 0,6
4,3 ± 1,0
14,3 ± 0,9
14,1 ± 1,5
1,1 ± 0,4
4,0 ± 0,9
7,5 ± 0,8*
22,3 ± 1,7
2,4 ± 0,4
5,8 ± 1,2
17,1 ± 1,5
12,7 ± 2,1*
1,9 ± 0,5
1,4 ± 0,5*
5,8 ± 0,8*
4,2 ± 0,6
0,3 ± 0,2
0,1 ± 0,08
4,0 ± 0,5
0,1 ± 0,1
0,1 ± 0,1
9,1 ± 1,0
1,4 ± 0,6
3,4 ± 0,5
4,1 ± 0,8*
0,8 ± 0,6
2,6 ± 0,5
11,1 ± 1,1
3,0 ± 0,7
3,0 ± 0,8
2,7 ± 0,5*
1,4 ± 0,5
1,7 ± 0,2**
6,6 ± 0,7
5,9 ± 0,6
34,1 ± 2,8
26,0 ± 2,9
42,3 ± 1,9
21,6 ± 2,6*
П р и м е ч а н и е . Отличие от величины соответствующего показателя у пациентов 1-й группы статистически значимо: *− при р < 0,01, ** − при р < 0,05.
12
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Ударцев Е.Ю., Ильинских Н.Н., Ильинских Е.Н. Влияние малых доз ионизирующего излучения… /c. 10–16
У больных 3-й группы отмечена наиболь- емой хромосомы 2 свидетельствует о том, что
шая частота клеток с цитогенетическими нару- большая часть наблюдаемых аберраций сосрешениями, при этом наблюдались изменения как доточена в теломерных районах длинных плеч
структуры, так и числа хромосом. Встречае- в зоне q31 и особенно q37, а также q11, при этом
мость клеток с цитогенетическими нарушения- сниженная частота аберраций была отмечена
ми в синовии пациентов 2-й группы также была для короткого плеча этой хромосомы. Обращазначимо выше, чем у больных 1-й группы. Кор- ет на себя внимание то, что в длинном плече
реляционный анализ полученных результатов большая часть разрывов приходилась на гранипозволил установить наличие прямо пропорци- цу между деконденсированной и конденсироональной зависимости (r = 0,82, p < 0,01) между ванной плотно окрашенной зонами хромосом.
частотой клеток синовии с цитогенетическими При титре антинуклеарных антител менее 1 : 80
нарушениями и содержанием антинуклеарных аберрации преимущественно локализовались в
антител в сыворотке крови.
хромосоме 1 (q42), 2 (q37) и 3 (p14) (16,1, 25,4 и
Полученные данные свидетельствовали 15,2 % при ожидаемых уровнях 8,44, 8,02 и 6,83
(см. табл. 1), что после лечения титр антинук- соответственно, p < 0,01). Похожие изменения в
леарных антител достоверно снижается, одна- локализации структурных нарушений хромоко число синовиоцитов у пациентов 1-й и 2-й сом наблюдаются при воздействии на клетки
групп имеет лишь тенденцию к изменению, до- организма некоторых вирусных и бактериальстоверно уменьшаясь у больных 3-й группы, но ных агентов [11], что может свидетельствовать
при этом оставаясь существенно выше, чем у об инфекционной природе такого рода изменебольных 1-й группы.
ний при ПТОА.
Анализ показал, что у больных ПТОА 3-й
Согласно данным корреляционного аналигруппы число клеток с ассоциациями ядрыш- за, между некоторыми регистрируемыми моркообразующих хромосом после лечения выше, фологическими формами ядра и показателями
чем у пациентов 1-й группы, при этом в объ- митотической активности, хромосомной патоединенной группе обследованных увеличивает- логии, размерами ядра, степенью конденсации
ся число клеток с ассоциациями 6 и 7 хромосом хроматина выявлена достоверная связь (в от(табл. 2).
меченных значениях p < 0,05), такая же зависиКорреляционный анализ свидетельствовал мость отмечена и для некоторых регистрируео достоверной обратно пропорциональной свя- мых форм патологии митоза (табл. 3).
зи между числом клеток с большим числом ассоциирующихся акроцентрических хромосом
Таблица 2
и митотической активностью синовиоцитов
(r = –0,68, p < 0,01). Кроме того, установлена Число клеток с ассоциациями ядрышкообразующих хромосом в синовиоцитах больных ПТОА
прямая зависимость между величиной ядрышколенных суставов до и после радонотерапии
ка и числом хромосом, вступающих в ассоциации (r = +0,72, p < 0,01), а также митотической
Число ассоциаций
Частота различных тиактивностью культуры синовиоцитов (r = +0,56,
хромосом, %
пов ассоциаций ядрышкоp < 0,01).
До
После
образующих хромосом
В культурах синовиоцитов больных ПТОА
лечения
лечения
коленных суставов 3-й группы удалось локализовать 681 структурную аберрацию хромосом,
2-х хромосом
30,1 ± 3,6
18,1 ± 3,8
из которых большая часть наблюдались в А3-х хромосом
31,0 ± 4,5
10,0 ± 4,6
группе хромосом, при этом преимущественно
4-х хромосом
15,4 ± 3,4
17,4 ± 3,6
поражалась хромосома 2 (обнаружено 21,6 %
5-ти хромосом
4,4 ± 1,1
15,0 ± 3,8
нарушений, а ожидалось 8,02 %, р < 0,01). В
6-ти хромосом
4,3 ± 1,1
9,8 ± 1,2**
хромосомах 6–18 наблюдаемая частота разры7-ми
хромосом
3,2
±
0,8
5,4 ± 0,9**
вов существенно не отличалась от ожидаемой,
8-ми хромосом
2,2 ± 0,4
5,3 ± 0,6
а в хромосомах 19–22 нарушений не установлено. Похожие результаты наблюдались в си9-ти хромосом
1,0 ± 0,3
2,1 ± 0,5
новиоцитах больных с титром антинуклеарных
10-ти хромосом
0,4 ± 0,2
2,9 ± 0,4
антител менее 1 : 80, здесь также преимущестП р и м е ч а н и е . ** – отличие от величины соответственно поражались крупные хромосомы А и В.
вующего
показателя до лечения статистически значимо
Не обнаружено поражений хромосом 12–22 и
при р < 0,05.
Y-хромосомы. Анализ наиболее часто поражаБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
13
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Ударцев Е.Ю., Ильинских Н.Н., Ильинских Е.Н. Влияние малых доз ионизирующего излучения… /c. 10–16
Таблица 3
Достоверные значения коэффициента корреляции (r) при сравнении различных показателей
кариологической и хромосомной патологий в синовиоцитах больных ПТОА коленных суставов
Регистрирумый показатель (число клеток)
Морфоформы ядра
Клеток с округлым ядром
Клеток с продолговатым ядром
Клеток с бобовидным ядро
Клеток с угловатым ядром
Клеток с однолопастным ядром
Клеток с многолопастным ядром
Клеток с микроядром
Клеток с несколькими микроядрами
Клеток с кариорексисом
Клеток с кариопикнозом
Клеток с кариолизисом
Клеток-симпластов
Формы патологии митоза
Клеток с преждевременным расхождением хроматид
в профазе
Клеток с отставанием хромосом и фрагментов в
метафазе
Клеток с преждевременным расхождением
хромосом в метафазе
Клеток с многогрупповыми метафазами
Клеток с К-митозом
Клеток с отставанием хромосом и фрагментов
в ана-телофазе
Клеток с неравнополюсной ана-телофазой
Клеток с трехполюсной ана-телофазой
Клеток с ана-телофазой с мостами
1
2
3
4
5
6
7
8
9
10
11
+
+
+
+
+
_
_
_
_
+
+
+
+
+
+
+
+
+
+
_
_
_
_
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
_
+
+
+
+
+
+
+
П р и м е ч а н и е . Обозначения столбцов: 1 – митотическая активность, 2 – клеток с хроматидными разрывами,
3 – клеток с хромосомными разрывами, 4 – клеток с обменами, 5 – клеток с гипоплоидией, 6 – клеток с гиперплоидией, 7 – клеток с полиплоидией, 8 – клеток с увеличенным размером ядра, 9 – клеток с уменьшенным размером ядра,
10 – клеток с высокой конденсацией хроматина ядра, 11 – клеток с низкой конденсацией хроматина ядра; значками
обозначены статистически значимые корреляционные зависимости: + прямо пропорциональная, – обратно пропорциональная.
ВЫВОДЫ
1. В синовии больных с посттравматическим
остеоартрозом до 6,6 – 42,3 % возрастает – в зависимости от титра антинуклеарных антител –
частота синовиоцитов с цитогенетическими
нарушениями в виде различных хромосомных
аберраций с прямо пропорциональной связью
между этими показателями, что свидетельствует о непосредственном влиянии антинуклеарных антител на изменения в ядерном аппарате
синовиоцитов.
2. Под влиянием радонотерапии в эквивалентной дозе альфа-излучения 280 мкЗв в си14
новии больных посттравматическим остеоартрозом происходит снижение титра антинуклеарных антител к клеткам синовии и вследствие
этого уменьшение на 48,9 % количества хромосомных аберраций синовиоцитов и числа аномалий в их ядерном аппарате.
СПИСОК ЛИТЕРАТУРЫ
1. Ударцев Е.Ю., Ильинских Н.Н., Распопова Е.А. и др. Влияние малых доз ионизирующего
излучения на морфофункциональное состояние
синовиоцитов у больных посттравматическим
остеоартрозом // XIV Российско-Португальский
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Ударцев Е.Ю., Ильинских Н.Н., Ильинских Е.Н. Влияние малых доз ионизирующего излучения… /c. 10–16
симпозиум «Новые технологии восстановительной медицины и курортологии» (физиотерапия,
реабилитация, спортивная медицина): Тез. докл.
М., 2008. 93–95.
Udartsev E.Yu., Ilyinskikh N.N., Raspopova Е.А.
et al. Effect of ionizing radiation in light doses on
morphofunctional condition of synoviocyte at the patients with posttraumatic osteoarthrosis // XIV Russian-Portuguese symposium «New Technologies of
Regenerative Medicine and balneotherapy» (physiatrics, rehabilitation, sports medicine): Proceedings.
M., 2008. 93–95.
2. Ильинских Н.Н., Ударцев Е.Ю., Ильинских Е. Н. и др. Влияние лечения радоном на изменения морфологии синовиоцитов больных артритами // Естествознание и гуманизм. 2007. 4. (4).
38–39.
Ilyinskikh N.N., Udartsev E.Yu., Ilyinskikh E.N. et
al. Effect of radon treatment on the changes of synoviocyte morphology at the patients with arthritis //
Estestvoznanie i gumanizm. 2007. 4. (4). 38–39.
3. Franke A., Reiner L., Resch K.L. Long-term
benefit of radon spa therapy in the rehabilitation of
rheumatoid arthritis: a randomised, double-blinded
trial // Rheumatol. Int. 2007. 27. (8). 703–713.
4. Yamaoka K., Mitsunobu F., Hanamoto K. et al.
Study on biologic effects of radon and thermal therapy on osteoarthritis // J. Pain. 2004. 5. (1). 20–25.
5. Falkenbach A., Kovacs J., Franke A. et al. Radon therapy for the treatment of rheumatic diseasesreview and meta-analysis of controlled clinical trials
// Rheumatol. Int. 2005. 25. (3). 205–210.
6. Wada M., Kawahito Y., Kimura S. et al. siRNA
targeting PLK-1 induces apoptosis of synoviocytes in
rheumatoid arthritis // Biochem. Biophys. Res. Commun. 2001. 357. (2). 353–359.
7. Seardoni H., Muller M.J., Hsu E.T. Cellular
lasing and aetiology of late somatic effects of ionizing radiation // Bull. Nat. Inst. Anim. India. 2001.
19. 37–43.
8. Ударцев Е.Ю., Ильинских Н.Н., Распопова Е. А. и др. Влияние радонотерапии на уровень
антинуклеарных антител и хромосомные аберрации у больных посттравматическим гонартрозом // XIV Российско-Португальский симпозиум
«Новые технологии восстановительной медицины и курортологии» (физиотерапия, реабилитация, спортивная медицина): Тез. докл. М., 2008.
91–93.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Udartsev E.J., Ilinskikh N.N., Raspopova Е.А. et
al. Effect of radonotherapy on antinuclear antibody
and chromosome aberration level among the patients
with posttraumatic gonarthrosis // XIV Russian-Portuguese symposium «New Technologies of Regenerative Medicine and balneotherapy» (physiatrics, rehabilitation, sports medicine): Proceedings. M., 2008.
91–93.
9. Lee S.H., Chang D.K., Goel A. et al. Microsatellite instability and suppressed DNA repair enzyme
expression in rheumatoid arthritis // J. Immunol.
2003. 1. 170. (9). 4869.
10. Yamanishi Y., Boyle D.L., Rosengren S. et al.
Regional analysis of p53 mutations in rheumatoid arthritis synovium // Proc. Natl. Acad. Sci. USA. 2002.
99. (15). 10025–10030.
11. Ильинских И.Н., Новицкий В.В., Ильинских Е.Н. и др. Инфекционная кариопатология.
Томск: Изд-во Том. ун-та, 2005. 168 с.
Ilyinskikh I.N., Novitsky V.V., Ilyinskikh E.N. et al.
Infectious karyo-pathology. Tomsk: Izd-vo Tom. unta, 2005. 168 p.
12. Knorr J., Sosnov E.R., Rivolta R.D. Induced
of chromosomes aberrations in osteoarthritis and
antinuclear antitels // Rheumatol. Int. 2001. 21. (2).
234–239.
13. Yooh N., Unitar G.F., Rooh T. Detecting single
antibody-forming cells // Progress in immunology. N.
Y., 2008. 3. 339–355.
14. Moorchead P.S., Novell P.C., Mellman W.J. et
al. Chromosome preparations of leukocytes cultured
from human peripheral blood // Exp. Cell Res. 1960.
20. (1). 613–616.
15. Бочков Н.П. Хромосомы человека и облучение. М.: Атомиздат, 1974. 154 с.
Bochkov N.P. Human chromosomes and irradiation. M.: Atomizdat, 1974. 154 p.
16. Захаров А.Ф., Бенюш В.А. Хромосомы человека: Атлас. М.: Медицина, 1982. 436 с.
Zakharov A.F., Benyush V.А. Human chromosomes: Atlas. М.: Meditsina, 1982. 436 p.
17. Засухина Г.Д. Репаративные механизмы
клеток и проблемы окружающей среды. М.: Наука, 1975. 284 с.
Zasukhina G.D. Reparative mechanisms of cells
and environment problems. М.: Nauka, 1975. 284 p.
15
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Ударцев Е.Ю., Ильинских Н.Н., Ильинских Е.Н. Влияние малых доз ионизирующего излучения… /c. 10–16
INFLUENCE OF IONIC RADIATION LOW DOSES ON CHROMOSOMAL
ABERRATIONS AND LEVEL OF ANTINUCLEAR ANTIBODIES INTO SYNOVIAL
CELLS OF THE PATIENTS WITH POSTTRAUMATIC OSTEOARTHRITIS
Yevgeniy Yur’evich UDARTSEV, Nikolay Nikolaevich ILYINSKIKH,
Ekaterina Nikolaevna ILYINSKIKH
Spa-hotel «Altai-WEST»
659900 Belokurikha , Slavskogo str., 39
Siberian State Medical University
634050 Tomsk, Moskovsky trakt, 2
The data on chromosomal analysis and detection of the level of antinuclear antibodies to synovial cells of 28 patients
at the age of 35–50 years with posttraumatic osteoarthritis of the knee have been performed in the article. It has been
revealed that the number of the cells with cytogenetic disorders in the form of various chromosomal aberrations with
directly–proportional correlation between these indices grow in 80.6–84.4 % into synovial fluid of the patients with
posttraumatic osteoarthritis depending on the titre of antinuclear antibodies. This fact testifies to the direct influence of antinuclear antibodies on the change of synoviocytes nuclear system. The decrease in the titre of antinuclear
antibodies to synovial cells by 50–75 %, reduction in the number of chromosomal aberrations of synoviocytes by
48.9%, and decline in the number of anomalies of their nuclear apparatus have been revealed after radonotherapy in
equivalent dose of 280 μSv alpha-radiation.
Key words: posttraumatic osteoarthritis, synoviocytes, ionic radiation, chromosomal aberrations, antinuclear antibodies.
Udartsev Ye.Yu. – candidate of medical sciences, orthopedist-traumatologists, e-mail: orthoped2@yandex.ru
Ilyinskikh N.N. – doctor of medical sciences, professor, head of the chair for biology and genetics,
e-mail: nauka-tomsk@yandex.ru
Ilyinskikh E.N. – doctor of medical sciences, professor of the chair for infectious diseases,
e-mail: nauka-tomsk@yandex.ru
16
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК 616.248-576.8.077.3.053.5
ЦИТОКИНОВЫЙ ПРОФИЛЬ ПРИ БРОНХИАЛЬНОЙ АСТМЕ
У ПОДРОСТКОВ И ЮНОШЕЙ
Шухрат Худайбердиевич ЗИЯДУЛЛАЕВ1, Назира Мусаевна ХАИТОВА1,
Тамара Уктамовна АРИПОВА2, Адалат Абдурахимовна УМАРОВА2
1 Самаркандский
государственный медицинский институт
703000, Республика Узбекистан, г. Самарканд, ул. А. Темура, 18
2 Институт
иммунологии Академии наук Республики Узбекистан
700060, г. Ташкент, ул. Я. Гулямова, 74
Современные представления об иммунологических аспектах патогенеза аллергических заболеваний, в том
числе бронхиальной астмы, свидетельствуют о ключевой роли в механизме развития аллергических реакций I типа дисбаланса в системе субпопуляций Тh1/Тh2-лимфоцитов, опосредованного цитокиновым профилем. В настоящем исследовании на основании определения уровня цитокинов в сыворотке крови методом
иммуноферментного анализа установлены особенности продукции IL-6 и интерферона-γ при бронхиальной
астме у мальчиков-подростков и юношей. Показано, что изменение уровня указанных параметров отражает
состояние иммунной системы, характерное для каждого клинико-патогенетического варианта заболевания
(преимущественно инфекционного, аллергического, смешанного). В проведенных исследованиях выделение
клинико-патогенетических групп подтверждается уровнем и спектром регулирующих цитокинов и направленностью иммунного ответа, а именно: у лиц с преимущественно инфекционными механизмами Th1-тип
иммунного ответа превалирует над Th2-типом, у подростков и юношей атопиков достоверно преобладает
Тh2 звено, а у лиц с заболеванием смешанного генеза иммунный ответ развивается по смешанному Тh1/
Тh2-типу. Установлено важное практическое значение определения уровней IL-6, интерферона-γ как дополнительных дифференциально-диагностических критериев направленности патогенетического процесса при
бронхиальной астме в подростковом и юношеском возрасте, а также их роль в перспективной возможности
правильного выбора иммунотропной терапии.
Ключевые слова: цитокины, бронхиальная астма, подростки, юноши.
Одним из современных направлений развития иммунологии является изучение роли
цитокинов в патогенезе и лечении иммуноопосредованных заболеваний. Известно, что
активация Th1-лимфоцитов, сопряженная с
продукцией некоторых ключевых цитокинов,
усиливает клеточный иммунитет. Детерминация иммунного ответа по гуморальному типу
осуществляется при доминирующем влиянии
Th2-цитокинов. Согласно современным представлениям, дисбаланс цитокинового профиля
при многих патологических состояниях, а также поляризация иммунного ответа по Th1- или
Th2-пути имеют решающую роль в патогенезе
иммунных заболеваний [1−5]. Две конкурирующие субпопуляции T-хелперов способны противодействовать дифференцировке и активации
друг друга. Подходы к лечению аллергических
заболеваний также заключаются в попытке изменить соотношение между Тh1- и Тh2-клетками, т. е. подавить созревание Тh2-клеток, которые продуцируют цитокины, отвечающие за
синтез реагинов В-лимфоцитами (IL-4 и IL-13)
и активацию эозинофилов (IL-3, IL-5, GM-CSF,
RANTES), инициировать дифференцировку
Тh1-клеток, что дало бы возможность заблокировать синтез IgE и предотвратить развитие вышеперечисленных реакций и, соответственно,
симптомов аллергии [6−8]. Интерферон-γ активирует мононуклеарные фагоциты, повышает
экспрессию молекул МНС I и II класса, непосредственно влияет на дифференцировку Т- и
В-лимфоцитов, активирует нейтрофилы и NKклетки [9−14]. Спектр биологического действия
Зиядуллаев Ш.Х. – к.м.н., ассистент кафедры терапии по подготовке врачей общей практики,
e-mail: ziyadullayev@mail.ru.
Хаитова Н.М. – д.м.н., проф., зав. кафедрой терапии по подготовке врачей общей практики
Арипова Т.У. – д.м.н., проф., директор
Умарова А.А. – д.м.н., зав. лабораторией иммуноцитокинов
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
17
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Зиядуллаев Ш.Х., Хаитова Н.М., Арипова Т.У., Умарова А.А. Цитокиновый профиль… /c. 17–20
IL-6 достаточно широк и реализуется не в увеличении пролиферации клеток-мишеней, а в
обеспечении дифференцировки этих клеток на
поздних стадиях развития. Являясь костимулятором, данный цитокин подготавливает пролиферативный ответ Т-клеток на митоген или
антиген, обеспечивает усиление продукции IL-2
Т-хелперами, распознавшими антиген [15−17].
Таким образом, совокупность свойств IL-6 и
интерферона-γ как факторов дифференцировки
ставит их в единый ряд с наиболее важными
эндогенными регуляторами иммунных и воспалительных процессов в организме.
Цель настоящей работы – установить патогенетическую информативность степени продукции конкурирующих цитокинов сыворотки
крови интерферона-γ и IL-6 у больных бронхиальной астмой в подростковом и юношеском
возрасте.
МАТЕРИАЛ И МЕТОДЫ
Нами изучены особенности уровня продукции цитокинов интерферона-γ и IL-6 иммунной системы в сыворотке периферической
крови у больных бронхиальной астмой (БА) в
подростковом возрасте. Обследовано 80 мальчиков-подростков и юношей в возрасте от 12
до 19 лет, страдающих бронхиальной астмой.
Контрольную группу составили 30 практически здоровых лиц аналогичного пола и возраста.
Больные бронхиальной астмой распределялись
по группам согласно международной классификации ВОЗ (МКБ-10) и в соответствии с
диагностическими критериями (GINA, 2006 г.).
Определение уровня интерферона-γ и IL-6 в
сыворотке крови проводили методом иммуноферментного анализа с использованием тестсистемы «ИФА − INF-γ − ИЛ-6» (ЗАО «Вектор-
Бест», Кольцово). Все исследования выполнены
с информированного согласия испытуемых и в
соответствии с этическими нормами Хельсинкской Декларации (2000 г.).
Статистическую обработку результатов исследования проводили, вычисляя среднее арифметическое значение (М), ошибку среднего
арифметического значения (m) и представляли
в виде M ± m. Различия между группами оценивали с помощью критерия Стъюдента, достоверными считались результаты при р < 0,05.
Связь между различными признаками в исследуемой выборке определяли с помощью корреляционного анализа величиной коэффициента
корреляции Пирсона (r).
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
Проведенные исследования показали, что у
больных бронхиальной астмой в подростковом
и юношеском возрасте наблюдается повышение
уровня IL-6 и снижение содержания интерферона-γ в сыворотке крови (см. таблицу). Для уточнения связи продукции IL-6 и интерферона-γ
при изучаемой патологии с клинико-патогенетическими формами заболевания мы провели
сопоставительный анализ. Выявлено, что у подростков и юношей, страдающих бронхиальной
астмой с преимущественно инфекционными
механизмами заболевания, имеется тенденция
к повышению уровня IL-6 в периферической
крови, что отражает выраженность воспаления
в этой группе пациентов. У больных с аллергическими механизмами заболевания, наоборот,
отмечается некоторое уменьшение содержания
IL-6 в сыворотке крови, что имеет важное значение в патогенезе развития БА. Наиболее низкий уровень продукции интерферона-γ зарегистрирован в группе больных БА подросткового и
Таблица
Содержание IL-6 и интерферона-γ в сыворотке крови больных БА подросткового
и юношеского возраста
Группа обследуемых
Практически здоровые (n = 30)
Больные БА:
общая группа (n = 80)
смешанная БА (n = 20)
атопическая БА (n = 39)
инфекционно-зависимая БА (n = 21)
Содержание IL-6, пг/мл
Содержание интерферона-γ, пг/мл
8,6 ± 3,6
13,9 ± 1,0
24,0 ± 3,8*
16,6 ± 1,5
32,1 ± 1,1##
37,9 ± 1,3##^
7,9 ± 0,5**
9,0 ± 1,2
4,9 ± 0,2##
8,3 ± 1,3^
П р и м е ч а н и е . Отличие от величины соответствующего показателя у практически здоровых лиц достоверно:
* − при p < 0,05, ** − при p < 0,01; ## − отличие от величины соответствующего показателя у пациентов со смешанной
формой БА достоверно при p < 0,01; ^ − отличие от величины соответствующего показателя у пациентов с атопической
формой БА достоверно при p < 0,05.
18
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Зиядуллаев Ш.Х., Хаитова Н.М., Арипова Т.У., Умарова А.А. Цитокиновый профиль … /c. 17–20
юношеского возраста с атопической клиникопатогенетической формой заболевания. Продукция интерферона-γ иммунокомпетентными
клетками при смешанной и инфекционно-зависимой формах БА в подростковом и юношеском
возрасте находилась на одинаково низком уровне, достоверно отличаясь от показателя группы
практически здоровых лиц.
При корреляционном анализе результатов исследования было выяснено, что в общей
группе больных БА в подростковом и юношеском возрасте показатели концентрации INF-γ
и IL-6 коррелируют отрицательно (r = −0,23,
p < 0,02), в то время как между соответствующими показателями практически здоровых лиц
выявлена прямая взаимосвязь (r = 0,19, p < 0,05).
При этом в группе больных с атопической формой БА данные показатели находились в более
выраженной обратной зависимости (r = −0,38,
p < 0,02). У больных подростков и юношей со
смешанной формой БА обнаружена тесная положительная корреляция (r = 0,67, p < 0,01).
Таким образом, в наших исследованиях
выделение клинико-патогенетических групп
подтверждается уровнем и спектром регулирующих цитокинов и направленностью иммунного ответа, а именно: у лиц с преимущественно
инфекционными механизмами Th1-тип иммунного ответа превалирует над Th2-типом, у подростков и юношей с атопической формой БА
преобладает Тh2-звено, а у пациентов со смешанным генезом заболевания иммунный ответ
развивается по смешанному Тh1/Тh2-типу.
Результаты проведенной работы имеют значение для практической медицины, поскольку
раскрывают существенные патогенетические
механизмы развития бронхиальной астмы. Установлено важное практическое значение определения уровней ИЛ-6, интерферона-γ как дополнительных дифференциально-диагностических
критериев направленности патогенетического
процесса при БА в подростковом возрасте.
ВЫВОДЫ
1. У больных бронхиальной астмой в подростковом возрасте выявляются отчетливые
изменения межклеточных взаимодействий
в иммунной системе: достоверное повышение
содержания IL-6, являющегося биомаркером
возрастных изменений и риска развития болезней, и, наоборот, снижение уровня регулятора
активности Th1-клеток интерферона-γ.
2. Проведенный анализ соотношения содержания IL-6 и IFN-γ, характеризующих баланс
про- и противовоспалительных цитокинов,
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
при БА в подростковом и юношеском возрасте,
позволяет выявить клинико-патогенетические
группы с преимущественно инфекционными,
где превалирует Th1-тип иммунного ответа над
Th2-типом, аллергическими, где преобладает
Тh2-звено, и смешанными механизмами генеза
заболевания, где иммунный ответ развивается
по смешанному Тh1/Тh2-типу.
СПИСОК ЛИТЕРАТУРЫ
1. Гельцер Б.И., Просекова Е.В., Деркач В.В. и
др. Система цитокинов и болезни органов дыхания. Владивосток: «Дальнаука», 2005. 256 с.
Geltzer B.I., Prosekova E.V., Derkach V.V. et al.
The system of cytokines and respiratory diseases.
Vladivostok: “Dal’nauka”, 2005. 256 р.
2. Ершов Ф.И. Система интерферона в норме
и при патологии. М., 1995. 240 с.
Ershov F.I. Interferon system in health and disease. M., 1995. 240 p.
3. Иммунная система детей и подростков: анатомо-физиологические особенности, нарушения
и методы оценки / Е.В. Просекова, В.В. Деркач,
Т.Н. Шестовская и др. Владивосток, 2007. 118 с.
The immune system of children and adolescents:
the anatomic and physiologicfeatures, disturbances and
evaluation methods / E.V. Prosekova, V.V. Derkach,
T.N. Shestovskaya. Vladivostok, 2007. 118 р.
4. Ковальчук Л.В., Ганьковская Л.В., Рубакова Э.И. Система цитокинов. М., 2000. 64 с.
Kovalchuk L.V., Gankovskaya L.V., Rubakov E.I.
The system of cytokines. M., 2000. 64 р.
5. Козлов В.А. Возможные направления в решении проблемы классификации иммуномодулирующих препаратов // Аллергология и иммунология. 2003. 4. (2). 15–19.
Kozlov V.A. Possible directions in addressing the
problem of classification of immunomodulatory drugs //
Allergologiya i immunologiya. 2003. 4. (2). 15–19.
6. Купаев В.И. Жестков А.В. Состояние системы цитокинов у беременных женщин, страдающих бронхиальной астмой // Иммунология. 2003.
5. 286–289.
Kupaev V.I., Zhestkov A.V. Status of cytokines
system in pregnant women with bronchial asthma //
Immunologiya. 2003. 5. 286–289.
7. Система цитокинов. Теоретические и клинические аспекты // Сборник трудов под ред.
В.А. Козлова и С.В. Сенникова. Новосибирск: Наука, 2004. 316 с.
Systems of cytokines. Theoretical and clinical aspects // Collection of scientific articles, eds. V. A. Kozlov and S.V. Sennikova. Novosibirsk: Nauka, 2004.
316 p.
8. Соловьева Н.Ю., Сенникова Ю.А., Гришина Л.В. и др. Баланс цитокинов в сыворотке крови и некоторые показатели иммунного статуса у
больных хроническим бронхитом и рецидивиру19
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Зиядуллаев Ш.Х., Хаитова Н.М., Арипова Т.У., Умарова А.А. Цитокиновый профиль… /c. 17–20
ющей герпетической инфекцией // Медицинская
иммунология. 2003. 3-4. (5). 461–463.
Solovieva N.Yu., Sennikova Yu.A., Grishina L.V. et
al. The balance of cytokines in serum and some indices of immune status in patients with chronic bronchitis and recurrent herpes infection // Meditsinskaya
immunologiya. 2003. 3-4. (5). 461–463.
9. Соловьева Н.Ю., Сенникова Ю.А., Гришина
Л.В. и др. Провоспалительные и иммунорегуляторные цитокины у больных с синдромом вторичного иммунодефицита при рецидивирующей
герпетической инфекции // Медицинская иммунология. 2003. 5. (5-6). 583–590.
Solovieva N.Yu., Sennikova Yu.A., Grishina L.V.
et al. Proinflammatory and immunoregulatory cytokines in patients with secondary immunodeficiency
syndrome with recurrent herpes infection // Meditsinskaya immunologiya. 2003. 5. (5-6). 583–590.
10. Косарев В.В. Эпидемиология, клинико-иммунологические аспекты аллергических заболеваний респираторного тракта. Самара, 2002. 144 с.
Kosarev V.V. Epidemiology, clinical and immunological aspects of allergic diseases of respiratory
tract. Samara, 2002. 144 p.
11. McKenzie G.J. Simultaneous disruption of
interleukin (IL)-4 and IL-13 defines individual roles
in T-helper cell type 2-mediated responses // J. Exp.
Med. 1999. 189. 1565–1572.
12. Prescott S.L. et al. Development of allergenspecific T-cell memory in atopic and normal // Children. Lancet. 1999. 353. 196–200.
13. Gruning G. et al. Requirement for IL-13 independently of IL-4 in experimental asthma // Science.
1998. 282. 2261–2263.
14. Durwood B.J. Concomitant problems with
asthma // Ala J. Med. Sci. 1985. 22. 393–395.
15. Schindler R., Mancilla J., Endres S. et al.
Correlations and interactions in the production of
interleukin-6 (IL-6), IL-1, and tumor necrosis factor
(TNF) in human blood mononuclear cells: IL-6 suppresses IL-1 and TNF // Blood 1990. 75. (40). 7–14.
16. Heinrich P.C., Castell J.V., Andus T. Interleukin-6 and the acute phase response // Biochem. J.
1990. 265. 621–636.
17. Dinarello C. The pathophysiologic roles of
interleukin-6 in human disease // Ann. Intern. Med.
1999. (128). 127−137.
CYTOKINE PROFILE AT ADOLESCENTS WITH BRONCHIAL ASTHMA
Shukhrat Khudayberdievich ZIYADULLAEV1, Nazira Musaevna KHAITOVA1,
Tamara Uktamovna ARIPOVA2, Adalat Abdurakhimovna UMAROVA2
1 Samarkand
State Medical Institute 703000, the Republic of Uzbekistan, Samarkand, A. Temur str., 18
2 Institute
of Immunology of Academy of Sciences of the Republic of Uzbekistan
700060, Tashkent, Ya. Gul’amov str., 74
Current views on the immunological aspects of the pathogenesis of allergic diseases, including asthma, indicate a key
role of the I type imbalance in the system of subpopulations Th1/Th2-lymphocytes mediated cytokine profile in the
mechanism of allergic reactions. The specific features of production of regulatory cytokines IL-6 and interferon-γ in
adolescents with bronchial asthma have been revealed on the basis of determining the level of immune system cytokines in serum by the method of immune-enzyme analysis. It has been shown that the change in these parameters
reflects the state of the immune system, which is characteristic for each clinical pathogenetic variants of the disease
(mainly infectious, allergic, and mixed). In the study, the selection of clinical and pathogenic groups has been proved
by the regulatory cytokines level and range and the immune response targeting. Namely, the immune response of
Th1 type prevails over Th2 type in the group of adolescents with predominant infectious mechanisms, Th2 link is
significantly higher in adolescents in atopy, whereas the immune response in adolescents with mixed genesis of the
disease develops through the mixed Th1/Th2-type. The major practical importance of determining the levels of IL-6,
IFN-γ as an additional differential-diagnostic criteria targeting pathogenic process at asthma in adolescence, as well
as their role in advanced capacity of correct choice of immunotropic therapy has been established.
Key words: cytokines, asthma, adolescents.
Ziyadullaev Sh.Kh. – candidate of medical sciences, assistant professor of the chair for therapy on general
practitioners preparing, e-mail: ziyadullayev@mail.ru
Khaitova N.M. – doctor of medical sciences, professor, head of the chair for therapy on general practitioners
preparing
Aripova T.U. – doctor of medical sciences, professor, director
Umarova A.A. – doctor of medical sciences, head of the laboratory for immunocytokines
20
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК 616.36-008.12-036.72
ОПЫТ ПРИМЕНЕНИЯ НОВЫХ ТЕХНОЛОГИЙ ДЛЯ ИЗУЧЕНИЯ КОМПЛЕКСА
ПАРАМЕТРОВ ЭРИТРОЦИТОВ ПРИ ДИФФУЗНЫХ ЗАБОЛЕВАНИЯХ ПЕЧЕНИ
Светлана Арсентьевна КУРИЛОВИЧ1, Маргарита Витальевна КРУЧИНИНА1,
Андрей Александрович ГРОМОВ1, Елена Геннадьевна НЕМЦОВА1,
Владимир Михайлович ГЕНЕРАЛОВ2, Талгат Сальманович БАКИРОВ2,
Махмуд Минахметович ШАКИРОВ3, Владимир Александрович РИХТЕР4,
Дмитрий Владимирович СЕМЕНОВ4
1 НИИ
терапии СО РАМН
630089, г. Новосибирск, ул. Бориса Богаткова, 175/1
2 ФГУН
Государственный научный центр вирусологии и биотехнологии «Вектор» Роспотребнадзора
630559, пос. Кольцово, Новосибирская область
3 Институт
органической химии им. Н.Н. Ворoжцова СО РАН
630090, г. Новосибирск, просп. Академика Лаврентьева, 9
4 Институт
химической биологии и фундаментальной медицины СО РАН
630090, г. Новосибирск, просп. Академика Лаврентьева, 8
В работе представлены результаты исследования множества параметров эритроцитов, включая их структурно-функциональные характеристики, полученные различными методами (капиллярная вискозиметрия,
исследование удельной электропроводности, АТФазной активности мембран, двумерная тонкослойная хроматография, газохроматографический и хромато-масс-спектрометрический анализ, диэлектрофорез в неоднородном переменном электрическом поле, 13С, 31Р, 1Н ЯМР-спектроскопия) при диффузной патологии
печени. Использование новых технологий, наряду с клиническими данными, позволяет сделать заключение
по целому комплексу вопросов гепатологии (дифференциальная диагностика, оценка степени фиброза печени, генез, активность, осложнения заболевания, контроль эффективности проводимой терапии). Наиболее
перспективным представляется метод диэлектрофореза эритроцитов как наименее трудоемкий, имеющий
высокую пропускную способность и высокую информативность.
Ключевые слова: патология печени, эритроциты, методы диагностики.
Хроническая диффузная патология печени
(ДПП) является широко распространенной с
тенденцией к дальнейшему росту заболеваемости [1, 2]. Основными этиологическими факторами повреждения печени остаются вирусы
и алкоголь. Для алкоголя печень является основным органом-мишенью, поскольку в ней
происходит метаболизм большей части этанола
[3]. Однако не у всех лиц, злоупотребляющих
спиртными напитками, развивается клиничес-
Курилович С.А. – д.м.н., проф., зав. лабораторией гастроэнтерологии, e-mail: kurilovich@yandex.ru
Кручинина М.В. – д.м.н., ведущий научный сотрудник, сотрудник лаборатории гастроэнтерологии,
e-mail: kruchmargo@yandex.ru
Громов А.А. – к.м.н., старший научный сотрудник лаборатории клинических и биохимических исследований, e-mail: romov.center@rambler.ru
Немцова Е.Г. – аспирант, младший научный сотрудник лаборатории гастроэнтерологии,
e-mail: neg-85@yandex.ru
Генералов В.М. – к.т.н., ведущий научный сотрудник, зав. лабораторией биофизического анализа,
e-mail: vmgeneral@mail.ru
Бакиров Т.С. – к.т.н., старший научный сотрудник лаборатории биофизического анализа,
e-mail: bakirov@vector.nsc.ru
Шакиров М.М. – старший научный сотрудник лаборатории биохимических и биофизических методов исследования, e-mail: mmsh@nioch.nsc.ru
Рихтер В.А. – к.б.н., зам. директора по научной работе, зав. лабораторией биотехнологии,
e-mail: richter@niboch.nsc.ru
Cеменов Д.В. – к.б.н., старший научный сотрудник лаборатории биотехнологии,
e-mail: semenov@niboch.nsc.ru
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
21
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Курилович С.А., Кручинина М.В., Громов А.А. и др. Опыт применения новых технологий… /c. 21–30
ки значимое поражение печени: частота выявления у них цирроза на вскрытии не превышает
10–15 %, в то время как у 1/3 изменения печени
вообще отсутствуют. Инфицирование вирусами В и С лиц с хронической алкогольной интоксикацией, по данным эпидемиологического
исследования, в 100 % случаев ассоциировано с
наличием диффузного поражения печени. Еще
одной злободневной проблемой становится неалкогольная жировая болезнь печени, которая
также может прогрессировать в цирроз печени.
Знание предикторов такого прогрессирования
в различных популяциях чрезвычайно важно.
Кроме того, при разной патологии печени, как
приобретенной, так и наследственной, нередко
наблюдается неконъюгированная (непрямая)
гипербилирубинемия, требующая дифференциального диагноза. Поэтому вопросы современной и качественной диагностики и дифференциальной диагностики, влияния различных
факторов на течение и прогноз болезни, установления степени фиброза (стадии болезни)
весьма актуальны. Решение их возможно только на базе знаний патогенетических механизмов развития болезни под действием разных
этиологических факторов.
Известно множество методов и подходов для
диагностики ДПП, одни из которых позволяют
определить этиологию процесса, его биохимическую, вирусологическую активность, другие – стадию заболевания, степень компенсации, выраженность фиброза, третьи позволяют
определить наличие осложнений. Многие из
диагностических методик обладают достаточной чувствительностью, специфичностью, стали
«золотым стандартом» гепатологии, как, например, биопсия печени. Недостатками большинства методов являются, как правило, высокая
трудоемкость, себестоимость, необходимость
применения широкой номенклатуры различных
ингредиентов, субъективизм, иногда противодействие со стороны пациента и т. д. [1, 2, 4].
Поэтому поиск новых подходов и методов
верификации диагноза при ДПП остается «задачей номер один». С этой точки зрения весьма
интересны структурно-функциональные параметры эритроцитов. Эритроцит – биологическая субстанция, которая обеспечивает транспорт кислорода и участвует в поддержании
гомеостаза в органах и тканях организма. В
силу своей многочисленности эритроциты преимущественно определяют основные физикохимические свойства крови. Поскольку между
расстройствами функций печени и гомеостазом
крови существует тесная связь, то для широкой
клинической практики ценным диагностичес22
ким критерием состояния печени является использование характеристик эритроцитов. Кроме
того, данные литературы свидетельствуют, что
эритроцит можно рассматривать как универсальную модель для изучения изменений цитоплазматических мембран и метаболизма клеток организма, в том числе гепатоцитов [5, 6].
С другой стороны, клетки красной крови являются уникальными объектами для исследования, поскольку они легко доступны, достаточно
устойчивы, «несут информацию» за последние
3–4 месяца, требуют минимальных затрат при
исследовании, их показатели обладают достаточной чувствительностью и специфичностью,
позволяют отразить целый комплекс показателей печени.
Цель настоящего сообщения – продемонстрировать возможности использования различных параметров эритроцитов для диагностики
ДПП, чему была посвящена серия исследований, выполненных в лаборатории гастроэнтерологии НИИ терапии СО РАМН при комплексировании с различными учреждениями. Обследование пациентов выполнено с одобрения
Комитета биомедицинской этики НИИ терапии
СО РАМН.
В нормальной клеточной мембране формируется своеобразная, тонко сбалансированная
система регуляции ее структуры и деятельности основных ферментных систем. Структурные
перестройки в нормальной мембране зависят
от температуры и при определенных условиях
приводят к изменению электрических характеристик мембраны, показателей деятельности
основных ферментных систем. Посредством
термотропного фазового перехода обеспечивается, очевидно, связь между структурой и электрическими свойствами, функциями ферментов мембраны клетки. Поэтому первым шагом
в наших исследованиях стало изучение структурно-функциональных свойств эритроцитов
в зависимости от температуры, что позволило
судить о тонких сдвигах в системе биополимеров под действием этанола при патологии печени алкогольного генеза. С целью обнаружения
термотропных фазовых переходов в области
+34–41 °С использовали метод капиллярной
вискозиметрии взвесей эритроцитов, их «теней» и гемоглобина в зависимости от температуры [7]. Для определения Na+, K+-АТФазной
активности применяли способ, предложенный
М.Ф. Некрасовой и соавт. [8]. Электрические
свойства взвесей «теней» эритроцитов и гемоглобина определяли, используя устройство для
измерения электропроводности биологических
тканей и жидкостей [9].
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Курилович С.А., Кручинина М.В., Громов А.А. и др. Опыт применения новых технологий… /c. 21–30
У пациентов (n = 88, средний возраст 42,4 ±
± 2,2 года) наличие патологии печени сопровождалось повышением вязкости в высокотемпературной области (+38–41 °С) и увеличением
абсолютных величин удельной электропроводности «теней» эритроцитов во всем интервале
температур (p < 0,02) [10]. При этом абсолютные
значения величин константы Михаэлиса-Ментен (Кm) и максимальной скорости гидролиза
АТФ (Vmax) при исследовании АТФ-азной активности в области физиологических температур
были достоверно ниже (p < 0,05), чем в группе
контроля (n = 36, 38,4 ± 1,14 года) (рис. 1).
Характерным в подгруппах с наличием
признаков патологии печени оказался фазовый
переход при +39 °С, который регистрировался
как в ранние, так и в отдаленные сроки абстиненции. Особенно убедительным это оказалось
в подгруппе с явными признаками патологии
печени, где даже спустя 3–4 недели после последнего алкогольного эксцесса перегиб при
+39 °С наблюдался в 86,6 % случаев. Выраженность и длительность сохранения данного пика
увеличивались по мере утяжеления патологии Рис. 1. Зависимость величины константы Михаэлиса-Ментен (Кm) от температуры (T, °С) для
печени, что подтверждено и пошаговым регрес+, K+-АТФазы эритроцитов с явными приNa
сионным анализом. Углубление патологии печезнаками поражения печени и без них. Достони коррелировало со смещением низкотемпераверность отличий: * – от группы больных без
турного пика в более низкотемпературную обповреждения печени, * – p<0,05, ** – p<0,01,
ласть (+36 °С – при умеренных, +35 °С – при
*** – p<0,0001
явных признаках патологии печени) (r = +0,56,
p < 0,02). При обследовании пациентов с различ- холестерина и ненасыщенных жирных кислот
ной степенью поражения печени все три мето- (особенно полиненасыщенных – докозотетраеда исследования структурно-функциональных новой, докозогексаеновой) по сравнению с контсвойств эритроцитов оказались достаточно ин- ролем (p < 0,01–0,05). Соотношение концентраций холестерина и фосфолипидов возрастало
формативными, взаимно дополняя друг друга.
Поскольку состояние фазового перехода за счет снижения уровня общих фосфолипидов
связано с перестройками как в белковых, так и (уменьшалось содержание фосфатидилхолина,
в липидных компонентах, детальное исследо- фосфатидилсерина, фосфатидилэтаноламина и
вание липидного спектра мембран у пациентов сфингомиелина при увеличении относительс алкогольным поражением печени позволило ного содержания лизофракций фосфолипидов)
установить тонкие сдвиги в нем. Определе- (p < 0,02–0,05) [13]. Доля полиненасыщенных
ние содержания фосфолипидов в эритроцитах жирных кислот среди всех жирным кислот в
проводили методом двумерной тонкослойной мембранах эритроцитов является высоко дохроматографии по методу Шталь Э. [11], жир- стоверным независимым маркером внезапной
нокислотного состава мембран эритроцитов – коронарной смерти [14], поэтому параметры
методами газохроматографического и хромато- эритроцитов весьма важны и для прогноза памасс-спектрометрического анализа метиловых тологии, сопутствующей ДПП.
Изменения структуры мембран эритроцитов
эфиров жирных кислот [11]. Мембраны эритроцитов выделяли по методике J.T. Dodge [12]. неизбежно приводят к изменениям их функциЛипидный и жирно-кислотный состав мембран ональных параметров. Изучение электрических
эритроцитов при алкогольном поражении пе- и вязкоупругих характеристик эритроцитов
чени (n = 54, 38,4 ± 1,14 года) характеризовался проводили на четырех фиксированных частоувеличением относительного содержания хо- тах методом диэлектрофореза в неоднородном
лестериновой фракции, насыщенных жирных переменном электрическом поле. У пациентов
кислот и более низким уровнем общих липи- с алкогольным поражением печени выявлены
дов и фосфолипидов, триглицеридов, эфиров прямые взаимосвязи уровня холестериновой
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
23
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Курилович С.А., Кручинина М.В., Громов А.А. и др. Опыт применения новых технологий… /c. 21–30
фракции в мембранах эритроцитов с обобщенными показателями вязкости (r = +0,64, p < 0,02),
жесткости (r = +0,47, p < 0,05), электропроводности (r = +0,57, p < 0,03) и обратные – с амплитудой деформации эритроцитов (r = –0,72,
p < 0,01), поляризуемостью при частоте 106 Гц
(r = –0,53, p < 0,05) [13, 15]. Полученные зависимости позволили судить об изменениях в
структуре мембран эритроцитов по изменениям электрических и вязкоупругих параметров
клеток красной крови.
Одной из важнейших проблем гепатологии
является определение стадии заболевания, степени выраженности фиброза печени, скорости
его прогрессирования, так как это, независимо
от этиологического фактора, определяет прогноз болезни и выбор терапии. Характеристика стадии болезни в гепатологическом диагнозе является обязательным компонентом после
этиологии и активности. Золотым стандартом
оценки степени фиброза печени (стадии заболевания) остается морфологический (гистологический) метод, однако его инвазивность,
необходимость пункционной биопсии печени,
сложности интерпретации результатов при небольшом размере биоптата, неудовлетворительная воспроизводимость заключений, данных
разными морфологами и т. д. стимулируют
разработку неинвазивных или малоинвазивных
способов оценки степени фиброза. Разработка
метода диэлектрофореза эритроцитов в неоднородном переменном электрическом поле (ДЭФ
в НПЭП) [16], а также ЯМР-спектроскопия и
морфометрия эритроцитов позволяют предполагать наличие корреляций между некоторыми
параметрами эритроцитов и степенью фиброза
печени. Для доказательства этой гипотезы параметры эритроцитов были изучены вышеописанными методами в пилотном исследовании у 19
пациентов (от 35 до 60 лет) с ДПП различного
генеза (вирусный, алкогольный, смешанный),
с разной степенью фиброза печени по данным
морфологического исследования. У 5 человек
был легкий или умеренный фиброз (F1-F2), у
14 – выраженный (F3-F4), т. е. прецирротическое состояние или цирроз печени. Группа сравнения (F0) состояла из 33 мужчин сопоставимого возраста, у которых при полном клиническом
и инструментальном исследовании не выявлено
признаков поражения печени и сердца.
Морфология эритроцитов исследовалась в
мазках периферической крови, окрашенных по
Романовскому в световом микроскопе стандартными методиками. При оценке морфологии
эритроцитов была использована классификация
Г.И. Козинца и Ю.А. Симоварта [17], к дефор24
мированным клеткам относили дегенеративно
измененные эритроциты (формы с признаками
дегенерации, причудливой формы, шизоциты,
пойкилоциты).
Показатели морфометрии эритроцитов существенно отличались в зависимости от выраженности фиброза печени. Если в группе здоровых без фиброза (F0) дискоциты составляли 80–85 %, деформированные эритроциты −
5–10 %, сфероциты – 10 % , то при нарастании
фиброза наблюдалось снижение процентного
содержания нормальных форм эритроцитов и
рост числа патологических форм эритроцитов
(рис. 2). Так, уже при наличии легкого или умеренного фиброза (F1-F2) на долю дискоцитов
пришлось только 55–60 %, на долю деформированных эритроцитов – 10–15 %, на долю сфероцитов – 10 %, а 15 % составили триангулоциты,
эхиноциты, стоматоциты и др. При выраженном
фиброзе (F3-F4) до 20–25 % возрастала доля
деформированных эритроцитов, до 25–30 % –
сфероцитов, и еще 10–15 % эритроцитов были
асимметричными или двуямочными, нормальных двояковогнутых клеток оставалось всего
35–40 %. При этом отмечено набухание почти
всех типов эритроцитов вследствие нарушения
осмотического равновесия в крови.
ЯМР-спектроскопия также выявила ряд особенностей, свойственных выраженному фиброзу печени. Так, по данным 13С ЯМР-спектроскопии, фиброз F3-F4 оказался ассоциирован с
повышенными интенсивностями пиков, отражающих резонансы ряда неароматических аминокислот (химический сдвиг, миллионные доли):
цистеина (174,2–57,3–26,0), глицина (173,0–42,0),
глутаминовой кислоты (181,8–175,1–55,2–27,6–
34,0), метионина (174,8–54,7–30,5–29,6–14,7)
(p < 0,001–0,05), и сниженными площадями
большей части остальных пиков спектра (2, 5–
12, 16, 18, 24, 26), содержащими резонансы как
ароматических, так и неароматических аминокислот (p < 0,01–0,05).
При исследовании методом 31Р ЯМР-спектроскопии у пациентов со степенью фиброза F3-F4
были больше площади резонансов глюкозо-6фосфатов, АМФ, ИМФ, пирофосфатов, 2,3-ДФГ
(p < 0,003–0,05) и меньше интенсивности резонансов АТФ (α, β и γ), УТФ (α и γ), Нb- и MgАТФ, β- и α-АДФ по сравнению с аналогичными в подгруппе пациентов со степенью фиброза F1-F2 (p < 0,0001–0,05). Большие по площади
пост-γ-АТФ-плато, пост-α-АТФ-плато достоверно чаще регистрировались у больных со степенью фиброза F3-F4 и в большинстве случаев
(74,6 %) это было сопряжено с отрицательной
клинической и биохимической динамикой.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Курилович С.А., Кручинина М.В., Громов А.А. и др. Опыт применения новых технологий… /c. 21–30
Рис. 2. Морфометрия эритроцитов при различной степени фиброза печени
Чувствительность ЯМР-спектроскопии эритроцитов (1Н, 13С, 31Р) для оценки степени фиброза печени составила 85,71 %, специфичность –
80 %, прогностическая ценность положительного
результата метода – 92,31 %, отрицательного –
66,67 %, индекс точности – 84,21 %.
При изучении электрических и вязкоупругих характеристик эритроцитов оказалось, что
у больных со степенью фиброза F3-F4 преобладали деформированные, предгемолитические
формы эритроцитов (р < 0,05) (см. рис. 2). У этих
пациентов была больше доля клеток с положительным диэлектрофорезом и поляризуемость
на высоких частотах 0,5 и 1 МГц (p < 0,001–
0,05), меньше − поляризуемость клеток на низких частотах (0,05 и 0,1 МГц) (p < 0,01–0,001).
При степени фиброза F3-F4 были увеличены
значения обобщенных показателей жесткости,
вязкости, среднего радиуса, индекса агрегации, деструкции, а также электрической проводимости мембраны эритроцитов и снижены
амплитуды деформации под действием НПЭП
(p < 0,001–0,05) (рис. 3).
Диагностическая точность метода диэлектрофореза эритроцитов в определении степени
фиброза печени оказалась удовлетворительной:
68,42 % при чувствительности 71,43 %, специфичности 60 %, прогностической ценности положительного результата 83,33 %, отрицательного – 42,86 %.
Для различной степени фиброза печени
рассчитаны дискриминирующие значения интегральных интенсивностей резонансов ЯМРспектров, электрических и вязкоупругих характеристик эритроцитов.
Таким образом, данные, полученные с помощью неинвазивных аппаратных методов (ДЭФ
эритроцитов в НПЭП и ЯМР-спектроскопия),
позволяют делать заключения о стадии ДПП
(т. е. степени выраженности фиброза печени)
[16, 18−24]. Кроме того, исследование параметров эритроцитов данными методами позволило
выявить особенности биохимической активности процесса, связанные с генезом заболевания.
Установленные корреляции между показателями диэлектрофореза и ЯМР-спектроскопии отражают патогенетические сдвиги в мембранах
клеток.
У пациентов с различной этиологией процесса наблюдалось изменение положения рав-
Рис. 3. Разделение и деформация эритроцитов у лиц: a – группы сравнения; b – больных со степенью фиброза
F1-F2; c, d – больных со степенью фиброза F3-F4 в неоднородном переменном электрическом поле при
частотах: a, b, c – 1 МГц, d – 0,1 МГц
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
25
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Курилович С.А., Кручинина М.В., Громов А.А. и др. Опыт применения новых технологий… /c. 21–30
Рис. 4. Зависимость степени поляризации эритроцитов от частоты неоднородного переменного
электрического поля. Показаны положения равновесных частот: 1 – у больных с хроническими вирусными гепатитами, 2 – у лиц группы
сравнения, 3 – у больных с алкогольным поражением печени
новесной частоты в НПЭП: при вирусной
этиологии процесса равновесная частота была
достоверно чаще (p < 0,05) смещена в область
более низких частот (0,1 МГц), в то время как
при алкогольном и смешанном генезе заболевания − напротив, в область более высоких частот (более 0,5 МГц) при условии одинакового
представительства разных стадий заболевания
в группах (рис. 4).
Наиболее жесткими, вязкими и плохо деформируемыми оказались эритроциты больных с
патологией печени алкогольного и смешанного
генеза, достоверно отличаясь по этим параметрам от клеток пациентов с поражениями печени вирусами гепатита С и В (p < 0,0001–0,05)
(см. таблицу). Получены высокодостоверные
сильные обратные корреляции жесткости эритроцитов и амплитуды деформации (r = –0,78,
p < 0,002). Соответственно, индекс агрегации
эритроцитов в растворе диэлектрика был наибольшим при алкогольном и смешанном генезе
заболевания.
Высокая электропроводность мембран и
относительная поляризуемость прямо коррелировали с показателями, характерными для синдрома цитолиза (АсАТ, АлАТ; концентрация
в сыворотке крови железа), воспалительного
синдрома (изменение белково-осадочных проб,
повышение уровней IgG, IgM, IgA) и синдрома
печеночно-клеточной недостаточности (снижение содержания в сыворотке крови общего белка, особенно альбуминов, протромбина,
холестерина) и обратно – с биохимическими
проявлениями синдрома холестаза (повышение
активности экскреторных ферментов щелочной
фосфатазы, гамма-глутамилтранспептидазы).
Гипербилирубинемия с повышением содержания как прямой, так и непрямой фракций ока26
залась обратно связанной с величиной среднего
радиуса эритроцитов (для общего билирубина
r = –0,916, p < 0,004; для прямого билирубина
r = –0,859, p < 0,013; для непрямого билирубина
r = –0,847, p < 0,016). Повышение уровня общего холестерина положительно коррелировало с
жесткостью клеток, а содержание холестерина
липопротеинов высокой плотности − с электропроводностью мембран (r = +0,259, p < 0,05)
и относительной поляризуемостью (r = +0,272,
p < 0,042).
Наиболее убедительные корреляции электрических и вязкоупругих параметров эритроцитов получены с резонансами карбоксильной,
олефиновой, областей замещенных метилом
групп на 13С ЯМР-спектрах взвесей эритроцитов. Величины поляризуемости, долей клеток
с положительным и отрицательным диэлектрофорезом продемонстрировали разнонаправленный характер связей с характеристиками
резонансов углеродного спектра, зависящий от
частоты НПЭП. Обратные корреляции между
величинами интенсивности сигналов АТФ (α, β
и γ, Нb-АТФ, Мg-АТФ) и значениями электропроводности, относительной поляризуемости,
жесткости, среднего радиуса, индекса агрегации, вязкости и прямые связи – с амплитудой
деформации эритроцитов под действием НПЭП
являются отражением сниженной способности
клеток к деформации при уменьшении в них
запасов макроэргических соединений. Корреляции с интенсивностью монофосфатных пиков,
высотой 2,3-дифосфоглицерата, неорганических
фосфатов и окружающих их пиков свидетельствуют о включении компенсаторных механизмов по мере прогрессирования патологического
процесса. У пациентов с алкогольным поражением печени проявились обратные зависимости
между электропроводностью, относительной
поляризуемостью, жесткостью, средним радиусом, индексом агрегации, вязкостью и высотой
пиков γ-УТФ , α-АДФ, интенсивностью резонанса α-УТФ, причем сила связей возрастала по
мере утяжеления процесса в печени [15, 19, 20].
В последующем детальное изучение фракционного состава фосфолипидной фракции мембран эритроцитов и динамики электрических и
вязкоупругих характеристик эритроцитов при
ДПП на фоне фосфолипидзамещающей терапии
послужило патогенетическим основанием назначения эссенциальных фосфолипидов (ЭФЛ)
при этой патологии. У 38 пациентов (возраст от
36 до 57 лет) с хроническим гепатитом вирусного, алкогольного и смешанного генеза были
исследованы фосфолипидный состав мембран
эритроцитов и электрические и вязкоупругие
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
П р и м е ч а н и е . Отличие от величины соответствующего параметра в группе 1 достоверно: * – при p < 0,05, ** – при p < 0,005, *** – при p < 0,0001; отличие от величины соответствующего параметра в группе 2 достоверно: ^ – при p < 0,05, ^^ – при p < 0,002, ^^^ – при p < 0,0001; отличие от величины соответствующего параметра
в группе 3 достоверно: # – при p < 0,05, ## – при p < 0,001, ### – при p < 0,0001.
7,14 + 0,59***^^^
7,36 ± 0,363##
4,93 ± 0,254##
0,79 ± 0,287*^#
18,1 ± 6,96**^^
4-я (алкогольное
поражение, n = 53)
0,74 ± 0,032 1,05 ± 0,170*^ 0,70 ± 0,102*^^^
0,46 ± 0,204***^^ 9,84 ± 1,450**^^ 11,42 ± 0,397***^^^ 8,46 + 0,67***^^^
8,44 ± 0,156*^
0,97 ± 0,178
9,73 ± 1,45*^
3-я (смешанный генез,
n = 34)
0,69 ± 0,044
2,32 + 0,86
5,93 ± 0,278
5,78 ± 1,370
1,14 ± 0,167
1,31 ± 0,142
0,71 ± 0,125
4,04 ± 0,708
2-я (вирус гепатита С,
n = 28)
0,54 ± 0,023
1,87 + 0,78
6,74 ± 2,39·10-15
6,07 ± 0,213
1,37 ± 0,219
1,49·± 0,379
0,70 ± 0,1801
4,74 ± 0,839
1-я (вирус гепатита В,
n = 31)
0,55 ± 0,034
Емкость клеточной
мембраны, 10-14 Ф
Электропроводность,
10-5 см/м
Поляризуемость
при 106 МГц,
10-15 м3
Амплитуда
деформации
эритроцитов
при 106 МГц,
10-6 м
Обобщенный
Индекс
показатель
агрегации
вязкости,
эритроцитов,
Па ⋅ с
усл. ед.
Обобщенный
показатель
жесткости,
10-6 Н/м
Группа больных
(этиология поражения
печени)
Вязкоупругие и электрические характеристики эритроцитов (Er) при диффузной патологии печени
различного генеза (среднее ± ошибка среднего)
Индекс деструкции эритроцитов, %
Таблица
Курилович С.А., Кручинина М.В., Громов А.А. и др. Опыт применения новых технологий… /c. 21–30
параметры эритроцитов в динамике лечения
ЭФЛ. На фоне курсовой терапии ЭФЛ отмечено достоверное увеличение пластичности,
поляризуемости, емкости, скорости движения
эритроцитов к электродам и снижение величин
обобщенных показателей вязкости, жесткости,
электропроводности, индексов агрегации и деструкции (p < 0,001–0,05), что может отражать
улучшение функционального состояния мембран гепатоцитов и служить патогенетическим
обоснованием применения ЭФЛ. Особенно выраженным оказалось изменение электрической
емкости мембран эритроцитов (р < 0,001), отражающей степень диспротеинемии при ДПП.
Получены прямые корреляции этого показателя с уровнем альбуминов (r = 0,511, p < 0,044)
и обратные с содержанием гамма-глобулинов
(r = –0,476, p < 0,05). В динамике лечения отмечено снижение активности трансаминаз, которые зависели от электроповодности (r = 0,927,
p < 0,003 для АлАТ и r = 0,520, p < 0,048 для
АсАТ) и поляризуемости (r = –0,908, p < 0,005
для АлАТ и r = –0,63, p < 0,004 для АсАТ) [25].
Таким образом, методика диэлектрофореза
эритроцитов может быть использована не только для диагностики ДПП, но и для контроля за
эффективностью проводимой терапии.
Изучение особенностей электрических и
вязкоупругих параметров эритроцитов у пациентов с непрямыми гипербилирубинемиями
позволило использовать полученные данные
в целях дифференциальной диагностики [26].
В исследование включено 28 пациентов (мужчины в возрасте от 17 до 67 лет) с непрямыми
гипербилирубинемиями, 20 из которых (71,4 %)
наблюдались с диагнозом «синдром Жильбера», оставшиеся – с диагнозом «непрямая гипербилирубинемия неясного генеза». Группа
больных с непрямыми гипербилирубинемиями
разнородна по поведению эритроцитов в неоднородном переменном электрическом поле. Для
пациентов с синдромом Жильбера характерны
умеренно сниженная пластичность эритроцитов на фоне слегка повышенных обобщенных
показателей вязкости, жесткости, емкости и
электропроводности мембран клеток, единичный лизис эритроцитов на низких частотах с
последующей умеренно повышенной агрегацией клеток по сравнению с группой контроля и
больных с эритроцитарными непрямыми гипербилирубинемиями (р < 0,0001–0,05). Для пациентов, непрямая гипербилирубинемия которых
определяется состоянием эритроцитов, типична
значительно сниженная поляризуемость на всех
частотах, резко повышенная склонность клеток
к гемолизу и образованию агрегатов при сохра27
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Курилович С.А., Кручинина М.В., Громов А.А. и др. Опыт применения новых технологий… /c. 21–30
ненной или слегка сниженной деформируемости эритроцитов (р < 0,001–0,02). Высокие значения индекса деструкции на всех частотах определяют высокие значения индекса агрегации,
поскольку высвобождающийся при разрушении
эритроцитов АДФ является мощным индуктором образования агрегатов, в том числе и лейкоцитарно-тромбоцитарных [27].
ЗАКЛЮЧЕНИЕ
Таким образом, исследование параметров
эритроцитов, включая их структурно-функциональные характеристики, различными методами (капиллярная вискозиметрия, исследование удельной электропроводности, АТФазной
активности мембран, двумерная тонкослойная
хроматография, газохроматографический и
хромато-масс-спектрометрический анализ, диэлектрофорез в НПЭП, 13С, 31Р, 1Н ЯМР-спектроскопия) позволяет, наряду с клиническими данными, сделать заключение по целому комплексу вопросов при диффузной патологии печени,
в частности, решить некоторые вопросы дифференциальной диагностики, оценить степень
фиброза печени, контролировать эффективность
проводимой терапии. Наибольшую ценность,
на наш взгляд, представляет метод диэлектрофореза эритроцитов в НПЭП как наименее трудоемкий, имеющий высокую пропускную способность и высокую информативность.
СПИСОК ЛИТЕРАТУРЫ
1. Гастроэнтерология. Национальное руководство / Под ред. В.Т. Ивашкина, Т.Л. Лапиной.
М., 2008. 700 с.
Gastroenterology. National guidance / Eds.
V.T. Ivashkin, T.L. Lapina. M., 2008. 700 p.
2. Подымова С.Д. Болезни печени. М., 1993.
544 c.
Podymova S.D. Liver diseases. M., 1993. 544 p.
3. Маевская М.В. Патогенез алкогольной болезни печени и роль генетической предрасположенности в ее развитии // Клинич. перспективы
гастроэнтерол., гепатол. 2004. (5). 2–11.
Maevskaya M.V. Pathogenesis of alcoholic liver
disease and the role of genetic predisposition to its
development // Klinich. perspektivy gastroenterol.,
gepatol. 2004. (5). 2–11.
4. Руководство по лабораторным методам диагностики / Под ред. проф. А.А. Кишкуна. М., 2007.
800 с.
Guidelines for laboratory diagnostic techniques /
Ed. prof. A.A. Kiskun. M., 2007. 800 p.
5. Геннис Р. Биомембраны: Молекулярная
структура и функции. М., 1997. 624 c.
Gennis P. Biomembranes: Molecular structure
and function. M., 1997. 624 p.
28
6. Новицкий В.В., Рязанцева Н.В., Степовая Е. А. Физиология и патофизиология эритроцита. Томск, 2004. 202 c.
Novitsky V.V., Ryazantseva N.V., Stepovaya E.V.
Physiology and pathophysiology of the erythrocyte.
Tomsk, 2004. 202 p.
7. Куницын В.Г., Хавин П.П., Куимов А.Д. Реологические свойства взвесей эритроцитов больных острым инфарктом миокарда в области физиологических температур // Бюл. экспер. биол.
мед. 1983. (5). 64–67.
Kunitsyn V.G., Khavin P.P., Kuimov A.D. Rheological properties of suspensions of red blood cells of
patients with acute myocardial infarction in the field
of physiological temperature // Byul. exper. biol. med.
1983. (5). 64–67.
8. Некрасова М.Ф. Структура и функции эритроцитарных мембран в норме и при поздних токсикозах беременных отечно-нефротического ряда:
автореф. дис. ... канд. мед. наук. Новосибирск,
1988.
Nekrasova M.F. Structure and function of erythrocyte membranes in normal and late toxicosis of edematous-nephrotic range pregnants: abstract of thesis ...
candidate of medical sciences. Novosibirsk, 1988.
9. Пат. 2076621 РФ. Способ воздействия вращающимся электрическим полем низкой частоты
на лабораторных животных / А.Д. Белкин, Р.Ш. Ибрагимов; опубл.10.04.1997.
Patent 2076621 RF. Method of exposure of
rotating electric field of low frequency to laboratory
animals / A.D. Belkin, R.Sh. Ibragimov; published
10.04.1997.
10. Куницын В.Г., Курилович С.А., Волченко М. В. Изменение удельной электропроводности
«теней» эритроцитов и гемоглобина при алкоголизме // Бюл. экспер. биол. мед. 1993. (12). 595–
598.
Kunitsyn V.G., Kurilovich S.A., Volchenko M.V.
Changing the conductivity of «shadows» of red blood
cells and hemoglobin at alcoholism // Byul. exper.
biol. med. 1993. (12). 595–598.
11. Кейтс М. Техника липидологии. Выделение, анализ и идентификация липидов: Пер. с
англ. М., 1975. 536 с.
Kates M. Technique of lipidology. Isolation, analysis and identification of lipids: Trans. from English.
M., 1975. 536 p.
12. Dodge J.T., Mitchell C., Hanahan D.J. The
preparation and chemical characteristics of hemoglobin-free ghosts of human erythrocytes // Arch. Biochem. Biophys. 1963. 100. 118–130.
13. Кручинина М.В., Курилович С.А., Громов А. А. и др. Алкогольное поражение печени:
взаимосвязь электрических, вязкоупругих характеристик эритроцитов и структуры их мембран //
Вестн. НГУ. 2008. 6. (2). 96–103.
Kruchinina M.V., Kurilovich S.A., Gromov A.A.
et al. Alcoholic liver disease: correlation between
electrical, viscoelastic properties of red blood cells
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Курилович С.А., Кручинина М.В., Громов А.А. и др. Опыт применения новых технологий… /c. 21–30
and the structure of their membranes // Vestn. NGU.
2008. 6. (2). 96–103.
14. De Backer G., Ambrosioni E., Borch-Johnsen K. et al. European guidelines on cardiovascular
disease prevention in clinical practice. Third Joint
Task Force of European and Other Societies on Cardiovascular Disease Prevention in Clinical Practice //
Eur. Heart. J. 2003. 24. 1601–1610.
15. Курилович С.А., Кручинина М.В., Генералов В.М. и др. Электрические параметры и структура мембран эритроцитов при диффузных заболеваниях печени // Рос. журн. гастроэнтерол.,
гепатол., колопроктол. 2009. XIX. (2). 30–36.
Kurilovich S.A., Kruchinina M.V., Generalov
V.M. et al. Electrical parameters and the structure
of erythrocyte membranes in diffuse liver diseases
// Ros. zhurn. gastroenterol., gepatol., koloproktol.
2009. XIX. (2). 30–36.
16. Пат. 2296327 РФ. Способ дифференциальной диагностики заболеваний печени / В.М. Генералов, Т.С. Бакиров, А.В. Пак и др.; опубл.
27.03.2007.
Patent 2296327 RF. Method of differential
diagnosis of liver diseases / V.M. Generalov, T.S. Bakirov, A.V. Pak et al.; published 27.03.2007.
17. Козинец Г.И., Симоварт Ю.А. Поверхностная архитектоника клеток периферической крови
в норме и при заболеваниях системы крови. Таллин: Валгус, 1984. 116 с.
Kozinets G.I., Simovart Yu.A. Surface architectonics of peripheral blood cells in health and blood system disorders. Tallin: Valgus, 1984. 116 p.
18. Кручинина М.В., Курилович С.А., Паруликова М.В., Шакиров М.М. ЯМР-спектроскопия эритроцитов у больных с патологией печени (предварительные результаты) // Эксперим. клинич.
гастроэнтерол., гепатол. 2003. Прил. 2. 28–33.
Kruchinina M.V., Kurilovich S.A., Parulikova
M.V., Shakirov M.M. NMR spectroscopy of red blood
cells in patients with liver pathology (preliminary
results) // Experim. klinich. gastroenterol., gepatol.
2003. Suppl. 2. 28–33.
19. Кручинина М.В., Курилович С.А., Паруликова М.В. и др. Особенности вязкоупругих и электрических характеристик эритроцитов у больных
с гепатитами и циррозами печени // Материалы
5-й Восточно-Сибирской гастроэнтерологической
конференции с международным участием «Клинико-эпидемиологичеcкие и этноэкологические
проблемы заболеваний органов пищеварения».
Красноярск, 2005. 230–238.
Kruchinina M.V., Kurilovich S.A., Parulikova M. V.
et al. Features of the viscoelastic and electrical properties of red blood cells in patients with hepatitis
and cirrhosis // Proceedings of the 5th East-Siberian
gastroenterology conference with international participation «The clinical, epidemiological and ethnoБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
environmental problems of digestive diseases». Krasnoyarsk, 2005. 230–238.
20. Кручинина М.В., Курилович С.А., Паруликова М.В. и др. Электрические и вязкоупругие свойства эритроцитов у больных с диффузной патологией печени // Докл. АН. 2005. 401. (5). 701–704.
Kruchinina M.V., Kurilovich S.A., Parulikova M. V.
et al. Electric and viscoelastic properties of red blood
cells in patients with diffuse hepatic pathology //
Dokl. AN. 2005. 401. (5). 701–704.
21. Кручинина М.В., Курилович С.А., Паруликова М.В. и др. Вязкоупругие и электрические характеристики эритроцитов при различной степени
фиброза печени // Вестн. НГУ. 2005. 3. (4). 43–52.
Kruchinina M.V., Kurilovich S.A., Parulikova M. V. et al. Viscoelastic and electrical characteristics of erythrocytes in varying degrees of hepatic
fibrosis // Vestn. NGU. 2005. 3. (4). 43–52.
22. Кручинина М.В., Курилович С.А., Паруликова М.В. и др. 31Р ЯМР-спектроскопия эритроцитов
и фиброз печени: пилотное исследование // Бюл.
СО РАМН. 2006. (4). 23–28.
Kruchinina M.V., Kurilovich S.A., Parulikova M. V.
et al. 31P NMR spectroscopy of red blood cells and
liver fibrosis: a pilot study // Byul. SO RAMN. 2006.
(4). 23–28.
23. Kruchinina M.V., Generalov V.M., Kurilovich
S.A. et al. Viscoelastic and electric characteristics of
erythrocytes at different degrees of hepatic fibrosis //
J. Global Toxin Rev. 2007. 10. 25–36.
24. Кручинина М.В., Курилович С.А., Шакиров
М.М., Кулагина Е.А. 13С ЯМР-спектроскопия эритроцитов в диагностике фиброза печени: пилотное
исследование // Материалы 8-й Восточно-Сибирской гастроэнтерологической конференции с
международным участием «Клинико-эпидемиологические и этноэкологические проблемы заболеваний органов пищеварения». Красноярск, 2008.
297–303.
Kruchinina M.V., Kurilovich S.A., Shakirov M.M.,
Kulagina E.A. 13C NMR spectroscopy of erythrocytes
in the diagnosis of liver fibrosis: a pilot study // Proc.
8th East-Siberian gastroenterology conference with
international participation «The clinical, epidemiological and ethno-environmental problems of digestive diseases». Krasnoyarsk, 2008. 297–303.
25. Курилович С.А., Кручинина М.В., Громов А. А.
и др. Обоснование применения эссенциальных
фосфолипидов при хронических заболеваниях печени: динамика электрических и вязкоупругих параметров эритроцитов // Эксперим. клинич. гастроэнтерол. 2010. (11). 46–52.
Kurilovich S.A., Kruchinina M.V., Gromov A.A. et
al. Substantiation for the use of essential phospholipids in chronic liver diseases: dynamics of electrical
and viscoelastic parameters of erythrocyte // Experim.
klinich. gastroenterol. 2010. (11). 46–52.
29
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Курилович С.А., Кручинина М.В., Громов А.А. и др. Опыт применения новых технологий… /c. 21–30
26. Кручинина М.В., Курилович С.А., Светлова И.О. и др. Диэлектрофорез эритроцитов: новые
возможности в диагностике непрямых гипербилирубинемий // Бюл. СО РАМН. 2009. (3). 29–35.
Kruchinina M.V., Kurilovich S.A., Svetlova I.O. et
al. Dielectrophoresis of red blood cells: new possi-
bilities in the diagnosis of indirect hyperbilirubinemia
// Byul. SO RAMN. 2009. (3). 29–35.
27. Исследование системы крови в клинической практике / Под ред. Г.И. Козинца, В.А. Макарова. М., 1997. 480 с.
The blood system investigation in clinical practice
/ Eds. G.I. Kozinets, V.A. Makarov. M., 1997. 480 p.
EXPERIENCE IN APPLYING NEW TECHNOLOGIES FOR LEARNING
COMPLEX OF PARAMETERS OF ERYTHROCYTES AT DIFFUSE LIVER DISEASES
Svetlana Arsentevna KURILOVICH1, Margarita Vitalievna KRUCHININA1,
Andrey Aleksandrovich GROMOV1, Elena Gennadievna NEMTSOVA1,
Vladimir Mikhailovich GENERALOV2, Talgat Sal’manovich BAKIROV2,
Makhmud Minakhmetovich SHAKIROV3, Vladimir Aleksandrovich RIKHTER4,
Dmitry Vladimirovich SEMENOV4
1 Institute
of Internal Medicine SB RAMS 630089, Novosibirsk, Boris Bogatkov str., 175/1
2 Federal
Service for Surveillance in Consumer Rights Protection and Human Welfare Federal
State Unitary Enterprise State Research Center of Virology and Biotechnology «Vector»
630559, Novosibirsk region, Novosibirsk district, Koltsovo
3 N.N.Vorozhtsov
Novosibirsk Institute of Organic Chemistry SB RAS
630090, Novosibirsk, Akademik Lavrentiev av., 9
4 Institute
of Chemical Biology and Fundamental medicine SB RAS,
630090, Novosibirsk, Akademik Lavrentiev av., 8
The results of the study on parameter set of red blood cells, including their structural and functional characteristics
obtained with different methods (capillary viscometry, study of conductivity, investigation of membranes ATPase
activity, two-dimensional thin-layer chromatography, gas-chromatography and gas chromatography-mass spectrometry analysis, dielectrophoresis in a nonuniform alternating electric field, 13C, 31P and 1H NMR spectroscopy) at
diffuse liver disease have been presented. Using new technologies along with clinical data allows us to conclude on
a range of issues of Hepatology, in particular to solve some problems of differential diagnosis, to assess the degree
of liver fibrosis (with fairly high levels of sensitivity and specificity), the genesis of the activity, the complications of
the disease, the therapy effictieveness control. The most promising method of erythrocytes dielectrophoresis being
the least labor–consuming has high throughput and information capacity.
Key words: liver pathology, erythrocytes, diagnostic methods.
Kurilovich S.A. – doctor of medical sciences, professor, head of the laboratory of gastroenterology,
e-mail: kurilovich@yandex.ru
Kruchinina M.V. – doctor of medical sciences, leading researcher of the laboratory of gastroenterology,
e-mail: kruchmargo@yandex.ru
Gromov A.A. – candidate of medical sciences, senior researcher of the laboratory of clinical and biochemical
studies, e-mail: gromov.center@rambler.ru
Nemtsova E.G. – postgraduate student, junior researcher of the laboratory of gastroenterology,
e-mail: neg-85@yandex.ru
Generalov V.M. – candidate of technical sciences, leading researcher, head of the laboratory of biophysical
analysis, e-mail: vmgeneral@mail.ru
Bakirov T.S. – candidate of technical sciences, senior researcher of the laboratory of biophysical analysis,
e-mail: bakirov@vector.nsc.ru
Shakirov M.M. – senior researcher of the laboratory of biochemical and biophysical research methods,
e-mail: mmsh@nioch.nsc.ru
Richter V.A. – candidate of biological sciences, deputy director for research, head of the laboratory of
biotechnology, e-mail: richter@niboch.nsc.ru
Semenov D.V. – candidate of biological sciences, senior researcher of the laboratory of biotechnology,
e-mail: Semenov@niboch.nsc.ru
30
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК 612.821.6: 612.822.3
ИНТЕРФЕРЕНЦИОННЫЕ ПРОЦЕССЫ СЕЛЕКЦИИ ИНФОРМАЦИИ
ПРИ КОНВЕРГЕНТНОМ/ДИВЕРГЕНТНОМ МЫШЛЕНИИ:
РОЛЬ ИНДИВИДУАЛЬНОГО ПРОФИЛЯ ПОЛУШАРНОЙ АСИММЕТРИИ
Анастасия Юрьевна КАРАЗАЕВА, Ольга Михайловна РАЗУМНИКОВА
НИИ физиологии СО РАМН
630117, г. Новосибирск, ул. Тимакова, 4
С использованием латерализованного предъявления иерархически организованных букв изучены взаимосвязи интеллекта и креативности с полушарными особенностями внимания и выяснено значение индивидуального профиля моторной асимметрии. Показано, что чем сильнее эффекты интерференции конкурирующих
свойств стимулов, тем меньше интеллект и менее выражено типичное доминирование правой руки, но больше креативность. Во взаимосвязи между интеллектом и интерференционными селективными процессами
сравнительно большее значение имеет левое полушарие, а между креативностью и эффектом интерференции – правое. Индивидуальные стратегии достижения творческой продуктивности связаны со степенью вовлечения правого полушария в решение проблемы и характером межполушарного взаимодействия и зависят
как от вербальной или образной природы креативного задания, так и от профиля моторной асимметрии.
Ключевые слова: креативность, интеллект, селекция информации, полушарная асимметрия, левши.
Термины «конвергентное» и «дивергентное» мышление были предложены Гилфордом
для противопоставления операций, соответственно приводящих либо к единственно верному решению, либо к разнообразным решениям проблемы, каждое из которых может быть
верным. Считается, что высокий уровень интеллектуальных способностей определяется успешностью конвергентного мышления, а творческая деятельность в большей мере зависит от
эффективности дивергентного. Ранее при анализе ЭЭГ коррелятов арифметических действий
(модель конвергентного мышления) и решения
эвристической задачи (модель дивергентного
мышления) нами было показано особое информативное значение правого полушария и межполушарного взаимодействия [1, 2].
Рассматривая особенности селекции информации при этих видах мышления, следует
отметить, что с дивергентным связывают преимущественно «дефокусированное» внимание,
позволяющее обрабатывать информацию с привлечением широко распределенных нейронных
сетей [3], тогда как для конвергентного требуется, напротив, эффективная концентрация
внимания. Упомянутые данные о взаимосвязи
креативности и активности мозга или креативности и внимания были получены с привлечением праворуких участников экспериментов, у
левшей они практически не изучены.
Учитывая, что полушарные взаимодействия
отличаются у левшей большей эффективностью
вследствие выявленных у них особенностей
морфологии и структуры мозолистого тела [4,
5], следует ожидать различий и в показателях
творческой деятельности у левшей и правшей.
Основанием для такой гипотезы могут быть
хорошо известные факты о полушарной специфике вербальных функций у левшей и организации межполушарного торможения [6−8], а
также мнение, что среди талантливых людей
левши встречаются чаще, чем в общей популяции [9, 10]. Однако немногочисленные исследования показателей интеллекта и креативности у левшей довольно противоречивы, так
как свидетельствуют и об их превосходстве,
и о более низких значениях, и об отсутствии
различий с правшами [11–14]. Поэтому первой
задачей, поставленной нами, стало изучение
показателей конвергентного и дивергентного
мышления в зависимости от индивидуального
профиля полушарной асимметрии.
Согласно гипотезе «нейронной эффективности» [15], основой интеллекта является эффективная селекция информации в локальных
нейронных системах мозга, специфика которых
определяется природой этой информации (вербальной, образной и т. д.). Поиск оригинальной
идеи, напротив, требует извлечения информации из отдаленных семантических категорий и,
Каразаева А.Ю. – аспирант
Разумникова О.М. – д.б.н., главный научный сотрудник, е-mail: razum@physiol.ru
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
31
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Каразаева А.Ю., Разумникова О.М. Интерференционные процессы селекции информации… /c. 31–38
соответственно, общего ослабления активационного состояния коры за счет «дефокусирования» внимания [3]. Таким образом, второй задачей исследования стало изучение взаимосвязи
продуктивности конвергентного/дивергентного
мышления и полушарных особенностей селективных процессов при конфликте релевантной
и иррелевантной информации у лиц, отличающихся профилем сенсомоторной асимметрии.
Для этого нами была использована парадигма
Д. Навона [16], которая широко применяется
для выяснения индивидуальных особенностей
организации зрительного восприятия человека.
Конфликтные варианты восприятия иерархически составленных больших букв из маленьких,
не совпадающих по своему значению, позволяют выяснить, какой эффект интерференции,
глобального или локального уровня, наиболее
характерен для данного индивида. Так как правое полушарие характеризуется большей специализацией в целостном восприятии сигнала
и глобальной стратегии анализа информации, а
левое – локальной [17], то можно было предположить, что конвергентное мышление будет в
большей степени связано с левополушарными
особенностями селективных процессов, а дивергентное – с правополушарными.
МАТЕРИАЛ И МЕТОДЫ
В исследовании приняли участие 84 студента 17–22 лет с нормальным или скорректированным до нормального зрением. Все испытуемые
дали информированное согласие на участие в
экспериментах, которые были одобрены Этическим комитетом НИИ физиологии и выполнялись в соответствии с этическими нормами
Хельсинкской декларации (2000 г.).
Для определения индивидуальной моторной
асимметрии использовали опросник Аннетт,
согласно которому необходимо было по 5-балльной системе (–2 для постоянной реакции левой руки, +2 – правой и 0 – смешанная реакция)
оценить степень использования правой или левой руки при выполнении 12 операций [18], и 4
пробы для оценки асимметрии ног [19]. Для исследования показателей образной креативности
применяли субтест Е.П. Торренса «Незавершенные фигуры», вербальной – «Когнитивный
синтез». Оригинальность образов вычисляли
как величину, обратную частоте встречаемости образов, придуманных с использованием
каждого из десяти стимулов – графических
фрагментов, на основе сравнения с предварительно созданной базой данных. Вербальную
оригинальность – как редкость встречаемости
32
смысла предложений, придуманных с использованием трех существительных из отдаленных
семантических категорий. Для оценки уровня
вербального и образного интеллекта применяли тест структуры интеллекта Амтхауэра. Психологическую часть исследования проводили в
течение месяца, предшествующего тестированию внимания. Подробнее методики психометрического тестирования описаны ранее в ряде
наших работ [20].
Для изучения особенностей процессов интерференции в ситуациях «глобального» и «локального» внимания использовали парадигму
Навона [16]. «Глобальными» стимулами были
большие буквы Н, Е, А, Б, которые состояли
из таких же меньших размеров («локальных»).
Использовали все комбинации больших и маленьких букв, т. е. НЕ, НА, НБ, ЕН и т. д., в том
числе – конгруэнтные (например, ЕЕ или НН)
или неконгруэнтные (например, ЕН или НЕ) их
комбинации. Вертикальный размер больших
букв составлял 4,5°, горизонтальный – 3,3°;
маленьких − соответственно 0,7° и 0,6°. Автор
компьютерной программы Р.М. Суслов.
Стимулы в псевдослучайном порядке предъявляли на 15-дюймовом мониторе на расстоянии
5° слева или справа от центральной точки фиксации взгляда (расстояние от глаз до монитора
54 см). Время предъявления точки фиксации
500 мс. Одновременно с ней на 160 мс предъявляли стимулы. Промежуток между началом
предъявления стимулов составлял 1500 мс.
Использовали 4 серии предъявления стимулов. Целью двух первых было изучение особенностей идентификации глобальных и локальных стимулов, а двух других – селекции
глобальных и локальных стимулов в разных
ситуациях их сравнения: при предъявлении
двух стимулов либо в левое, либо в правое,
либо одновременно в оба поля зрения. В настоящем исследовании представлены результаты
анализа данных в серии сравнения иерархически организованных букв. Согласно инструкции
необходимо было, сравнивая две буквы, реагировать нажатием клавиши «да» на одинаковые
глобальные стимулы «Н» или «Е» (рис. 1, а) и
на клавишу «нет» при появлении всех других
комбинаций стимулов. В серии изучения внимания на локальном уровне требовалось выделять одинаковые локальные «н» или «е» (рис. 1,
б). В каждой серии было предъявлено 160 стимулов, 50 % которых составляли целевые. Во
всех сериях регистрировали время реакции для
правильных ответов и число ошибок для разных вариантов предъявления стимулов.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Каразаева А.Ю., Разумникова О.М. Интерференционные процессы селекции информации… /c. 31–38
бальных процессов достоверных связей с ЭИлг
не обнаружено.
Таким образом, чем сильнее эффекты интерференции конкурирующих свойств стимулов, тем меньше интеллект, но больше креативность.
Рис. 1. Пример стимулов, предъявляемых в оба поля
Роль индивидуального профиля асимметзрения: а – при сравнении глобальных свойств рии. При корреляционном анализе асимметрии
букв, б – локальных
использования правой или левой руки установлена отрицательная связь этого показателя со
Степень выраженности эффекта интерфе- значениями вербальной и образной оригинальренции (ЭИ) при конкуренции конгруэнтных ности (–0,19 < Ккор < –0,22; p < 0,05), а также с
и неконгруэнтных или локальных и глобаль- выраженностью эффекта интерференции (см.
ных свойств стимулов вычисляли как разницу табл. 1). Типичное доминирование правой руки
между временем реакции на стимулы каждого и правой ноги было негативно связано с ЭИк
вида (неконгруэнтные минус конгруэнтные или при внимании к локальным свойствам стимулокальные минус глобальные), отнесенную ко лов. Положительная связь была характерна
времени реакции на конгруэнтный или гло- между степенью доминирования правой ноги
бальный стимул соответственно. При статис- и левополушарным ЭИл при конгруэнтном
тическом анализе данных использовали пара- предъявлении букв. Таким образом, усиление
метрические и непараметрические методы, так показателя левшества соответствует тем полукак распределение показателей интеллекта и
Таблица 1
ЭИ соответствовало нормальному, а для сенсоКорреляционные связи между эффектом
моторной асимметрии и креативности имело
интерференции
и показателями моторной
соответственно правостороннюю или левостоасимметрии или интеллекта/креативности
роннюю асимметрию.
Коррелирующие показатели Коэф_кор t(N-2)
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
Корреляционный анализ интерференционных процессов при селекции конгруэнтныхнеконгруэнтных стимулов (ЭИк) показал, что
образный компонент интеллекта (IQf) был негативно связан со степенью интерференции
между конгруэнтными и неконгруэнтными
глобальными стимулами при их сравнении в
двух полушариях (ЭИк_глМП); для вербального компонента (IQv) такая негативная корреляция с ЭИк_глМП была близка к достоверной
(табл. 1).
Оригинальность образного дивергентного мышления положительно коррелировала с
ЭИк для локальных стимулов, адресованных
правому полушарию или одновременно двум
(соответственно, ЭИк_локПП и ЭИк_локМП в
табл. 1), а оригинальность вербального мышления была связана положительно с ЭИк_локПП,
но отрицательно − с ЭИк_глМП. Пример взаимосвязи показателей образной оригинальности
и ЭИк_локМП показан на рис. 2, а.
В случае анализа роли интерференционных
процессов при селекции локальных-глобальных
свойств стимулов (ЭИлг) установлено, что IQf
был негативно связан с ЭИл_кЛП (рис. 2, б),
а образная оригинальность – положительно с
ЭИлг_нкМП (см. табл. 1). Для показателей верБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
p
Интеллект
IQf & ЭИк_глМП
–0,26
–2,43
0,02
IQf & ЭИл_кЛП
–0,3
–2,6
0,01
IQv & ЭИк_глМП
–0,2
–1,88
0,06
Креативность
ОО & ЭИк_локПП
0,26
2,23
0,03
ОО & ЭИк_локМП
0,32
2,75
0,01
ОО & ЭИл_нкМП
0,24
2,05
0,05
ВО & ЭИк_глМП
–0,22
–2,05
0,04
ВО & ЭИк_локПП
0,3
2,62
0,01
Моторная асимметрия
Асим_рука & ЭИк_локПП
–0,25
–2,16
0,03
Асим_нога & ЭИк_локМП
–0,27
–2,33
0,02
Асим_нога & ЭИл_кЛП
0,35
3,15
0,01
П р и м е ч а н и е . Асим_рука – показатель степени доминирования руки, асим_нога – ноги; ОО – образная оригинальность, ВО – вербальная оригинальность; IQf – образный компонент интеллекта, IQv – вербальный; ЭИк –
эффект интерференции при конфликте конгруэнтных (к) и
неконгруэтных (нк) стимулов, ЭИл – эффект интерференции при конфликте локальных и глобальных характеристик стимулов, лок – локальное внимание, гл – глобальное;
ПП – предъявление стимулов в левое поле зрения, ЛП – в
правое, МП – в два поля одновременно; Коэф_кор – коэффициент корреляции Спирмена.
33
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Каразаева А.Ю., Разумникова О.М. Интерференционные процессы селекции информации… /c. 31–38
Рис. 2. Корреляционная связь между эффектом интерференции и показателями образной оригинальности (ОО)
(а) и образного компонента интеллекта (IQf) (б). ЭИк_локМП – интерференция между конгруэнтными и неконгруэнтными свойствами стимулов, адресованных в оба поля зрения, в ситуации внимания на
локальном уровне; ЭИл_кЛП – интерференция между локальными и глобальными свойствами стимулов,
адресованных левому полушарию, при их конгруэнтном предъявлении
шарным эффектам интерференции конкурирующих свойств стимулов, которые были связаны
с креативностью.
Распределение полученных значений «рукости» (абсолютное предпочтение правой – 24
балла, левой – минус 24 балла) свидетельствует,
что 91,7 % участников исследования составили
те, кто при выполнении разных видов деятельности предпочитают правую руку. Исходя из
средних значений этого показателя, нами были
сформированы группы с большим (21,9 ± 0,2; 42
человека) или меньшим (5,5 ± 2,3; 28 человек)
предпочтением правой руки, в которых были
проанализированы оригинальность вербального или образного дивергентного мышления
и уровень интеллекта в зависимости от полушарных особенностей ЭИ. Для подбора модели
дивергентного мышления (креативности) или
конвергентного (интеллекта) использовали метод пошаговой множественной регрессии, показатели оригинальности или IQ рассматривали
как зависимые переменные, а ЭИ − как независимые.
В табл. 2 приведены лучшие модели описания вербальной/образной оригинальности и
вербального/образного IQ на основе ЭИк или
ЭИл для групп с большим или меньшим предпочтением правой руки (ГР_П и ГР_Л соответственно).
Согласно уравнению множественной регрессии, достоверными предикторами образной
оригинальности в ГР_П являются преимущественно особенности интерференционных процессов в правом полушарии и при межполушарном обмене информацией. Оригинальность
придуманных образов повышается при условии
34
снижения правополушарного ЭИ, но его повышения при межполушарном взаимодействии
(соответственно компоненты ЭИк_глПП, ЭИл_
нкПП и ЭИк_глМП, ЭИл_нкМП в табл. 2). Достоверен был также вклад ЭИк с положительным знаком для селекции локальных стимулов
в правом полушарии, но отрицательным – для
селекции глобальных в левом (ЭИк_локПП,
ЭИк_глЛП).
В ГР_Л повышению образной оригинальности, напротив, сопутствует усиление правополушарного ЭИ (Эк_глПП в табл. 2). Следует отметить, что выбранные уравнения множественной
регрессии позволяют объяснить только небольшую долю дисперсии образной оригинальности
(0,23 < R2 < 0,38). В ГР_Л коэффициент детерминации увеличивается до 0,67, если в модель
образной оригинальности вместо ЭИлг_нкПП
ввести ЭИл_кМП совместно с показателями
ЭИк на локальном уровне (см. табл. 2), однако в
этом случае вклад ни одного из показателей ЭИ
не достигал значимого уровня.
Достоверное описание вербальной оригинальности удалось получить только в ГР_П:
повышению оригинальности сопутствовало
снижение межполушарного ЭИ при селекции
локальных и глобальных свойств конгруэнтных стимулов (ЭИл_кМП), но увеличение
правополушарной интерференции при сравнении конгруэнтных и неконгруэнтных локальных стимулов (ЭИк_локПП). В ГР_Л наиболее
близким к значимому (p < 0,07) был предиктор
ЭИк_глМП, уменьшение которого вело к повышению оригинальности составленных предложений.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Каразаева А.Ю., Разумникова О.М. Интерференционные процессы селекции информации… /c. 31–38
Таблица 2
Предикторы креативности и интеллекта в группах
с доминированием правой (ГР_П) или левой (ГР_Л) руки
ГР_П
Компоненты
регрессии
ГР_Л
р
Бета
Компоненты
регрессии
Бета
р
Образная оригинальность
R2 = 0,23, p = 0,02
R2 = 0,38, p = 0,01 (модель 1)
ЭИк_глПП
–1,92
0,03
ЭИк_глПП
ЭИк_глЛП
–0,34
0,05
ЭИл_нкПП
R2
0,58
0,02
–0,16
0,51
= 0,67, p = 0,008 (модель 2)
ЭИк_глМП
0,45
0,02
ЭИк_локПП
1,62
0,04
ЭИк_глПП
0,52
0,08
ЭИл_нкМП
0,76
0,005
ЭИк_локПП
0,45
0,11
ЭИл_нкПП
–2,51
0,02
ЭИк_локМП
0,38
0,12
ЭИл_кПП
1,29
0,07
ЭИл_кМП
–0,38
0,08
ЭИл_кМП
–0,21
0,22
Вербальная оригинальность
R2
R2 = 0,29, p = 0,09
= 0,21, p = 0,02
ЭИк_глЛП
–0,25
0,08
ЭИк_глМП
–0,45
0,07
ЭИк_локПП
0,29
0,04
ЭИл_нкМП
0,29
0,13
Эл_кМП
–0,32
0,02
Вербальный интеллект
R2 = 0,30, p = 0,004
R2 = 0,21, p = 0,16
ЭИк_глЛП
2,86
0,0004
ЭИк_глЛП
0,54
0,12
ЭИк_локЛП
–4,76
0,0005
ЭИл_кЛП
–0,64
0,07
ЭИл_нкЛП
5,05
0,0003
ЭИл_кЛП
–3,52
0,0002
П р и м е ч а н и е . R2 – коэффициент детерминации, остальные обозначения – как в табл. 1.
Достоверная модель описания конвергентного типа мышления оказалась возможной только
для вербального компонента интеллекта (IQv) у
правшей. Информативными для IQv стали левополушарные интерференционные процессы:
уровень интеллекта был положительно связан с
ЭИк_глЛП и ЭИл_нкЛП, но отрицательно – с
ЭИк_локЛП и ЭИл_кЛП. В ГР_Л наибольший
вклад в вербальный интеллект вносила степень
левополушарного торможения при сравнении
локальных и глобальных конгруэнтных стимулов (см. табл. 2).
Для образного интеллекта в ГР_П только
13 % дисперсии можно было связать с ЭИ, наибольший вклад вносил ЭИл_кМП (β = −0,41,
р = 0,02). В ГР_Л лучшая модель включала все
показатели ЭИ, что позволило описать 88 %
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
дисперсии, но ни один из них, как и сама модель, не достигли достоверного уровня значимости (0,07 < p < 0,20).
Обнаруженную нами негативную связь эффектов интерференции конкурирующих свойств
стимулов с показателями интеллекта можно
рассматривать с позиций гипотезы «нейронной
эффективности» [15], в соответствии с которой
успешность конвергентного мышления определяется локальной определенностью и «жесткостью» нейронной организации при селекции
информации, что может отражаться в снижении ЭИ. Действительно, также негативные корреляции были выявлены согласно регрессионной модели интеллекта с использованием ЭИ,
возникающим при селекции, специфичной для
левого полушария информации: конгруэнтных
35
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Каразаева А.Ю., Разумникова О.М. Интерференционные процессы селекции информации… /c. 31–38
букв и локального уровня внимания, тогда как
положительные связи интеллекта и ЭИ обнаруживаются для показателей, отражающих процессы интерференции либо при несвойственной левому полушарию селекции глобальных
свойств вербальных стимулов, либо при конфликте между локальным и глобальным вниманием в ситуации сравнения неконгруэнтных
стимулов (см. табл. 2).
Положительную связь эффекта интерференции с креативностью можно объяснить с привлечением гипотезы К. Мартиндейла о «дефокусированном» внимании для объяснения связанных с креативностью изменений активности
коры мозга [3]. Так как дивергентное мышление
характеризуется селекцией информации в более
широко и диффузно распределенных («гибких»)
нейронных сетях мозга, то при высоком уровне
активации (например, при решении сложной
проблемы) следует ожидать общего усиления
ЭИ. Действительно, положительная взаимосвязь креативности и интерференции информации была обнаружена нами для правополушарных и межполушарных селективных процессов
в ситуациях выполнения сложных заданий: селекции информации на локальном уровне или
при предъявлении неконгруэнтных стимулов.
При низком активационном уровне, напротив,
«дефокусированное» внимание сопровождается ослаблением тормозных процессов, как
это было отмечено с использованием модели
«латентного торможения» [21]. Вероятно, что
таким же образом следует интерпретировать
обнаруженную в группе типичных правшей негативную связь образной креативности и правополушарного эффекта интерференции, так
как селекцию стимулов на глобальном уровне
внимания, отнесенном к функциям правого полушария [17], можно рассматривать для правшей как «легкую».
Дополнительно к этому, однако, вербальная
оригинальность, напротив, негативно коррелировала с межполушарным ЭИк на глобальном
уровне. Такой эффект может отражать необходимость подключения вербальных функций
правого полушария для поиска наиболее оригинальных ассоциаций между заданными словами при эффективном обмене информацией
между полушариями для формирования в конечном счете оригинального по смыслу предложения. Действительно, особое значение правого полушария отмечено при поиске отдаленных словесных ассоциаций, создании метафор
и юмористических высказываний [22, 23].
Типичное доминирование правой руки и
правой ноги связано с ослаблением ЭИ при
36
правополушарной селекции информации и ее
межполушарном обмене, указывая на то, что
связанные с креативностью особенности интерференционных процессов отличаются в зависимости от индивидуального профиля моторной
асимметрии.
Согласно регрессионному уравнению описания образной креативности в группе с типичным доминированием правой руки максимальный вклад в оригинальность имеет ослабление
интерференционных процессов в правом полушарии, но их усиление при межполушарном
взаимодействии (см. табл. 2). В группе с относительным преобладанием левой руки большей
образной оригинальности соответствует, напротив, усиление правополушарного ЭИк на глобальном уровне. Если в модель для ГР_Л ввести показатели интерференции информации при
межполушарном обмене (модель 2 в табл. 2), то
они позволяют описать около 70 % дисперсии
образной оригинальности, указывая, таким образом, на менее выраженную функциональную
специализацию полушарий при селекции информации у левшей. По-видимому, эти данные
совместно с известными из литературы фактами об ослаблении латерализации когнитивных
функций и процессов межполушарного торможения у левшей [6, 24] могут отражать разные
полушарные стратегии генерации оригинальных образов. При ярко выраженной латерализации образных функций у типичных правшей
негативные связи образной оригинальности и
правополушарного ЭИ можно рассматривать
как аналог вышеописанной взаимосвязи интеллекта и интерференционных процессов. Тогда
при атипичной моторной асимметрии вместо
«нейронной эффективности» на первый план
выходит «дефокусированное» внимание, способствующее решению задачи с привлечением
информации из отдаленных семантических категорий. Следовательно, связанные с креативностью эффекты правополушарного и межполушарного усиления ЭИ соответствуют склонности к левшеству, подтверждая таким образом
представления о большей частоте встречаемости левшей среди талантливых людей [9, 10].
При анализе вербального мышления достоверные взаимосвязи креативности и ЭИ или интеллекта и ЭИ получены только в группе правшей, что также можно рассматривать как еще
одно доказательство меньшей специализации
полушарий в организации вербальных функций у левшей. Относительно большее подобие
в группах во взаимосвязях показателей интерференционных процессов и вербального мышления, чем образного, по-видимому, обусловлеБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Каразаева А.Ю., Разумникова О.М. Интерференционные процессы селекции информации… /c. 31–38
но общими правилами построения предложения и тем, что вербальная оригинальность, как
упоминалось выше, требует функций правого
полушария.
ЗАКЛЮЧЕНИЕ
Конвергентное и дивергентное мышление
по-разному связано с эффектами интерференции при конфликте локальных/глобальных или
конгруэнтных/неконгруэнтных свойств стимулов. Большим значениям интеллекта как показателю успешности конвергентного мышления соответствует ослабление интерференции
вербальной информации, и в этой взаимосвязи
сравнительно большее значение имеет левое
полушарие. Для повышения образной оригинальности необходимо усиление эффекта интерференции при селекции информации в правом полушарии и ее межполушарном обмене.
Оригинальность вербального дивергентного
мышления положительно связана с правополушарным эффектом интерференции, но отрицательно – с межполушарным. Усилению
интерференционных процессов при селекции
информации соответствовали атипичное доминирование левой руки и большая креативность.
Таким образом, можно заключить, что индивидуальные стратегии достижения творческой
продуктивности связаны с разной степенью
вовлечения полушарий в решение проблемы и
характером межполушарного взаимодействия,
зависящими от природы креативного задания
(вербальной или образной) и профиля моторной асимметрии.
СПИСОК ЛИТЕРАТУРЫ
1. Разумникова О.М. Мышление и функциональная асимметрия мозга. Новосибирск: Изд-во
СО РАМН, 2004. 272 с.
Razumnikova O.M. Thinking and functional brain
asymmetry. Novosibirsk: SO RAMN, 2004. 272 p.
2. Разумникова О.М. Частотно-пространственная организация активности коры мозга при конвергентном и дивергентном мышлении в зависимости от фактора пола: Сообщение II. Анализ
когерентности ЭЭГ // Физиол. человека. 2005. 31.
(2). 69–80.
Razumnikova O.M. Gender-dependent frequencyspatial organization of the brain cortex activity during convergent and divergent thinking: II. Analysis
of the EEG coherence // Fiziol. cheloveka. 2005. 31.
(2). 69–80.
3. Martindale C. Biological bases of creativity //
Handbook of creativity / Ed. R.J. Sternberg. Cambridge: Cambridge University Press, 1999. 137–152.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
4. Cherbuin N., Brinkman C. Hemispheric interactions are different in lefthanded individuals // Neuropsychology. 2006. 20. 700–707.
5. Witelson S.F., Goldsmith C.H. The relationship of hand preference to anatomy of the corpus
callosum in men // Brain Res. 1991. 545. 175–182.
6. Жаворонкова Л.А. Правши и левши: особенности межполушарной асимметрии и параметров
когерентности ЭЭГ // Журнал высш. нервн. деят.
2007. 57. (6). 645–662.
Zhavoronkova L.A. Right- and left-handed subjects: characteristics of interhemispheric asymmetry and EEG coherence parameters // Zhurn. vyssh.
nervn. deyat. 2007. 57. (6). 645–662.
7. Basic S., Hajnsek S., Poljakovic Z. et al. Determination of cortical language dominance using
functional transcranial Doppler sonography in lefthanders // Clin. Neurophysiol. 2004. 115. 154–160.
8. Szaflarski J.P., Binder J.R., Possing E.T. et
al. Language lateralization in left-handed and ambidextrous people: fMRI data // Neurology. 2002. 59.
238–244.
9. Hassler M., Gupta D. Functional brain organization, handedness, and immune vulnerability in
musicians and non-musicians // Neuropsychologia.
1993. 31. (7). 655–660.
10. Preti A., Vellante M. Creativity and psychopathology: Higher rates of psychosis proneness and
nonright-handedness among creative artists compared
to same age and gender peers // J. Nerv. Ment. Dis.
2007. 195. (10). 837–845.
11. Corballis M.C., Hattie J., Fletcher R. Handedness and intellectual achievement: An even-handed
look // Neuropsychol. 2008. 46. 374–378.
12. Moore D.W., Bhadelia R.A., Billings R.L. et
al. Hemispheric connectivity and the visual–spatial
divergent-thinking component of creativity // Brain
Cogn. 2009. 70. 267–272.
13. Newland G.A. Differences between left- and
right-handers on a measure of creativity // Percept.
Motor Skills. 1981. 53. 787–792.
14. Shobe E.R., Ross N.M., Fleck J.I. Influence
of handedness and bilateral eye movements on creativity // Brain Cogn. 2009. 71. 204–214.
15. Haier R.J., Siegel B.V., Nuechterlein K.H.
et al. Cortical glucose metabolic rate correlates of
abstract reasoning and attention studied with positron emission tomography // Intelligence. 1988. 12.
199–217.
16. Navon D. Forest before trees: the precedence
of global features in visual perception // Cogn. Psychol. 1977. 9. 353–383.
17. Volberg G., Hübner R. Hemispheric differences for the integration of stimulus levels and their
contents: Evidence from bilateral presentations //
Percept. Psychophys. 2006. 68. 1274–1258.
37
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Каразаева А.Ю., Разумникова О.М. Интерференционные процессы селекции информации… /c. 31–38
18. Annett M.A. Сoordination of hand preference and skill replicated // Br. J. Psychol. 1976. 67.
587–592.
19. Леутин В.П., Николаева Е.И. Психофизиологические механизмы адаптации и функциональная асимметрия мозга. Новосибирск: Наука,
1988. 193 с.
Leutin V.P., Nikolaeva E.I. Psychophysiological
mechanisms of adaptation and functional brain asymmetry. Novosibirsk: Nauka, 1988. 193 p.
20. Разумникова О.М. Способы определения
креативности. Методические материалы по психологии. Новосибирск: НГТУ, 2002.
Razumnikova O.M. Methods for determining creativity. Methodical materials for psychology. Novosibirsk: NGTU, 2002.
21. Carson S.H., Peterson J.B., Higgins D.M.
Decreased latent inhibition is associated with increased creative achievement in high-functioning individuals // J. Person. Soc. Psychol. 2003. 85. (3).
499–506.
22. Howard-Jones P.A., Blakemore S-J., Samuel
E.A. et al. Semantic divergence and creative story
generation: An fMRI investigation // Cogn. Brain
Res. 2005. 25. 240–250.
23. Shammi P., Stuss D.T. Humor appreciation: a
role of the right frontal lobe // Brain. 1999. 122. (4).
657–666.
24. Nowicka A., Tacikowski P. Transcallosal
transfer of information and functional asymmetry of
the human brain // Laterality. 2011. 16. (1). 35–74.
INTERFERENCE PROCESSES IN INFORMATION SELECTION
ASSOCIATED WITH DIVERGENT/CONVERGENT THINKING:
EFFECT OF HEMISPHERIC ASYMMETRY PROFILES
Аnastasiya Yur’evna KARAZAEVA, Ol’ga Mikhailovna RAZUMNIKOVA
Research Institute of Physiology SB RAMS
630117, Novosibirsk, Timakov str., 4
Effect of motor asymmetry in relationships between creativity or intelligence and global-local hemispheric selective
processing was examined by hierarchical letter presenting. The results show that an increase of interference processes is associated with higher figural originality but lower both intelligence and typical dominance of the right hand.
The left hemisphere has the utmost importance in relationship between intelligence and interference processes but
the right hemisphere – between creativity and interference effect. Individual strategies of creative efficiency connect
with the degree of the right-hemispheric involving in problem solution and characteristics of interhemispheric interactions and depend on both the verbal or figurative nature of the creative task and the profile of motor asymmetry.
Key words: creativity, intelligence, information selection, hemispheric asymmetry.
Каrazaeva A.Yu. – post-graduate student
Razumnikova O.M. – doctor of biological sciences, chief researcher, е-mail: razum@physiol.ru
38
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК 575.113.2:577.15:577.121
ГЕНЕТИЧЕСКИЙ ПОЛИМОРФИЗМ ЦИТОХРОМА P450 2C9,
УЧАСТВУЮЩЕГО В МЕТАБОЛИЗМЕ ЛЕКАРСТВЕННЫХ ПРЕПАРАТОВ,
В ПОПУЛЯЦИЯХ КОРЕННЫХ ЖИТЕЛЕЙ СЕВЕРНОЙ СИБИРИ
Роза Павловна КОРЧАГИНА1, Людмила Павловна ОСИПОВА1,
Наталья Александровна ВАВИЛОВА1, Елена Николаевна ВОРОНИНА2,
Максим Леонидович ФИЛИПЕНКО2
1Институт
цитологии и генетики СО РАН
630090, г. Новосибирск, пр. Академика Лаврентьева, 10
2Институт
химической биологии и фундаментальной медицины СО РАН
630090, г. Новосибирск, пр. Академика Лаврентьева, 8
Исследованы частоты встречаемости CYP2C9*2 и CYP2C9*3 в коренных самодийских популяциях селькупов, тундровых и лесных ненцев, нганасан, а также у русских Северной Сибири. По полиморфизму CYP2C9*2 коренные этносы занимают промежуточное положение между европеоидными и монголоидными
популяциями, тогда как по полиморфизму CYP2C9*3 такой закономерности не обнаружено. По частотам
CYP2C9*2 все самодийцы достоверно отличаются от русских. Кроме того, статистическая значимость различий продемонстрирована между лесными и тундровыми ненцами. По частотам CYP2C9*3 обнаружены
более существенные и достоверные различия между самодийскими популяциями. Во всех пяти изученных
популяциях выявлена значительная суммарная доля лиц – «медленных» метаболизаторов, у которых можно
прогнозировать риск развития нежелательных побочных реакций на лекарственные препараты. Полученные
данные могут быть использованы в протоколах рекомендаций дозирования лекарственных препаратов в
популяциях коренных жителей Северной Сибири.
Ключевые слова: цитохром Р450, биотрансформация, ксенобиотики, аллели CYP2C9*2 и CYP2C9*3, лекарственные препараты, самодийские популяции.
Цитохромы Р450 (CYPs) – ферменты, осуществляющие реакции окисления многочисленных соединений эндогенного (стероиды,
желчные кислоты, жирные кислоты, простагландины, лейкотриены, биогенные амины) и
экзогенного происхождения, то есть ксенобиотиков (лекарства, яды, продукты промышленного загрязнения, пестициды, канцерогены,
мутагены) [1, 2]. Индивидуальные особенности работы системы биотрансформации определяются уникальным для каждого человека
сочетанием полиморфных вариантов генов соответствующих ферментов, что ведет к различной устойчивости или чувствительности индивидов к воздействию повреждающих внешних
факторов. Наличие функционально неполноценных вариантов генов биотрансформации
ксенобиотиков предрасполагает к возникнове-
нию различных заболеваний, а также являются
причиной неблагоприятных ответных реакций
организма человека на лекарственные препараты [3, 4]. Поэтому в настоящее время проблема
повышения безопасности применения фармакологических препаратов является весьма актуальной.
CYP2C9 – изофермент подсемейства цитохромов CYP2C, куда также входят CYP2C8,
CYP2C18, CYP2C19. Аминокислотный состав
этих ферментов идентичен более чем на 82 %.
CYP2C составляет примерно 20 % от общего
содержания цитохромов в микросомах печени
человека. Изофермент CYP2C9 имеет размер
55,6 кДа и состоит из 490 аминокислотных
остатков [5], вовлечен в биоактивацию таких
канцерогенов, как полициклические ароматические гидрокарбонаты и гетероциклические
ароматические амины. CYP2C9 ответственен
Корчагина Р.П. – аспирант лаборатории популяционной этногенетики, e-mail:kruosana@mail.ru
Осипова Л.П. – к.б.н., зав. лабораторией популяционной этногенетики, e-mail: ludos84@mail.ru
Вавилова Н.А. – старший лаборант лаборатории популяционной этногенетики, e-mail: senk_off@mail.ru
Воронина Е.Н. – к.б.н., младший научный сотрудник, группа фармакогеномики, e-mail: voronina_l@mail.ru
Филипенко М.Л. – к.б.н., руководитель группы фармакогеномики, e-mail: max@.niboch.nsc.ru
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
39
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Корчагина Р.П., Осипова Л.П., Вавилова Н.А. и др. Генетический полиморфизм цитохрома… /c. 39–46
за метаболизм 10 % терапевтически важных
лекарственных препаратов, таких как антикоагулянт варфарин, антиконвульсант фенитоин,
противодиабетический препарат толбутамид,
нестероидные противовоспалительные лекарственные препараты (ибупрофен, диклофенак и
др.), лозартан и др. [6−8]. Ген CYP2C9 локализован на 10-й хромосоме в области 10q24, содержит 9 экзонов и входит в состав кластера
CYP2C8 – CYP2C9 – CYP2C19 – CYP2C18
[9].
Существуют данные, что полиморфизм в гене
CYP2C9 оказывает существенное влияние на
токсичность лекарственных препаратов и связан с риском развития нежелательных побочных реакций у индивидов в ответ на применение нестероидных противовоспалительных
лекарственных препаратов [10], варфарина –
антикоагулянта непрямого действия, применяемого в клинической практике для лечения и
предупреждения сердечно-сосудистых заболеваний [11, 12]. Так, было показано, что именно
носительство полиморфных аллелей CYP2C9*2,
CYP2C9*3 гена CYP2C9 связано с учащением
геморрагических осложнений в дебюте лечения
и необходимостью снижения поддерживающей
дозы варфарина [13, 14].
CYP2C9*2 и CYP2C9*3 являются наиболее
распространенными функционально дефектными аллелями в европейской популяции [15, 16].
Встречаемость обоих вариантов крайне низка
в африканских и азиатских популяциях [16].
CYP2C9*2 возник вследствие транзиции T430C
в 3-м экзоне гена, что привело к замене цистеина на аргинин в положении 144 (R144C) полипептидной цепи. CYP2C9*3 представляет собой
однонуклеотидную замену C1075A в седьмом
экзоне гена. Результатом этой мутации является замена лейцина на изолейцин в положении
359 полипептидной цепи (I359L) [17]. По сравнению с аллелем «дикого» типа, обозначаемым
как CYP2C9*1, варианты CYP2C9*2 и CYP2C9*3
обеспечивают синтез фермента со сниженной
метаболизирующей активностью. Поэтому носителей вариантов CYP2C9*2 и CYP2C9*3 как
в гомозиготном, так и в гетерозиготном состоянии считают «медленными» метаболизаторами: у них снижен метаболизм лекарственных
средств, которые в высоких концентрациях накапливаются в организме, что приводит к появлению нежелательных лекарственных реакций,
вплоть до интоксикаций. В связи с этим таким
лицам следует назначать лекарственные средства в дозе, меньшей средней терапевтической
[6, 8].
Установлено, что частоты полиморфных
вариантов CYP2C9*2 и CYP2C9*3 проявляют
40
существенные межэтнические различия и, вероятно, могут являться «маркерами» предрасположенности к риску развития нежелательных
побочных реакций на эти лекарства в каждой
отдельной популяции. Следовательно, выявление генотипов CYP2C9 важно для достижения
эффективных результатов лекарственной терапии, прогнозирования и предотвращения развития нежелательных побочных реакций, что
будет способствовать сбережению здоровья населения.
Полиморфизм гена CYP2C9 изучен во многих популяциях человека [16, 18], но не в популяциях коренных этносов и русских Северной
Сибири. Поэтому объектом нашего исследования явились селькупы, тундровые и лесные
ненцы Ямало-Ненецкого автономного округа,
нганасаны полуострова Таймыр и русские, проживающие на территории Северной Сибири.
Селькупы, тундровые и лесные ненцы, нганасаны по языку относятся к самодийской ветви
уральской языковой семьи. По антропологическим и генетическим данным в их генофондах
фиксируются европеоидный и монголоидный
компоненты [19−22].
Успешное развитие медицины ведет к тому,
что происходит активное проникновение лекарственных препаратов в среду коренных
северных жителей. К тому же меняются стандарты лечения, требующие применения все
новых лекарств, с которыми не сталкивались
ранее коренные народы Севера. Для того чтобы терапия медикаментами была безопасной и
эффективной, необходимо знать особенности
их метаболизма у коренных этносов. Следовательно, целью данной работы явилось изучение
генетического полиморфизма цитохрома Р450
2С9 (CYP2C9*2 и CYP2C9*3) в коренных популяциях селькупов, тундровых ненцев, лесных
ненцев, нганасан, а также у русских Северной
Сибири, как в этническом контексте, так и для
выявления в этих популяциях возможной степени риска развития побочных реакций на терапию лекарственными препаратами.
МАТЕРИАЛ И МЕТОДЫ
Материал для исследования собирался
во время экспедиций 1988–2009 гг. в ЯмалоНенецкий автономный округ и п-ов Таймыр
Красноярского края под руководством к.б.н.
Л.П. Осиповой. Забор крови производился по
международным правилам с использованием
«Информированного согласия» от добровольцев, практически здоровых на момент исследования. Выборки были сформированы из пула
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Корчагина Р.П., Осипова Л.П., Вавилова Н.А. и др. Генетический полиморфизм цитохрома… /c. 39–46
этнических представителей селькупов (n = 330),
тундровых (n = 313) и лесных ненцев (n = 303),
нганасан (n = 186) и русских Северной Сибири (n = 345). В эти выборки не вошли метисы
разных уровней от браков коренных жителей с
русскими и другими пришлыми этносами.
Образцы ДНК были выделены из лейкоцитарных фракций венозной крови стандартным
методом фенол-хлороформной экстракции с
использованием протеиназы K. Генотипирование однонуклеотидных замен в гене CYP2C9
проводилось в режиме реального времени с
использованием конкурирующих TaqMan-зондов, комплементарных полиморфным участкам
ДНК. Каждый образец амплифицировался с
использованием пары праймеров и двух зондов, несущих «гаситель» на 3′-конце и разные
флуоресцентные красители (FAM либо R6G) на
5′-конце. Последовательности праймеров и зондов для CYP2C9*2 были следующими: 5′-CTGCGGAATTTTGGGATG-3′; 5′-TAAGGTCAGTGATATGGAGTAGGG-3′ и 5′-R6G-CATTGAGGACCGTGTTCAAG-BHQ2-3′;
5′-FAM-CATTGAGGACTGTGTTCAAGAG-RTQ-3′. Праймеры
для CYP2C9*3 имели структуры 5′-CAAATGCCCTACACAGATGC-3′ и 5′-GATACTATTAATTTGGGGACTTCG-3′, а зонды – 5′-R6GCCAGAGATACCTTGACCTTCTC-BHQ2-3′ и 5′FAM-CCAGAGATACATTGACCTTCTC-BHQ23′. Общий объем реакционной смеси составлял
25 мкл, смесь содержала ДНК с концентрацией 15 нг/мкл, 300 нМ каждого праймера, по
100–200 нМ TaqMan-зондов, конъюгированных
с FAM или R6G, 200 мкМ dNTPs, амплификационный буфер (650 мМ Tris-HCl, 240 мМ
(NH4)2SO4, 0,5% Tween 20, 35 мМ MgCl2), термостабильную Taq-полимеразу – 0,5 ед. акт./реакц. ПЦР проводилась в следующих условиях:
начальная денатурация 1 мин 30 с при 96 °С; затем 45 циклов, включающих денатурацию при
96 °С 8 с, отжиг праймеров и последующую
элонгацию при 60 °С в течение 40 с (каждый
шаг сопровождался регистрацией флуоресцентного сигнала в диапазонах, соответствующих
интервалам флуоресценции флуорофоров FAM
и R6G). Работа проводилась с использованием
амплификатора iCycler iQ 4 (Bio-Rad, США).
Полученные данные обрабатывались с помощью программы «Bio-Rad iQ5». Популяционные частоты аллельных вариантов вычисляли на основе наблюдаемых частот генотипов.
Оценку соответствия частот генотипов равновесию Харди–Вайнберга проводили с использованием критерия χ2 (Пирсона), применяя on-line
тест-программу, http://ihg2.helmholtz-muenchen.
de/cgi-bin/hw/hwa1.pl (при p > 0,05 равновесие
выполняется). Оценку достоверности различий по частотам аллелей между исследованными выборками проводили по критерию χ2 (при
p < 0,05 результаты считались статистически
значимыми).
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
Во всех исследованных выборках распределение частот CYP2C9*2 и CYP2C9*3 генотипов
соответствует равновесию Харди–Вайнберга
(табл. 1). Исследование показало, что в самодийских популяциях численно преобладают индивиды с «нормальными» генотипами CYP2C9*2СС и CYP2C9*3-АА. Их частоты варьируют и
лежат в пределах 86,5–94,9 % для CYP2C9*2 и
83,9–98,0 % для CYP2C9*3, превышая соответствующие значения для русских Северной Сибири (74,5 и 80,9 % соответственно).
Распределение генотипов CYP2C9 в самодийских популяциях и у русских Северной Сибири приведено в табл. 2.
В исследованных популяциях, как показано в табл. 2, кроме лиц с «нормальным» CYP2C9*1/*1 генотипом, присутствует также значительная доля «медленных» метаболизаторов,
Таблица 1
Распределение генотипов CYP2C9*2 и CYP2C9*3 и соответствие их равновесию Харди–Вайнберга
в исследованных популяциях
Генотип CYP2C9*2
Популяция (выборка)
Селькупы (330)
Тундровые ненцы (313)
Лесные ненцы (303)
Нганасаны (186)
Русские Северной Сибири
(345)
Генотип CYP2C9*3
CC
CT
TT
Соответствие
равновесию
Харди–Вайнберга
298
297
262
173
32
16
41
13
0
0
0
0
p = 0,36
p = 0,64
p = 0,21
p = 0,62
277
289
297
171
52
23
6
14
1
1
0
1
p = 0,38
p = 0,46
p = 0,86
p = 0,24
257
81
7
p = 0,84
279
65
1
p = 0,17
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
AA
AC
CC
Соответствие
равновесию
Харди–Вайнберга
41
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Корчагина Р.П., Осипова Л.П., Вавилова Н.А. и др. Генетический полиморфизм цитохрома… /c. 39–46
Таблица 2
Частоты CYP2C9 генотипов и суммарные частоты «медленных» метаболизаторов
в исследованных популяциях, %
Генотип CYP2C9
CYP2C9*1/*1
CYP2C9*1/*2
CYP2C9*1/*3
CYP2C9*2/*3
CYP2C9*2/*2
CYP2C9*3/*3
Суммарная частота
«медленных» метаболизаторов, %
Селькупы
(n = 330)
Тундровые ненцы
(n = 313)
Лесные ненцы
(n = 303)
Нганасаны
(n = 186)
Русские Северной
Сибири (n = 345)
74,85 (247)**
9,09 (30)
15,15 (50)
0,61 (2)
0,00 (0)
0,30 (1)
87,22 (273)
5,11 (16)
7,35 (23)
0,00 (0)
0,00 (0)
0,32 (1)
84,49 (256)
13,53 (41)
1,98 (6)
0,00 (0)
0,00 (0)
0,00 (0)
84,95 (158)
6,99 (13)
7,53 (14)
0,00 (0)
0,00 (0)
0,54 (1)
59,71 (206)
20,00 (69)
14,49 (50)
4,35 (15)
1,16 (4)
0,29 (1)
25,15
12,78
15,51
15,05
40,29
П р и м е ч а н и е . В скобках указана численность носителей определенных генотипов.
Таблица 3
Частоты аллеля CYP2C9*2 и достоверность различий между изученными популяциями
и другими этническими группами
Популяция
Общее чисЧастота
Тундровые
Селькупы
ло аллелей CYP2C9*2, %
ненцы
Селькупы*
660
4,85
Тундровые ненцы*
626
2,56
Лесные ненцы*
606
6,77
Нганасаны*
372
3,49
Эвены [23]
162
3,00
Чукчи [23]
228
6,60
Китайцы [16]
1016
0,00
Русские Северной
Сибири*
690
13,77
Русские Чукотки [23]
404
7,40
Русские Воронежской области [26]
580
10,50
Немцы [27]
734
10,60
Словенцы [18]
254
12,20
χ2 = 3,77;
p = 0,05
χ2 = 3,77;
p = 0,05
χ2 = 1,58;
p = 0,21
χ2 = 0,68;
p = 0,41
χ2 = 0,52;
p = 0,47
χ2 = 0,61;
p = 0,43
χ2 = 45,40;
p = 0,00
2
χ = 25,22;
p = 0,00
χ2 = 2,26;
p = 0,13
χ2 = 11,53;
p = 0,00
χ2 = 12,95;
p = 0,00
χ2 = 12,07;
p = 0,00
Лесные
ненцы
χ2 = 1,58;
p = 0,21
2
χ = 10,38;
p = 0,00
Нганасаны
χ2 = 0,68;
p = 0,41
χ2 = 0,40;
p = 0,53
χ2 = 3,69;
p = 0,05
χ2 = 10,38;
p = 0,00
χ2 = 0,40; χ2 = 3,69;
p = 0,53
p = 0,05
χ2 = 0,01; χ2 = 2,19; χ2 = 0,00;
p = 0,93
p = 0,14
p = 0,98
χ2 = 6,02; χ2 = 0,00; χ2 = 2,12;
p = 0,01
p = 0,95
p = 0,15
χ2 = 23,03; χ2 = 63,40; χ2 = 31,05;
p = 0,00
p = 0,00
p = 0,00
2
2
2
χ = 44,13; χ = 13,05; χ = 22,44;
p = 0,00
p = 0,00
p = 0,00
2
2
χ = 11,31; χ = 0,06; χ2 = 4,44;
p = 0,00
p = 0,04
p = 0,80
χ2 = 26,82; χ2 = 4,04; χ2 = 12,65;
p = 0,00
p = 0,04
p = 0,00
χ2 = 28,84; χ2 = 4,71; χ2 = 13,55;
p = 0,00
p = 0,03
p = 0,00
χ2 = 27,12; χ2 = 5,10; χ2 = 13,82;
p = 0,00
p = 0,02
p = 0,00
Русские Северной Сибири
χ2 = 25,22;
p = 0,00
2
χ = 44,13;
p = 0,00
2
χ = 13,05;
p = 0,00
χ2 = 22,44;
p = 0,00
χ2 = 11,20;
p = 0,00
χ2 = 6,22;
p = 0,01
χ2 = 127,39;
p = 0,00
χ2 = 7,62;
p = 0,01
χ2 = 2,16;
p = 0,14
χ2 = 2,32;
p = 0,13
χ2 = 6,20;
p = 0,65
П р и м е ч а н и е . Здесь и в табл. 4 * – данные настоящего исследования; полужирным шрифтом выделены статистически значимые различия в парном сравнении.
причем максимальная суммарная их частота
наблюдается у русских Северной Сибири, что
достоверно отличает последних от всех самодийцев (р = 0,00). Из когорты коренных жителей выделяются селькупы, в выборке которых
42
частота лиц с подобным фенотипом достоверно
выше, чем в остальных самодийских этносах.
Нам показалось целесообразным провести
парный сравнительный анализ частот аллелей
CYP2C9*2 и CYP2C9*3 между самодийцами и
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Корчагина Р.П., Осипова Л.П., Вавилова Н.А. и др. Генетический полиморфизм цитохрома… /c. 39–46
некоторыми другими этническими группами
(табл. 3, 4).
Как можно видеть из табл. 3 и 4, частоты аллелей CYP2C9*2 и CYP2C9*3 варьируют
среди самодийских популяций. При этом по
CYP2C9*2 среди коренных этносов достоверно
отличаются лишь лесные и тундровые ненцы
(р = 0,00). Причем у лесных ненцев наблюдается максимальная частота аллеля CYP2C9*2, а
у тундровых ненцев – минимальная по сравнению с другими самодийцами. В исследованных
этносах частоты CYP2C9*2 сходны с таковыми
у чукчей и эвенов (р > 0,05). Существенным
фактом является то, что во всех самодийских
популяциях, а также у чукчей и эвенов, аллель
CYP2C9*2 встречается значительно реже, чем
в популяциях русских Северной Сибири, Воронежской области и европеоидов Германии,
Словении (p < 0,05). У китайцев он не встречается вовсе. Исходя из этих данных, можно выдвинуть предположение, что мутантный аллель
CYP2C9*2 имеет европеоидное происхождение.
Не исключено также, что в выборках детей чукчей [23] имеются дети от смешанных браков с
европеоидами, что обусловливает присутствие в
антропологически монголоидных этносах чукчей и эвенов мутантных вариантов CYP2C9*2 и
CYP2C9*3, сравнимых с частотами в самодийских этносах. По частотам CYP2C9*2 самодийцы занимают промежуточное положение между европеоидными и монголоидными популяциями, что согласуется с данными о наличии в
их генофондах европеоидного и монголоидного
компонентов. Что касается русских Северной
Сибири, то частота аллеля CYP2C9*2 в этой
популяции согласуется с частотами для русских, проживающих в Воронежской области, и
для других европеоидов (р > 0,05). Исключение
составляют русские, проживающие на Чукотке
[23], в выборке (n = 202) которых встречаемость
аллеля CYP2C9*2 ниже в 2 раза по сравнению
с русскими Северной Сибири (р = 0,006). Остается неясным, проводили ли авторы этой работы генеалогический анализ при формировании
данной выборки.
Если по частотам аллеля CYP2C9*2 коренные этносы практически не различаются между собой, то по частотам аллеля CYP2C9*3
наблюдается существенная этническая вариабельность. Так, нганасаны и тундровые ненцы
Таблица 4
Частоты аллеля CYP2C9*3 и достоверность различий между изученными популяциями
и другими этническими группами
Популяция
Общее чисЧастота
Тундровые
Селькупы
ло аллелей CYP2C9*3, %
ненцы
Селькупы*
660
8,18
Тундровые ненцы*
626
3,99
Лесные ненцы*
606
0,99
Нганасаны*
372
4,30
Эвены [23]
162
7,00
Чукчи [23]
228
3,00
Китайцы [16]
896
3,30
Русские Северной
Сибири*
690
9,71
Русские Чукотки [23]
404
9,00
Русские Воронежской области [26]
580
6,70
Немцы [27]
734
7,80
Словенцы [18]
254
6,30
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
χ2 = 7,99;
p = 0,01
χ2 = 7,99;
p = 0,01
2
χ = 31,55; χ2 = 9,61;
p = 0,00
p = 0,00
2
χ = 4,44; χ2 = 0,00;
p = 0,03
p = 0,95
2
χ2 = 1,52;
χ = 0,15;
p = 0,70
p = 0,22
2
χ = 5,44; χ2 = 0,16;
p = 0,02
p = 0,69
2
χ = 14,63; χ2 = 0,25;
p = 0,00
p = 0,62
2
2
χ
= 13,58;
χ = 0,65;
p = 0,00
p = 0,42
χ2 = 0,07; χ2 = 8,57;
p = 0,00
p = 0,79
2
χ = 0,63;
χ2 = 3,52;
p = 0,43
p = 0,06
2
2
χ = 0,03; χ = 06,93;
p = 0,01
p = 0,87
2
χ2 = 1,49;
χ = 0,57;
p = 0,45
p = 0,22
Лесные
ненцы
χ2 = 31,55;
p = 0,00
χ2 = 9,61;
p = 0,00
χ2 = 9,49;
p = 0,00
2
χ = 15,96;
p = 0,00
χ2 = 3,26;
p = 0,07
χ2 = 7,27;
p = 0,01
χ2 = 39,98;
p = 0,00
2
χ = 32,78;
p = 0,00
2
χ = 23,24;
p = 0,00
2
χ = 29,75;
p = 0,00
2
χ = 16,86;
p = 0,00
Нганасаны
χ2 = 4,44;
p = 0,03
χ2 = 0,00;
p = 0,95
χ2 = 9,49;
p = 0,00
χ2 = 0,86;
p = 0,35
χ2 = 0,27;
p = 0,61
χ2 = 0,40;
p = 0,53
χ2 = 7,84;
p = 0,00
χ2 = 5,10;
p = 0,02
χ2 = 1,79;
p = 0,18
χ2 = 3,74;
p = 0,05
χ2 = 0,76;
p = 0,38
Русские
Северной
Сибири
χ2 = 0,65;
p = 0,42
2
χ = 13,58;
p = 0,00
2
χ = 39,98;
p = 0,00
χ2 = 7,84;
p = 0,00
χ2 = 0,84;
p = 0,36
χ2 = 8,13;
p = 0,00
2
χ = 23,12;
p = 0,00
χ2 = 0,08;
p = 0,77
χ2 = 2,77;
p = 0,10
χ2 = 1,21;
p = 0,27
χ2 = 1,91;
p = 0,17
43
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Корчагина Р.П., Осипова Л.П., Вавилова Н.А. и др. Генетический полиморфизм цитохрома… /c. 39–46
показывают сходные частоты, близкие к таковым в монголоидных популяциях китайцев,
чукчей (р > 0,05). В популяции селькупов, напротив, выявлена максимальная частота CYP2C9*3, сходная с таковой у русских Северной
Сибири, у русских из других регионов, а также
у европейцев (немцы, словенцы) (р > 0,10). Особенным фактом явилось то, что среди всех популяций, как исследованных, так и взятых для
сравнения, у лесных ненцев наблюдается минимальная частота встречаемости CYP2C9*3, а
также максимальная частота CYP2C9*2 среди
самодийских и других северных популяций.
Возможно, на такое распределение частот полиморфных вариантов гена CYP2C9 повлияло
то, что популяция лесных ненцев, небольшая
по численности, в результате эпидемий оспы и
кори несколько раз проходила через «бутылочное горлышко», что могло привести к генному
дрейфу, в результате которого произошел сдвиг
в генных частотах. К тому же не исключено, что такому распределению частот аллелей
CYP2C9*2 и CYP2C9*3 способствовало особая
система заключения браков (предпочтительно
между родственниками), что привело к повышенному коэффициенту инбридинга – 0,012 у
лесных ненцев (у нганасан − 0,002) [24, 25].
ЗАКЛЮЧЕНИЕ
В целом наше исследование выявило существенную вариабельность распределения частот
аллелей CYP2C9*2 и CYP2C9*3 в самодийских
популяциях коренных жителей, а также у этнических русских Северной Сибири, но по сравнению с встречаемостью у русских Северной
Сибири и в других европеоидных популяциях
эти частоты значительно снижены среди самодийцев, что, возможно, объясняется действием
факторов микроэволюции (генный дрейф, миграции). С осторожностью можно предположить
и влияние естественного отбора в пользу наиболее «приспособленных» генных вариантов
у коренных жителей Севера в условиях среды
обитания, насыщенной природными «аллергенами» (пыльца растений, дым от костров и др.).
При анализе генотипов проведенное исследование выявило значимую суммарную долю
«медленных» метаболизаторов среди коренных
жителей и русских Северной Сибири. Данная
величина варьирует от 13 % у тундровых ненцев до 25 % у селькупов и максимальна в популяции русских Сибири (40 %). Полученные
результаты позволяют нам в изученных популяциях прогнозировать наличие индивидуального и популяционного риска развития нежела44
тельных побочных реакций в ответ на лечение
такими важными и эффективными лекарственными препаратами, как антикоагулянты, нестероидные противовоспалительные препараты. Причем, предположительно, максимальная
степень риска существует у русских Северной
Сибири по сравнению с селькупами, ненцами и
нганасанами.
Однако нужно учесть, что в настоящее время увеличивается степень метисации коренного северного населения с русскими, что способствует привнесению «новых» генных вариантов в генофонды самодийцев и может изменить степень риска. Следовательно, подбор доз
лекарственных препаратов в изученных нами
популяциях должен проводиться с осторожностью. А выявление генотипов CYP2C9 необходимо включить в список медицинских обследований и проводить в индивидуальном порядке
среди представителей коренных этносов и русских Северной Сибири, применяя результаты
генотипирования при подборе оптимальных
доз лекарственных препаратов потенциальным
пациентам для эффективной терапии. Кроме
того, мы считаем необходимым проведение более масштабного скрининга популяций коренных жителей Севера и Сибири по полиморфизмам других генов системы биотрансформации
ксенобиотиков. Конечная цель подобного рода
исследований – сведение до минимума риска
побочных реакций, угрожающих жизни. Эти
меры будут способствовать сбережению здоровья населения. К тому же грамотный индивидуальный подход к дозированию медикаментов
окажет сберегающий эффект на бюджет здравоохранения.
БЛАГОДАРНОСТИ
Финансовая поддержка данного исследования осуществлялась Интеграционным проектом № 5.5 (2006–2008 гг.), Государственным
контрактом № 01-15/36 и экспедиционными
грантами СО РАН № 1/8 за 2008 г. и № 1/2 за
2009 г. (для Осиповой Л.П.); Интеграционными
проектами СО РАН № 17 (2009–2011 гг.) и № 84
(2009–2011 гг.) (для Филиппенко М.Л.).
Авторы выражают глубокую благодарность
представителям коренных этносов, принявшим
участие в данном исследовании. А также Андреенкову О.В., Бочкареву М.Н. и Зубкову Е.А.
за выделение образцов ДНК; Бурлаковой Н.А.,
Чуркиной Т.В., Молетотовой Н.А, Карафет Т.М.
и Вепреву С.Г. за помощь в проведении экспедиционных исследований и Гольцовой Т.В. за
предоставление генеалогических данных по
нганасанам.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Корчагина Р.П., Осипова Л.П., Вавилова Н.А. и др. Генетический полиморфизм цитохрома… /c. 39–46
СПИСОК ЛИТЕРАТУРЫ
1. Райс Р.Х., Гуляева Л.Ф. Биологические эффекты токсических соединений. Новосибирск,
2003. 208 с.
Rays R.H., Gulyaeva L.F. Biological effects of
toxic compounds. Novosibirsk, 2003. 208 p.
2. Nelson D.R., Koymans L., Kamataki T. et al.
P450 superfamily: update on new sequences, gene
mapping, accession numbers and nomenclature //
Pharmacogenetics. 1996. 6. 1–42.
3. Баранов В.С., Баранова Е.В., Иващенко Т.Э.,
Асеев М.В. Геном человека и гены «предрасположенности» (Введение в предиктивную медицину).
СПб., 2000. 272 с.
Baranov V.S., Baranova E.V., Ivashchenko T.E.,
Aseev M.V. Genome of human and genes of the «predisposition» (Introduction to the predictive medicine).
SPb., 2000. 272 p.
4. Ляхович В.В., Вавилин В.А., Макарова С.И.,
Гришанова А.Ю. Экогенетический аспект полифакторных заболеваний // Вестн. ВОГиС. 2006. 10.
(3). 514–519.
Lyakhovich V.V., Vavilin V.A., Makarova S.I.,
Grishanova A.YU. Ecogenetical aspect of multifactorial
diseases // Vestn. VOGiS. 2006. 10. (3). 514–519.
5. Goldstein J.A., de Morais S.M.F. Biochemistry
and molecular biology of the human CYP2C subfamily // Pharmacogenetics. 1994. 4. 285–299.
6. Lee C., Pieper J.A., Frye R. et al. Tolbutamide,
flurbiprofen and losartan as probes of CYP2C9 activity in humans // J. Clin. Pharmacol. 2003. 43. (1).
84–91.
7. Rettie A.E., Jones J.P. Clinical and toxicological relevance of CYP2C9: Drug-drug interactions and
pharmacogenetics // Annu. Rev. Pharmacol. Toxicol.
2005. 45. 477–494.
8. Sanderson S., Emery J., Higgins J. CYP2C9
gene variants, drug dose, and bleeding risk in warfarin-treated patients: a HuGEnet systematic review and
meta-analysis // Genet. Med. 2005. 7. (2). 97–104.
9. Morais, S.M.F., Schweiki H., Blaisdell J., Goldstein J.A. Gene structure and upstream regulatory regions of human CYP2C9 and CYP2C18 // Biochem.
Biophys. Res. Commun. 1993. 194. 194–201.
10. Обжерина А.Ю., Игнатьев И.В., Дмитриев Н.В. и др. Изучение полиморфного маркера
Ile359Leu гена CYP2C9 у больных с эрозивноязвенными поражениями верхних отделов желудочно-кишечного тракта на фоне приема нестероидных противовоспалительных препаратов
(предварительные данные) // Клин. фармакол. и
терапия. 2009. (6). 41.
Obzherina A.Yu., Ignat`ev I.V., Dmitriev N.V. et
al. The study of polymorphous marker Ile359Leu
of gene CYP2C9 in patients with erosive-ulcerative
lesions of upper gastrointestinal tract against the use
of non steroidal anti-inflammatory drugs (preliminary
data) // Klin. farmakol. i terapiya. 2009. (6). 41.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
11. Кожахметова С.С., Раманкулов Е.М.,
Момыналиев К.Т. Повышение безопасности терапии непрямыми антикоагулянтами на основе
фармакогеномного подхода у этнических казахов // Режим доступа: http://www.nc-i.ru/index.
php?p=showtezis&id=268
Kozhakhmetova S.S., Ramankulov E.M., Momynaliev K.T. Increasing safety of therapy with indirect
anticoagulants on the basis of pharmacogenomical
approach in ethnic Kazakhs // Availably: http://www.
nc-i.ru/index.php?p=showtezis&id=268
12. Pirmohamed M., Park B.K. Cytochrome P450
enzyme polymorphisms and adverse drug reactions //
Toxicology. 2003. 192. (1). 23–32.
13. Сироткина О.В., Улитина А.С., Тараскина А.Е. и др. Аллельные варианты CYP2C9*2 и
CYP2C9*3 гена цитохрома CYP2C9 в популяции
Санкт-Петербурга и их клиническое значение при
антикоагулянтной терапии варфарином // Рос. кардиол. журн. 2004. (6). 24–31.
Sirotkina O.V., Ulitina A.S., Taraskina A.E. et al.
Allelic variants CYP2C9*2 and CYP2C9*3 of cytochrome CYP2C9 gene in Saint Petersburg population
and its clinical effect on the time of anticoagulating
therapy with warfarin // Ros. kardiol. zhurn. 2004.
(6). 24–31.
14. Freeman B.D., Zehnbauer B.A., McGrath S.
et al. Cytochrome P450 polymorphisms are associated with reduced warfarin dose // Surgery. 2000. 128.
(2). 281–285.
15. Сычев Д.А., Стасяк Е.В., Игнатьев И.В.
и др. Клиническая фармакогенетика изофермента
цитохрома Р-450 2С9 // Клин. фармакол. и терапия. 2005. (4). 60–63.
Sychev D.A., Stasyak E.V., Ignat`ev I.V. et al.
Clinical pharmacogenetics of isoenzyme of cytochrome Р-450 2С9 // Klin. farmakol. i terapiya. 2005.
(4). 60–63.
16. Xie H.-G., Prasad H.C., Kim R.B., Stein C.M.
CYP2C9 allelic variants: ethnic distribution and functional significance // Adv. Drug Deliv. Rev. 2002. 54.
1257–1270.
17. CYP2C9 allele nomenclature // Availably:
http://www.cypalleles.ki.se/cyp2c9.htm
18. Herman D., Dolzan V., Breskvar K. Genetic
polymorphism of Cytochrome P450 2C9 and 2C19
in Slovenian population // Zdrav. Vestn. 2003. 72.
347–351.
19. Аксянова Г.А., Багашев А.Н., Богордаева А.А. и др. Этнография и антропология Ямала.
Новосибирск, 2003. 390 с.
Aksyanova G.A., Bagashev A.N., Bogordaeva A.A. Ethnography and anthropology of Yamal.
Novosibirsk, 2003. 390 p.
20. Осипова Л.П. Генетические маркеры иммуноглобулинов (система Gm) для оценки процессов миграции и метисации в популяциях человека
в Северной Сибири // Сиб. экол. журнал. 1994. 1.
(2). 129–140.
45
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Корчагина Р.П., Осипова Л.П., Вавилова Н.А. и др. Генетический полиморфизм цитохрома… /c. 39–46
Osipova L.P. Genetic markers of immunoglobulins
(system of Gm) for the estimation of migration and
admixture processes in human populations in Northern
Siberia // Sib. ekol. zhurn. 1994. 1. (2). 129–140.
21. Karafet T.M., Osipova L.P., Gubina M.A.
et al. High levels of Y chromosome differentiation
among Native Siberian populations and the genetic
signature of a boreal hunter-gatherer way of life //
Hum. Biol. 2002. 16. 702–722.
22. Sukernik R.I., Karaphet T.M., Osipova L.P.
Distribution of blood groups, serum markers and red
cell enzymes in two human populations from Northern Siberia // Hum. Hered. 1978. 28. (5). 321–327.
23. Koman I.E., Sychev D.A., Pavliut E.V. et al.
Ethnic features of CYP2C9 gene polymorphism in
Chukotka children // Availably: http://www.mediasphera.ru/journals/pediatr/207/eng/3000/
24. Абанина Т.А. Популяционная структура
лесных ненцев: демографические характеристики,
структура браков, миграция, анализ смешения //
Генетика. 1982. 18. (11). 1884–1893.
Abanina T.A. Population structure of the Forest
Nenets, pattern of mating, migration and admixture //
Genetika. 1982. 18. (11). 1884–1893.
25. Гольцова Т. В. Родственные браки, инбридинг и его эффекты у нганасан Таймыра // Генетика. 1981. 17. (5). 896–905.
Goltzova T.V. Consanguineous marriages,
inbreeding and its effects in Taimyr Nganasans //
Genetika. 1981. 17. (5). 896–905.
26. Gaikovitch E.A., Cascorbi I., Mrozikiewicz
P.M. et al. Polymorphisms of drug-metabolizing
enzymes CYP2C9, CYP2C19, CYP2D6, CYP1A1,
NAT2 and of P-glycoprotein in a Russian population
// Eur. J. Clin. Pharmacol. 2003. 59. 303–312.
27. Ackermann E., Cascorbi I., Sachse C. et
al. Frequencies and the allelic linkage of CYP2C9
mutations in a German population, and the detection
of a C/T mutation in intron 2 // Eur. J. Clin. Pharmacol.
1997. 52. A 71.
GENETIC POLYMORPHISM OF DRUG-METABOLIZING CYTOCHROME P450 2C9
IN INDIGENOUS PEOPLE POPULATIONS OF NORTHERN SIBERIA
Roza Pavlovna KORCHAGINA1, Lyudmila Pavlovna OSIPOVA1, Natalya Aleksandrovna
VAVILOVA1, Elena Nikolaevna VORONINA2, Maksim Leonidovich FILIPENKO2
1 Institute
of Cytology and Genetics SB RAS
630090, Novosibirsk, Akademic Lavrentiev av., 10
2 The
Institute of Chemical Biology and Fundamental Medicine SB RAS
630090, Novosibirsk, Akademic Lavrentiev av., 8
The frequencies of CYP2C9*2 and CYP2C9*3 alleles in indigenous Samoedic populations of Selkups, Tundra Nenets, Forest Nenets, Nganasans and also in Russians of Northern Siberia have been investigated. The results showed
the intermediary position of CYP2C9*2 allele frequencies in Samoedic peoples, compared with Europeans and
Mongoloids, but this regularity for CYP2C9*3 has not been observed. The CYP2C9*2 frequencies for all Samoedic peoples reliably differ from ones for Russians. In addition, the reliability of differences for the frequencies of
CYP2C9*2 allele between Tundra and Forest Nenets has been shown. More substantial and reliable differences for
the frequencies of CYP2C9*3 between indigenous populations have been revealed. The considerable total part of
peoples – slow metabolizers has been elicited in all five studied populations. Consequently, we can predict the risk of
adverse drug reactions among these peoples. Our data can be used in the protocols of recommendations for dosing
drugs in populations of native residents of Northern Siberia.
Key words: cytochrome P450, biotransformation, xenobiotics, alleles CYP2C9*2 and CYP2C9*3, medicinal preparations, Samoedic populations
Korchagina R.P. – postgraduate student of the laboratory for population ethnogenetics, e-mail: kruosana@mail.ru
Osipova L.P. – candidate of biological sciences, head of the laboratory for population ethnogenetics,
e-mail: ludos84@mail.ru
Vavilova N.A. – senior laboratory assistant of the laboratory for population ethnogenetics,
e-mail: senk_off@mail.ru
Voronina E.N. – candidate of biological science, junior researcher of the group for pharmacogenomics,
e-mail: voronina_l@mail.ru
Filipenko M.L. – candidate of biological sciences, head of the group for pharmacogenomics,
e-mail: max@.niboch.nsc.ru
46
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК 616.12-008.318-001.1:615.272
ОСНОВНЫЕ ТИПЫ СТРЕСС-ИНДУЦИРОВАННЫХ ИЗМЕНЕНИЙ
ВАРИАБЕЛЬНОСТИ СЕРДЕЧНОГО РИТМА И ИНТЕНСИВНОСТИ
СВОБОДНОРАДИКАЛЬНЫХ ПРОЦЕССОВ У НЕЛИНЕЙНЫХ КРЫС
В УСЛОВИЯХ ОСТРОГО НАПРЯЖЕНИЯ
Евгения Владимировна КУРЬЯНОВА
ФГБУ ВПО Астраханский государственный университет
414000, г. Астрахань, пл. Шаумяна, 1
С применением индивидуально-типологического подхода к анализу стресс-индуцированных изменений параметров вариабельности сердечного ритма и интенсивности процессов перекисного окисления липидов у
нелинейных крыс выявлено 3 основных типа реакции на острый стресс. Сбалансированный тип выявляется
у крыс с исходно средней мощностью волн сердечного ритма и характеризуется снижением мощности HF- и
повышением мощности LF-волн без значительного изменения общей вариабельности ритма, умеренной интенсификацией перекисных процессов и каталазной активности крови. Взрывной тип характерен для особей
с исходно низкой мощностью волн сердечного ритма и отличается резким повышением индекса напряжения,
снижением мощности волн сердечного ритма в первые минуты стресса с последующим резким падением
индекса напряжения, повышением общей вариабельности кардиоинтервалов за счет усиления мощности HF-,
но особенно – LF и VLF-волн, максимальной степенью прироста каталазной активности крови и интенсивности перекисного окисления липидов в тканях. Замедленный тип проявляется у крыс с исходно высокой
мощностью волн сердечного ритма и характеризуется низкими значениями индекса напряжения и стрессорной частоты сердечного ритма, медленным снижением мощности HF-волн, значительным повышением
мощности LF- и VLF-волн на завершающем этапе стресса, высокими показателями пероксидации липидов в
тканях, особенно у самок крыс. Данные свидетельствуют о необходимости типологического подхода к анализу изменений вариабельности сердечного ритма и перекисных процессов у нелинейных крыс в условиях
острого стресса.
Ключевые слова: типы вариабельности сердечного ритма, перекисное окисление липидов, каталазная активность, острый стресс, типы реакций на стресс, нелинейные крысы.
Необходимость индивидуального подхода
к оценке результатов клинических и экспериментальных исследований для большинства
ученых представляется вполне очевидной, однако такой подход далеко не всегда реализуется на практике. Последнее особенно характерно для работ с использованием лабораторных
животных, в подавляющем большинстве которых авторы придерживаются традиционного
подхода к анализу среднегрупповых значений
исследуемых показателей, не учитывая исходное состояние регуляторных систем отдельных
особей. Между тем, по данным К.В. Судакова
и сотрудников НИИ нормальной физиологии
им. П. К. Анохина [1, 2], а также других авторов
[3], у крыс разных генетических линий четко
выражена индивидуальность реакций на стресс
по показателям поведенческой активности, изменению частоты сердечных сокращений и
артериального давления, электрической актив-
ности мозга, изменению концентрации катехоламинов в надпочечниках и структурах мозга.
Нужно признать, что не в каждой лаборатории есть возможность оперативно контролировать уровень катехоламинов, других медиаторов
и гормонов у животных в ходе эксперимента.
В связи с этим внимание привлекают методы
неинвазивной функциональной диагностики, в
том числе методы анализа вариабельности сердечного ритма (ВСР) [4, 5], так как, по мнению
разработчиков [4], они позволяют индивидуально оценивать функциональное состояние и
изменение активности механизмов регуляции
функций сердца и организма в целом. Вместе с
тем высокая индивидуальная изменчивость параметров ВСР создает трудности для анализа и
интерпретации результатов обследования. Поэтому на последнем симпозиуме по теоретическим аспектам и практическому использованию
методов анализа ВСР (Ижевск, 2008) принято
Курьянова Е.В. – доцент кафедры физиологии и морфологии человека и животных,
e-mail: fyzevk@rambler.ru
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
47
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Курьянова Е.В. Основные типы стресс-индуцированных изменений… /c. 47–55
решение об обязательном применении индивидуально-типологического подхода к оценке
данных ВСР.
Волны сердечного ритма (СР) очень чувствительны к различным нагрузкам и стрессовым ситуациям, но в доступной литературе практически отсутствуют представления о
том, какие паттерны стресс-индуцированных
изменений ВСР можно наблюдать у нелинейных крыс, поскольку индивидуально-типологический подход в работе с этими животными
применяется редко [6, 7]. Ранее нами [8] был
разработан алгоритм определения типа регуляции СР на основе относительной и абсолютной
мощности волн спектра ВСР, выявлены типы
регуляции СР, обнаружены типологические
различия интенсивности процессов пероксидации липидов у нелинейных крыс в условиях
фоновой активности [9]. Целью настоящей работы стало выявление основных типов стрессиндуцированных изменений ВСР и показателей свободнорадикального гомеостаза у самцов
и самок нелинейных крыс.
МАТЕРИАЛ И МЕТОДЫ
Опыты проведены на 105 нелинейных белых
крысах обоих полов 3,5–4-месячного возраста.
Эксперименты выполнены в соответствии с
«Правилами проведения работ с использованием экспериментальных животных» (Приложение к приказу Министерства здравоохранения СССР от 12.08.1977 г. № 755). Животные
содержались в стандартных условиях вивария
при свободном доступе к воде и корму. Группы
формировались из крыс с доминированием в
спектре волн высокочастотного спектрального
компонента HF (более 38 % от суммарной мощности спектра) [8] на основе предварительного
анализа ВСР. В день острого опыта часть животных каждой группы подвергалась эмоционально-болевому стрессу (ЭБС) длительностью
1 час по методике [2, 10], сочетающей иммобилизацию крыс в плексигласовом пенале с электрокожным раздражением хвоста по стохастической схеме пороговыми значениями переменного тока (4–6 B, 50 Гц). За время иммобилизации раздражение наносили 5 раз, длительность
каждой стимуляции 5 с.
ЭКГ регистрировали у ненаркотизированных крыс на аппаратно-программном комплексе «Варикард» (Рамена, Россия) с помощью миниатюрных электродов-зажимов при
местном обезболивании лидокаином (0,05 мл
0,5 % раствора внутрикожно). Обработка рядов
R-R-интервалов и анализ ВСР производили в
48
программе «ИСКИМ6». Точность измерения RR-интервалов составляла 1 мс. Из любой записи ЭКГ обрабатывали по 300 R-R-интервалов.
Рассчитывали частоту сердечного ритма (ЧСР),
моду (наиболее часто встречающееся в данном
динамическом ряду значение кардиоинтервала,
Мо), индекс напряжения (ИН) по Баевскому [4],
с учетом ширины класса гистограммы (7,8 мс).
Спектральный анализ проводили в диапазонах
HF (0,9–3,0 Гц), низкочастотного спектрального
компонента LF (0,32–0,9 Гц), очень низкочастотного спектрального компонента VLF (0,18–
0,32 Гц). ВСР исследовали в состоянии спокойного бодрствования на 15-й, 30-й и 60-й минуте
ЭБС.
Концентрацию ТБК-реактивных продуктов (ТБК-РП, нмоль/500 мг ткани или нмоль/л
плазмы крови), скорость аскорбатзависимого
образования продуктов перекисного окисления
липидов (АЗ-ПОЛ, нмоль/500 мг ткани в час)
проводили в плазме крови, свежеприготовленных гомогенатах миокарда и печени по [11].
Каталазоподобную активность в плазме крови
(мккат/л) определяли по методике [12]. Забор
крови и тканей для анализа проводили сразу
после регистрации ЭКГ, для чего крыс декапитировали под нембуталовым наркозом.
Математическую обработку данных выполняли в операционной среде Statisticа 6.0 с применением методов ранжирования, t-теста Стъюдента, корреляционного анализа.
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
Согласно данным таблицы, среди нелинейных крыс с доминированием HF-волн в спектре
ВСР присутствуют особи трех типов регуляции
СР, которые характеризуются низкой, средней и
высокой мощностью волн (НМВ, СМВ и ВМВ)
в доминирующей части спектра, как было показано и ранее [8]. Среди самцов 46 % особей
имеют СМВ, 28 % – ВМВ и 26 % – НМВ, среди самок 50 % животных относятся к группе с
НМВ, 32 % – к группе с СМВ и меньшинство
(18 %) имеют ВМВ. Между типологическими
группами существуют значимые различия как
по абсолютной мощности волн HF, LF и VLF,
так и по ИН (р < 0,001). Среди самцов самую
высокую ЧСР имеют крысы с НМВ (р < 0,05
и р < 0,001), а низкую ЧСР – особи с ВМВ
(р < 0,001). У самок типологические различия
по ЧСР выражены слабее и существенны только между группами НМВ и ВМВ (р < 0,05). Во
всех группах самки крыс имеют более высокую
ЧСР, чем самцы (р < 0,05).
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Курьянова Е.В. Основные типы стресс-индуцированных изменений… /c. 47–55
Таблица
Фоновые показатели ВСР и свободнорадикальных процессов у самцов и самок нелинейных крыс
(n = 105) различных типологических групп, выделенных на основе абсолютной мощности волн
спектра ВСР (среднее значение ± ошибка среднего)
Показатель
Средняя мощность волн
(СМВ), n = 42
самцы
самки
(n = 28)
(n = 14)
Низкая мощность волн
(НМВ), n = 38
самцы
самки
(n = 16)
(n = 22)
Высокая мощность волн (ВМВ),
n = 25
самцы
самки
(n = 17)
(n = 8)
ЧСР, уд/мин
315,2 ± 7,4
340,2 ± 3,1□
Показатели ВСР
343,1 ± 7,2#
359,9 ± 4,5□
297,6 ± 9,9&&&, ###
337,8 ± 7,9&, □
Мо, мс
192,8 ± 4,4
176,8 ± 1,6□
176,2 ± 4,8#
205,4 ± 8,3&&&, ###
177,8 ± 3,9&, □
5,25###
167,4 ± 2,1□
6,21###
2,54&&&, ###
19,52 ± 3,44&&&, #
ИН, отн. ед.
24,86 ± 2,21 33,41 ± 4,03 60,41 ±
HFабс, мс2
8,74 ± 0,62
6,11 ± 0,46
2,33 ± 0,24###
2,13 ± 0,28### 22,36 ± 3,65&&&, ### 19,03 ± 1,86&&&, ###
LFабс, мс2
3,57 ± 0,59
2,65 ± 0,36
1,08 ± 0,12###
0,87 ± 0,16###
7,11 ± 1,17&&&, ###
7,25 ± 1,98&&&, #
VLFабс, мс2
2,76 ± 0,40
3,14 ± 0,51
1,07 ± 0,20###
0,88 ± 0,17###
4,22 ± 0,81&&&, #
4,68 ± 1,08&&&, #
74,01 ±
17,25 ±
Показатели интенсивности процессов ПОЛ и каталазной активности
ТБК-РП плазмы,
нмоль/л
Каталазная активность плазмы,
мккат/л
ТБК-РП миокарда,
нмоль/500 мг
АЗ-ПОЛ миокарда,
нмоль/500 мг в час
ТБК-РП печени,
нмоль/500 мг
АЗ-ПОЛ печени,
нмоль/500 мг в час
самцы
(n = 10)
3,17 ± 0,29
самки
(n = 7)
2,53 ± 0,30
самцы
(n = 8)
2,61 ± 0,28
самки
(n = 10)
2,31 ± 0,15
самцы
(n = 7)
2,78 ± 0,17
самки
(n = 4)
1,33 ± 0,10#, &&, □□
46,4 ± 4,1
48,7 ± 9,7
61,3 ± 3,4#
47,1 ± 5,8
44,7 ± 4,2&&
77,7 ± 1,9&, □□□
1,03 ± 0,09 0,31 ± 0,04□□□ 0,58 ± 0,08##
0,32 ± 0,03□□
0,76 ± 0,07#, &
0,33 ± 0,04□□
6,05 ± 0,37 2,88 ± 0,32□□□ 2,62 ± 0,26###
2,43 ± 0,37
5,65 ± 0,44 &&&
1,99 ± 0,12□□□
2,03 ± 0,22 0,39 ± 0,04□□□ 0,81 ± 0,09##
0,55 ± 0,11
1,03 ± 0,26#
0,29 ± 0,05□
11,31 ± 2,04
2,60 ± 0,08&, ###, □□
15,38 ± 1,74 7,22 ± 0,59□□
7,56 ± 0,72## 4,64 ± 0,47##, □□
П р и м е ч а н и е . Отличие от величины соответствующего параметра у крыс того же пола из группы СМВ достоверно: # – при p < 0,05, ## – при p < 0,01, ### – при p < 0,001; отличие от величины соответствующего параметра у крыс
того же пола из группы НМВ достоверно: & – при p < 0,05, && – при p < 0,01, &&& – при p < 0,001; отличие от величины соответствующего параметра у самцов достоверно: □ – при p < 0,05, □□ – при p < 0,01, □□□ – при p < 0,001.
Самцы крыс с НМВ отличаются от животных других групп высокой каталазной активностью плазмы крови (р < 0,05), низким содержанием ТБК-РП в миокарде и печени (р < 0,01)
и низкой скоростью АЗ-ПОЛ в этих тканях
(р < 0,01) (см. таблицу). Наиболее высокое содержание продуктов ПОЛ в тканях характерно для самцов со СМВ. Среди самок наиболее
высокая каталазная активность плазмы свойственна особям с ВМВ (р < 0,05) при низком содержании ТБК-РП в плазме крови (p < 0,01) и
низкой скорости АЗ-ПОЛ в печени (р < 0,001).
Анализ реакции на ЭБС по параметрам
ВСР, ПОЛ тканей и каталазной активности
крови проводили с учетом исходного состояния регуляторных механизмов. У крыс группы
СМВ максимальный рост ЧСР отмечается на
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
15-й мин ЭБС (у самцов – на 39 %, р < 0,001, у
самок – на 25 %, р < 0,001), тахикардия является особенно стойкой у самок (рис. 1 и 2). Для
самцов характерно повышение ИН в ходе всего
стресса (на 79–43 %, р < 0,05), у самок – только
на 30-й мин опыта (р < 0,05). Мощность волн
доминирующего диапазона HF снижается к 30-й
мин (р < 0,01 и р < 0,001), наряду с этим мощности LF- (р < 0,05) и VLF-волн (р < 0,001) повышаются (у самцов – с 30-й мин, у самок – с
15-й мин опыта), при этом суммарная мощность
волн спектра остается в пределах исходных величин в течение всего ЭБС у самцов и в первой
половине стресса у самок, что свидетельствует
о поддержании относительного вегетативного
баланса. Только у самок на 60-й минуте стресса
резко увеличивается мощность LF- (в 6,8 раза,
49
Рис. 1. Типы динамики показателей сердечного ритма у самцов нелинейных крыс при остром эмоционально-болевом стрессе. Здесь и на рис. 2, 3 отличие от
величины соответствующего параметра у крыс в состоянии покая достоверно: * – при p < 0,05, ** – при p < 0,01, *** – при p < 0,001
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Курьянова Е.В. Основные типы стресс-индуцированных изменений… /c. 47–55
50
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Рис. 2. Типы динамики показателей сердечного ритма у самок нелинейных крыс при остром эмоционально-болевом стрессе
Курьянова Е.В. Основные типы стресс-индуцированных изменений… /c. 47–55
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
51
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Курьянова Е.В. Основные типы стресс-индуцированных изменений… /c. 47–55
Рис. 3. Особенности стресс-индуцированных изменений показателей ПОЛ тканей и каталазной
активности плазмы крови у нелинейных крыс с
разными типами регуляции сердечного ритма
р < 0,001), VLF- (в 4,2 раза, р < 0,001) и даже
HF-колебаний (в 1,5 раза, р < 0,05), что указывает на повышение активности центров, согласующих СР с колебаниями артериального давления, и надсегментарного уровня регуляции,
а также на смещение вегетативного баланса в
сторону преобладания парасимпатических влияний. Согласно данным рис. 3, у самцов и самок группы СМВ стресс сопровождается ростом каталазной активности плазмы в 2–3 раза,
умеренным повышением концентрации ТБК-РП
в печени (р < 0,05 и р < 0,01), скорости АЗ-ПОЛ
в миокарде (р < 0,001) и печени (р < 0,001 и
р < 0,05). В целом, характер реакции на стресс
у крыс с СМВ имеет сбалансированный характер с умеренной (у самцов) и сильной (у самок)
централизацией регуляции и умеренной интенсификацией процессов липидной пероксидации
в тканях.
У крыс с НМВ максимальный прирост
ЧСР также приходится на 15-ю минуту ЭБС и
составляет около 35 % (р < 0,001) у самцов и
25 % (р < 0,001) у самок, однако тахикардия у
этих животных менее стойкая и слабеет к 60й мин опыта (см. рис. 1 и 2). В начале стресса
ИН резко повышается (р < 0,01 и р < 0,001), СР
52
становится еще более ригидным у самцов за
счет снижения мощности VLF- (р < 0,001) и LFволн (р < 0,05) при резком доминировании низкоамплитудных HF-волн, а у самок – за счет
ослабления HF-волн (р < 0,05). У всех крыс с
НМВ в ходе стресса высокая напряженность
сменяется лавинообразным нарастанием вариабельности СР и снижением ИН (р < 0,001). При
этом мощность HF-волн повышается у самцов
в 3,5 раза (р < 0,001) на 60-й мин, у самок в 2,4
раза (р < 0,05) на 30-й мин ЭБС. Однако основной вклад в рост вариабельности СР вносят
LF-волны, мощность которых увеличивается в
наибольшей мере как у самцов, так и у самок
(р < 0,001), а также VLF-волны (р < 0,05). Эти
изменения ВСР свидетельствуют об активации
всех уровней регуляции, в особенности стволовых центров, согласующих СР с колебаниями
артериального давления [4], а также о смещении вегетативного баланса в сторону преобладания парасимпатических влияний. Стресс вызывает у самцов и самок группы НМВ резкое (в
3,5–4,5 раза) повышение каталазной активности плазмы крови (см. рис. 3), высокий прирост
уровня ТБК-РП и АЗ-ПОЛ в печени (р < 0,001)
самцов, но несмотря на это абсолютные значения показателей ПОЛ у них, как и в условиях
фоновой активности, ниже, чем у крыс других
типологических групп. В целом, стресс-индуцированные изменения ВСР и параметров свободнорадикального гомеостаза у крыс с НМВ
имеют взрывной характер, с резкими колебаниями активности как уровней регуляции, так
симпатического и парасимпатического каналов
регуляции, формированием высокой централизации управления, резкой интенсификацией перекисных процессов и каталазной активности
крови.
У крыс с ВМВ максимальный рост ЧСР
составляет 27–28 % от исходной (р < 0,001) у
самцов – на 15-й и 60-й мин (р < 0,001), у самок – на 30-й мин ЭБС (р < 0,001), средняя ЧСР
у самцов не поднимается выше 400 уд/мин (см.
рис. 1 и 2). ИН повышается у самцов также на
15-й и 60-й мин (р < 0,01), у самок – в первой
половине ЭБС (р < 0,01 – р < 0,05), но абсолютные значения показателя значительно ниже,
чем у крыс других групп. Мощность HF-волн
у самцов остается высокой в первой половине
ЭБС и снижается только к 60-й мин (р < 0,05),
свидетельствуя о высоком уровне парасимпатических влияний. У самок мощность HF-волн
падает в 5,5 раза (р < 0,001) к 30-й мин ЭБС, т. е.
парасимпатические влияния у них снижаются в
значительно большей мере и быстрее, чем у самцов. Несмотря на то что общая вариабельность
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Курьянова Е.В. Основные типы стресс-индуцированных изменений… /c. 47–55
СР у крыс группы ВМВ поддерживается в ходе
стресса на достаточно высоком уровне, к 60-й
мин значительно усиливаются VLF- (р < 0,001)
и LF-волны (р < 0,01), причем у самцов это усиление сопряжено с падением HF-волн (р < 0,05).
Вероятнее всего, активация надсегментарных
эрготропных, катехоламинергических структур
[4, 8] направлена на регуляцию активности автономного контура и обеспечение достаточной
мобилизации функций сердечно-сосудистой
системы в ситуации напряжения. У самцов с
ВМВ в условиях ЭБС каталазная активность
плазмы крови увеличивается более чем втрое
(р < 0,001), значительно повышается интенсивность ПОЛ в тканях (см. рис. 3). Самки группы
ВМВ, в отличие от самок других типологических групп, реагируют на стресс наибольшей
степенью прироста интенсивности ПОЛ и высокой концентрацией ТБК-РП в плазме крови и
тканях (р < 0,001), но наименьшим повышением каталазной активности крови (только в 1,5
раза, р < 0,001). В целом, крысам с ВМВ свойственен замедленный тип реакции на стресс, с
постепенным ослаблением парасимпатических
влияний и особенно сильным нарастанием активности стволового и надсегментарного уровней регуляции на завершающем этапе стресса,
значительным накоплением продуктов ПОЛ и
снижением устойчивости тканей к прооксидантной провокации, последнее характерно в большей мере для самок.
У самцов и самок крыс всех групп с ростом
ЧСР в ходе стресса коррелирует повышение
каталазной активности крови (r = 0,60 – 0,89,
р < 0,01) и увеличение уровня ТБК-РП и скорости АЗ-ПОЛ в печени (r = 0,72–0,73 и r = 0,87–
0,85, р < 0,01).
Анализируя данные, отмечаем, что в условиях острого напряжения у крыс всех типологических групп повышается мощность LF- и
VLF-волн при снижении мощности HF-волн,
которые в исходном состоянии доминировали
в спектре ВСР. Степень изменений ЧСР, ИН и
волновой структуры, скорость их развития и
стойкость различаются у особей разных групп,
кроме того, у крыс с НМВ мощность HF-волн
даже повышается.
Из работ, в которых учитывалось исходное
состояние организма перед предъявлением нагрузки, известно, что стресс (дегидратация) вызывает у крыс с нормотонией и ваготонией рост
ИН, у крыс с исходным преобладанием симпатических влияний первоначально также усиливаются симпатические влияния, но по мере
развития дегидратации начинают преобладать
парасимпатические влияния, что расценивается
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
как истощение механизмов адаптации [6]. При
моделировании роста симпатических влияний
введением изадрина крысы с исходно высоким
симпатическим тонусом выживают, а погибают в основном крысы с исходно высоким парасимпатическим тонусом [7]. При аналогичном
подходе к анализу реакций людей на нагрузку
[13] обнаружено, что у лиц с исходным преобладанием парасимпатических влияний гипоксия сопровождается падением вариабельности
кардиоинтервалов, а у лиц с исходным преобладанием симпатической активности в ответ на
гипоксию повышается вариабельность СР.
Данные литературы [6, 7, 13] и собственные
результаты свидетельствуют о закономерной
реакции каналов регуляции СР на острое напряжение. Она сходно проявляется и у человека, и у животных, и состоит в том, что при
исходном преобладании влияний на СР одного из отделов вегетативной нервной системы в
ситуации экстренной мобилизации организма
повышаются влияния ее «антагонистического»
отдела. Это можно рассматривать как проявление принципа акцентированного антагонизма отделов вегетативной нервной системы. То
есть в стрессовой ситуации следует ожидать
усиления вариабельности кардиоинтервалов,
если в исходном состоянии или в первые минуты стресса сформировался напряженный СР. И
наоборот, при стрессе следует ожидать снижения вариабельности СР, если в покое сформировался достаточно вариабельный СР. Только
в первом случае, как показывают наблюдения,
изменения мощности волн происходят быстро
и резко, во втором случае – постепенно.
В свою очередь, чем медленнее активизируются механизмы, усиливающие напряженность СР, тем больше накапливается продуктов
ПОЛ при стрессе. Это обусловлено участием
гормонов и медиаторов стресса в индукции и
торможении процессов пероксидации в тканях
при стрессе [14]. Особенности стресс-индуцированных изменений ПОЛ и каталазной активности, по нашему мнению, связаны с различиями в динамике активности регуляторных систем, концентрации и скорости высвобождения
гормонов и медиаторов стресса, неодинаковой
чувствительностью к ним тканей у животных
различных типологических групп. Так, у крыс
с СМВ и НМВ пик прессорных реакций приходится на 15-ю мин стресса, а у крыс с ВМВ – на
30–60-ю, что отражается на фазных изменениях ПОЛ и активности каталазы. У крыс с ВМВ
(особенно у самок) развитие стресс-реакции
требует особенно сильной активации высших
эрготропных структур, кроме того, у них выше
53
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Курьянова Е.В. Основные типы стресс-индуцированных изменений… /c. 47–55
риск интенсификации ПОЛ, что создает угрозу
срыва адаптации.
Таким образом, среди нелинейных крыс с
исходным доминированием HF-волн в спектре
ВСР выявлено 3 типа реакции на острый стресс
в зависимости от исходного состояния регуляции СР: сбалансированный, взрывной и замедленный, которые различаются по выраженности
и стойкости тахикардии, изменению ИН и абсолютной мощности волн спектра ВСР, а также
по степени повышения каталазной активности
плазмы крови и интенсификации ПОЛ в тканях
сердца и печени. Выявленные типы стрессорных изменений реализуются как у самцов, так
и у самок, отличия реакций женских особей
на стресс состоят в более быстром нарастании
вариабельности СР и формировании более высокой мощности медленных волн спектра, что
связано с особенностями нейровегетативной
сферы у представителей женского пола [15].
Приведенные данные свидетельствуют о
том, что характер вегетативной регуляции сердечного ритма имеет существенное значение
для формирования ответной реакции на острый стресс как со стороны регуляторных систем, так и на уровне тканей в виде изменения
интенсивности процессов свободнорадикального окисления липидов и антиоксидантной
защиты. Существенным результатом является
обнаружение основных паттернов стресс-индуцированных изменений ВСР и ПОЛ в зависимости от исходного симпато-парасимпатического баланса. Выявленные закономерности
стресс-индуцированных изменений позволяют
с определенной долей вероятности прогнозировать реакцию на стресс самцов и самок нелинейных крыс по исходному типу ВСР.
СПИСОК ЛИТЕРАТУРЫ
1. Судаков К.В. Индивидуальность эмоционального стресса // Журн. неврол. психиатрии.
2005. 105. (2). 4–12.
Sudakov K.V. Individuality of emotional stress //
Zhurn. nevrol. psikhiatrii. 2005. 105. (2). 4–12.
2. Перцов С.С., Коплик Е.В., Краузер В. и др.
Катехоламины надпочечников крыс линии Август
и Вистар при остром эмоциональном стрессе //
Бюл. экспер. биол. мед. 1997. 123. (6). 645–648.
Pertsov S.S., Koplik E.V., Krauzer V. et al.
Catecholamine of adrenal glands in rats of line August
and Wistar at sharp emotional stress // Byul. exper.
biol. med. 1997. 123. (6). 645–648.
3. Кириллина Т.Н., Усачева М.А., Белкина Л. М. Особенности нейровегетативной регуляции у крыс с разной устойчивостью к стрессу,
54
оцениваемые по вариабельности параметров гемодинамики // Бюл. экспер. биол. мед. 2006. 142.
(10). 376–381.
Kirillina T.N., Usacheva M.A., Belkina L.M.
Features of neurovegetative regulation at rats with
different resistance to the stress, estimated by the
variability of hemodynamic parameters // Byul. exper.
biol. med. 2006. 142. (10). 376–381.
4. Баевский Р.М., Иванов Г.Г., Чирейкин Л.В.
и др. Анализ вариабельности сердечного ритма
при использовании различных электрокардиографических систем: методические рекомендации //
Вестн. аритмол. 2001. (24). 1–23.
Baevsky R.M., Ivanov G.G., Chireikin L.V. et
al. The analysis of variability of heart rhythm using
various electrocardiographic systems: methodical
recommendations // Vestn. aritmol. 2001. (24). 1–23.
5. Надареишвили К.Ш., Месхишвили И.И.,
Кахиани Д.Д. и др. Вариабельность сердечного
ритма среди кроликов породы шиншилла // Бюл.
экспер. биол. мед. 2002. 134. (12). 657–659.
Nadareishvili K.Sh., Meshishvili I.I., Kakhiani D. D. et al. Heart rate variability among rabbits
of chinchilla breed // Byul. exper. biol. med. 2002.
134. (12). 657–659.
6. Боднар Я.Я., Золенкова Е.Г., Боднар Л.П.
Изменения сердечного ритма у крыс при обезвоживании организма // Физиол. журн. 1990. 36. (2).
84–88.
Bodnar Ya.Ya., Zolenkova E.G., Bodnar L.P.
Changes of the heart rhythm at rats under condition
of organism dehydration // Fiziol. zhurn. 1990. 36.
(2). 84–88.
7. Шляховер В.Е., Ковальчук Н.В., Баринов Э. Ф., Зинкович И.И. Спектральная характеристика вариабельности сердечного ритма у
крыс при нагрузке изадрином // Вестн. науч. исследований. 2001. (6). 35–39.
Shlуakhover V.E., Kovalchuk N.V., Barinov E.F.,
Zinkovich I.I. The spectral characteristic of heart rate
variability at rats under the loading of izadrine //
Vestn. nauch. issledovaniy. 2001. (6). 35–39.
8. Курьянова Е.В. К вопросу о применении
спектральных и статистических параметров вариабельности сердечного ритма для оценки нейровегетативного состояния организма в эксперименте
// Бюл. СО РАМН. 2009. 140. (6). 30–37.
Kur`yanova E.V. On the question of application
of spectral and statistical parameters of heart rate
variability to the estimation of organism neurovisceral
conditions in experiment // Byul. SO RAMN. 2009.
140. (6). 30–37.
9. Курьянова Е.В., Савельева Е.С., Абуталиева Г.Е., Саскаева Б.С. Особенности свободнорадикальных процессов у нелинейных крыс с различным типом вегетативной регуляции сердечного
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Курьянова Е.В. Основные типы стресс-индуцированных изменений… /c. 47–55
ритма: онтогенетический аспект // Изв. Самарского науч. центра РАН. 2008. 2. 84–90.
Kur`yanova E.V., Savel`eva E.S., Abutalieva G.E.,
Saskaeva B.S. Features of peroxidation processes at
nonlinear rats with various type of vegetative regulation of the intimate rhythm: ontogenesis aspect // Izv.
Samarskogo nauch. tsentra RAN. 2008. 2. 84–90.
10. Самохвалова Т.Н. Роль взаимодействия
стриатума и гипоталамо-гипофизарно-надпочечниковой системы в регуляции адаптивного поведения у крыс: автореф. дис. … канд. биол. наук.
Астрахань, 1998.
Samokhvalova T.N. Role of interaction between
striatum and hypothalamus-pituitary-adrenal system
in regulation of adaptive behavior at rats: abstract of
thesis… candidate of biological sciences. Astrakhan,
1998.
11. Стальная М.Д., Гаришвили Т.Т. Метод определения малонового альдегида с помощью тиобарбитуровой кислоты // Современные методы в
биохимии. М.: Медицина, 1977. 66–68.
Stalnaya M.D., Garishvili T.T. Method of definition
of malonic aldehyde using thiobarbituric acid //
Modern methods in biochemistry. M.: Meditsina,
1977. 66–68.
12. Королюк М.А., Иванова Л.И., Майорова И. Г., Токарев В.Е. Метод определения активности каталазы // Лаб. дело. 1988. (1). 16–18.
Korolyuk M.A., Ivanova L.I., Maiorova I.G.,
Tokarev V.E. Method of catalase activity estimation //
Lab. delo. 1988. (1). 16–18.
13. Головина А.С., Филиппова Е.Б., Лесова Е. М. О показателях сердечного ритма при гипоксии // Механизмы функционирования висцеральных систем. СПб., 2007. 88–89.
Golovina A.S., Filippova E.B., Lesova E.M. About
parameters of heart rhythm at hypoxia // Mechanisms
of visceral systems functioning. SPb., 2007. 88–89.
14. Айрапетянц М.Г., Гуляева Н.В. Роль свободнорадикального окисления липидов в механизмах адаптации // Вестн. АМН СССР. 1988. (11).
49–55.
Airapetyants M.G., Gulyaeva N.V. Role of lipid
peroxidation in adaptation mechanisms // Vestn. AMN
SSSR. 1988. (11). 49–55.
15. Dart A.M., Du X.-J., Kingwell B.A. Gender,
sex hormones and autonomic nervous control of the
cardiovascular system // Cardiovasc. Res. 2002. 53.
(3). 678–687.
BASIC TYPES OF STRESS-INDUCED CHANGES OF HEART RATE VARIABILITY
AND PEROXIDATION INTENSITY AT INBRED RATS UNDER THE SHARP STRESS
Evgeniya Vladimirovna KURIYANOVA
Astrakhan state university
414000, Astrakhan, Shaumyan sq., 1
3 basic reactions to the sharp stress have been revealed at nonlinear rats using an individual–typological approach
to the analysis of stress–induced changes of heart rate variability (HRV) parameters and lipid peroxidation processes
activity. The balanced type has been determined at rats with initially average capacity of HRV waves and has been
characterized with the decrease in capacity of HF- and increase in capacity of LF-waves without significant change
of the rhythm general variability, the lipid peroxidation moderate intensification and blood catalase activity. The
explosive type is characteristic for individuals with initially low capacity of HRV waves and differs over sharp
increase in stress index, decrease of HRV waves capacity during the first minutes of the stress with the subsequent
sharp drop of stress index, increase in the general variability RR-intervals due to amplification of capacity of HF
waves, especially LF and VLF waves, the maximal degree of increase in blood catalase activity and intensity of
lipid peroxidation processes in tissue. The slow type has been shown at rats with initially high capacity of waves of
HRV spectrum and characterized by low SI values and heart rate frequency, slow decrease of HF-waves capacity,
strong increase of LF and VLF capacity at the closing stage of stress, high parameters of lipid peroxidation in tissue
especially at female rats. The data testify to the necessity of the typological approach to the analysis of changes of
HRV and peroxidation processes at inbred rats under conditions of sharp stress.
Key words: types of heart rate variability, lipid peroxidation, catalase activity, sharp stress, types of responses to
stress, inbred rats.
Kuriyanova E.V. – associate professor of the chair for human and animal physiology and morphology, e-mail:
fyzevk@rambler.ru
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
55
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК 577.32: 616-002.5
ИССЛЕДОВАНИЕ АКТИВНОСТИ СВОБОДНОРАДИКАЛЬНЫХ
ОКИСЛИТЕЛЬНЫХ ПРОЦЕССОВ В ДИНАМИКЕ ХРОНИЧЕСКОГО
ГЕНЕРАЛИЗОВАННОГО БЦЖ-ГРАНУЛЕМАТОЗА
Вячеслав Алексеевич ШКУРУПИЙ1,2, Елена Брониславовна МЕНЬЩИКОВА1,
Николай Константинович ЗЕНКОВ1, Виктор Олегович ТКАЧЕВ1
1 Научный
центр клинической и экспериментальной медицины СО РАМН
630117, г. Новосибирск, ул. Тимакова, 2
2 ГБОУ
ВПО Новосибирский государственный медицинский университет Минздравсоцразвития РФ
630091, г. Новосибирск, Красный проспект, 52
Проведено исследование активности свободнорадикальных окислительных процессов в перитонеальном экссудате и печени мышей в ходе развития хронического генерализованного БЦЖ-индуцированного гранулематоза (3, 30, 60 и 90 сутки после однократного внутривенного введения 0,5 мг вакцины БЦЖ). Обнаружено,
что активность свободнорадикальных окислительных процессов в печени, оцениваемая по интенсивности
хемилюминесценции ее гомогенатов, возрастала до максимальных значений на 60 сутки после инъекции
вакцины БЦЖ, снижаясь к 90 суткам, но оставаясь значимо выше величин в контроле. Пик генерации активированных кислородных метаболитов нейтрофилами и макрофагами перитонеального экссудата у этих
животных, определяемой с помощью проточной цитофлуориметрии, наблюдали на 30 сутки эксперимента.
Полученные данные свидетельствуют о возрастании стационарной концентрации Н2О2 в печени инфицированных животных, не связанном с ее локальной продукцией фагоцитами.
Ключевые слова: гранулема, туберкулез, активированные кислородные метаболиты, фагоциты, печень.
Многие инфекционные (туберкулез, туляремия и др.) и неинфекционные (силикоз, асбестоз,
гранулематозный гепатит и др.) заболевания
(более 70 нозологий) характеризуются появлением в интерстиции органов гранулем, возникающих в результате пролиферации и трансформации в гранулемах фагоцитирующих клеток,
генерирующих активированные кислородные
метаболиты (АКМ) [1, 2]. Общепризнанно, что
гранулематозное воспаление необходимо для
изоляции чужеродных объектов, в том числе и
микроорганизмов, которые не могут быть удалены посредством фагоцитоза с последующей
деградацией клетками системы мононуклеарных фагоцитов (СМФ). Проблемой является
практически полное отсутствие эффективных
средств и приемов воздействия на индукторы
гранулематозов биологической природы, и прежде всего – микобактерии туберкулеза. Еще
одну проблему гранулематозов, индуцируемых
факторами бактериальной природы, представляет собой высокая непредсказуемость итогов
их развития и разрешения: время жизни гранулем и характер их «обратного развития» очень
индивидуальны и связаны как с особенностями
индуцирующих факторов, так и с реактивностью организма. Наименее изученным остается
вопрос об участии в гранулемогенезе АКМ как
эволюционно древнего механизма внутри- и
межклеточной регуляции, «дирижирующего»
(в том числе через посредство редокс-зависимых транскрипционных факторов) процессами
миграции и кооперации клеток, изменения их
функциональной активности, жизненного цикла, пролиферации и гибели [3].
Чрезвычайно важной остается проблема
элиминации факторов бактериальной природы – индукторов гранулематозов, что в полной
мере относится к микобактерии туберкулеза,
поскольку она персистирует преимуществен-
Шкурупий В.А. – д.м.н., проф., академик РАМН, зав. кафедрой патологической анатомии, директор,
e-mail: sck@soramn.ru
Меньщикова Е.Б. – д.м.н., рук. группы свободнорадикальных процессов, e-mail: lemen@soramn.ru
Зенков Н.К. – д.б.н., ведущий научный сотрудник группы свободнорадикальных процессов,
e-mail: lemen@soramn.ru
Ткачев В.О. – к.б.н., старший научный сотрудник лаборатории молекулярных механизмов физиологии и
патологии клетки, e-mail: tkachev_victor@mail.ru
56
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Шкурупий В.А., Меньщикова Е.Б., Зенков Н.К., Ткачев В.О. Исследование активности … /c. 56–62
но внутри вакуолярного аппарата макрофагов.
Макрофаги специализированы на противобактериальной защите, 90 % которой определяется
кислородзависимыми механизмами [4, 5]. Высокая заболеваемость туберкулезом у людей с
генетическими дефектами NAD(P)H-оксидазы
[6] и положительный эффект применения ингаляций NO-радикалов [7] указывают на необходимость более глубокого изучения роли свободнорадикальных процессов с участием АКМ
в персистенции микобактерий в динамике развития туберкулезного гранулематоза.
Цель настоящего исследования – изучить
динамику активности свободнорадикальных
окислительных процессов в ходе развития хронического БЦЖ-индуцированного генерализованного гранулематоза у мышей. Использование печени обусловлено большой концентрацией в ней резидентных макрофагов – центров
гранулемообразования, и в совокупности с изучением изменений, происходящих в перитонеальном компартменте системы фагоцитирующих клеток, может свидетельствовать о генерализации гранулематоза.
МАТЕРИАЛ И МЕТОДЫ
Экспериментальные животные и модели. Исследование проводили на мышах-самцах
линии BALB/c двухмесячного возраста массой
18–22 г из питомника НИИ клинической иммунологии СО РАМН. Генерализованный туберкулезный гранулематоз моделировали однократным введением каждому животному в
хвостовую вену 0,5 мг вакцины БЦЖ (ФГУП
НПО Микроген, Москва) в 1 мл 0,85%-го водного раствора NaCl [1, 2, 8]. Контролем служили интактные животные, которым вводили аналогичный объем 0,85 % раствора NaCl.
Мышей выводили из эксперимента под эфирным наркозом путем дислокации позвонков в
шейном отделе через 3, 30, 60 и 90 суток после
инфицирования, в каждой группе (по числу этапов наблюдения) было по 5 животных. Мышей
предварительно взвешивали, получали перитонеальный экссудат. После вскрытия брюшной
полости проводили эвисцерацию печени, орган
взвешивали и готовили гомогенаты. Печень в
качестве объекта изучения использовали в связи с тем, что в ней сосредоточен наибольший
компартмент клеток СМФ, что детерминирует
высокую концентрацию гранулем в органе.
Хемилюминесцентный (ХЛ) анализ. Печень измельчали в гомогенизаторе ПоттераЭльвейема, добавляя бесцветную среду Хенкса
из расчета 200 мг ткани в 1 мл среды. ИзмериБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
тельную кювету термостатировали при 37 °С в
ячейке хемилюминометра («Фотон», Россия) в
течение 2 мин, регистрируя фоновую ХЛ, вводили в нее 2 мл гомогената печени, термостатировали в течение 2 мин, затем в течение 2 мин
измеряли спонтанную ХЛ. После этого в систему вводили 0,1 мл 100 нМ раствора люминола
(«Serva», Германия) и вновь регистрировали ХЛ
в течение 2 мин. Н2О2-индуцированную люминол-зависимую ХЛ гомогенатов измеряли, регистрируя ХЛ после введения в систему 0,1 мл
раствора перекиси водорода (конечная концентрация 39,5 мМ). Интенсивность ХЛ выражали в
условных единицах (1 усл. ед. = 5 импульсов за
1 с), каждое значение усредняли; при расчете величин спонтанного и люминол-усиленного свечения из полученных средних значений вычитали среднюю величину фоновой ХЛ кюветы.
Определение продукции активных форм
кислорода клетками перитонеального экссудата методом проточной цитофлуориметрии. Перитонеальный экссудат, содержащий
большое количество фагоцитирующих клеток,
использовали для их получения, промывая
брюшную полость мышей холодной культуральной средой RPMI-1640 («Биолот», Россия)
c 1 % фетальной бычьей сыворотки («Биолот»)
и держали на льду до момента измерения. Для
измерения суммарной продукции АКМ выделенные клетки инкубировали в течение 15 минут в 1 мл бесцветной среды Хенкса с 10 мкМ
диацетата
2,7-дихлородигидрофлуоресцеина
(«Sigma», США), после внутриклеточного ферментативного деацилирования окисляющегося
до интенсивно флуоресцирующего продукта
2,7-дихлорофлуоресцеина (DCF), или 50 мкМ
дигидроэтидия («Sigma»), в результате окисления супероксид-анионом люминесцирующего
в красной области спектра. Исследовали спонтанную продукцию АКМ, а также стимулированную 100 нМ форбол-12-миристат-13-ацетата
(PMA, «Sigma»). На проточном цитофлуориметре FACSCalibur («Becton-Dickinson», США)
измеряли интенсивности DCF-зависимой флуоресценции (λEm = 488 нм, λEx = 520 нм), свидетельствующей о генерации клетками преимущественно Н2О2, и флуоресценции этидия
(λEm = 488 нм, λEx = 630 нм; регистрация преимущественно супероксид-аниона). Гейты, содержащие макрофаги и нейтрофилы, выделяли
по показателям прямого и бокового светорассеяния. Результаты выражали в виде отношений
величин интенсивности флуоресценции клеток
к принятому за 100 % усредненному значению
спонтанной флуоресценции в контроле.
57
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Шкурупий В.А., Меньщикова Е.Б., Зенков Н.К., Ткачев В.О. Исследование активности … /c. 56–62
Статистический анализ. Поскольку распределение значений ХЛ и флуоресценции в
выборках отличалось от нормального, данные
представлены в виде медианы (Me), указаны
также нижняя (Q1) и верхняя (Q3) квартили. Различия между группами оценивали с помощью
критерия Манна – Уитни и считали значимыми
при p < 0,05. Наличие связей между различными признаками определяли с помощью корреляционного анализа величиной коэффициента
корреляции Спирмена (r).
РЕЗУЛЬТАТЫ
Ранее было показано, что введение мышам
вакцины БЦЖ в использованной дозе приводит
к развитию генерализованного гранулематоза с
наиболее высокой концентрацией туберкулезных гранулем в печени и легких [1, 9].
В ходе выполнения эксперимента обнаружено, что на 3 сутки после введения мышам
вакцины БЦЖ ни один из показателей ХЛ гомогенатов печени не изменялся (см. рисунок).
На 30 сутки (время формирования макрофагально-эпителиоидных гранулем в печени) величина спонтанной ХЛ значимо не отличалась
от контрольных значений, однако при введении
в систему регистрации люминола выявлено достоверное повышение интенсивности свечения
у подопытных животных, еще более выраженное в условиях индукции ХЛ перекисью водорода. Через 60 суток после начала эксперимента
величина люминол-усиленной ХЛ гомогенатов
печени мышей, которым была введена вакцина
БЦЖ, увеличивалась еще более выражено – показатель не только многократно превышал соответствующее значение у мышей в контроле,
но и был достоверно больше величины люминол-зависимой ХЛ гомогенатов печени животных на 30 сутки после инъекции вакцины
БЦЖ. Согласно ранее полученным данным [1],
в этот период в составе гранулем в печени доминировали эпителиоидные клетки и макрофаги. При этом следует отметить, что величина
Н2О2-индуцированной ХЛ на данном сроке
наблюдения в группах опыта и контроля была
одинаковой. К 90 суткам эксперимента, когда у
инфицированных животных существенно снижается концентрация гранулем в печени, а в
их составе доминируют эпителиоидные клетки
и отчасти фибробласты, мыши групп опыта и
контроля различались по интенсивности и люминол-зависимой, и Н2О2-индуцированной ХЛ
(см. рисунок), при этом величина последнего
показателя в контрольной группе была парадоксально низкой.
В ходе проведения анализа взаимосвязей
между различными показателями интенсивности ХЛ и массы тела и органов обнаружен ряд
интересных закономерностей. Так, если у контрольных (интактных) животных значимые корреляционные связи обнаружены между массой
тела, с одной стороны, и H2O2-индуцированной
ХЛ, массой печени и легких – с другой, то после внутривенного введения вакцины БЦЖ дополнительно появляются прямые корреляции
между массой печени, с одной стороны, и люминол-зависимой ХЛ ее гомогенатов и массой
легких – с другой, а также отрицательная взаимосвязь между массой легких и H2O2-индуцированной ХЛ, в то время как обратная зависимость H2O2-индуцированной ХЛ от массы тела
перестает быть значимой (табл. 1).
Рис. Изменение интенсивности ХЛ гомогенатов печени мышей в динамике развития гранулематоза, индуцированного внутривенным введением вакцины БЦЖ; белые столбики – контроль, серые – инфицирование
БЦЖ. Знаком # отмечены величины параметров, достоверно отличающиеся от величин соответствующих
показателей предыдущего срока наблюдения; здесь и в табл. 2 звездочкой отмечены величины параметров,
достоверно отличающиеся от величин соответствующих показателей в контроле
58
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Шкурупий В.А., Меньщикова Е.Б., Зенков Н.К., Ткачев В.О. Исследование активности … /c. 56–62
Таблица 1
Взаимосвязь (r) между показателями массы тела и органов и интенсивности ХЛ гомогенатов печени
мышей после введения вакцины БЦЖ за весь период наблюдения
Спонтанная
ЛюминолЛюминол-зависимая ХЛ,
ХЛ
зависимая ХЛ
индуцированная H2O2
Показатель
Спонтанная ХЛ
Люминол-зависимая ХЛ
Люминол-зависимая ХЛ,
индуцированная H2O2
Масса тела
Масса печени
Масса легких
0,12
0,46
0,24
–0,06
–0,09
0,22
0,62*
0,12
Масса
печени
Масса
легких
–0,18
–0,19
0,25
0,32
–0,06
–0,27
–0,62*
0,09
–0,44
0,51*
0,65*
0,27
–0,36
0,22
0,07
0,06
Масса
тела
–0,08
–0,07
–0,57*
0,67*
0,49*
0,63*
П р и м е ч а н и е . Верхняя правая часть таблицы – контроль, нижняя левая – внутривенное введение вакцины
БЦЖ; звездочкой отмечены значимые величины r.
Таблица 2
Изменение продукции АКМ клетками перитонеального экссудата мышей в динамике развития
гранулематоза, индуцированного внутривенным введением вакцины БЦЖ (усл. ед.), Me (Q1–Q3)
Тип клеток
РМА
Группа животных
3 сутки
30 сутки
Контроль
60 сутки
DCF-зависимая флуоресценция
–
Гранулоциты
+
–
Макрофаги
+
1,01
(0,91–1,09)
1,53
(1,20–2,70)
0,99
(0,93–1,06)
1,63
(1,38–2,67)
0,91
(0,86–0,98)
1,88
(1,67–2,14)
0,99
(0,94–1,02)
2,05
(1,87–2,18)
1,23*
(1,17–1,42)
3,00*
(2,79–3,29)
1,10
(1,06–1,51)
2,74*
(2,41–3,00)
1,07
(1,04–1,32)
1,78
(1,51–1,88)
1,25*
(1,16–1,29)
1,57
(1,53–1,60)
Этидий-зависимая флуоресценция
–
Гранулоциты
+
–
Макрофаги
+
0,91
(0,88−1,16)
2,18
(1,52−2,65)
1,03
(0,86−1,08)
1,17
(0,99−1,57
0,98
(0,84−0,99)
3,11
(2,93−3,37)
1,05
(1,04−1,08)
1,64
(1,58−1,70)
При исследовании активности свободнорадикальных процессов в перитонеальном экксудате было установлено, что на 3 сутки у мышей
после внутривенного введения вакцины БЦЖ
значения интенсивности флуоресценции клеток
перитонеального экссудата не отличаются от
аналогичных показателей клеток мышей контрольной группы, что, видимо, обусловлено малым временным отрезком для развертывания
структурно-функциональных событий, знаменующих туберкулезный гранулематоз. Через 30
суток после внутривенного введения микобактерий у мышей увеличивается величина спонБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
1,21
(1,14−1,31)
4,98*
(4,45−5,83)
1,41*
(1,32−1,52)
2,11*
(2,02−2,28)
1,22
(1,20−1,42)
2,85
(2,50−3,04)
0,90#
(0,84−1,05)
1,14#
(1,03−1,32)
танной и стимулированной РМА генерации
АКМ гранулоцитами, свидетельствующая об
их метаболической активации (табл. 2). Также
на этом сроке (30 суток) отмечено праймирование перитонеальных макрофагов, заключающееся в увеличении интенсивности флуоресценции дихлорофлуоресцеина после предварительной активации клеток форболовым эфиром
на фоне неизмененного уровня спонтанной продукции АКМ. Спустя 60 суток после внутривенного введения вакцины БЦЖ интенсивность
генерации H2O2 и O2– (как спонтанная, так и
при индукции дыхательного взрыва PMA) фа59
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Шкурупий В.А., Меньщикова Е.Б., Зенков Н.К., Ткачев В.О. Исследование активности … /c. 56–62
гоцитами брюшной полости мышей в целом
возвращалась к исходным значениям, хотя нестимулированная DCF-зависимая флуоресценция перитонеальных макрофагов оставалась
несколько повышенной (см. табл. 2).
ОБСУЖДЕНИЕ
В проведенном нами исследовании показано, что БЦЖ-гранулематоз сопровождается последовательным увеличением активности свободнорадикальных окислительных процессов
в печени, оцениваемых по величине люминолзависимой хемилюминесценции гомогенатов,
с пиком на 60 сутки наблюдений. Так, в этот
период величина данного показателя в 20 раз
превышала таковую в контроле, а к 90 суткам
существенно уменьшалась. В то же время она
оставалась выше величины показателя у мышей
контрольной (неинфицированной) группы. Полученные данные, также как и возникновение у
инфицированных БЦЖ животных корреляции
между массой печени и величиной люминол-зависимой ХЛ ее гомогенатов, свидетельствуют о
возрастании стационарной концентрации Н2О2
в печени инфицированных животных, на наш
взгляд, преимущественно в гранулемах. Так, в
работе [10] также показано, что формирование
индуцированной Schistosoma mansoni гранулемы в печени мышей сопровождается постепенным повышением генерации в ней H2O2, более
того, возрастание стационарной концентрации
перекиси водорода происходит и вне гранулемы, в окружающих ее гепатоцитах (хотя и в
меньшей степени). При этом, безусловно, следует иметь в виду, что количественно вклад клеток гранулемы в общую клеточность гомогената печени невелик, об этом свидетельствует и
отсутствие различий между спонтанным свечением гомогенатов интактных и БЦЖ-инфицированных мышей во все сроки исследования.
О высоком напряжении источников синтеза H2O2 именно на 60 сутки эксперимента свидетельствует и тот факт, что если на 30 и 90
сутки наблюдения дополнительное введение в
систему «гомогенат печени – люминол» экзогенной перекиси водорода сопровождалось увеличением хемилюминесценции относительно
контрольных значений, то через 60 суток после
введения вакцины БЦЖ показатели групп опыта и контроля не различались (см. рисунок). В
пользу этого также косвенно говорит возникновение обратной зависимости между величиной
данного показателя и массой легких (органа, в
котором численная плотность и диаметр гранулем в данном модели максимальны [1, 9, 12]).
60
Отсутствие активации гранулоцитов на начальных этапах эксперимента (3 сутки) – как
спонтанной, так и PMA-индуцированной (см.
табл. 2), согласуется с данными литературы о
том, что эти клетки не принимают непосредственного участия в захвате БЦЖ в печени, в
отличие от клеток Купфера и вновь рекрутируемых моноцитов/макрофагов [11]. Кроме того, в
этот период гранулемы еще не сформированы,
процесс их образования находится на начальной стадии образования мелких инфильтратов.
В то же время привлечение в печень моноцитов
как клеток-эффекторов воспаления на стадии
формирования зрелых гранулем (30 сутки) [1]
сопровождается активацией кислород-зависимого метаболизма и мононуклеарных, и полиморфно-ядерных лейкоцитов – конститутивного
и вследствие развития дыхательного «взрыва»
синтеза перекиси водорода и ее предшественника супероксид-аниона. Более раннее (на 60 сутки) начало снижения генерации АКМ нейтрофилами и макрофагами перитонеального экссудата
(см. табл. 2), нежели активности свободнорадикальных окислительных процессов в печени
(на 90 сутки) (см. рисунок), свидетельствует
о том, что уменьшение масштаба генерализованного воспаления предшествует разрешению
локального воспаления (активации процессов
«диссоциации» и фиброзирования гранулем). В
данном контексте мы имеем в виду снижение
концентрации в гранулемах фагоцитов, в результате чего уменьшается обусловленная ими
кислород-опосредованная деструкция прилегающих клеток паренхимы печени и превалирование процессов «диссоциации». Интересно,
для выбранных в настоящем исследовании сроков наблюдения – 30, 60 и 90 сутки характерно последовательное снижение в гранулемах
относительного содержания нейтрофилов и моноцитов/макрофагов, наиболее активных продуцентов АКМ [1, 2, 12]. Таким образом, нельзя
однозначно утверждать, что обнаруженное повышение стационарной концентрации перекиси
водорода в печени инфицированных животных,
особенно через 60 суток после введения вакцины БЦЖ, обусловлено прямой генерацией H2O2
фагоцитами.
Наиболее эффективно межклеточную редокс-регуляцию осуществляют нейтральные и
способные к трансмембранной миграции формы
АКМ – оксид азота, пероксинитрит и перекись
водорода. Участие NO-радикалов в формировании как инфекционных, так и неинфекционных
гранулем у человека и животных известно достаточно давно [13]. Участие перекиси водорода
в формировании и развитии гранулематоза изуБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Шкурупий В.А., Меньщикова Е.Б., Зенков Н.К., Ткачев В.О. Исследование активности … /c. 56–62
чено в меньшей степени. В настоящее время
также изучается не только цитотоксический,
но и регуляторный потенциал данной молекулы. Показано, что система H2O2/пероксидаза эозинофилов принимает непосредственное
участие в деструкции яиц Schistosoma mansoni
в гранулеме [14], в то же время анализ микробицидности альвеолярных макрофагов морских свинок для разных штаммов М. tuberculosis и M. bovis не выявил взаимосвязи с активностью их дыхательного взрыва и продукцией
Н2О2, хотя эффективность фагоцитоза бактерий разных штаммов обратно коррелировала
с их вирулентностью [15]. Обнаружено, что
введение соединений, ингибирующих перекись
водорода, также как истощающей нейтрофилы
антисыворотки, дозозависимо снижало образование гранулем неинфекционного генеза [16,
17], в частности, за счет угнетения экспрессии
хемокинов на поверхности эндотелиальных
клеток (снижения экспрессии моноцитарного
хемотаксического протеина-1) [17]. Полученные данные о разобщении активности процессов с участием Н2О2 и ее предшественника
О2– на организменном (фагоциты перитонеальной полости) и локальном (гомогенаты печени)
уровне на разных стадиях БЦЖ-индуцированного гранулематоза также, очевидно, свидетельствуют о возможной роли перекиси водорода в
межклеточной коммуникации при формировании, созревании и «диссоциации» гранулем в
динамике процесса.
ЗАКЛЮЧЕНИЕ
Исследование динамики активности свободнорадикальных окислительных процессов
в печени и перитонеальном экссудате выявило усиление этих процессов в первые 2 месяца
после внутривенной инъекции вакцины БЦЖ
мышам. Последующее уменьшение метаболической активности фагоцитирующих клеток перитонеального экссудата после 60 дней
предшествовало снижению активности свободнорадикальных процессов в пораженных
органах печени и легких. Полученные данные
свидетельствуют о возрастании стационарной
концентрации Н2О2 в печени инфицированных
животных, не связанном с ее локальной продукцией фагоцитами.
БЛАГОДАРНОСТИ
Авторы признательны сотрудникам НЦКЭМ СО РАМН к.м.н. О.В. Потаповой, к.м.н.
Л.А. Черданцевой, к.б.н. Т.В. Шарковой за помощь в постановке эксперимента.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
СПИСОК ЛИТЕРАТУРЫ
1. Шкурупий В.А. Туберкулезный гранулематоз. Цитофизиология и адресная терапия. М.:
РАМН, 2007. 536 с.
Skurupiy V.A. Tuberculous granulomatosis.
Cytophysiology and address therapy. M.: RAMN,
2007. 536 p.
2. Granulomatous infections and inflammations:
Cellular and molecular mechanisms / Ed. D.L. Boros.
Washington: ASM Press, 2003. 325 p.
3. Finkel T. Signal transduction by reactive oxygen species // J. Cell Biol. 2011. 194. 7–15.
4. Маянский Д.Н. Хроническое воспаление.
М.: Медицина, 1991. 272 с.
Mayanskiy D.N. Chronic inflammation. M.:
Meditsina, 1991. 272 p.
5. Меньщикова Е.Б., Зенков Н.К., Ланкин В.З.
и др. Окислительный стресс. Патологические состояния и заболевания. Новосибирск: АРТА, 2008.
284 с.
Menshchikova E.B., Zenkov N.K., Lankin V.Z. et
al. Oxidative stress: Pathological conditions and diseases. Novosibirsk: ARTA, 2008. 284 p.
6. Lee P.P., Chan K.W., Jiang L. et al. Susceptibility to mycobacterial infections in children with
X-linked chronic granulomatous disease: a review of
17 patients living in a region endemic for tuberculosis
// Pediatr. Infect. Dis. J. 2008. 27. 224–230.
7. Чернеховская Н.Е., Свистунов Б.Д., Поваляев А.Б. и др. Применение оксида азота в комплексном лечении больных туберкулезом легких //
Пробл. туберкулеза и болезней легких. 2009. (6).
50–52.
Chernekhovskaya N.E., Svistunov B.D., Povalyaev A.B. et al. The use of nitric oxide in the complex
treatment of patients with pulmonary tuberculosis //
Probl. tuberkulyoza i bolezney legkikh. 2009. (6).
50–52.
8. Филимонов П.Н., Шкурупий В.А., Курунов
Ю.Н. и др. Исследование процессов фиброзирования в печени и легких при лечении лизосомотропным препаратом изониазида хронического туберкулеза у мышей // Пробл. туб. 1999. (1). 63–65.
Filimonov P.N., Skurupiy V.A., Kurunov Yu.N. et
al. Investigation of liner and lung fibrosis in the treatment of chronic tuberculosis in mice with lysosometropic drug isoniazid // Probl. tub. 1999. (1). 63–65.
9. Шкурупий В.А., Машак А.Н., Овсянко Е.В.,
Овсянко Я.У. Динамика мононуклеарных фагоцитов в лимфатических узлах и гранулемах при хроническом туберкулезном воспалении // Бюл. эксперим. биологии и медицины. 2001. (2). 201–204.
Skurupiy V.A., Mashak A.N., Ovsyanko E.V.,
Ovsyanko Ya.U. Dynamics of mononuclear phagocytes in the lymph nodes and granulomas in chronic
61
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Шкурупий В.А., Меньщикова Е.Б., Зенков Н.К., Ткачев В.О. Исследование активности … /c. 56–62
tuberculous inflammation // Byul. eksperim. biologii
i meditsiny. 2001. (2). 201–204.
10. Abdallahi O.M., Hanna S., De Reggi M.,
Gharib B. Visualization of oxygen radical production
in mouse liver in response to infection with Schistosoma mansoni // Liver. 1999. 19. 495–500.
11. Egen J.G., Rothfuchs A.G., Feng C.G. et al.
Macrophage and T cell dynamics during the development and disintegration of mycobacterial granulomas
// Immunity. 2008. 28. 271–284.
12. Nibbering P.H., van der Heide G.A., van
Furth R. Immunocytochemical analysis of cellular
responses to BCG // Clin. Exp. Immunol. 1989. 75.
147−154.
13. Facchetti F., Vermi W., Fiorentini S. et al.
Expression of inducible nitric oxide synthase in human granulomas and histiocytic reactions // Am. J.
Pathol. 1999. 154. 145–152.
14. Hanna S., Gharib B., Lepidi H. et al. Experimental schistosomiasis, protective aspects of granulomatous reaction in the mouse liver // Parasitol. Res.
2005. 96. 6–11.
15. O’Brien S., Jackett P.S., Lowrie D.B., Andrew
P.W. Guinea-pig alveolar macrophages kill Mycobacterium tuberculosis in vitro, but killing is independent
of susceptibility to hydrogen peroxide or triggering
of the respiratory burst // Microb. Pathog. 1991. 10.
199–207.
16. Roy D.K., Kumar K.T., Karmakar S. et al.
Pharmacological studies on Indian black tea (leaf variety) in acute and chronic inflammatory conditions //
Phytother. Res. 2008. 22. 814–819.
17. Kilgore K.S., Imlay M.M., Szaflarski J.P. et al.
Neutrophils and reactive oxygen intermediates mediate glucan-induced pulmonary granuloma formation
through the local induction of monocyte chemoattractant protein-1 // Lab. Invest. 1997. 76. 191–201.
ACTIVITY OF FREE-RADICAL OXIDATIVE PROCESSES DYNAMICS
IN CHRONIC GENERALIZED BCG-GRANULOMATOSIS
Vyacheslav Alekseevich SHKURUPIY1,2, Elena Bronislavovna MENSHCHIKOVA1,
Nikolay Konstantinovich ZENKOV1, Viktor Olegovich TKACHEV
1 Center
of Clinical and Experimental Medicine SB RAMS
630117, Novosibirsk, Timakov str., 2
2 Novosibirsk
State Medical University of Minzdravsotsrazvitiya
630091, Novosibirsk, Krasnyi av., 52
The dynamic of free-radical oxidative processes activity in the peritoneal exudate and liver of mice during the
development of chronic generalized BCG-induced granulomatosis (3, 30, 60 and 90 days after a single intravenous
injection of 0.5 mg BCG vaccine) has been investigated. Free-radical oxidative processes activity in the liver, as
measured by the intensity of homogenate chemiluminescence, has been found to increase to maximum at 60 day
after injection of BCG vaccine, decreasing at 90 day, but remaining significantly higher than control values. The
peak of reactive oxygen species generation by peritoneal exudate neutrophils and macrophages in these animals, as
determined by flow cytometry, was observed on 30 day of the experiment. The data obtained suggest that a steadystate H2O2 concentration in the liver of infected animals is not associated with local hydrogen peroxide production
by phagocytes.
Key words: granuloma, tuberculosis, reactive oxygen species, phagocytes, liver.
Skurupiy V.A. – doctor of medical sciences, professor, academician of RAMS, e-mail: sck@soramn.ru
Menshchikova E.B. – doctor of medical sciences, head of group for free-radical processes,
e-mail: lemen@soramn.ru
Zenkov N.K. – doctor of biological sciences, leading researcher of group for free-radical processes,
e-mail: lemen@soramn.ru
Tkachev V.O. – candidate of biological sciences, senior researcher of group for free-radical processes,
e-mail: tkachev_victor@mail.ru
62
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК 616.895.8: 547.96
МАСС-СПЕКТРОМЕТРИЧЕСКИЙ АНАЛИЗ БЕЛКОВ СЫВОРОТКИ КРОВИ
БОЛЬНЫХ ШИЗОФРЕНИЕЙ
Лариса Викторовна ЛОГИНОВА1,2,3, Людмила Павловна СМИРНОВА1,
Владимир Васильевич КОВАЛЬ2,3, Ольга Семёновна ФЁДОРОВА2,3,
Аркадий Валентинович СЕМКЕ1, Светлана Александровна ИВАНОВА1
1 НИИ
психического здоровья СО РАМН
634014, г. Томск, ул. Алеутская, 4
2 Институт
химической биологии и фундаментальной медицины СО РАН
630090, г. Новосибирск, пр. Академика Лаврентьева, 8
3 ГОУ
ВПО Новосибирский государственный университет
630090, г. Новосибирск, ул. Пирогова, 2
В работе представлены различия в протеомном составе крови, выявленные путем масс-спектрометрического
анализа и электрофоретического разделения белков сыворотки крови больных шизофренией и здоровых лиц.
При электрофоретическом анализе сыворотки крови больных шизофренией получены различия в сравнении
с контрольной группой в белковом спектре следующих областей молекулярных масс, кДа: 165–195, 70–130,
40–45, < 25. В сыворотке крови больных шизофренией выявлены 5 белков, не встречающихся у здоровых
лиц: тирозинкиназа (EC 2.7.1.112) – 128263 Да, ядерный клеточно-специфичный эпителиальный гаплоидный
белок 1 – 25933 Да, цинк-связывающий белок 747 – 20597 Да и два белка с неизвестными функциями (гипотетический белок LANCL1 – 45711 Да и гипотетический белок DP1 участка Рolyposis coli – 21135 Да).
Ключевые слова: шизофрения, протеомика, MALDI-TOF-масс-спектрометрия.
В настоящее время активно развиваются
новые подходы к диагностике психических заболеваний, использующие достижения и методы протеомики – науки, которая занимается
выявлением, регистрацией и созданием банков
данных всех белков в клетке [1, 2]. Протеомика
ставит своей целью исчерпывающую идентификацию сложных белковых образцов. Понимание протеомных процессов на уровне клетки
необходимо для раскрытия патогенеза и будет
способствовать появлению новых методов диагностики социально значимых заболеваний,
а также анализа перспективных мишеней для
разработки новых лекарственных препаратов
[3].
В клинической психиатрии шизофрения
является одной из актуальных проблем вследс-
твие преобладания по распространенности,
тяжести социальных последствий и высоких
показателей инвалидизации, наступающей в
молодом возрасте. Этиология и патогенез шизофрении не известны. Существует множество
гипотез возникновения этой болезни. Одна из
них, аутоинтоксикационная, позволяет сделать
предположение о том, что в основе развития
шизофрении могут лежать нарушение белкового обмена и накопление в организме больных разнообразных белковых продуктов. Тем
не менее до сих пор не удалось обнаружить
признаки наличия биохимических сдвигов или
маркерных белков, отличающихся особой специфичностью, свойственных только больным
шизофренией [4].
Логинова Л.В. – аспирант, e-mail: L.V.Loginova@mail.ru
Смирнова Л.П. – к.м.н., старший научный сотрудник лаборатории клеточных и молекулярно-биологических исследований
Коваль В.В. – к.х.н., доцент, старший научный сотрудник лаборатории исследования модификации биополимеров
Федорова О.С. – д.х.н., проф., зав. лабораторией исследования модификации биополимеров
Семке А.В. – д.м.н., проф., руководитель отделения эндогенных расстройств
Иванова С.А. – д.м.н., проф., зав. лабораторией клеточных и молекулярно-биологических исследований,
e-mail: Svetlana@mail.tomsknet.ru
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
63
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Логинова Л.В., Смирнова Л.П., Коваль В.В. и др. Масс-спектрометрический анализ белков … /c. 63–68
В современных протеомных исследованиях выделены из ткани мозга умерших больных
шизофренией комплексы патологически измененных белков [5]. Аномальные белки, типичные для шизофрении, встречаются не только в
мозге, но также в ткани печени и эритроцитах
[6]. Некоторые исследования демонстрируют
потенциал спинно-мозговой жидкости в качестве источника нейроспецифических биомаркеров [7]. Выявление белка-маркера, или регуляторных белков, участвующих в патогенезе шизофрении и других психических расстройств, в
доступном для использования в диагностических целях биоматериале (сыворотке крови) позволит создать основу для разработки методов
прогнозирования риска развития психических
заболеваний и методов эффективной терапии,
что значительно увеличит качество жизни и
долгосрочный прогноз у пациентов [8, 9].
Сыворотка крови доступна и удобна для использования в диагностических целях. Помимо
основных сывороточных белков в ней содержатся в небольших количествах белки различных тканей, попадающие в результате разрушения клеток при различных заболеваниях. Сыворотка находится в состоянии динамического
равновесия, и любой сдвиг этого равновесия
отражает изменение в функционировании организма. Исследование белкового спектра сыворотки крови особенно значимо для диагностики
патологических состояний, сопровождающихся
нарушениями обмена белков. При многих заболеваниях в сыворотке крови изменяется соотношение отдельных белков (диспротеинемия),
несмотря на то, что общее содержание белка
может остаться нормальным [10, 11].
В связи с вышеизложенным поиск специфических маркеров в протеоме, характерных для
шизофрении, является актуальным.
Целью данного исследования является изучение различий в электрофоретическом распределении и сравнительный качественный анализ
белков сыворотки крови больных шизофренией и здоровых людей, идентифицированных на
масс-спектрометре MALDI-TOF.
МАТЕРИАЛ И МЕТОДЫ
В рамках данного исследования было обследовано 8 пациентов в возрасте от 18 до 55
лет (средний возраст – 36,5 ± 15,1 года), из них
3 женщины и 5 мужчин. Длительность заболевания составила от 8 до 37 лет, средняя продолжительность заболевания – 21,8 ± 15,8 года.
Все пациенты проходили курс стационарного
лечения в отделении эндогенных расстройств
64
НИИ психического здоровья СО РАМН. Диагностическая оценка и клиническая квалификация расстройств проводилась в соответствии
с Международной статистической классификацией болезней, травм и причин смерти 10-го
пересмотра (МКБ-10), шифр F2. Клинико-нозологическая структура представлена следующими расстройствами: один пациент имел
диагноз недифференцированная шизофрения
(МКБ-10 F20.3), у двух пациентов диагностирована простая шизофрения (МКБ- 10 F20.60),
у четырех – параноидная шизофрения (МКБ10 F20.00) и у одного пациента – шизоаффективное расстройство (МКБ-10 F25.0). В группу
контроля вошли 8 психически и соматически
здоровых лиц, соответствующих по полу и возрасту. Все больные и испытуемые из контрольной группы дали информированное согласие на
участие в клиническом исследовании. Исследование проведено с соблюдением протокола,
утвержденного комитетом по биомедицинской
этике НИИ психического здоровья СО РАМН и
в соответствии с Хельсинкской Декларацией.
У обследуемых лиц брали кровь из локтевой
вены утром натощак в пробирки типа Vacuette
с активатором образования сгустка. Для отделения сыворотки крови от форменных элементов
пробирку с кровью центрифугировали при 1500
об/мин 30 мин.
Анализ протеома осложнен присутствием в
сыворотке крови мажорных белков в очень высокой концентрации. С целью отделения 6 мажорных белков (альбумина, иммуноглобулина
G, иммуноглобулина А, антитрипсина, трансферина и гаптоглобина) в исследуемой сыворотке после 5-кратного разведения фосфатно-солевым буфером, центрифугирования и
фильтрования через стандартный фильтр диаметром 22 мкм была использована аффинная
хроматография на хроматографе фирмы Agilent Technologies (США). Аффинная хроматография – разновидность лигандной хроматографии. В основе последней лежит реакция взаимодействия разделяемых примесей с лигандом,
связанным с инертным носителем. В случае аффинной хроматографии в роли примесей выступают биологически активные вещества (белки,
ферменты), вступающие с лигандом в специфическое биохимическое взаимодействие (антитело-антиген). Именно высокая специфичность
подобного взаимодействия обусловливает высокую эффективность аффинной хроматографии.
Фракции белков, не связавшиеся с аффинным сорбентом, концентрировали до 1 мл с помощью ультрафильтрации через фильтры МикБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Логинова Л.В., Смирнова Л.П., Коваль В.В. и др. Масс-спектрометрический анализ белков … /c. 63–68
рон-ультра (MILLIPORE, Франция) на 5 кДа. В
настоящее время большая часть работ в протеомике выполняется с использованием электрофоретического разделения. Электрофорез позволяет выявить индивидуальные вариации протеома, оценить статистические параметры для
каждого пятна. Затем, сравнивая усредненные
электрофореграммы между группами, удается
выявить различия, связанные с заболеванием.
Различия заключаются в повышении или понижении экспрессии белка, некоторые белки появляются в плазме больных, тогда как другие
могут исчезнуть [12].
Анализ концентрированных белков осуществляли с использованием электрофоретического разделения в 12 % ПААГ по методу
Laemmli [13] в градиенте додецилсульфат натрия − ПААГ с окраской coomassie brilliant blue.
Процедуру электрофоретического разделения
проводили с использованием прибора Protean II
xi Cell (Bio-Rad, США). Затем выполняли трипсинолиз белка в геле. Белковые пятна в геле
помещали в пробирки, в которые добавляли
30 мкл смеси, содержащей 50 % ацетонитрила
и 5 % муравьиной кислоты. Полученную смесь
интенсивно перемешивали на вортексе в течение 5 мин. Супернатант использовали в качестве исследуемого образца для проведения массспектрометрического анализа.
Подготовленные таким образом белковые
экстракты вносили в лунки стального планшета для MALDI-TOF-масс-спектрометрии. Метод
масс-спектрометрического анализа MALDI-TOF
основан на разделении ионов исследуемого вещества по величинам m/e (отношение массы
иона m к его заряду e) и измерении этих величин.
Для анализа использовали 1 мкл образца,
смешивая его с эквивалентным объемом насыщенного раствора матрицы-НССА-в растворе,
содержащем 50 % ацетонитрила и 0,1 % трифторуксусной кислоты [14]. В качестве контрольного образца, а также внешнего калибратора использовался стандартный набор белков
фирмы «Bruker Daltonics» (Германия). Массспектрометрический анализ проводили с использованием MALDI-TOF-масс-спектрометра
Autoflex II («Bruker Daltonics»). Для получения
каждого масс-спектра использовали от 1400 до
2000 импульсов лазера с мощностью излучения, установленной на уровне минимального
порогового значения, достаточного для десорбции – ионизации образца. Для каждого образца
записывали спектр, полученный в результате
суммирования 10 одиночных спектров (1400–
2000 импульсов лазера). Для записи испольБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
зовали программное обеспечение FlexControl
2.4 (Build 38), а для обработки и анализа массспектров − FlexAnalysis 2.4 (Build 11) фирмы
«Bruker Daltonics» (Германия).
Идентификацию белков по наборам значений масс пептидов после трипсинолиза проводили с использованием опции Peptide Fingerprint программы Mascot (www.matrixscience.
com, «Matrix Science», США). Были заданы
следующие параметры поиска: точность определения массы 100 миллионных долей, таксон
Homo sapiens. Погрешность определения масс
ионов пептидных фрагментов составляла примерно 0,03 %.
При проведении статистической обработки
результатов электрофоретического исследования достоверность различий между группами
определяли с помощью точного критерия Фишера, статистически значимыми считали различия при р < 0,05.
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
В результате нашего исследования выявлены различия в электрофоретическом распределении белков у больных шизофренией, в отличие от группы здоровых лиц, представленные
на рисунке. Зависимости в изменениях белкового спектра от пола, возраста и длительности
заболевания не получено.
При электрофоретическом анализе сыворотки крови больных шизофренией обнаружены
различия в сравнении с контрольной группой
в белковом спектре следующих областей молекулярных масс: 165–195 кДа, 70–130 кДа, 40–
45 кДа, < 25 кДа (табл. 1).
Выявленные изменения в спектре распределения белков могут носить как качественный,
Таблица 1
Различия, выявленные при анализе
электрофореграммы белков сыворотки
крови больных шизофрений и здоровых лиц
Молекулярная масса
белков, кДа
165–195
70−110
40–45
< 25
Шизофрения
Контроль
Интенсивная полоса
шириной 30–40 кДа
3–4 полосы разной
интенсивности
Широкая интенсивная полоса или две
узких
До четырех узких
полос
Полоса отсутствует
либо узкая (5 кДа)
1–2 полосы шириной 90–98 кДа
Одна менее интенсивная полоса
1–2 полосы средней интенсивности
65
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Логинова Л.В., Смирнова Л.П., Коваль В.В. и др. Масс-спектрометрический анализ белков … /c. 63–68
Рис. Различия в электрофоретическом распределении белков при шизофрении
так и количественный характер и быть обусловлены различными причинами – от изменения конформационной структуры белков
до появления белков, свойственных данному
патологическому процессу. Известно, что при
шизофрении наблюдается интенсивная генерация свободнорадикальных продуктов, усиление
перекисного окисления липидов, повышение
окислительной деструкции белков, что приводит к нарушению структуры, функции клеточных мембран и, соответственно, рецепторного
аппарата или нарушение метаболизма самих
гормонов и нейротрансмиттеров, вызванное усилением свободнорадикальных процессов [15].
При дальнейшем анализе полученных данных выявлены значимые различия масс-спектрометрических белковых профилей сыворотки
крови больных шизофренией и здоровых людей. В табл. 2 представлены белки, выделенные
из сыворотки крови у больных шизофренией,
не встречающиеся у здоровых лиц и имеющих
Score больше 40. В таблицу не включены белки, имеющие более низкое значение Score.
В области 130 кДа у больных шизофренией обнаружена тирозинкиназа (EC 2.7.1.112) –
128263 Да, не встречающаяся у здоровых лиц.
Активность этого фермента в кровеносном
русле увеличивается в результате повреждения ДНК, а также некоторыми химическими
сигналами, в том числе cAMP, cGMP, диацилглицеролом, Ca2+-кальмодулином, эти сигнальные молекулы появляются при активации всех
кальций-зависимых процессов, запускаемых в
том числе и окислительным стрессом. Окислительный стресс принимает участие в патогенезе нейродегенеративных заболеваний [16, 17].
В области 40–45 кДа у больных шизофренией обнаружен неидентифицированный белок
LANCL1 – 45711 Да с неизвестной функцией,
не встречающийся у здоровых лиц. В области >25 кДа выявлен ядерный клеточно-специфичный эпителиальный гаплоидный белок
1 – 25933 Да, в области <25 кДа – цинк-связывающий белок 747 – 20597 Да и гипотетический белок DP1 участка Рolyposis coli – 21135 Да,
также встречающиеся только у больных.
Таблица 2
Белки сыворотки крови больных шизофренией, не встречающиеся у здоровых лиц
(достоверность различий р < 0,05)
Молекулярная масса, Да
Score
20597
21135
25933
45711
128263
46
65
53
66
47
66
Международное название белка
Zinc finger protein 747 (Q9BV97_HUMAN)
Рolyposis coli region hypothetical protein DP1 (A39658_HUMAN)
Haploid germ cell-specific nuclear protein 1 (Q75WM6 HUMAN)
Hypothetical protein LANCL1 (Q86VR7_HUMAN)
Protein-tyrosine kinase (EC 2.7.1.112) (A35962 HUMAN)
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Логинова Л.В., Смирнова Л.П., Коваль В.В. и др. Масс-спектрометрический анализ белков … /c. 63–68
Возможно, идентифицированные белки могут играть роль маркеров или регуляторных
белков, участвующих в патогенезе шизофрении. Необходимо проведение дальнейших исследований с увеличением количества обследованных больных шизофренией.
ВЫВОДЫ
1. При электрофоретическом анализе белкового спектра сыворотки крови больных шизофренией в сравнении с контрольной группой получены отличия в следующих областях
молекулярных масс: 165–195 кДа, 70–130 кДа,
40–45 кДа, < 25 кДа.
2. В сыворотке крови больных шизофренией выявлены 5 белков, не встречающихся у
здоровых лиц: тирозинкиназа (EC 2.7.1.112) –
128263 Да, ядерный клеточно-специфичный
эпителиальный гаплоидный белок 1 – 25933 Да,
цинк-связывающий белок 747 – 20597 Да и
два белка с неизвестными функциями (гипотетический белок LANCL1 – 45711 Да и гипотетический белок DP1 участка Рolyposis coli –
21135 Да).
БЛАГОДАРНОСТИ
Работа выполнена в рамках междисциплинарного интеграционного проекта СО РАН
№ 90 и поддержана ФЦП «Научные и научнопедагогические кадры инновационной России»
на 2009−2013 годы (государственный контракт
14.740.12.0819).
СПИСОК ЛИТЕРАТУРЫ
1. Сарвилина И.В., Каркищенко В.Н., Горшкова Ю.В. Междисциплинарные исследования в
медицине. М.: Техносфера, 2007. 368–369.
Sarvilina I.V., Karkishchenko V.N., Gorshkova
Yu.V. Interdisciplinary research in medicine // M.:
Tekhnosfera, 2007. 368−369.
2. Hamacher M., Meyer H.E. HUPO Brain Proteome Project: aims and needs in proteomics // Expert Rev. Proteomics. 2005. 2. 1–3.
3. Filiou M.D., Turck C.W., Martins-de-Souza D. Quantitative proteomics for investigating psychiatric disorders // Proteomics Clin. Appl. 2011. 5.
38–49.
4. Pickard B. Progress in defining the biological causes of schizophrenia // Expert Rev. Mol. Med.
2011. 28. 25–26.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
5. Föcking M., Dicker P., English J.A. et al.
Common proteomic changes in the hippocampus in
schizophrenia and bipolar disorder and particular evidence for involvement of cornu ammonis regions 2
and 3 // Arch. Gen. Psychiatry. 2011. 68. 477–488.
6. Prabakaran S., Wengenroth M., Lockstone H. E. et al. 2-D DIGE analysis of liver and red
blood cells provides further evidence for oxidative
stress in schizophrenia // J. Proteome Res. 2007. 6.
141–149.
7. Lakhan S.E. Schizophrenia proteomics: biomarkers on the path to laboratory medicine? // Diagn.
Pathol. 2006. 1. 11–12.
8. Berrettini W.H. Are schizophrenic and bipolar
disorders related? A review of family and molecular
studies // Biol. Psychiatry. 2000. 48. 531–538.
9. English J.A., Pennington K., Dunn M.J.,
Cotter D.R. The neuroproteomics of schizophrenia //
Biol. Psychiatry. 2011. 69. 163–72.
10. Dudley E., Hässler F., Thome J. Profiling for
novel proteomics biomarkers in neurodevelopmental
disorders // Expert Rev. Proteomics. 2011. 8. 127–
136.
11. Ashburner M., Ball C.A., Blake J.A. et al.
Gene ontology: tool for the unification of biology.
The Gene Ontology Consortium // Nat. Genet. 2000.
25. 25–29.
12. Swatton J.E., Prabakaran S., Karp N.A. et
al. Protein profiling of human postmortem brain using 2-dimensional fluorescence difference gel electrophoresis (2-D DIGE) // Mol. Psychiatry. 2004. 9.
128–143.
13. Laemmli U.K. Cleavage of structural proteins
during the assembly of the head of bacteriophage T4
// Nature. 1970. 227. 680–685.
14. Gobom J., Schuerenberg M., Mueller M. et
al. Alpha-cyano-4-hydroxycinnamic acid affinity
sample preparation. A protocol for MALDI-MS peptide analysis in proteomics // Anal. Chem. 2001. 73.
434–438.
15. Fendri C., Mechri A., Khiari G. et al. Oxidative stress involvement in schizophrenia pathophysiology: a review // Encephale. 2006. 32. 244–252.
16. Chiueh C.C., Andoh T., Lai A.R. et al. Neuroprotective strategies in Parkinson’s disease: protection against progressive nigral damage induced by
free radicals // Neurotox. Res. 2000. 2. 293–310.
17. Yao J.K., Reddy R. Oxidative stress in schizophrenia: pathogenetic and therapeutic implications //
Antioxid. Redox Signal. 2011. 15. 1999–2002.
67
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Логинова Л.В., Смирнова Л.П., Коваль В.В. и др. Масс-спектрометрический анализ белков … /c. 63–68
MASS-SPECTROMETRIC ANALYSIS OF SERUM PROTEINS
IN PATIENTS WITH SCHIZOPHRENIA
Larisa Viktorovna LOGINOVA1,2,3, Lyudmila Pavlovna SMIRNOVA1,
Vladimir Vasilevich KOVAL2,3, Olga Semenovna FEDOROVA2,3,
Arkadiy Valentinovich SEMKE1, Svetlana Aleksandrovna IVANOVA1
1
Institute for Mental Health SB RAMS
634014, Tomsk, Aleutskaya str., 4
2 Institute
of Chemical Biology and Fundamental Medicine SB RAS
630090, Novosibirsk, Akademic Lavrent’ev av., 8
3 Novosibirsk
State University
630090, Novosibirsk, Pirogov str., 2
The differences in electrophoretic distribution of serum proteins and comparative proteomic analysis of serum proteins of patients with schizophrenia and healthy individuals have been studied. At electrophoretic analysis of serum
from patients with schizophrenia, differences as compared with control group in the protein spectrum of molecular
weights of the following areas have been obtained: 165–195 kDa, 70–130 kDa, 40–45 kDa, < 25 kDa. In serum of
the patients with schizophrenia, 5 proteins have been indentified which have not been found in healthy individuals:
polyposis coli region hypothetical protein DP1(21135 kDa), Haploid germ cell-specific nuclear protein 1 (25933 kDa),
Tyrosine-protein kinase 1 (128263 kDa), two proteins with unknown functions: protein-AAH12461 (BC012461 kDa),
LOC protein-147645 (45711 kDa).
Keywords: schizophrenia, proteome, MALDI-TOF-MS.
Loginova L.V. – postgraduate student, e-mail: L.V.Loginova@mail.ru
Smirnova L.P. – candidate of medical sciences, senior researcher of the laboratory for cellular and molecular
biological investigation
Koval V.V. – candidate of chemical sciences, senior researcher of the laboratory for biopolymers modification
investigation
Fedorova O.S. – doctor of chemical sciences, professor, head of the laboratory for biopolymers modification
investigation
Semke A.V. – doctor of medical sciences, professor, head of the department of endogenic disorders
Ivanova S.A. – doctor of medical sciences, professor, head of the laboratory for cellular and molecular biological
investigations, e-mail: Svetlana@mail.tomsknet.ru
68
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК 616.248
СРАВНИТЕЛЬНЫЕ АСПЕКТЫ АЛЛЕЛЬНОГО ПОЛИМОРФИЗМА ГЕНА IL-4
У КОРЕННЫХ И ПРИШЛЫХ ЖИТЕЛЕЙ РЕСПУБЛИКИ ХАКАСИЯ, БОЛЬНЫХ
АЛЛЕРГИЧЕСКОЙ БРОНХИАЛЬНОЙ АСТМОЙ
Елена Анатольевна АНДРЕЙЧИКОВА1, Александр Александрович ПИСКУНОВ2,
Сергей Витальевич СЕННИКОВ2, Владимир Александрович КОЗЛОВ2
1 ГУЗ
Хакасская Республиканская больница им. Г.Я. Ремишевской
655012, г. Абакан, ул. Ленина, 23
2
НИИ клинической иммунологии СО РАМН
630099, г. Новосибирск, ул. Ядринцевская, 14
Изучено распределение частот аллелей и генотипов полиморфных точек гена IL-4 в позициях –590 Т→
С и –33 Т→С у коренных и пришлых жителей Республики Хакасия, больных аллергической бронхиальной астмой (БА). Материалом для исследования послужила выборка страдающих БА хакасов (66 человек) и
европеоидов (33 больных), постоянно проживающих в республике. Генотипирование полиморфизмов –590
Т→С, –33 Т→С гена IL-4 проводилось методом полимеразной цепной реакции и посредством анализа полиморфизма длин рестрикционных фрагментов. Установлено, что коренные жители Хакасии с атопической
бронхиальной астмой являются преимущественно носителями генотипов –590С/Т и –33С/Т гена IL-4, в то
время как пришлые жители республики − генотипов –590Т/Т и –33Т/Т. Обнаружено статистически значимое
увеличение сывороточной концентрации IL-4 в периферической крови больных БА коренных жителей по
сравнению с пришлыми. Выявлены этнические особенности ассоциации продукции IL-4 у больных БА с
различными генотипами гена IL-4.
Ключевые слова: аллергическая астма, полиморфизм генов, IL-4.
Бронхиальная астма (БА) широко распространена в различных популяциях, частота
встречаемости этого заболевания варьирует от
1 до 18 % в разных странах мира [1]. Существующая разница в распространенности БА между
расами, проживающими в одном регионе, может быть связана с социально-экономическими
условиями, воздействием аллергенов, особенностью питания [2]. В различных этнических
группах могут иметь место особенности иммунопатогенеза, которые представляют как теоретический, так и практический интерес. Допустимо, что для такого сложного заболевания,
как бронхиальная астма, имеет место этническая специфика в детерминации, что доказывается различием некоторых участков сцепления
в этнически дифференцированных популяциях.
Эти различия могут лежать в основе межпопуляционной вариабельности заболеваемости атопическими патологиями, обусловливая отличия
в подверженности к астме у разных народов.
Но недостаток данных не позволяет установить
возможные причины внутри- и межпопуляционных различий в распространенности БА [2].
Согласно современным представлениям,
ключевую роль в иммунном ответе при БА
играют хелперные Т-лимфоциты (Тh). Под воздействием определенного спектра цитокинов
может формироваться один из двух вариантов
Тh-лимфоцитов: Тh1, которые продуцируют
IL-2 и IFN-γ, являющийся мощным активатором макрофагов, и поэтому занимают центральное место в клеточном иммунном ответе, и Тh2,
продуцирующие цитокины IL-4, IL-5, IL-13,
ответственные за формирование гуморального
иммунного ответа. Вариант иммунного ответа зависит как от генетически обусловленных
особенностей иммунологических реакций организма (у лиц с атопией имеется генетически
обусловленная поляризация дифференцировки
Тh0 по пути Тh2), так и от характера антигена.
Именно IL-4, продуцируемый Тh2-лимфоци-
Андрейчикова E.А. − врач-аллерголог-иммунолог, е-mail: elenandr@yandex.ru
Пискунов А.А. − научный сотрудник лаборатории молекулярной иммунологии, e-mail: ici@online.nsk.su
Сенников С.В. − д.м.н., проф., зав. лабораторией молекулярной иммунологии, е-mail: ini@online.nsk.su
Козлов В.А. − д.м.н., проф., академик РАМН, директор, е-mail:v_kozlov@online.nsk.su
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
69
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Андрейчикова Е.А., Пискунов А.А., Сенников С.В., Козлов В.А. Сравнительные аспекты… /c. 69–73
тами, на начальных стадиях развития аллергического воспаления связывается со своим
рецептором на поверхности В-клеток, играет
ключевую роль в переключении В-клеток с
синтеза IgG на IgE. Именно IgЕ играет центральную роль при атопии, являясь основным
иммунологическим маркером сенсибилизации
[3]. В работах отечественных и зарубежных авторов имеются указания на наличие ассоциаций полиморфизма генов данного медиатора с
астмой и атопией [4−6].
Цель настоящего исследования – сравнительный анализ распределения частот аллелей
и генотипов, полиморфных локусов (–33Т→С
и –590С→Т) гена IL-4 у коренных и пришлых
жителей Хакасии, больных аллергической
бронхиальной астмой.
МАТЕРИАЛ И МЕТОДЫ
Исследование проведено на этнических
группах больных аллергической IgЕ-опосредованной (атопической) БА, постоянно проживающих на территории Республики Хакасия. Обследованный контингент подразделяли
на две популяции: хакасов (монголоидов, или
коренных жителей) и европеоидов (пришлое
население). Группы больных составили пациенты, имеющие положительные результаты
кожных аллергопроб и ранее подтвержденный
диагноз бронхиальной астмы [10]. Под наблюдением находилось 99 человек: 66 больных
БА хакасов и 33 больных европеоидов. Среди
больных коренной национальности было 36 %
мужчин и 64 % женщин. Возраст больных находился в пределах от 15 до 68 лет (средний
возраст – 38,2 ± 6,3 года). Длительность болезни составляла от 1 года до 18 лет, в среднем −
6,5 ± 0,6 года. У 35 % пациентов наблюдалась
отягощенная наследственность по бронхиальной астме. В группу больных БА европеоидов
вошли 28 % мужчин и 72 % женщин. Средний
возраст составил 39,9 ± 7,2 года, длительность
болезни − 7,4 ± 0,7 года. У 25 % пациентов наблюдалась отягощенная наследственность по
бронхиальной астме.
Содержание цитокина IL-4 в сыворотке
крови определяли с помощью меченых моноклональных и поликлональных антител («R&D
Systems», США) методом электрохемилюминесценции с использованием прибора «Origen
Analyzer» («IGEN», США) и реагентов, приготовленных согласно протоколам [7].
Для генотипирования использовали образцы тотальной ДНК, выделенной из цельной
венозной крови, с использованием комплекта
70
реагентов «Проба НК» научно-производственной фирмы ООО «ДНК-технология» (г. Москва). Полиморфные локусы гена IL-4 в позициях
–590 Т→С и –33Т→С идентифицировали полимеразной цепной реакцией с использованием последовательностей олигонуклеотидных
праймеров, описанных ранее [2]. Рестрикцию
ампликионов IL-4-590 и IL-4-33 проводили
с использованием специфичных эндонуклеаз
BsIF и BstMA соответственно.
Статистический анализ проводился с помощью пакета программ «Statistica for Windows
6.0», программы OpenEpi. Для сравнения частот аллелей и генотипов между различными
группами использовали критерий χ² Пирсона с
поправкой Йетса на непрерывность. Сравнение
уровня IL-4 в сыворотке крови в группах пациентов проводили с помощью непараметрического критерия U Манна − Уитни. Различие считали статистически значимыми при р < 0,05.
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
В результате исследования полиморфных
вариантов в локусах –590 и –33 гена IL-4 при
аллергической БА у жителей Хакасии получено, что частоты генотипов в двух группах значительно различались.
При анализе частот генотипов и аллелей в
области –590 (рис. 1) обнаружено, что у пришлых жителей преобладает «дикий» гомозиготный генотип Т/Т (69,8 %) в отличие от
группы коренных жителей (12,5 %) (χ² = 18,09;
р < 0,001).
Кроме этого, у европеоидов с БА наблюдалось достоверное снижение встречаемости
гетерозиготного генотипа С/Т (18,1 %) по сравнению с хакасами (60,7 %), у которых этот генотип преобладал (χ² = 15,56; р < 0,001). Частота вариантного аллеля Т была выше у больных
европеоидов (79 %), чем у хакасов с БА (55 %)
(χ² = 10,50; р < 0,001). Не установлено статистически значимых различий в частоте генотипа
С/С между изучаемыми группами.
Также показана расовая специфика в распределении частот аллелей и генотипов полиморфного варианта –33С→Т гена IL-4 (рис. 2). При
оценке частоты встречаемости различных генотипов полиморфного локуса –33 гена IL-4 у
лиц с БА русской и хакасской этнической принадлежности, проживающих на территории
Республики Хакасия, выявлено, что частота гомозигот Т/Т в группе хакасов с БА была ниже,
чем в группе европеоидов (χ² = 20,51; р < 0,001),
а гетерозигот С/Т − выше (χ² = 16,95; р < 0,001).
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Андрейчикова Е.А., Пискунов А.А., Сенников С.В., Козлов В.А. Сравнительные аспекты… /c. 69–73
Рис. 1. Распределение частот аллелей и генотипов локуса –590 гена IL-4 у европеоидов и хакасов
с БА
Рис. 2. Распределение частот аллелей и генотипов полиморфного локуса –33 гена IL-4 у европеоидов
и хакасов с БА
Отмечена явная тенденция к увеличению числа
носителей аллеля Т у европеоидов с БА (80 %) в
отличие от хакасов (55 %) (χ² =11,88; р < 0,001).
Полученные нами результаты исследований
распределения частот аллелей и генотипов полиморфных локусов гена IL-4 у больных европеоидов Хакасии в значительной мере совпадают с данными аналогичных исследований для
центрального региона России и Западной Сибири [2, 8, 9], но расходятся с данными для монголоидных популяций России, проживающих в
Восточной Сибири [6].
Учитывая важность IL-4 в иммунопатогенезе БА, мы сравнили сывороточную концентрацию цитокина в группах больных БА жителей
Республики Хакасия и обнаружили, что у хакасов, больных БА, он достоверно выше, чем у
европеоидов с БА (в 1,99 раза, p < 0,05).
Анализ ассоциированности аллелей полиморфного локуса –590 гена IL-4 с его содержанием в периферической крови у больных БА
показал, что у коренных жителей с БА, носителей аллеля С, уровень IL-4 выше, чем у носителей аллеля T. Среди европеоидов с БА, наоборот, более высокая концентрация цитокина
наблюдалась у пациентов − носителей аллеля
Т, а меньшая − у носителей аллеля С (табл. 1).
При этом содержание IL-4 в сыворотке крови у
пациентов с БА носителей аллеля С достоверно
выше у хакасов, чем у европеоидов (р < 0,05).
В нашем исследовании у носителей аллеля
С полиморфного участка –33 гена IL-4 концентрация IL-4 в сыворотке крови хакасов с
БА оказалась выше, чем среди европеоидов
(р < 0,05). У европеоидов наибольший уровень
IL-4 в сыворотке крови определялся у носителей аллеля Т (табл. 2).
Среди обследованных лиц преобладают индивиды, обладающие генотипами, обеспечивающими в основном повышенный уровень продукции IL-4, что, вероятно, соответствует состоянию функционирования контролируемых
ими звеньев иммунной системы у пациентов с
аллергической IgЕ-опосредованной бронхиальной астмой.
Однако следует отметить, что феномен гиперпродукции IL-4 может быть обусловлен не
только аллельными вариантами гена IL-4, но и
комплексом факторов, регулирующих его экспрессию [6].
На сегодняшний день проведено множество
исследований, касающихся ассоциации отдель-
Таблица 1
Уровень IL-4 у европеоидов и хакасов с БА
в зависимости от аллеля локуса –590
гена IL-4 (М ± m)
Таблица 2
Уровень IL-4 у европеоидов и хакасов с БА
в зависимости от аллеля локуса –33
гена IL-4 (М ± m)
Аллель
Европеоиды
Содержание
n
IL-4 (пг/мл)
n
Хакасы
Содержание IL-4
(пг/мл)
С
10
22,79 ± 2,15
50
83,33 ± 8,12*
Т
29
39,91 ± 2,94
35
68,1 ± 7,62
Европеоиды
Аллель
Хакасы
n
Содержание
IL-4 (пг/мл)
n
Содержание IL-4
(пг/мл)
С
11
16,54 ± 4,95
5
92,35 ± 16,84*
Т
28
44,8 ± 5,74
66
62,4 ± 12,46
П р и м е ч а н и е . Здесь и в табл. 2 * − отличие от содержания IL-4 у европеоидов достоверно при р < 0,05.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
71
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Андрейчикова Е.А., Пискунов А.А., Сенников С.В., Козлов В.А. Сравнительные аспекты… /c. 69–73
ных генотипов полиморфных вариантов гена
IL-4 с сывороточным уровнем продукции цитокина в различных этнических группах. Так,
на популяции европеоидов г. Москвы было
продемонстрировано, что аллели Т в локусах
–33 и –590 гена IL-4 определяют увеличение
содержания IL-4 в сыворотке крови [2].
ЗАКЛЮЧЕНИЕ
Таким образом, в настоящем исследовании
показано, что коренные и некоренные популяции Хакасии, проживающие в одинаковых климатогеографических и социальных условиях,
имеют значительные различия в полиморфизме
гена IL-4, влияющего на патогенез БА. Установленная расовая специфика в распределении
частот аллелей и генотипов исследуемых полиморфных вариантов гена IL-4 у больных представляется важной в связи с тем, что, вероятно,
обусловливает различия в распространенности и характере течения бронхиальной астмы у
представителей разных рас.
СПИСОК ЛИТЕРАТУРЫ
1. Bateman E.D., Jithoo A. Asthma and allergy –
a global perspective // Allergy. 2007. 62. 213−215.
2. Gervaziev Y.V., Kaznacheev V.A., Gervazieva V. B. Allelic polymorphisms in the interleukin-4
promoter regions and their association with bronchial
asthma among the Russian Population // Int. Arch.
Allergy Immunol. 2006. 141. 257–266.
3. Oettgen H.C., Geha R.S. IgE in asthma and
atopy: cellular and molecular connections // J. Clin.
Invest. 1999. 104. 829–835.
4. Beghe B., Barton S., Rorke S. et al. Polymorphisms in the interleukin-4 and interleukin-4 receptor
alpha chain genes confer susceptibility to asthma and
atopy in a Caucasian population // Clin. Exp. Allergy.
2003. 33. 1111–1117.
5. Chiang C.H., Tang Y.C., Lin M.Y. et al. Association between the IL-4 promoter polymorphisms
and asthma or severity of hyperresponsiveness in Taiwanese // Respirology. 2007. 12. (1). 42–48.
72
6. Фрейдин М.Б., Пузырев В.П., Огородова Л. М. и др. Полиморфизм генов интерлейкинов
и их рецепторов: популяционная распространенность и связь с атопической бронхиальной астмой
// Генетика. 2002. 38. (12). 1710−1718.
Freidin M.B., Puzyrev V.P., Ogorodova L.M. et
al. Polymorphism of interleukins genes and their receptors: population distribution and association with
atopic bronchial asthma // Genetika. 2002. 38. (12).
1710–1718.
7. Sennikov S.V., Krysov S.V., Injelevskaya T.V.
et al. Quantitative analysis of immunoregulatory
cytokines by electrochemiluminescence method // J.
Immunol. Methods. 2003. 275. 81–88.
8. Огородова Л.М., Федорова О.С., Брагина Е.Ю. и др. Генетические маркеры бронхиальной астмы у детей, больных атопическим дерматитом // Пульмонология. 2007. (4). 37–44.
Ogorodova L.M., Fedorova O.S., Bragina E.Yu.
et al. Genetic markers of bronchial asthma in children with atopic dermatitis // Pulmonologiya. 2007.
(4). 37–44.
9. Шалухина А.Р. Эпидемиологическое и
клинико-генетическое исследование бронхиальной астмы в Республике Башкортостан: автореф.
дис. … канд. мед. наук. Уфа, 2006.
Shalukhina A.R. Epidemiological and clinicogenetic investigation of bronchial asthma in the
Pepublic of Bashkortostan: abstract of thesis. …
candidate of medical sciences. Ufa, 2006.
10. Global Initiative for Asthma. Global Strategy
for Asthma Management and Prevention. National
Institutes of Health. (Revised 2006). No. 02-3659.
Bethesda, MD.
11. Esnault S., Benbernou N., Lavaud F. et al.
Differential spontaneous expression of mRNA for IL4, IL-10, IL-13, IL-2 and IFN-gamma in peripheral
blood mononuclear cells from atopic patients //J.
Clin. Exp. Immunol. 1996. 103. 111–118.
12. Lee S.G., Kim B.S., Kim J.H. et al. Gene-gene
interaction between interleukin-4 and interleukin-4
receptor alpha in Korean children with asthma // Clin.
Exp. Allergy. 2004. 34. 1202–1208.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Андрейчикова Е.А., Пискунов А.А., Сенников С.В., Козлов В.А. Сравнительные аспекты… /c. 69–73
COMPARATIVE ASPECTS OF THE IL-4 GENE POLYMORPHISM IN PATIENTS
WITH ASTHMA – INHABITANTS OF THE REPUBLIC OF KHAKASSIA
Elena Anatol`evna ANDREICHIKOVA1, Аleksander Аleksandrovich PISKUNOV2,
Sergey Vital`evich SENNIKOV2, Vladimir Aleksandrovich KOZLOV2
1
Khakassia Republic Hospital named after G.Ya. Remishevskaya
655012, Abakan, Lenin str., 23
2 Institute
of Clinical Immunology SB RAMS
630099, Novosibirsk, Yadrintsevskaya str., 14
The distribution of alleles and genotypes of polymorphic loci of IL-4 –gene in positions –590 Т→С and –33 Т→
С has been investigated in patients with allergic bronchial asthma (BA) — aboriginal and non-aboriginal inhabitants of the Republic of Khakassia. The test material has been taken from 66 Khakas with BA and 33 Caucasian
patients permanently residing in the Republic of Khakassia. The genotyping of IL-4 gene polymorphism at the –590
Т→С and–33 Т→С has been carried out with the method of polymerase chain reaction and analysis of restriction
fragments length polymorphism. It has been established that the aboriginal inhabitants of Khakassia with atopic
bronchial asthma are predominately the carriers of –590С/Т and –33С/Т genotypes of IL-4 gene, whereas the nonaboriginal inhabitants of the Republic Khakassia are the carriers of –590Т/Т and –33Т/Т genotypes. The statistically
significant increase in serum concentration of IL-4 gene in peripheral blood of the patients with BA — aboriginal
inhabitants in comparison with non-aboriginal people has been revealed. The ethnic peculiarities of the association
of the IL-4 gene production in the patients with BA with different genotypes of IL-gene have been detected.
Keywords: atopic asthma, gene polymorphism, IL-4.
Andreichikova Е.А. − allergologist-immunologist, е-mail: elenandr@yandex.ru
Piskunov A.A. − researcher of the laboratory of molecular immunology, e-mail: ici@online.nsk.su
Sennikov S.V. − doctor of medical sciences, professor, head of the laboratory of molecular immunology,
е-mail: ini@online.nsk.su
Kozlov V.A. − doctor of medical sciences, professor, academician of RAMS, director
е-mail: v_kozlov@online.nsk.su
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
73
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
КЛИНИЧЕСКАЯ МЕДИЦИНА
УДК: 612.331/332+611.018.73+616-072.1
ВИРТУАЛЬНАЯ КОЛОНОСКОПИЯ В РАБОТЕ ВРАЧА ОБЩЕЙ ПРАКТИКИ
Елена Юрьевна ХОМУТОВА
ГОУ ВПО Омская государственная медицинская академия Минздравсоцразвития РФ
644043, г. Омск, ул. Ленина, 12
В последние годы отмечается широкое внедрение новых методик мультиспиральной компьютерной томографии, в том числе и виртуальной колоноскопии (ВКС). В статье отражены технические требования к проведению ВКС, вопросы интерпретации изображений, подготовки кишечника к исследованию, собственно
методика проведения исследования. В заключение представлены показания и противопоказания к ВКС.
Ключевые слова: виртуальная колоноскопия, колоректальный рак, полипы толстой кишки.
В последние годы отмечается широкое внедрение мультиспиральной компьютерной томографии (МСКТ) для исследования различных
органов и систем [1]. Одной из новых МСКТметодик исследования толстой кишки является
виртуальная колоноскопия (ВКС), позволяющая
получать трехмерные изображения толстой
кишки с возможностью осмотра поверхности
слизистой кишки в различных вариантах. В
России ВКС применяется только эпизодически,
и в научной литературе имеются лишь единичные публикации по данной методике [1–3]. За
рубежом ВКС достаточно широко используется, даже для проведения скрининга патологии
толстой кишки [4].
Виртуальная колоноскопия – рентгенологический метод обследования толстой кишки,
который осуществляется с помощью мультиспирального компьютерного томографа и соответствующего программного обеспечения, позволяющего выполнить различные плоскостные
и объемные изображения просвета кишки.
Наибольшее значение данная методика
имеет в диагностике новообразований толстой
кишки, аномалий развития, дивертикулов и
воспалительных поражений толстой кишки,
ее приоритетное направление − выявление неопластических изменений толстой кишки в связи с высокими показателями заболеваемости раком толстой кишки как в России (3–4-е месте в
структуре онкологических заболеваний), так и
в мире (2–3-е место в структуре смертности от
онкологических заболеваний) [5]. Возникновение колоректального рака (КРР) возможно предупредить путем своевременного выявления и
удаления полипов. Выбор методов обследова-
ния для программы скрининга КРР предполагает не только убедительные показатели достоверности результатов, но и доверие к методу
у пациентов, их расположение к подготовке и
проведению исследования [6].
ТЕХНИЧЕСКИЕ ТРЕБОВАНИЯ
К ПРОВЕДЕНИЮ ВКС
Для выполнения ВКС необходимо провести сканирование тонкими срезами толщиной
1–1,5 мм с перекрытием 50 % [2]. Их получение с помощью односрезового компьютерного
томографа (КТ) затруднительно в связи с высокой лучевой нагрузкой и длительным временем сканирования. Поэтому предпочтительно
использовать мультиспиральные КТ, что позволяет уменьшить время исследования и, соответственно, снизить риск появления артефактов
от дыхания, перистальтики и движения, уменьшить лучевую нагрузку. Нами используется 6срезовый КТ «Brilliance» (PHILIPS Medical System, Голландия) со следующими параметрами
сканирования: толщина среза 1,5 мм, перекрытие 0,75 мм, питч 0,9, коллимация 6 × 0,75. Напряжение на трубке и сила тока подбираются
индивидуально в зависимости от комплекции
пациента (от 50 до 200 мАс и от 80 до 150 кВ).
Длина сканирования и поле обзора (Field of
View, FOV) определяются также индивидуально в зависимости от физических параметров
пациента.
Компьютерная система КТ для удобства
использования должна быть обеспечена интерфейсом на базе платформы Windows XP. Необходимо наличие двухконсольной технологии
управления сканирования и постобработки,
Хомутова Е.Ю. – к.м.н., ассистент кафедры лучевой диагностики и лучевой терапии,
e-mail: ogma.ray@rambler.ru
74
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Хомутова Е.Ю. Виртуальная колоноскопия в работе врача … /c. 74–80
оборудованной цветными плоскоэкранными
безбликовыми мониторами с диагональю не
менее 48 см и матрицей не менее 1280 × 1024.
Общая оперативная память компьютерной системы должна составлять не менее 4 Гб, а временная память хранения изображений − не менее 146 Гб. Сетевой интерфейс между КТ рабочей станцией и «читающей» рабочей станцией
должен быть одинаковым, передача данных
быстрой и автоматической, без потери информации. Сетевой кабель рекомендуется категории 5 UTP со скоростью 100 мВ/с [7]. Скорость
может быть и другой в зависимости от мощности техники.
Для получения объемного изображения необходимо наличие быстродействующей рабочей
станции и соответствующего специализированного программного обеспечения. Для получения слепка поверхности слизистой оболочки
толстой кишки устанавливаются следующие
параметры: ширина окна 1200 HU (Haunsfield
Units, единиц Хаунсфилда), уровень окна 300
HU, порог затененности > –500 HU, диапазон
от –900 HU до 300 HU, интерфейс: мягкие ткани/воздух [2].
Программа Virtual Colonoscopy самостоятельно устанавливает параметры окна, формирует трехмерные изображения и производит
расчет центральной линии (пути следования
виртуальной камеры).
Для возможности копирования информации
на съемный носитель желательно наличие возможности экспорта данных через USB-порт.
Также необходимо DICOM-сопряжение с
опциями DICOM Send/Receive, DICOM Query/
Retrive, DICOM Storage, DICOM Basic Print для
интеграции рабочей станции КТ в общебольничную сеть и возможностью передачи, обработки, архивирования диагностических изображений, а также дистанционной печати.
Для хранения и архивирования полученных
данных используются различные варианты:
общебольничная база данных пациентов типа
PACS (Picture Archiving and Communication Systems, Система связи и архивирования изображений) с хранением информации на жестких дисках большого объема, а также оптические диски
CD-R. В нашей практике используются диски
CD-R объемом 700 Мб, что достаточно для записи результатов исследования одного пациента.
ПОДГОТОВКА КИШЕЧНИКА
По данным зарубежной литературы [7, 8]
с целью получения адекватной визуализации
при ВКС необходимо проводить предварительБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
ное очищение кишки. При хорошей подготовке
кишечника чувствительность ВКС в выявлении
полипов всех размеров увеличивается [3]. Полипы и раковые опухоли могут скрываться под
резидуальным содержимым. Остатки твердого
стула, особенно гомогенной структуры, прилежащие к стенке, также можно принять за полиповидное образование. Очищение кишечника для ВКС сходно с таковым при подготовке
к ирригоскопии и фиброколоноскопии. Подготовка начинается в день перед исследованием.
Обед в день перед исследованием не позже
13-00 часов, вечером накануне и утром в день
исследования рекомендуется исключить прием
пищи. В день исследования утром можно выпить стакан сладкого чая с бутербродом.
Для очищения кишки используют один из
двух основных протоколов.
1. Метод постановки очистительных клизм
«до чистой воды» в 20-00 в день перед исследованием.
Объем одной клизмы для взрослых составляет около 1,5–2 л, для ребенка 6 лет − около
0,5 л воды комнатной температуры.
Утром не позже чем за 3 часа до исследования поставить 2–3 клизмы.
2. Метод приема слабительных препаратов
типа «Фортранс» (раствор электролитов).
Препарат Фортранс применяется из расчета
1 пакетик препарата на 20 кг массы тела пациента. Каждый пакетик необходимо растворить
в 1 л воды. Литр раствора принимается на протяжении часа по стакану каждые 15 минут. Начинать прием препарата следует не позже 14-00
в день перед исследованием. Утром в день исследования (не позже чем за 3 часа до процедуры) необходимо поставить 2–3 клизмы.
За час до исследования пациентам старше
5 лет рекомендуется принять препарат спазмолитического действия (например, Дротаверин,
«Но-шпа»).
Во время подготовки пациент может продолжать прием лекарств, которые принимает
обычно.
Для пациентов с сахарным диабетом необходима корректировка дозы сахароснижающих
препаратов лечащим врачом на период подготовки и в день исследования.
ВВЕДЕНИЕ ГАЗА В КИШКУ
Исследование начинается с введения определенного количества воздуха, углекислого
газа или смеси газов в толстую кишку [7, 8].
Традиционно для растяжения кишки используется атмосферный воздух [3]. Преиму75
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Хомутова Е.Ю. Виртуальная колоноскопия в работе врача … /c. 74–80
ществами введения воздуха является его легкая
доступность и финансовая экономичность. Но
в состав атмосферного воздуха входит азот, который плохо абсорбируется в кишке. Поэтому
иногда пациент может испытывать резкую боль
и вспучивание в течение нескольких часов после процедуры.
При ряде диагностических манипуляций используется углекислый газ [3]. По данным ряда
исследований [3], отмечается снижение дискомфорта пациентов при использовании СО2, что
связано с большей способностью углекислого газа проникать через липидную мембрану,
большим парциальным градиентом давления
по ходу кишечной стенки и легким спазмолитическим действием. Таким образом, СО2 быстрее
абсорбируется слизистой оболочкой кишки и
выводится через легкие. Для проведения ВКС в
среднем требуется введение около 4 л углекислого газа [7]. Наш опыт также свидетельствует
о лучшей переносимости пациентами введения
СО2 в толстую кишку.
Пациент размещается на столе аппарата, в
прямую кишку вводится наконечник, смазанный вазелином (можно использовать гель, содержащий лидокаин для уменьшения болевых
ощущений), через который нагнетается воздух,
углекислый газ или смесь газов. Установка наконечника может осуществляться врачом или
рентгенолаборантом в положении пациента на
правом боку с согнутыми в коленях ногами.
Для нагнетания газа в толстую кишку используются различные устройства. Самое простое –
это груша, соединенная с наконечником. Нами
используется устройство для раздувания толстой кишки, по типу аппарата Боброва, которое
позволяет контролировать давление и объем
вводимого газа [9].
Инсуффляция газа начинается в положении
пациента на правом боку, что позволяет раздуть нисходящий и сигмовидный отделы, затем пациент поворачивается на спину. Обычно
вводится 3 л газа под давлением, не превышающим 30 мм рт. ст. Инсуффляция газа производится до предела терпения пациента (чувства
наполнения в области живота и дискомфорта).
Далее от пациента требуется лежать неподвижно и неглубоко дышать. Затем проводится предварительное сканирование (КТ-топограмма), по
данным которого определяется степень растяжения кишки. При необходимости вводится дополнительный объем газа. После сканирования
на спине пациенты переворачиваются на живот. Осуществляется дополнительное введение
газа и производится сканирование в положении
на животе. Как отмечает большинство пациен76
тов, неприятные ощущения от введенного газа
достаточно быстро проходят. Дискомфорт в области живота исчезает в течение 10–30 минут
после окончания процедуры. Общее время исследования составляет 5–10 минут.
ИНТЕРПРЕТАЦИЯ ВКС
Интерпретация полученных данных начинается с оценки слепка кишки [7] (рис. 1).
Оценивается форма, расположение, контур,
гаустрация, ширина просвета кишки на всем
протяжении, качество подготовки к исследованию. На данном этапе возможно выявление
аномалий развития, дивертикулов, признаков
хронического воспаления, наличие стенозирования просвета, недостаточность баугиниевой
заслонки [8]. Проекция тканевых переходов
отображает структуры интереса как затененные
или как прозрачные [1]. Данное изображение
может быть создано с помощью SSD (Superficiality Shadow Display, дисплей оттененных поверхностей) или VRT (Volume Rendering Transformation, объемное представление) с узким
диапазоном КТ-чисел, который соответствует
переходной зоне между содержимым просвета (воздух или контрастное средство) и окружающей тканью. SSD – реалистически выглядящее трехмерное изображение поверхностей
интересующих структур. VRT –– метод отображения, который обеспечивает прозрачность
изображений и 3D-эффекты (рис. 2). Эта техника обработки информации создает, например,
изображения, симулирующие ирригоскопию
Рис. 1. Виртуальная колоноскопия. Слепок просвета
толстой кишки. Трехмерное изображение
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Хомутова Е.Ю. Виртуальная колоноскопия в работе врача … /c. 74–80
Рис. 2. Виртуальная колоноскопия. Пациент с объемным образованием слепой кишки (стрелки). А – аксиальная
проекция; Б – эндоскопическое окно; В – сагиттальная проекция; Г – коронарная проекция; Д – проекция тканевых переговоров с использованием VRT
с двойным контрастированием [1]. В качестве альтернативы могут быть выбраны мультипланарные реконструкции тканевых переходов,
позволяющие достигнуть сходных результатов.
Далее производится эндоскопический осмотр
просвета кишки по ходу центральной линии
[8]. Центральная линия определяется автоматически либо вручную. При эндоскопическом
осмотре можно оценивать внутреннюю поверхность толстой кишки: характер складок, наличие объемных образований, сужений просвета,
дивертикулов [8] (рис. 3). На аксиальных срезах
и мультиплоскостных реформациях оцениваются толщина стенки кишки и степень инвазии опухоли, состояние околокишечных тканей
и внутрибрюшные лимфоузлы [8]. Программа
виртуальной диссекции (filet) позволяет получить плоскостной обзор внутренней поверхности кишки путем выпрямления центральной оси
кишки и выполнения виртуального продольного разреза [2] (см. рис. 3). Прицельная VRT
(объемное представление) позволяет детально
анализировать подобъем интересующего объБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
екта. Плавно перемещаемые объемные изображения тонкими срезами обеспечивают хороший
обзор анатомических особенностей в сложных
случаях и при пространственных искажениях.
Панорамный обзор создает эндоскопическую
проекцию в направлении движения и в противоположном направлении, а также изображения боковых сторон толстой кишки, улучшает
визуализацию между складками [2].
ПОКАЗАНИЯ И ПРОТИВОПОКАЗАНИЯ К ВКС
Виртуальная колоноскопия может проводиться как скрининговое исследование, а также
как диагностическая методика, соответственно, показания и противопоказания в каждом из
этих вариантов будут различные.
Показания для проведения ВКС в качестве
скринингового метода (первичного выявлений
новообразований толстой кишки) следующие
[7]:
• возраст старше 50 лет,
• положительный результат теста на онкомаркеры,
77
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Хомутова Е.Ю. Виртуальная колоноскопия в работе врача … /c. 74–80
Рис. 3. Виртуальная колоноскопия. В режиме filet (верхний фрагмент изображения) при цветном картировании
визуализируется дивертикул, выполненный воздухом, в виде кольца синего цвета. В эндоскопическом окне
и на аксиальном изображение определяется устье дивертикула
• наличие скрытой крови в анализах кала,
• анемия неясного генеза,
• незавершенная (в полном объеме) эндоскопическая колоноскопия,
• пациенты группы высокого риска (с отягощенной наследственностью).
Скрининговые методики для выявления колоректального рака необходимы в связи с общепризнанным мнением, что рак развивается из
полипов, которые рассматриваются как предраковое заболевание [4]. Поэтому в современной
онкологии на первый план выходит проблема
выявления и лечения доброкачественных предраковых новообразований, особенно таких, которые в течение многих месяцев и лет могут
протекать абсолютно бессимптомно и выявляются либо случайно, либо при скрининге.
78
Диагностическая ВКС показана следующим
группам пациентов [7]:
• с повторяющимися желудочно-кишечным
кровотечениями,
• с изменением функций кишечника,
• с болями внизу живота,
• с подозрением на аномалию развития толстой кишки,
• с подозрением на воспалительные заболевания кишечника,
• с железодефицитной анемией,
• для осмотра престенотических участков,
недоступных для оптической колоноскопии,
• для динамического наблюдения полипов.
Противопоказаниями для проведения ВКС
являются [7]:
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Хомутова Е.Ю. Виртуальная колоноскопия в работе врача … /c. 74–80
• острый живот,
• ранний послеоперационный период,
• токсический мегаколон,
• ущемленная грыжа толстой кишки,
• беременность и лактация,
• абсолютная клаустрофобия.
В нашей клинике в течение последних трех
лет проводится активное внедрение методики
ВКС в клиническую практику. За это время
было проведено 548 исследований, отработана
методика проведения ВКС, получен патент на
устройство для раздувания толстой кишки [9],
изучены различные варианты постпроцессорной обработки изображений, проведены дозиметрические исследования. Показаниями для
проведения ВКС являлись наличие жалоб на
изменение нормального режима функционирования толстой кишки, положительного результата теста на онкомаркеры, наличие скрытой
крови в анализах кала. После проведения виртуальной колоноскопии 488 (89 %) пациентам
была проведена эндоскопическая колоноскопия. Всего при ВКС было выявлено 788 объемных образований у 402 пациентов (73,4 %) из
548 обследованных. В 767 случаях образования
были верифицированы как полипы (97,3 %). В
21 случае был диагностирован колоректальный
рак (2,7 %). Кроме оценки характера роста опухоли КТ-исследование позволило у 8 пациентов
обнаружить увеличенные брыжеечные лимфоузлы, а у трех человек выявить метастазы
в печень. Минимальный размер выявленного
полипа при ВКС составлял 4 мм в диаметре.
Множественные полипы выявлены у 6 (1,5 %)
из 402 пациентов. Кроме объемных образований толстой кишки, у 379 пациентов из 548
обследованных при ВКС был диагностирован и
ряд других изменений. Дивертикулы были выявлены у 116 пациентов, долихосигма − у 267,
долихоколон − у 172, послеоперационный стеноз − у 26 обследованных, признаки хронического колита отмечались у 309 человек. В целом
чувствительность виртуальной колоноскопии в
отношении выявления объемных образований
по сравнению с эндоскопической колоноскопией составила 93 %, специфичность − 78 %.
Таким образом, ВКС является высокоинформативной и малоинвазивной методикой исследования толстой кишки, которая со временем найдет достойное место в диагностическом алгоритме исследований патологии толстой кишки.
ЗАКЛЮЧЕНИЕ
В современной онкологии на первый план
выходит проблема выявления и лечения добБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
рокачественных предраковых новообразований, особенно таких, которые в течение многих
лет могут протекать абсолютно бессимптомно и имеют достаточно большую распространенность. Эта задача с успехом решается при
скрининге методом виртуальной колоноскопии.
Конечно, проведение анализа полученных на
ВКС результатов одним врачом-рентгенологом
следует заменить на просмотр двумя врачами
(«двойное чтение») для большей информативности и эффективности скрининга по аналогии
с маммографией. Исследование показало высокую чувствительность виртуальной колоноскопии в выявлении различной патологии толстой
кишки, в частности, в обнаружении объемных
образований – 93 %. Исключительной прерогативой ВКС является возможность изучения
толщины стенки, протяженность ее поражения,
оценка паракишечных изменений, состояния
лимфатического аппарата, брыжейки, а также
параллельно паренхиматозных органов живота.
Данная методика особенно показана при неполной или противопоказанной эндоскопической
колоноскопии, изучении престенотических отделов кишки. Комфортность ВКС для пациента
значительно выше, чем эндоскопическая колоноскопия и ирригоскопия. Кроме того, виртуальная колоноскопия имеет высокую пропускную способность и низкую лучевую нагрузку
по сравнению с ирригоскопией.
Следовательно, внедрение скрининговой
виртуальной колоноскопии наряду с эндоскопической колоноскопией и тестами на скрытую
кровь в странах с большим населением, к которым относится Россия, является одним из путей решения проблемы снижения смертности
от КРР.
СПИСОК ЛИТЕРАТУРЫ
1. Тарасенко Т.Д., Зубарев А.Р. Возможности
мультиспиральной компьютерной томографической колонографии (виртуальной колоноскопии) в
диагностике новообразований толстой кишки //
Вестн. Рос. гос. мед. ун-та. 2009. (1). 52–56.
Tarasenko T.D., Zubarev A.R. Possibilities of
multispiral computer tomographic colonography
(virtual colonoscopy) in diagnostics of colon tumor //
Vestn. Ros. gos. med. un-ta. 2009. (1). 52–56.
2. Хомутова Е.Ю., Игнатьев Ю.Т., Скрипкин Д.А. и др. Виртуальная колоноскопия: методика проведения // Радиология-практика. 2009. (2).
21–27.
Khomutova E.Yu., Ignatiev Yu.T., Skripkin D.A.
et al. Virtual colonoscopy technique // Radiologiyapraktika. 2009. (2). 21–27.
79
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Хомутова Е.Ю. Виртуальная колоноскопия в работе врача … /c. 74–80
3. Хомутова Е.Ю., Игнатьев Ю.Т. Мультиспиральная компьютерная виртуальная колоноскопия
в диагностике патологии толстой кишки (обзор литературы) // Мед. визуализация. 2008. (6). 73–77.
Khomutova E.Yu., Igmat`ev Yu.T. Multispiral
computer tomography in diagnostics of colon diseases
(literature review) // Med. vizualizatsiya. 2008. (6).
73–77.
4. Levin B., Lieberman D.A., McFarland B. et al.
Screening and surveillance for the early detection of
colorectal cancer and adenomatous polyps, 2008: a
joint guideline from the American Cancer Society, the
US Multi-Society Task Force on Colorectal Cancer,
and the American College of Radiology // Gastroenterology. 2008. 134. 1570–1595.
5. Jemal A., Siegel R., Ward E. et al. Cancer statistics, 2008 // CA Cancer J. Clin. 2008. 58. 71–96.
6. Fletcher R.H. Colorectal cancer screening on
stronger footing // New Engl. J. Med. 2008. 359.
1285–1288.
7. Virtual Colonoscopy. A Practical Guide / Eds.
P. Lefere, S. Gryspeerdt. Berlin: Springer-Verlag,
2006.
8. Yee J. Virtual colonoscopy / Ed. M. Galdino. Philadelphia: Lippincott Williams and Wilkins,
2008.
9. Пат. 80342 РФ. Устройство для раздувания
толстой кишки / Е.Ю. Хомутова, Ю.Т. Игнатьев,
Д.А. Скрипкин и др.; опубл. 10.02.2009.
Patent 80342 RF. Apparatus for colon distension /
E.Yu. Khomutova, Yu.T. Ignatiev, D.A. Skripkin et al.;
published 10.02.2009.
VIRTUAL COLONOSCOPY IN PHYSICIAN PRACTICE
Elena Yurievna KHOMUTOVA
Omsk State Medical Academy
644043, Omsk, Lenin av., 12
In recent years there has been widespread adoption of new methods of multislice computed tomography, including
virtual colonoscopy (VC). The article describes the technical requirements for video conferencing, questions of
interpretation of images, bowel preparation to study the actual methodology of the investigation. In conclusion, the
indications and contraindications to the VC have been presented.
Key words: virtual colonoscopy, colorectal cancer, colorectal polyps.
Khomutova E.Yu. — candidate of medical sciences, assistant professor of the chair for radiology and
radiotherapy, e-mail: ogma.ray@rambler.ru
80
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК: 616.12-008.331-06:616.132-089
АРТЕРИАЛЬНАЯ ГИПЕРТЕНЗИЯ В ОЦЕНКЕ РИСКА РАЗВИТИЯ
СЕРДЕЧНО-СОСУДИСТЫХ СОБЫТИЙ ПОСЛЕ РЕКОНСТРУКТИВНЫХ
ВМЕШАТЕЛЬСТВ НА АРТЕРИЯХ НИЖНИХ КОНЕЧНОСТЕЙ
Леонид Семенович БАРБАРАШ1, Ольга Леонидовна БАРБАРАШ2,
Вероника Владимировна ЕВТУШЕНКО1, Рената Витальевна РЕПНИКОВА2,
Сергей Сергеевич АЛТАРЕВ1, Алексей Витальевич ФРОЛОВ2
1 НИИ
комплексных проблем сердечно-сосудистых заболеваний СО РАМН
650002, г. Кемерово, Сосновый бульвар, 6
2 ГОУ
ВПО Кемеровская государственная медицинская академия Минздравсоцразвития РФ
650029, г. Кемерово, ул. Ворошилова, 22а
Цель исследования: оценить особенности синдрома артериальной гипертензии (АГ) у пациентов с облитерирующими заболеваниями сосудов нижних конечностей (ОЗСНК) и возможность использования показателей
«офисного» измерения артериального давления (АД) и суточного мониторирования АД (СМАД) для прогнозирования риска развития сердечно-сосудистых событий в течение года после перенесенного хирургического вмешательства по поводу атеросклеротического поражения аорты и ее ветвей. Материал и методы.
Обследовано 102 пациента, поступивших в хирургическое отделение для проведения реконструктивной операции на артериях нижних конечностей. Все пациенты в зависимости от отдаленного годичного прогноза
разделены на группу с неблагоприятным (38 человек) и благоприятным (68 человек) прогнозом. Результаты.
Использование для обследования СМАД позволило диагностировать АГ дополнительно у 26 (54,2 %) пациентов с неизмененными офисными значениями АД. У большинства пациентов с ОЗСНК независимо от
выявления при офисном измерении синдрома АГ регистрируются патологические суточные профили АД.
Наличие АГ в дооперационном периоде повышает относительный риск развития осложненного течения послеоперационного периода. Выводы. Таким образом, использование для обследования СМАД позволяет повысить эффективность выявления пациентов с АГ среди больных ОЗСНК. Необходимо включать показатели
суточного мониторирования АД, наряду с такими факторами, как поражение коронарного русла, наличие
сахарного диабета и другие, в оценку глобального риска развития сердечно-сосудистых осложнений у пациентов с ОЗСНК.
Ключевые слова: артериальная гипертензия, реконструктивные вмешательства на аорте и ее ветвях.
Облитерирующие заболевания сосудов
нижних конечностей (ОЗСНК) связаны с высокой сердечно-сосудистой заболеваемостью
и смертностью [1, 2]. Перемежающаяся хромота – наиболее важный предиктор сердечно-сосудистой смертности, повышающий ее в 3 раза,
а общую смертность – в 2−5 раз [3]. Известно,
что артериальная гипертензия (АГ) – важный
фактор риска сосудистых расстройств, в том
числе ОЗСНК. При наличии АГ у 2–5 % пациентов наблюдается наличие перемежающейся
хромоты, имеющей тенденцию к учащению с
увеличением возраста [4]. Причем в 35–50 %
случаев у пациентов, страдающих ОЗСНК,
имеет место АГ [5]. Установлено, что при сочетании АГ и ОЗСНК возрастает риск развития
инфаркта миокарда и инсульта [6]. Однако ни в
одном исследовании до сих пор не было выяснено, насколько АГ изменяет течение ОЗСНК, в
том числе после проведения реконструктивных
вмешательств на сосудах нижних конечностей.
Цель исследования − оценить особенности
синдрома АГ у пациентов с ОЗСНК и возможность использования показателей «офисного»
Барбараш Л.С. – д.м.н., академик РАМН, директор, e-mail: olb61@mail.ru
Барбараш О.Л. – д.м.н., зав. кафедрой кардиологии и сердечно-сосудистой хирургии, e-mail: olb61@mail.ru
Евтушенко В.В. – врач-кардиолог отделения сердечно-сосудистой хирургии, e-mail: evtuvv@kemcardio.ru
Репникова Р.В. – к.м.н., ассистент кафедры факультетской терапии с клинической иммунологией, профессиональными болезнями и эндокринологией, e-mail: rvrkem@mail.ru
Алтарёв С.С. – к.м.н., старший научный сотрудник лаборатории реабилитации, e-mail: altass@kemcardio.ru
Фролов А.В. – ассистент кафедры кардиологии и сердечно-сосудистой хирургии, e-mail: heart@kemcity.ru
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
81
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Барбараш Л.С., Барбараш О.Л., Евтушенко В.В. и др. Артериальная гипертензия в оценке… /c. 81–86
измерения артериального давления (АД) и суточного мониторирования АД (СМАД) для
прогнозирования риска развития сердечно-сосудистых событий в течение года после перенесенного хирургического вмешательства по
поводу атеросклеротического поражения аорты
и ее ветвей.
МАТЕРИАЛ И МЕТОДЫ
В исследование вошли пациенты, находящиеся на предоперационной подготовке по поводу
проведения реконструктивной операции на артериях нижних конечностей. Среди 102 обследованных было 98 (96,1 %) мужчин, средний
возраст обследованных составлял 61,5 ± 3,4 года
(от 43 до 80). Всем пациентам в предоперационном периоде была проведена коронароангиография. У 64 (62,7 %) человек выявлено поражение
коронарных артерий. У 42 пациентов в связи
с наличием гемодинамически значимого коронарного атеросклероза в качестве первого этапа
хирургического лечения выбрана коронарная
реваскуляризация (коронарное шунтирование у
30 больных и стентирование коронарных артерий – у 12), в качестве второго – вмешательства на артериях нижних конечностей. Хирургическое вмешательство выполняли у больных
с ишемией нижней конечности II Б и III стадии
(по Фонтену), обусловленной окклюзией или
«критическим» стенозом инфраингвинальных
артерий, при этом в качестве сосудистых протезов использовали аутовену, синтетический
или биологический протез.
Сахарный диабет 2-го типа был выявлен у
12 (11,8 %) обследованных, перенесенный ранее
инфаркт миокарда (ИМ) – у 16 (15,7 %) пациентов. Приступы стенокардии I–II функционального класса имели место у 34 (33,3 %), проявления хронической сердечной недостаточности
в пределах I–II функционального класса – у 50
(49 %) пациентов.
Всем больным проводилось общеклиническое обследование с анализом анамнеза основного заболевания, сопутствующей патологии,
оценкой общего клинического и кардиологического статуса. Инструментальные методы
включали также измерение артериального давления, эхокардиографию (Эхо-КГ), проводимую на аппарате «Aloka» (Япония), оценку поражения коронарного русла с использованием
ангиографической установки «Innova» (США).
Липидный спектр крови оценивали холестеринэстеразным и колориметрическим методами на
биохимическом анализаторе Sapphire 400 (Япония).
82
СМАД проводилось осциллометрическим
методом с использованием портативного регистратора (BPLab МнСДП-2, ООО «Петр Телегин», г. Нижний Новгород), осуществляющего
измерение АД и частоты сокращений сердца
(ЧСС) в фазу декомпрессии. Анализировались
показатели среднесуточного, дневного, ночного
систолического (САД) и диастолического артериального давления (ДАД), среднего гемодинамического давления, частоты сердечных сокращений, индекс времени гипертензии в дневное
и ночное время, степень ночного снижения АД.
Суточный профиль АД определяли согласно
Национальным клиническим рекомендациям
Всероссийского научного общества кардиологов, 2008 г. [7].
База данных формировалась в среде Microsoft Office Excel 2003 (Microsoft Corporation).
Статистическая обработка материала проводилась с использованием пакета статистических
программ SPSS for Windows 11.0.1 (SPSS Inc.,
США). Использовались методы описательной
статистики: для количественных переменных
данные представлены в формате М ± SD, где
М – среднее значение, SD – стандартное отклонение, для качественных − в виде процентного
отношения. Проверка однородности двух несвязанных выборок осуществлялась с использованием критерия Манна–Уитни, анализ таблиц
сопряженности проводился с использованием критерия χ2. Для определения вероятности
развития неблагоприятных исходов у пациента
использовался дискриминационный анализ с
прямым пошаговым методом ввода независимых переменных в модель. Оценка качества
построения прогностической модели осуществлялась с помощью построения ROC-кривой и
определения площади под ней (С-статистика) с
расчетом 95 % доверительного интервала для
этого показателя. Критическое значение уровня
значимости принималось равным 5 % (0,05).
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
В зависимости от значений АД при его
офисном измерении в предоперационном периоде все обследованные пациенты были разделены на две группы. В первую группу вошли
48 больных (47,1 %), у которых при офисном
измерении АД значения его не превышали: для
САД – 139 мм рт. ст., для ДАД – 89 мм рт. ст.
Вторая группа включала 54 (52,9 %) пациента с
АД, равным или превышающим 140/90 мм рт. ст.
При этом средние значения САД для этих групп
составили 126,0 ± 6,7 и 142,2 ± 5,5 мм рт. ст. соБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Барбараш Л.С., Барбараш О.Л., Евтушенко В.В. и др. Артериальная гипертензия в оценке… /c. 81–86
ответственно (р < 0,001), для ДАД – 76,8 ± 5,2 и
85,0 ± 4,6 мм рт. ст. соответственно (р < 0,001).
При сравнении клинико-анамнестических
характеристик пациентов с наличием и отсутствием синдрома АГ при офисном измерении АД
не выявлено достоверных различий по возрасту пациентов, содержанию общего холестерина
крови, показателям Эхо-КГ, частоте выявления
ангиографических признаков коронарного атеросклероза. Таким образом, офисное измерение
АД у пациентов с ОЗСНК не позволило выделить пациентов с высоким сердечно-сосудистым риском, так как среди обследованных с
нормальными и повышенными значениями АД
не выявлено принципиальных различий по основным клинико-анамнестическим характеристикам.
Измерение АД в офисных условиях является неотъемлемой составляющей обследования
всех амбулаторных и госпитальных пациентов.
Однако известны ограничения традиционного
клинического измерения АД. Так, доказано,
что у 15–20 % больных при офисном измерении
АД имеет место гипердиагностика АГ вследствие феномена «гипертонии белого халата». С
другой стороны, у 10–15 % пациентов имеет
место гиподиагностика АГ вследствие «феномена белого халата наоборот». Кроме того,
офисное измерение АД не дает представление о
его колебаниях в периоды различной активности больного, в том числе во время ночного сна
[8]. Приведенные факты определяют необходимость оценки суточной динамики АД. Однако в
современных рекомендациях по АГ СМАД занимает позицию только дополнительного метода обследования, представляющего клинически
важную информацию.
У пациентов двух анализируемых групп
достоверных различий по таким важным пока зателям, определяющим прогноз пациентов,
как показатели среднего дневного (131,1 ± 13,1
и 135,1 ± 14,5 мм рт. ст., р = 0,20) и ночного
(118,9 ± 15,0 и 123,0 ± 18,5 мм рт. ст, р = 0,32) САД
и среднего дневного (77,2 ± 10,1 и 78,2 ± 11,3
мм рт. ст., р = 0,95) и ночного (67,6 ± 9,2 и
69,0 ± 10,6 мм рт. ст., р = 0,82) ДАД, а также
степень ночного снижения АД, определяемая
суточными индексами (СИ), выявлено не было.
Вместе с тем по данным СМАД критерии АГ
(по таким показателям, как нагрузка давлением
более 30 % и индекс времени САД и ДАД) выявлены у 30 пациентов, из них у 8 (16,7 %) лиц
первой группы и у 22 (40,7 %) – второй группы
(р = 0,01). Помимо этого, у 7 обследованных (4
пациента из первой группы и 3 из второй группы) имела место изолированная «ночная гиперБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
тензия», проявившаяся тем, что в дневные часы
показатели АД не превышали нормальных значений, а в ночные были выше 120/75 мм рт. ст.
Таким образом, синдром АГ из 102 обследованных пациентов при проведении СМАД
выявлен у 69 (67,6 %). Данный факт позволяет
прийти к выводу о том, что офисное измерение
АД у пациентов с ОЗСНК является обязательным, но недостаточным в диагностике АГ.
Для пациентов с ОЗСНК оказалась характерна изолированная систолическая АГ. Так,
она обнаружена у 42 (60,9 %) пациентов с АГ,
в то время как у остальных выявлена систолодиастолическая форма АГ. Этот факт нашел
отражение и в других исследованиях [9, 10], и
связан он, по-видимому, со снижением эластичности крупных артерий, накоплением в артериях кальция и эластина [11].
Анализ пациентов, разделенных по результатам офисного измерения АД на лиц с повышенным и нормальным значениями АД по показателям СИ, продемонстрировал, что среди пациентов 1-й группы только у 18 (37,5 %) выявляется суточный профиль САД типа «dipper»,
в то время как у остальных пациентов – 30
(62,5 %) – патологические суточные профили.
В группе больных с нормальным офисным АД
был также наиболее высок процент выявления пациентов с отсутствием снижения САД
в ночное время. Кроме того, обращает на себя
внимание и то, что у 4 (8,4 %) пациентов 1-й
группы выявляется суточный профиль «nightpeaker», характеризующийся подъемом в ночное время АД. Среди пациентов 2-й группы
(с наличием АГ при офисном измерении) лиц,
имеющих суточный профиль САД типа «dipper», оказалось также мало – 16 (29,6 %). У 38
(70,4 %) пациентов были обнаружены патологические индексы, из них наиболее часто наблюдался суточный профиль «night-peaker». Такая
же закономерность проявлялась и при анализе
распределения суточного профиля ДАД. Патологические профили АД по результатам СМАД
выявлены в целом (для САД и ДАД) у 70,9 %
пациентов 1-й группы и у 70,4 % лиц 2-й группы. Приведенный факт свидетельствует о том,
что у большинства пациентов с ОЗСНК независимо от обнаружения при офисном измерении
синдрома АГ имеют место патологические суточные профили АД.
Безусловно, высокая частота выявления патологических суточных индексов АД у пациентов с ОЗСНК связана с болевым синдромом,
свойственным пациентам с ишемией нижних
конечностей. Данные последних лет подтвердили, что отсутствие адекватного снижения АД в
83
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Барбараш Л.С., Барбараш О.Л., Евтушенко В.В. и др. Артериальная гипертензия в оценке… /c. 81–86
ночное время является мощным независимым
фактором риска смерти от сердечно-сосудистых причин [12]. Установлена линейная зависимость смертности от сердечно-сосудистых
заболеваний и степени снижения АД в ночные
часы. Каждое увеличение соотношения ночь/
день (для САД или ДАД) на 5 % ассоциировалось с увеличением риска смерти на 20 %, причем это соотношение сохранялось даже в тех
случаях, когда средние суточные уровни АД
не превышали норму (135/80 мм рт. ст.). Кроме того, показано, что отсутствие адекватного
снижения АД в ночные часы ассоциируется с
повышенной вовлеченностью в патологический процесс органов-мишеней и может быть
возможным (хотя и неспецифическим) индикатором вторичных форм АГ [8]. Приведенные
данные позволяют отнести пациентов с ОЗСНК
к категории высокого риска развития сердечнососудистых событий.
При оценке отдаленного послеоперационного периода (в течение 1 года) у 38 (36 мужчин
и 2 женщины) из 102 обследованных пациентов
(37,25 %) отмечено развитие неблагоприятных
событий, среди которых декомпенсация артериальной гипертензии имела место у 4 (3,9 %),
проведенное вторым этапом коронарное шунтирование – у 6 (5,9 %), развитие Q-необразующего ИМ – у 2 (2,0 %) человек. Летальных
случаев на данном этапе не зарегистрировано.
Кроме того, возобновление симптомов ишемии
нижних конечностей с повторным оперативным вмешательством в течение года наблюдения было отмечено у 16 (15,7 %) пациентов, без
повторного вмешательства – у 14 (13,7 %), односторонняя ампутация нижней конечности – у
4 (3,9 %) человек. Таким образом, развитие рецидива (увеличения степени ишемии) ОЗСНК
было наиболее частым среди всех наблюдаемых неблагоприятных событий в течение одного года после хирургического вмешательства.
Не было выявлено различий в вероятности
развития ишемии нижних конечностей в послеоперационном периоде в зависимости от наличия АГ в предоперационном периоде, оцененной
с помощью офисного измерения АД, сопутствующих хронической обструктивной болезни
легких и ишемический болезни сердца, а также
типа используемого протеза. Не выявлено различий среди пациентов с благоприятным и неблагоприятным прогнозом и при анализе частоты выявления традиционных факторов риска
(пол, возраст, наличие сахарного диабета и пр.).
Таким образом, использование традиционных
маркеров риска для прогнозирования течения
84
послеоперационного периода у пациентов с ОЗСНК было недостаточным.
В дальнейшем у обследованных пациентов с различным годовым прогнозом проанализированы различия в основных показателях
метаболического профиля, внутрисердечной
гемодинамики, оцененных перед операцией.
Выявлено, что в группе неблагоприятного прогноза, по сравнению с пациентами, имеющими
благоприятное течение отдаленного послеоперационного периода, в предоперационном периоде был значимо выше уровень общего холестерина (6,9 ± 1,4 ммоль/л и 6,2 ± 1,2 соответственно, р = 0,049), давление в легочной артерии
(19,4 ± 6,1 и 17,3 ± 4,4 мм рт. ст. соответственно,
р = 0,006), размеры левого предсердия (3,7 ± 0,4
и 3,6 ± 0,3 см соответственно, р = 0,01) и толщина задней стенки левого желудочка (1,2 ± 0,1
и 1,1 ± 0,1 см соответственно, р = 0,02).
Показатели предоперационной суточной динамики АД (СМАД) у обследованных пациентов с различным годовым прогнозом представлены в табл. 1.
Из табл. 1 видно, что в группе пациентов с
неблагоприятным прогнозом процент измерений САД более 140 мм рт. ст. был достоверно
выше, чем у пациентов с благоприятным годовым прогнозом. При анализе предоперационной
оценки суточных индексов АД в зависимости
от годового прогноза (табл. 2) выявлено, что в
группе пациентов с неблагоприятным прогнозом у большинства пациентов по СИ САД и
ДАД преобладала суточная кривая типа «nondipper» и «night-peaker», что отражает отсутствие закономерного снижения АД в ночное время суток или даже его подъем.
Таким образом, пациенты с наличием патологических индексов как по САД, так и по
ДАД, принадлежащих к типам «non-dipper» и
«night-peaker» при предоперационной оценке
СМАД, имеют наибольшую вероятность попадания в группу неблагоприятного годового
прогноза.
С целью определения независимых предикторов неблагоприятного исхода в течение года
после перенесенного хирургического вмешательства проведен дискриминационный анализ,
в который были включены все ранее исследуемые параметры (клинико-анамнестические
данные, данные «офисного» измерения АД и
СМАД, показатели метаболического профиля,
данные Эхо-КГ). В качестве факторов неблагоприятного прогноза идентифицированы следующие показатели: давление в легочной артерии
выше 30 мм рт. ст., фракция выброса ниже 40 %
(по данным дооперационной Эхо-КГ) и процент
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Барбараш Л.С., Барбараш О.Л., Евтушенко В.В. и др. Артериальная гипертензия в оценке… /c. 81–86
Таблица 1
Показатели СМАД, оцененные в предоперационном периоде у пациентов с благоприятным
и неблагоприятным течением отдаленного послеоперационного периода (через 12 месяцев)
Прогноз
Показатель
р
Благоприятный (n = 64) Неблагоприятный (n = 38)
Среднее САД днем, мм рт. ст.
Среднее ДАД днем, мм рт. ст.
Вариабельность САД днем, мм рт. ст.
Вариабельность ДАД днем, мм рт. ст.
Среднее САД ночью, мм рт. ст.
Среднее ДАД ночью, мм рт. ст.
Вариабельность САД ночью, мм рт. ст.
Вариабельность ДАД ночью, мм рт. ст.
Среднее пульсовое АД, мм рт. ст.
СИ САД, %
СИ ДАД, %
САД более 140 мм рт. ст., %
ДАД более 140 мм рт. ст., %
130,4 ± 11,7
77,2 ± 10,0
15,4 ± 3,9
12,2 ± 2,1
118,2 ± 13,3
66,8 ± 8,1
10,9 ± 3,6
10,0 ± 2,9
48,7 ± 10,6
10,2 ± 8,3
14,3 ± 8,7
33,4 ± 17,3
21,8 ± 20,1
138,0 ± 16,4
78,5 ± 12,2
16,8 ± 5,0
12,2 ± 1,9
125,7 ± 21,5
70,9 ± 12,3
10,6 ± 2,0
9,8 ± 3,6
52,3 ± 10,4
8,5 ± 10,4
11,5 ± 10,1
45,4 ± 16,9
32,3 ± 27,2
0,11
0,76
0,39
0,93
0,35
0,48
1,0
0,98
0,26
0,54
0,44
0,01
0,26
Таблица 2
Различия суточных индексов АД, оцененных СМАД, у пациентов с различным годовым прогнозом
СИ САД
Тип суточной
кривой
over-dipper
dipper
non-dipper
night-peaker
СИ ДАД
Благоприятный
прогноз, n = 64
Неблагоприятный
прогноз, n = 38
Благоприятный
прогноз, n = 64
Неблагоприятный
прогноз, n = 38
11 (17,2 %)
31 (48,4 %)
10 (15,6 %)
12 (18,6 %)
4 (10,6 %)
4 (10,6 %)
20 (52,6 %)
10 (26,2 %)
16 (25,0 %)
28 (43,7 %)
12 (18,8 %)
8 (12,5 %)
6 (15,8 %)
5 (13,2 %)
18 (47,4 %)
9 (23,6 %)
П р и м е ч а н и е . Для всех показателей р = 0,002.
измерений САД > 140 мм рт. ст. по данным
СМАД. Прогностическая модель, включающая
указанные показатели, объясняет 68,6 % наблюдений, что является хорошим результатом.
Качество полученной модели оценено с помощью С-статистики, площадь под ROC-кривой
составляет 0,70 (95 % доверительный интервал
0,59–0,80, p = 0,001).
Таким образом, данные настоящего исследования свидетельствуют о том, что использование для обследования СМАД позволяет
повысить эффективность выявления пациентов
с АГ среди больных ОЗСНК и демонстрируют
необходимость включения показателей суточного мониторирования АД, наряду с такими
факторами, как поражение коронарного русла,
наличие сахарного диабета и другие, в оценку
глобального риска развития сердечно-сосудистых осложнений у пациентов с ОЗСНК.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
СПИСОК ЛИТЕРАТУРЫ
1. Карпов Р.С. Современные проблемы атеросклероза: взгляд клинициста: актовая лекция.
Томск: Сибирский издательский дом, 2003. 39 с.
Karpov R.S. Contemporary problems of atherosclerosis: view of clinician: assembly lecture. Tomsk:
Sibirsky Izdatelsky Dom, 2003. 39 р.
2. Липовецкий Б.М. Атеросклероз и его осложнения со стороны сердца, мозга и аорты. СПб.,
2008. 142 с.
Lipovetsky B.M. Atherosclerosis and its complications of heart, brain and aorta. SPb., 2008. 142 p.
3. Binaghi F. Prevalence of peripheral arterial occlusive disease and associated risk factors in a sample
of southern Sardinian population // Int. Angiol. 1994.
13. 233–245.
4. Cheng S.W., Ting A.С., Lau. H. et al. Epidemiology of atherosclerosis peripheral arterial occlusive disease in Hong Kong // World J. Surg. 1999.
23. 202–206.
85
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Барбараш Л.С., Барбараш О.Л., Евтушенко В.В. и др. Артериальная гипертензия в оценке… /c. 81–86
5. Bennett P.C., Silverman S., Gill P. Hypertension and peripheral arterial disease // J. Hum. Hypertens. 2009. 23. 213–215.
6. Makin A., Lip G.Y.H., Silverman S. et al. Peripheral vascular disease and hypertension: a forgotten association? // J. Hum. Hypertens. 2001. 15.
447–454.
7. Оганов Р.Г., Мамедов М.Н. Национальные
клинические рекомендации. Всероссийское научное общество кардиологов. М.: Силицея-Полиграф, 2008. 512 с.
Oganov R.G., Mamedov M.N. National clinical
recommendations. All-Russian scientific society of
cardiologists. M.: Silizeya-Poligraf, 2008. 512 р.
8. Mul G. Relationships between 24h blood
pressure blood and target organ damage in patients
with mild to moderate essential hypertension // Blood
Press. Monit. 2001. 6. 115–123.
9. Chobnanian A.V. Isolated systolic hypertension
in the elderly // N. Eng. J. Med. 2007. 357. 789–796.
10. Белов Ю.В., Базылев В.В., Кизыма А.Г.
Мета-анализ результатов стресс-исследований у
больных перед операциями на периферических
сосудах и брюшной аорте // Хирургия. 2008. (11).
4–7.
Belov Yu.V., Bazilev V.V., Kizima A.G. Metaanalysis of stress results on patients before operations
for peripheral vessels and abdominal aorta //
Khirurgiya. 2008. (11). 4–7.
11. Vural K.M., Bayazit M. Nitric oxide: implications for vascular and endovascular surgery // Eur. J.
Vasc. Endovasc. Surg. 2001. 22. 285–292.
12. Okhubo T., Hozawa A., Yamaguchi J. et al.
Prognostic significance of the nocturnal decline in
blood pressure in individuals with and without high
24-h blood pressure: the Ohasama study // J. Hypertens. 2002. 20. 2183–2189.
INDICES OF BLOOD PRESSURE IN ASSESSMENT OF CARDIOVASCULAR
DEVELOPMENT RISK AFTER RECONSTRUCTIVE OPERATIONS
FOR ARTERIES OF LOWER EXTREMITIES
Leonid Semenovich BARBARASH1, Olga Leonidovna BARBARASH2,
Veronika Vladimirovna EVTUSHENKO1, Renata Vitaljevna REPNIKOVA2,
Sergey Sergeevich ALTAREV1, Alexey Vitaljevich FROLOV2
1 Institute
for Integrated Problems of Cardiovascular Diseases SB RAMS
650002, Kemerovo, Sosnovy bld., 6
2 Kemerovo
State Medical Academy 650029, Kemerovo, Voroshilov str., 22-A
The purpose of this research was to investigate the features of the arterial hypertension (AH) syndrome at patients
with obliterating diseases of lower extremities vessels (ODLEV) and opportunities to use indices of arterial blood
pressure (BP) “office” measurement and Holter-monitoring for prediction of cardiovascular development risk during
the first year after surgical operation for atherosclerotic lesion of aorta and its branches. Material and methods. 102
patients admitted to the surgery ward for subsequent reconstructive operation of lower extremity arteries have been
examined. Depending on long-term one-year prognosis all patients have been divided into two groups: with unfavorable (38 people) and favorable (68 people) prognosis. Results. The use of Holter-monitoring permits to recognize
the arterial hypertension additionally at 26 (54,2 %) patients with invariable indices of «office» BP. The most part
of the patients with ODLEV have pathologic daily profiles of BP regardless of BP syndrome detection in case the
«office» measurement. The AH occurrence within the preoperative period increases the relative risk of complicated
postoperative course. Summary. Therefore the use of Holter-monitoring in the checkup permits to increase the effectiveness of detection of the patients with AH among people with ODLEV. It is necessary to include the indices
of Holter-monitoring along with such factors as the lesion of coronary arteries, diabetes mellitus etc. into the assessment of cardiovascular complications risk at patients with ODLEV.
Key words: arterial hypertension, reconstructive operations of aorta and its branches
Barbarash L.S. – doctor of medical sciences, academician of RAMS, director, e-mail: olb61@mail.ru
Barbarash O.L. – doctor of medical sciences, head of the chair for cardiology and cardiovascular surgery,
e-mail: olb61@mail.ru
Evtushenko V.V. – cardiologist of the department for cardiovascular surgery, e-mail: evtuvv@kemcardio.ru
Repnikova R.V. – candidate of medical sciences, assistant lecturer of the chair for faculty therapy with clinical
immunology, occupational diseases and endocrinology, e-mail: rvrkem@mail.ru
Altarev S.S. – candidate of medical sciences, senior researcher of the laboratory of rehabilitation,
e-mail: altass@kemcardio.ru
Frolov A.V. – assistant lecturer of the chair for cardiology and cardiovascular surgery, e-mail: heart@kemcity.ru
86
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК 612.17 – 017.2:618.3
НЕЙРОВЕГЕТАТИВНАЯ РЕАКТИВНОСТЬ У БЕРЕМЕННЫХ
ПРИ РАЗЛИЧНЫХ ФОРМАХ ГЕСТАЦИОННЫХ НАРУШЕНИЙ
Сергей Александрович КЛЕЩЕНОГОВ
НИИ комплексных проблем гигиены и профессиональных заболеваний СО РАМН
654041, г. Новокузнецк, ул. Кутузова, 23
Исследованы реакции симпатической (S) и парасимпатической (PS) подсистем вегетативной нервной системы (ВНС) у беременных с различными формами гестационных осложнений на фоне функциональных нагрузочных проб (счет в уме, углубленное дыхание). Маркерами S и PS, а также барорефлекторной функции
служили показатели спектральной мощности (вариабельности) ритма сердца беременных. Показано, что в
статических условиях (состояние бодрствующего покоя) достоверные различия между контролем и группой осложненной беременности (ОБ) имелись лишь по параметру детрентного флуктуационного анализа.
При функциональных пробах достоверные сдвиги ваго-симпатического индекса (ВСИ) найдены на фоне
дыхательной нагрузки за счет повышения вагального тонуса. Существенные нагрузочные изменения ВСИ
были отмечены в подгруппах женщин ОБ, имевших исходно повышенную барорефлекторную активность и
симпатический тонус. Кроме того, имелись отчетливые различия реактивности ВНС по формам осложнений
беременности. Сделан вывод о том, что умеренная дыхательная нагрузка (гипервентиляция) у беременных
может служить основой при формировании прогностических критериев в акушерской клинике.
Ключевые слова: беременность, нагрузочные пробы, вариабельность ритма сердца.
Проблема охраны репродуктивного здоровья женщин в настоящее время рассматривается как чрезвычайно важный объект исследований [1]. Это обусловлено не только социальными аспектами, связанными с неблагоприятной
демографической ситуацией в России, но и сугубо медицинскими задачами прогнозирования
акушерских осложнений на доклинической стадии их развития. Попытки решения этих задач
тесно сопряжены с выявлением ранних признаков патологии, которыми являются те или
иные сдвиги гомеостаза в организме женщины.
Неспецифичность последних, как правило, служит главным препятствием при их использовании в качестве прогностических критериев.
Преодолеть эти затруднения возможно на пути
индивидуализации оценок с применением динамических показателей вегетативной системы
регуляции.
В данной работе ставилось целью изучить
некоторые показатели вегетативной нервной
системы у беременных для решения задач прогнозирования ряда форм акушерской патологии. В качестве маркеров состояния ВНС применялись неинвазивные методы оценки вариабельности ритма сердца матери. Использовался
динамический подход с применением функциональных нагрузочных проб.
МАТЕРИАЛ И МЕТОДЫ
Контингент. Обследовано 400 беременных,
из них в I триместре (до 13 недели включительно) – 54 (13,5 %), во II триместре (14–26 нед) –
277 (69,3 %) и в III триместре (27–36 нед) – 69
(17,2 %) женщин. Средний срок беременности
при обследовании составил 20,7 ± 5,9 нед (M ±
SD; здесь и далее M − среднее арифметическое
значение, SD − стандартное отклонение). В возрасте менее 23 лет было 120 женщин (30 %), из
них юных (16–17 лет) – 16 (4 %). В возрасте от
23 до 27 лет – 151 (37,8 %), более 27 лет – 129
беременных (32,2 %). Средний возраст женщин
составил 25,2 ± 4,8 года.
Исследования проводились с разрешения
биоэтического комитета НИИ КПГПЗ и информированного согласия испытуемых. При отборе
исключались лица с клинически манифестированной сердечно-сосудистой (гипертоническая
болезнь, ишемическая болезнь и другие заболевания сердца), бронхолегочной, желудочнокишечной и почечной патологией. Критерием
отсеивания являлся прием лекарственных препаратов, способных повлиять на вегетативный
статус обследуемых. Изучение клинического
течения и исходов беременностей производилось на основании данных медицинских доку-
Клещеногов С.А. – к.м.н., старший научный сотрудник лаборатории физиологии,
e-mail: serg_kle29@mail.ru
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
87
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Клещеногов С.А. Нейровегетативная реактивность у беременных… /c. 87–92
ментов (амбулаторные карты и истории беременности и родов).
В соответствии с ретроспективной оценкой завершенных беременностей все женщины
были разделены на контрольную и основную
группы. Основная группа включала 303 женщины с патологическим течением беременности и
родов. Были выделены 5 подгрупп по формам
гестационной патологии: 1) синдром задержки
внутриутробного развития плода (ЗВРП) диагностирован у 51 беременной (16,8 % от общего
числа обследованных); 2) поздний гестоз беременных зафиксирован у 32 женщин (10,6 %);
3) патологическое течение беременности при
выраженной угрозе невынашивания, многоводии, признаках внутриутробного инфицирования наблюдалось у 52 женщин (17,2 %); 4)
спонтанные преждевременные роды (ПР) произошли у 31 беременной (10,2 %); 5) подгруппа
беременных с аномалиями родового периода
(АРП) включала 137 женщин (45,2 %).
Процедура. Все исследования проводились
в утренние часы в положении сидя. ЭКГ-сигнал
регистрировался в течение 256 последовательных сокращений сердца с одновременной подачей через аналогово-цифровой преобразователь
в компьютер для анализа по соответствующим
программам. Запись ЭКГ производили последовательно: 1) в спокойном состоянии (фон), 2) при
предъявлении умственного нагрузочного теста
(последовательное вычитание в уме из 500 по
7, seven-test), 3) в периоде восстановления после
умственной нагрузки, 4) при дыхательной нагрузочной пробе и 5) в периоде восстановления
после дыхательной пробы. На 4-м этапе процедуры испытуемым предлагалось углубить дыхание, соблюдая по возможности одинаковые
временные промежутки между экскурсиями
легких. В результате достигались умеренные,
близкие к физиологическим, воздействия симпатической (умственный «стресс») и парасимпатической (углубленное дыхание с произвольной частотой) направленности [2].
Показатели. Изучали спектрально-частотные показатели вариабельности ритма сердца (ВРС) с помощью компьютерного варианта
преобразования Фурье [2]. Соблюдали международные стандарты частотных диапазонов
указанных компонентов спектра ВРС [3]. Отношение высокочастотного спектрального компонента (HF) к очень низкочастотному компоненту (VLF) использовали как оценку вегетативного (ваго-симпатического) баланса [2]. Нелинейные характеристики ритма сердца оценивались
с помощью показателей аппроксимированной
88
энтропии и детрентного флуктуационного анализа [4, 5].
Сравнение средних групповых величин показателей осуществляли по критерию t Стъюдента, сравнение процентов – по двустороннему критерию φ Р. Фишера [6]. Применяли дисперсионный анализ с вычислением F-критерия
Р. Фишера для статистической оценки разброса
индивидуальных значений показателей.
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
В соответствии с условиями контролируемого исследования, группы были сопоставимыми по средним показателям возраста и гестационного срока. Согласно полученным данным, имелась тенденция к увеличению средней
догестационной массы тела женщин основной
группы по сравнению с контрольной группой.
Средний срок родоразрешения был статистически значимо снижен в основной группе.
В фоновом состоянии покоя (вне нагрузочных проб) значимое межгрупповое отличие
наблюдалось лишь по показателю детрентного
флуктуационного анализа (DFA) в сторону его
повышения у женщин с осложненной беременностью (p < 0,05). Кроме того, имелась тенденция к снижению спектрального показателя HF
(уровень синусовой дыхательной аритмии сердца) и ваго-симпатического индекса (отношение HF/VLF) в основной группе (p < 0,10). По
величинам частоты сердечных сокращений, RR
(средний кардиоинтервал), Var (вариационный
размах RR), спектральных компонентов LF и
VLF, а также среднего артериального давления
сравниваемые группы существенно не различались. Следовательно, наиболее чувствительным
индикатором гестационной патологии в статическом состоянии беременных являлся параметр DFA. Это согласуется с данными нашей
предыдущей работы [7], где было показано, что
нелинейная динамика ритма сердца беременных, в частности параметр DFA как один из ее
маркеров, является более ценным критерием
прогноза в отношении ряда осложнений беременности, чем спектральные и статистические
показатели ВРС.
Далее был проведен дисперсионный анализ комплекса изученных показателей ВРС. В
качестве результирующего признака выбран
показатель ваго-симпатического соотношения
(HF/VLF). Рассчитывалась величина изменения
данного показателя при каждой из нагрузочных
проб (умственный тест, гипервентиляция) по
отношению к фоновому состоянию женщин. В
двухфакторном дисперсионном анализе исслеБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Клещеногов С.А. Нейровегетативная реактивность у беременных… /c. 87–92
Таблица 1
Дисперсионный анализ влияния нагрузочных проб
на ваго-симпатическое соотношение
у беременных контрольной и основной групп
Источник
варьирования
(фактор)
Норма/патология
беременности
Спектральный вид
ВРС
Взаимодействие
факторов
Критерий F
Фишера
Уровень
достоверности p
Ум
Г/в
Ум
Г/в
3,8
3,3
0,05
0,05
8,3
9,1
0,01
0,01
0,4
4,9
нд
0,01
П р и м е ч а н и е . Ум – умственный тест (счет в уме);
здесь и в табл. 2 Г/в – гипервентиляция (углубленное дыхание с произвольной частотой), нд – недостоверно.
довалось влияние на дисперсию ваго-симпатического соотношения качественных показателей «спектральный вид вариабельности ритма
сердца» и «норма/патология беременности», а
также взаимовлияние указанных факторов в отношении результирующего признака (табл. 1).
Результаты анализа свидетельствовали о
том, что наибольшее влияние на дисперсию
ваго-симпатического индекса при обеих использованных нагрузочных пробах оказывал фактор «спектральный вид ВРС» (p < 0,01). Вместе
с тем фактор «норма/патология беременности»
также оказался значимым (p < 0,05).
Взаимодействие факторов «спектральный
вид ВРС» и «норма/патология беременности»,
по этим данным было существенным при дыхательной нагрузочной пробе (p < 0,01) и недостоверным при умственном тесте (p > 0,05).
Это означало, что из двух использованных на-
грузочных проб именно гипервентиляция приводит к появлению качественно различного
поведения нейровегетативных систем регуляции у женщин с нормальным и патологическим
развитием беременности.
Учитывая найденную эффективность пробы
с гипервентиляцией для дифференцировки гестационной нормы и патологии, была проведена оценка динамики ВСИ при данной пробе в
подгруппах женщин с различными спектральными видами вариабельности ритма сердца.
Представлялось важным выяснить, какие именно индивидуальные особенности вегетативного
статуса являются основой различного поведения регуляторных систем при гипервентиляции, обусловливая высокую дисперсию вагосимпатического соотношения у беременных.
Результаты такой оценки (табл. 2) указывали
на отчетливые различия нагрузочных изменений ВСИ между нормой и патологией беременности в двух подгруппах женщин: бароактивного вида и депрессивного вида ВРС I типа.
В обоих случаях существенное увеличение
ваго-симпатического индекса на фоне дыхательной пробы наблюдалось лишь в основной
группе беременных (p < 0,001). Заметим, что
бароактивный вид ВРС соответствует повышенному уровню спектральной мощности колебаний кардиоритма в диапазоне 0,1 Гц, связанном
с активностью барорефлекса. Депрессивный
вид ВРС I типа отражает сниженный уровень
спектральной мощности в диапазоне синусовой
дыхательной аритмии сердца (частота колебаний около 0,25 Гц), что свидетельствует о симпатической активации [2, 3].
Далее следовало получить представление
об особенностях нагрузочной динамики ВСИ
Таблица 2
Значения ваго-симпатического индекса в покое и при дыхательной нагрузочной пробе
в сравниваемых группах беременных (М ± SD)
Вид ВРС
n
Контрольная группа
Фон
Г/в
p
n
Основная группа
Фон
Г/в
p
Оптимальный
24
0,60 ± 0,13
0,86 ± 0,22
0,001
40
0,63 ± 0,12
0,75 ± 0,19
0,001
Ваготонический
29
0,95 ± 0,12
0,98 ± 0,23
нд
63
0,94 ± 0,17
0,95 ± 0,25
нд
Бароактивный
9
0,74 ± 0,15
0,65 ± 0,15
нд
65
0,71 ± 0,16
0,84 ± 0,25
0,001
Депрессивный II типа
18
0,75 ± 0,18
0,91 ± 0,29
нд
38
0,82 ± 0,24
0,89 ± 0,24
нд
Депрессивный I типа
17
0,40 ± 0,11
0,37 ± 0,18
нд
97
0,38 ± 0,17
0,52 ± 0,27
0,001
Всего
97
0,72 ± 0,24
0,80 ± 0,31
0,05
303
0,66 ± 0,27
0,76 ± 0,30
0,05
П р и м е ч а н и е . Фон – исходное состояние покоя; значения показателей ВРС даны в десятичных логарифмах спектральной плотности мощности.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
89
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Клещеногов С.А. Нейровегетативная реактивность у беременных… /c. 87–92
Таблица 3
Динамика ваго-симпатического индекса при дыхательной нагрузочной пробе в подгруппах женщин
с различными формами осложнений беременности
Группа беременных
Контрольная
ЗВРП
Гестоз
Угрожающие ПР
ПР
АРП
n
Опт
97
51
32
52
31
137
+44,6***
+15,9
+28,7
–6,0
+22,7
+27,3*
Прирост ВСИ в ответ на гипервентиляцию, %
Вид вариабельности ритма сердца
Ваг
Бар
ДII
+3,6
+6,2
–12,0
–5,3
+7,1
+1,5
–10,1
+26,9*
+19,1
+25,9*
+42,7**
+10,7▼
+24,5
–11,0
+41,2
+4,4
+17,8
+15,9▼
ДI
–2,7
+52,3▼
+47,9*
+62,1**
+76,4
+33,1*
П р и м е ч а н и е . Уровень достоверности отличий от фонового уровня показателя (критерий φ Фишера): ▼ – p < 0,10,
* – p < 0,05, ** – p < 0,01, *** – p < 0,001.
при разных формах гестационной патологии.
Результаты соответствующего анализа суммированы в табл. 3. По этим данным всех беременных с осложненной беременностью можно
было классифицировать на 4 группы соответственно характеру нагрузочной динамики вагосимпатического индекса.
1) Группа, в которую вошли женщины с
аномалиями родового периода. Данная группа
приближалась к контрольной по аналогичному распределению спектральных видов вариабельности ритма сердца. Исключение составил
процент бароактивного вида ВРС, который оказался выше у женщин с АРП по сравнению с
женщинами контрольной группы (20,4 и 9,3 %
соответственно, p = 0,017). В обеих группах существенные сдвиги ВСИ при дыхательной пробе наблюдались при оптимальном виде ВРС.
Отличие группы АРП от контрольной заключалось в значительной динамике ВСИ при депрессивном виде ВРС I типа (p < 0,05), а также
в виде тенденции – при спектральных видах бароактивном и депрессивном II типа (p < 0,10).
2) Группа беременных с синдромом ЗВРП
и состоявшимися спонтанными преждевременными родами. Эта группа отличалась выраженной динамикой ВСИ при бароактивном виде
вариабельности ритма сердца (ЗВРП: 26,9 %;
ПР: 42,7 %, p < 0,05, p < 0,01 соответственно в
сравнении с исходной величиной показателя). В
группе ЗВРП представленность бароактивных
видов ВРС была существенно выше, чем в контрольной (31,4 и 9,3 % соответственно, p < 0,01).
Группа ПР по распределению видов ВРС характеризовалась повышенным процентом ваготонических вариантов (35,5 %), что отличало ее
от всех других групп гестационной патологии.
90
3) Группа, включавшая женщин с угрожающими преждевременными родами. Симпатическая активация у этих беременных подтверждалась повышенным процентом депрессивного
вида ВРС I типа, 51,9 % при 17,5 % в контрольной группе (p < 0,001). Кроме того, при данном
виде ВРС имелась выраженная динамика вагосимпатического индекса при дыхательной пробе (прирост ВСИ на 62,1 %, p < 0,01).
4) Беременные с поздним гестозом характеризовались сочетанием признаков предыдущих
2-й и 3-й выделенных групп, поскольку у них
отмечалось высокая частота как бароактивного,
так депрессивного I типа спектральных видов
(25,0 и 34,4 % при 9,3 и 17,5 % в контрольной
группе, p < 0,03 и p < 0,05 соответственно).
Однако выраженная динамика ВСИ при дыхательной пробе у этих женщин отмечалась лишь
при симптомах симпатической активации у
пациенток со спектральным видом депрессивным I типа (прирост ВСИ на 47,9 %, p < 0,05 по
сравнению с фоновым уровнем показателя), но
не при бароактивном виде вариабельности ритма сердца.
Таким образом, при изучении динамических характеристик ваго-симпатического баланса при дыхательной нагрузочной пробе был
выявлен ряд особенностей не только индивидуального (и группового) типа нейровегетативной
регуляции у беременных, но также по различным формам гестационной патологии.
ЗАКЛЮЧЕНИЕ
Основным результатом данной работы явилось установление высокоинформативного критерия риска осложнений беременности – динамических характеристик ваго-симпатического
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Клещеногов С.А. Нейровегетативная реактивность у беременных… /c. 87–92
баланса организма матери при проведении пробы с умеренной гипервентиляцией.
В последние годы динамические показатели
вариабельности ритма сердца все чаще становятся объектом физиологических исследований
[8, 9]. Применяются различные нагрузочные
пробы с целью выявления скрытых характеристик вегетативного статуса человека в нормальных условиях и при различных формах патологии. Весьма ценным данное направление исследований представляется с точки зрения попыток оценки индивидуального риска развития
патологических процессов [10], поскольку при
функциональной нагрузочной пробе сравниваются два состояния одного и того же субъекта:
до и после соответствующей нагрузки.
Проба с гипервентиляцией, по результатам
настоящего исследования, обусловливала высокую степень дисперсии ваго-симпатического
индекса у беременных при всех учтенных формах гестационной патологии. Имели значение
два фактора: спектральный вид вариабельности ритма сердца, классифицированный в предыдущих исследованиях [2], и принадлежность
женщины к группе нормы или патологии беременности. Наиболее убедительным результатом
представляется тот факт, что статистически значимое влияние на дисперсию ваго-симпатического баланса оказывало сочетание упомянутых
двух факторов. Это означало, что выявление
скрытых признаков гестационной патологии с
помощью дыхательной нагрузочной пробы связано с индивидуальным типом вегетативной
регуляции.
Результаты данного исследования указывают на патогномоничность двух видов вариабельности ритма сердца у беременных – бароактивного и депрессивного I типа, отражающего состояние симпатической активации. Это
подтверждают данные других авторов, которые
свидетельствуют о снижении порога барорефлекса и увеличении активности симпатического
звена ВНС у беременных при ряде форм гестационной патологии [11, 12]. Новым результатом
мы считаем выявление значимости кардиопульмонального взаимодействия для манифестации
скрытых признаков различных форм осложнений беременности.
СПИСОК ЛИТЕРАТУРЫ
1. Фофанова И.Ю. Необходимость и некоторые особенности предгравидарной подготовки в
современных условиях // Гинекология. 2009. (1).
76–78.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Fofanova I.Yu. Necessity and some peculiarities
of pre-conceptional training in contemporary conditions // Ginekologiya. 2009. (1). 76–78.
2. Клещеногов С.А., Флейшман А.Н. Спектральный компьютерный анализ кардиоритма беременных: оценка течения и прогнозирование
осложнений беременности: Метод. пособие для
практич. врачей. Новокузнецк, 2003.
Kleshchenogov S.A., Fleishman A.N. Computer
spectral analysis of the heart rate variability in pregnant women: assessment of the course and prediction
of the pregnancy complications: Method. manual for
practitioners. Novokuznetsk, 2003.
3. Camm A., Malic M., Bigger J. et al. Heart rate
variability: Standards of measurement, physiological
interpretation and clinical use. Task Force of European
Society of Cardiology and the North American Society
of Pacing and Electrophysiology // Circulation. 1996.
93. 1043–1065.
4. Pincus S. Approximate entropy as a measure
of system complexity // Proc. Natl. Acad. Sci. USA.
1991. 88. 2297–2301.
5. Peng C., Havlin S., Stanley A. et al. Quantification of scaling exponents and crossover phenomena
in nonstationary heartbeat time series // Chaos. 1995.
5. 82–87.
6. Гублер Е.В. Вычислительные методы анализа и распознавания патологических процессов.
М.: Медицина, 1978. 296 с.
Gubler E.V. Calculating methods for analyzing
and recognition of the pathological conditions. M.:
Meditsina, 1978. 296 p.
7. Клещеногов С.А., Каньковска О.И. Нелинейная вариабельность ритма сердца матери в прогнозировании патологических исходов беременности
// Вестн. РАМН. 2009. (7). 3–8.
Kleshchenogov S.A., Kanjkovska O.I. Nonlinear variability of maternal cardiac rhythm and
prognostication of pathological pregnancy outcome //
Vestn. RAMS. 2009. (7). 3–8.
8. Ekholm E., Erkkola R. Autonomic cardiovascular
control in pregnancy // Eur. J. Obstet. Gynecol.
Reprod. Biol. 1996. 64. 29–36.
9. Mendonca G., Fernhall B., Kevin S. et al.
Spectral methods of heart rate variability analysis
during dynamic exercise // Clin. Autonom. Res.
Gynecol. 2009. 19. 237–245.
10. Goodman S.N. Towards evidence-based medical statistics: 1: The Bayes factor // Ann. Intern. Med.
1999. 130. 1005–1013.
11. Fisher T., Schobel H., Frank H. et al. Pregnancy-induced sympathetic overactivity: a precursor of preeclampsia // Eur. J. Clin. Invest. 2004. 34.
443– 448.
12. Yang C., Chao T., Cuo T. et al. Preeclamptic
pregnancy is associated with increased sympathetic
and decreased parasympathetic control of HR // Am.
J. Physiol. 2000. 278. H267– H273.
91
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Клещеногов С.А. Нейровегетативная реактивность у беременных… /c. 87–92
NEUROAUTONOMIC REACTIVITY IN PREGNANT WOMEN
WITH VARIOUS GESTATIONAL ABNORMALITIES
Sergei Aleksandrovich KLESHCHENOGOV
Institute for Complex Problems of Hygiene and Occupational Diseases SB RAMS
654041, Novokuznetsk, Kutuzov str., 23
The responses of sympathetic (S) and parasympathetic (PS) subsystems of the autonomic nervous system (ANS)
have been investigated in pregnant women with various gestational abnormalities against the background of functional loading tests (mental task, deep breathing). Spectral power variables of maternal cardiac rhythm (variability)
serve as the markers of S and PS as well as baroreflex functions. It has been shown that in the static position (conscious rest) significant differences between control and complicated pregnancy (CP) groups were merely according
to Detrended Fluctuation Analysis parameter. The essential changes of the vago-sympathetic index (VSI) were found
under loading tests (deep breathing) due to the increase of the vagal tone. Prominent loading shifts of VSI were
revealed in CP subgroups of women with initially elevated baroreflex and sympathetic activity. Also, there were
distinctive differences of ANS reactivity depending on the types of gestational pathology. It has been concluded
that the moderate respiratory load (hyperventilation) of pregnants might provide the basis for development of the
prognostic criteria in obstetrical practice.
Key words: pregnancy, loading tests, heart rate variability.
Kleshchenogov S.A. – candidate of medical sciences, senior researcher of the laboratory of physiology,
e-mail: serg_kle29@mail.ru
92
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК 616-073.97:616.12-008.331.1
РЕГИОНАЛЬНЫЕ ОСОБЕННОСТИ СУТОЧНОГО ПРОФИЛЯ
АРТЕРИАЛЬНОГО ДАВЛЕНИЯ У БОЛЬНЫХ АРТЕРИАЛЬНОЙ
ГИПЕРТЕНЗИЕЙ И ИХ ВЗАИМОСВЯЗЬ С ФАКТОРАМИ РИСКА
СЕРДЕЧНО-СОСУДИСТЫХ ЗАБОЛЕВАНИЙ
Владимир Яковлевич ПОЛЯКОВ, Юрий Алексеевич НИКОЛАЕВ,
Татьяна Рэмоновна МАЦИЕВСКАЯ
Научный центр клинической и экспериментальной медицины СО РАМН
630117, Новосибирск, ул. Тимакова, 2
Изучены региональные особенности показателей суточного профиля артериального давления (АД) и их связь
с факторами риска сердечно-сосудистых заболеваний у больных артериальной гипертензией (АГ). Использованы методы суточного мониторирования АД, эхокардиографии, клиническо-лабораторных исследований. У
больных АГ, проживающих на Севере, чаще встречался суточный профиль АД nondipper (ночное снижение
АД менее 10 %) с более высокими в ночной период показателями диастолического АД, его вариабельности,
большей степенью выраженности гипертрофии миокарда, повышением уровня общего холестерина крови и
индекса массы тела. Полученные данные могут использоваться при лечении и профилактике АГ.
Ключевые слова: суточный профиль артериального давления, артериальная гипертензия, dipper, nondipper, факторы риска.
Современная медицина рассматривает оценку и коррекцию адаптационных возможностей
организма человека как одну из важных задач
повышения эффективности здравоохранения
[1], формирования региональных стратегий лечения и профилактики заболеваний [2] с учетом медико-биологического и экологического
районирования территорий [3]. При артериальной гипертензии (АГ) напряженность процессов адаптации в условиях Севера способствует
формированию патогенетических особенностей
заболевания, увеличению как внутренних, так
и внешних патологических связей, способствующих его прогрессированию и более тяжелому
течению [4]. Расширение использования новых
методов диагностики, таких как суточное мониторирование артериального давления (СМАД),
способствовало развитию представления о гемодинамических факторах риска сердечно-сосудистых заболеваний. В частности, в таком качестве рассматриваются: недостаточное ночное
снижение АД или ночная гипертензия, высокие
вариабельность артериального давления (АД),
пульсовое АД [5–7]. Исследования показывают,
что в условиях климато-географического стрес-
са северных широт у больных АГ происходит
изменение хроноструктуры гемодинамики на
фоне развивающихся метаболических изменений [8].
Цель исследования − изучить региональные
особенности показателей суточного профиля
артериального давления у больных артериальной гипертензией и их взаимозависимость с
факторами риска сердечно-сосудистых заболеваний.
МАТЕРИАЛ И МЕТОДЫ
Проведен анализ суточного профиля артериального давления у 350 больных артериальной
гипертензией I–II степени и 1–2 стадии, проживающих в условиях Севера (Тюменская область,
Республика САХА (Якутия)), и у 89 больных
артериальной гипертензией I–II степени и 1–2
стадии, постоянно проживающих в умеренных
широтах и обследованных на базе клиники Научного центра клинической и экспериментальной медицины СО РАМН (г. Новосибирск). Все
обследованные были в возрасте от 25 до 65 лет,
средний возраст – 48,6 ± 12,1 года. Исследование соответствовало этическим стандартам,
Поляков В.Я. – к.м.н., старший научный сотрудник лаборатории патогенеза соматических заболеваний,
e-mail: vpolyakov15@yandex.ru
Николаев Ю.А. – д.м.н., главный научный сотрудник, и.о. зам. директора по клинической и научной работе;
руководитель лаборатории патогенеза соматических заболеваний
Мациевская Т.Р. – врач ультразвуковой диагностики, врач высшей категории
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
93
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Поляков В.Я., Николаев Ю.А., Мациевская Т.Р. Региональные особенности суточного… /c. 93–98
личие гипертрофии миокарда левого желудочка
определялось по толщине задней стенки левого
желудочка и межжелудочковой перегородки, а
также по индексу массы миокарда левого желудочка (125 г/м2 и более для мужчин, 110 г/м2 и
более для женщин). Проводился анализ клинико-лабораторных данных, включающий определение уровня холестерина в сыворотке крови.
При суждении о частоте нарушений липидного
профиля крови пользовались рекомендациями
Комитета экспертов ВНОК, составленными с
учетом Европейских рекомендаций III пересмотра, 2003 г.
При выполнении статистической обработки
полученных данных характер распределения исследуемых параметров оценивали графическим
способом, а также с использованием критерия
Колмогорова – Смирнова. При параметрическом распределении исследуемого признака для
оценки межгрупповых различий использовали
t-критерий Стъюдента, при непараметрическом
распределении – U-критерий Манна – Уитни.
Корреляционный анализ проводили с помощью
методов Пирсона, Спирмена. Выявленные различия считали статистически значимыми при
величине p < 0,05.
разработанным в соответствии с Хельсинкской
декларацией Всемирной ассоциации «Этические принципы проведения научных медицинских исследований с участием человека» (2000
год) и с Правилами клинической практики в
Российской Федерации, утвержденными Приказом Минздрава РФ № 266 (2003 год), и проводилось в соответствии с информированным согласием на участие. Для верификации диагноза
эссенциальной артериальной гипертензии были
использованы рекомендации экспертов ВОЗ
(1999 г.), Всероссийского научного общества
кардиологов (ВНОК, 2004, 2008 гг.). Для определения риска сердечно-сосудистых осложнений и смерти использовались системы стратификации «SCORE» и «Фремингемская модель».
Всем обследованным были проведены обязательные и дополнительные обследования, рекомендуемые ВНОК 2004, 2008 гг. с целью исключения симптоматических АГ и идентификации
степени, стадии и группы риска. Оценивалось
наличие факторов риска сердечно-сосудистых
заболеваний, включая гиперхолестеринемию и
ожирение. Проводилось суточное мониторирование артериального давления и кардиоритма
аппаратом BPLab (Россия). При выполнении
СМАД производились регистрация показателей гемодинамики и дополнительный компьютерный расчет показателей. Ультразвуковое исследование сердца осуществлялось с помощью
диагностической системы VIVID-3 (США). На-
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
Среди больных АГ, проживающих в условиях Севера, преобладал нарушенный суточный
Таблица 1
Сравнительная характеристика показателей хроноструктуры гемодинамики
у больных АГ dipper и nondipper, проживающих в умеренных широтах и на Севере (M ± m)
ипСАДд
ивСАДд
ииСАДд
ипСАДн
ивСАДн
ииСАДн
ипДАДд
ивДАДд
ииДАДд
ипДАДн
ивДАДн
ииДАДн
dipper (n = 31)
Новосибирск
nondipper (n = 20)
p
141,8 ± 27,7
56,3 ± 6,3
55,9 ± 6,1
47,5 ± 10,4*
43,4 ± 6,3**
42,9 ± 5,9**
98,0 ± 14,5
60,6 ± 5,5
59,5 ± 5,2
50,8 ± 7,9*
58,6 ± 5,5
55,1 ± 5,3
114,9 ± 22,7
61,5 ± 6,8
58,9 ± 6,3
93,0 ± 12,2*
80,3 ± 5,4**
74,0 ± 5,4**
91,6 ± 18,3
58,8 ± 7,2
57,4 ± 7,0
95,9 ± 19,9*
68,9 ± 6,7
67,7 ± 6,2
0,492
0,591
0,737
0,007
< 0,001
0,001
0,783
0,843
0,813
0,021
0,244
0,137
dipper (n = 35)
Якутия
nondipper (n = 21)
p
114,9 ± 17,9
60,5 ± 4,9
59,2 ± 4,6
38,7 ± 8,1**
41,5 ± 5,5**
41,5 ± 5,5**
80,9 ± 13,5
56,0 ± 5,2
53,8 ± 4,9
41,2 ± 6,7**
52,1 ± 6,2*
50,9 ± 5,5*
116,2 ± 26,4
62,8 ± 6,3
61,4 ± 6,1
113,6 ± 20,3**
77,9 ± 5,3**
71,9 ± 5,7**
94,8 ± 20,2
62,4 ± 6,7
58,0 ± 6,4
103,8 ± 20,4**
77,0 ± 6,9*
74,9 ± 6,1*
0,967
0,779
0,772
< 0,001
< 0,001
0,001
0,557
0,455
0,591
0,001
0,013
0,007
П р и м е ч а н и е . Расчетные индексы повышенного артериального давления: ип – индекс площади, ив – индекс
времени, ии – индекс измерений; САДд – систолическое АД дневное; САДн – систолическое АД ночное; ДАДд – диастолическое АД дневное; ДАДн – диастолическое АД ночное; различие показателей статистически значимо: * − при
p ≤ 0,05, ** − при p ≤ 0,001.
94
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Поляков В.Я., Николаев Ю.А., Мациевская Т.Р. Региональные особенности суточного… /c. 93–98
профиль артериального давления с недостаточным (менее 10 %) ночным снижением АД (nondippper), таких пациентов было 48 %. Физиологический суточный профиль АД (dipper, ночное
снижение 10–22 %) был у 43 % обследованных
на Севере, избыточное ночное снижение АД
(более 22 %, over-dipper) – у 9 %. В умеренных
широтах основная часть (более 65 %) обследованных больных с АГ имела физиологический
суточный профиль артериального давления.
Только 25 % обследованных имели суточный
профиль АД dipper, 8 % – over-dipper.
У больных АГ nondipper, проживающих на
Севере, были также более высокие в ночной
период по сравнению с больными АГ dipper
вариабельность ДАД (11,36 ± 1,02 и 9,0 ± 0,58
мм рт. ст. соответственно; p = 0,04); индексы
нагрузки повышенным АД (табл. 1). Выявлена
особенность суточной динамики минимального диастолического артериального давления у
больных АГ nondipper, проживающих на Севере. По данным суточного мониторирования отсутствовало ночное снижение этого показателя,
даже была тенденция к некоторому его увеличению (рис. 1). Также в этой подгруппе были
статистически значимы более высокие показатели двойного произведения АД × ЧСС в ночной период (рис. 2).
У больных АГ, проживающих на Севере,
были более выраженные (r до 0,47; p < 0,001)
по сравнению с больными АГ, проживающими в умеренных широтах (r до 0,34; p < 0,05),
прямые корреляционные связи степени гипертрофии миокарда левого желудочка по данным
эхокардиографии с расчетными индексами нагрузки повышенным артериальным давлением.
Причем в подгруппе nondipper наиболее сильные корреляционные связи со степенью гипер-
Рис. 1. Сравнительная диаграмма суточной динамики
минимального диастолического АД по данным
СМАД у больных АГ nondipper, проживающих в
умеренных широтах (у.ш.) и на Севере (с); * –
значимое различие показателей (p < 0,001)
трофии миокарда имели расчетные индексы нагрузки повышенным АД в ночной период.
В подгруппе проживающих на Севере
больных АГ nondipper отмечалось достоверно
(p < 0,001) более выраженная гипертрофия миокарда левого желудочка (1,25 ± 0,05 см) при
уровне холестерина в сыворотке крови более
5,0 ммоль/л по сравнению с подгруппой с уровнем холестерина менее 5,0 ммоль/л (толщина
задней стенки левого желудочка 1,02 ± 0,10 см).
Таких различий у больных АГ dipper, проживающих на Севере, и у больных dipper и nondipper, проживающих в умеренных широтах,
не было выявлено. В подгруппе больных nondipper, проживающих на Севере, выявлены
прямые корреляционные связи средних и максимальных показателей САД в ночной период
и уровня гликемии при проведении теста толерантности к глюкозе (r = 0,72; p < 0,001). У жителей умеренных широт, страдающих АГ, значимые коэффициенты корреляции проявлялись
с таким фактором риска, как возраст, у мужчин
Рис. 2. Сравнительная суточная динамика показателя двойного произведения САД × ЧСС по данным суточного
мониторирования у больных артериальной гипертензией dipper и nondipper, проживающих на Севере (а)
и в умеренных широтах (б); * – статистическая значимость различия показателей (p < 0,05)
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
95
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Поляков В.Я., Николаев Ю.А., Мациевская Т.Р. Региональные особенности суточного… /c. 93–98
Таблица 2
Сравнительная характеристика корреляционных связей расчетных индексов нагрузки
повышенным артериальным давлением с факторами риска сердечно-сосудистых заболеваний
–0,01
0,01
0,1
–0,03
0,07
–0,17
–0,13
–0,24
0,01
–0,1
0,11
–0,09
0,72*
0,53*
0,35
0,28
0,12
–0,02
0,41*
0,21
0,31
0,58*
0,44*
0,72*
0,2
0,38
0,2
0,4
Уровень холестеринемии
Мужчины старше
55 лет
0,48*
0,32
0,14
–0,15
Ожирение
Уровень холестеринемии
0,04
–0,03
–0,11
–0,32
Мужчины старше
55 лет
Ожирение
–0,15
–0,1
–0,03
0,14
Север (nondipper)
Уровень холестеринемии
Мужчины старше
55 лет
0,37*
0,31
0,13
–0,06
Ожирение
Уровень холестеринемии
Север (dipper)
Ожирение
ипСАДд
ипСАДн
ипДАДд
ипДАДн
Новосибирск
(nondipper)
Мужчины старше
55 лет
Новосибирск (dipper)
0,21
0,21
0,06
0,13
П р и м е ч а н и е . Расчетные индексы повышенного артериального давления: ип – индекс площади, САДд – систолическое артериальное давление дневное; САДн – систолическое АД ночное; ДАДд – диастолическое артериальное давление дневное; ДАДн – диастолическое АД ночное; * – статистически значимые коэффициенты корреляции (p < 0,05).
– это возраст старше 55 лет (табл. 2). А у больных АГ, проживающих на Севере, статистически значимо проявлялись корреляционные связи
индексов нагрузки повышенным АД с наличием гиперхолестеринемии, ожирения, увеличением индекса массы тела, – факторами риска,
отражающими метаболическое звено патогенеза
заболевания. В зависимости от типа суточного
профиля АД величины коэффициентов корреляции в подгруппе dipper были выше в дневной период (r = 0,37–0,72; p < 0,05), а в подгруппе nondipper – в ночной период (r = 0,44–0,72,
p < 0,05) (см. табл. 2). Прямой характер связи
свидетельствовал о том, что при увеличении
выраженности факторов риска возрастали значения показателей суточного профиля АД.
Таким образом, у больных с артериальной
гипертензией выявлены региональные особенности суточного профиля АД. Большая выраженность нарушений суточного профиля гемодинамических характеристик и специфичность
их связи с факторами риска могут быть связаны с дополнительными средовыми нагрузками
на организм больных АГ, вызванными комплексом климатогеографических факторов. А
выявленные в нашем исследовании особенности суточного профиля АД dipper и nondipper у
больных с артериальной гипертензией могут
рассматриваться как проявление их компенсаторно-приспособительных реакций к факторам
среды. Рассмотрение функционального состоя96
ния сердечно-сосудистой системы в динамике
с использованием суточного мониторирования
АД представляется актуальным в рамках концепции сердечно-сосудистого континуума [9].
Одновременное сочетание у больных АГ nondipper, проживающих на Севере, гемодинамических факторов риска [10] – недостаточного
ночного снижения АД, высокой вариабельности
АД, высоких значений двойного произведения
АД × ЧСС – свидетельствует о более неблагоприятном прогнозе течения заболевания. Обращает на себя внимание то, что у больных АГ
nondipper, проживающих на Севере, отмечается
большая выраженность связи функциональных
и метаболических факторов риска, что может
рассматриваться как синдром функционально-метаболической дисрегуляции, характеризующий особенность патогенеза артериальной
гипертензии у этой категории больных. В этом
случае развитию АГ может способствовать патогенетическое объединение клинико-метаболических и функциональных нарушений, которые по принципу обратной связи отягощают
и способствуют прогрессированию артериальной гипертензии. Это становится возможным
благодаря объединению группы симптомов на
одной патогенетической основе, в качестве которой могут выступать молекулярно-клеточные
механизмы интеграции регуляции циркадных
ритмов, метаболизма белками Cry, Per, Clock,
Bmall. При гипертрофии миокарда показано наБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Поляков В.Я., Николаев Ю.А., Мациевская Т.Р. Региональные особенности суточного… /c. 93–98
рушение экспрессии белков Cry и Per, регулирующих циркадный ритм [11]. Также отмечено,
что система Clock/Bmal1 включена в регуляцию
липидного обмена [12, 13]. Установлено, что
за экспрессию регулирующих белков Clock и
Bmal1 на клеточном уровне отвечает транскрипционный фактор RORα. А его коактиватором
является участвующий в работе многих транскрипционных факторов клетки белок PGC-1α,
активность которого зависит от питательных
веществ [14]. Считается, что эндотелиальная
дисфункция, вызванная в том числе и окислительным стрессом (являющегося частью северного климатогеографического стресса), имеет
важное значение в патогенезе артериальной гипертензии и нарушении циркадных ритмов гемодинамики, регуляции уровня минимального
АД [15]. Показано, что степень жесткости сосудов коррелирует с показателями артериального
давления, полученного путем суточного мониторирования и степенью ночного снижения АД.
Отмечено, что PGC-1α является связующим
звеном влияния оксида азота на метаболизм. А
инсулин-зависимый вазопротективный эффект
опосредован активацией фосфатидил-3-киназы
в эндотелиальных клетках и микрососудах, что
приводит к повышению экспрессии гена эндотелиальной NO-синтазы, высвобождению NO
эндотелиальными клетками и инсулин-обусловленной вазодилатации. И изменения углеводного обмена могут приводить к нарушениям
в NO-зависимом звене регуляции тонуса сосудов. Таким образом на молекулярно-клеточном
уровне может происходить интеграция метаболических процессов и циркадных ритмов.
ЗАКЛЮЧЕНИЕ
У больных АГ, проживающих на Севере,
выявлено нарушение суточных ритмов гемодинамики, что проявляется недостаточным ночным снижением АД у 48 % обследованных. У
больных АГ со сниженным суточным индексом
АД по сравнению с пациентами с нормальным
циркадным ритмом АД чаще встречалась гипертрофия миокарда левого желудочка. У больных АГ с суточным профилем артериального
давления nondipper, проживающих в условиях
Севера, отмечается сочетание сниженного суточного индекса АД с более высокими в ночной
период показателями минимального диастолического артериального давления, вариабельности ДАД, двойного произведения (АД × ЧСС).
Показатели суточного профиля артериального
давления у больных АГ взаимосвязаны с факторами риска сердечно-сосудистых заболеваБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
ний. У больных АГ, проживающих на Севере,
отмечены более значимые прямые связи повышенных показателей АД по данным СМАД с
факторами риска, отражающими степень метаболических нарушений, уровнем гиперхолестеринемии, индексом массы тела, уровнем гликемии. Полученные результаты, отражающие
региональные различия хроноструктуры гемодинамики у больных АГ dipper и nondipper и их
взаимосвязь с факторами риска сердечно-сосудистых заболеваний, могут быть использованы
при разработке программ первичной и вторичной профилактики АГ.
СПИСОК ЛИТЕРАТУРЫ
1. Баранов В.М., Баевский Р.М., Берсенева А. П., Михайлов В.М. Оценка адаптационных
возможностей организма и задачи повышения эффективности здравоохранения// Экология человека. 2004. (6). 25–29.
Baranov V.М., Baevskiy R.М., Berseneva А.Р.,
Mikhailov V.М. The evaluation of adaptive possibilities of organism and problems of increase of public
health services efficiency // Ekologiya cheloveka.
2004. (6). 25–29.
2. Глазунов И.С. Построение региональной политики, стратегии и системы профилактики заболеваний и укрепления здоровья населения // Профилактика заболеваний и укрепление здоровья.
1999. (5). 3–8.
Glazunov I.S. Construction of regional policy,
strategy and system of prevention of the diseases and
solidifying of population health // Profilaktika zabolevaniy i ukreplenie zdorov’ya. 1999. (5). 3–8.
3. Максимов А.Л. Роль медико-биологических и экологических факторов при формировании
концепции районирования территории Российской
Федерации // Экология человека. 2004. (6). 35–42.
Maksimov A.L. The role of the biomedical and
ecological factors for shaping of the concept of regions of the Russian Federation // Ekologiya cheloveka. 2004. (6). 35–42.
4. Буганов А.А., Уманская Л.Е., Саламатина Л. В. Вопросы профилактической кардиологии
в экологически нестабильном районе Крайнего
Севера. Надым, 2000. 204 с.
Buganov А.А., Umanskaya L.Е., Salamatina L.V.
Problems of preventive cardiology in ecological unstable region of the Far North. Nadym, 2000. 204 p.
5. Cuspidi C., Meani S., Salerio C. et al. Cardiovascular target organ damage in essential hypertensives with or without reproducible nocturnal fall in
blood pressure // J. Hypertens. 2004. 22. 273–280.
97
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Поляков В.Я., Николаев Ю.А., Мациевская Т.Р. Региональные особенности суточного… /c. 93–98
6. Кобалава Ж.Д., Котовская Ю.В., Моисеев В. С. Особенности утреннего подъема АД у
больных гипертонической болезнью с различными вариантами суточного ритма // Кардиология.
1999. (6). 23–26.
Kobalava G.D., Kotovskaya Yu.V., Moiseev V.S.
Features of BP morning rise at patients with arterial
hypertension with various variants of 24-hour rhythm
// Kardiologiya. 1999. (6). 23–26.
7. Pickering T. Future developments in ambulatory blood pressure monitoring and self-blood pressure
monitoring in clinical practice // Blood Press. Monit.
2002. 7. 21–25.
8. Николаев Ю.А., Дарянина С.А., Пальцев А.И.
и др. Эпидемиология, патогенез, профилактика и
лечение артериальной гипертензии у пришлого
населения на Севере. Новосибирск, 2005. 200 с.
Nikolaev Yu.А., Daryanina S.А., Paltsev А.I. et
al. Epidemiology, pathogenesis, prevention and treatment of arterial hypertension at newcomers’ population of the North. Novosibirsk, 2005. 200 p.
9. Беленков Ю.Н., Мареев В.Ю. Сердечно-сосудистый континуум // Сердечная недостаточность.
2002. (3). 7–11.
Belenkov Yu.N., Mareev V.Yu. Heart-vascular continuum // Serdechnaya nedostatochnost’. 2002. (3).
7–11.
10. Muxfieldt E.S., Salles G.F. Pulse pressure or
dipping pattern: which one is a better cardiovascular
risk marker in resistant hypertension? // J. Hypertens.
2008. 26. 878–884.
11. Young M.E., Razeghi P., Taegtmeyer H. Clockgenes in the heart: characterization and attenuation
with hypertrophy // Circ. Res. 2001. 88. 1142–1150.
12. Tsai J.Y., Kienesberger P.C., Pulinilkunnil T.
et al. Direct regulation of myocardial triglyceride
metabolism by the cardiomyocyte circadian clock /
/ J. Biol. Chem. 2010. 285. 2918–2929.
13. Inoue I., Shinoda Y., Ikeda M. et al. CLOCK/
BMAL1 is involved in lipid metabolism via transactivation of the peroxisome proliferator-activated
receptor (PPAR) response element // J. Atheroscler.
Thromb. 2005. 12. 169–174.
14. Liu C., Li S., Liu T. et al. Transcriptional
coactivator PGC-1alpha integrates the mammalian
clock and energy metabolism // Nature. 2007. 447.
477–481.
15. Adamopoulos D., Vyssoulis G., Karpanou E.
et al. Environmental determinants of blood pressure,
arterial stiffness, and central hemodynamics // J. Hypertens. 2010. 28. 903–909.
REGIONAL FEATURES OF 24-HOUR BLOOD PRESSURE PROFILE
AT THE ARTERIAL HYPERTENSION AND THEIR INTERRELATION
WITH THE CARDIO-VASCULAR RISK FACTORS
Vladimir Yakovlevich POLYAKOV, Yuryi Alekseevich NIKOLAEV,
Tatiana Remonovna MACIEVSKAIA
Research Center for Clinical and Experimental medicine SB RAMS
630117, Novosibirsk, Timakov str., 2
The regional features of 24-hour blood pressure (BP) profile in patients with arterial hypertension (AH) and their
relation with cardiovascular risk factors have been investigated. The 24-hour BP monitoring, echocardiography and
clinical–laboratory investigation have been performed. A considerable disorder of 24-hour BP profile - nondipper
pattern with insufficient decrease of BP at night (less then 10 %) was revealed in a subgroup of the patients with AH
living in the North. The patients with AH nondipper had higher diastolic BP, variability of diastolic BP myocardial
hypertrophy, the increased level of total cholesterol and body mass index. The obtained data can be applied to the
AH treatment and prevention.
Key words: 24-hour blood pressure profile, arterial hypertension, risk factors, dipper, nondipper, risk factors.
Polyakov V.Ya. – candidate of medical sciences, senior researcher of the laboratory for pathogenesis of somatic
diseases, e-mail: vpolyakov15@yandex.ru
Nikolaev Yu.A. – doctor of medical sciences, deputy director for clinical and scientific investigation, head of the
laboratory for pathogenesis of somatic diseases
Matsyevskaya T.R. – physician of ultrasonic diagnosis, doctor of higher category
98
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК 617-089.844
СПОСОБ НЕНАТЯЖНОЙ ГЕРНИОПЛАСТИКИ ПРИ ЛЕЧЕНИИ БОЛЬНЫХ
С ПОСЛЕОПЕРАЦИОННЫМИ ВЕНТРАЛЬНЫМИ ГРЫЖАМИ
Константин Сергеевич ХОХЛОВ1, Надежда Николаевна МИХАЙЛОВА2,
Владимир Иванович ХАЛЕПА1
1 МЛПУ
Городская клиническая больница № 1
654041, г. Новокузнецк, пр. Бардина, 30
2 НИИ
комплексных проблем гигиены и профзаболеваний СО РАМН
654041, г. Новокузнецк, ул. Кутузова, 23
Разработан способ герниопластики при лечении пациентов с послеоперационными вентральными грыжами. Разработано устройство для фиксации полипропиленового протеза. Изучены ближайшие и отдаленные
результаты лечения 46 больных. Отличительной чертой предложенного метода является то, что в ходе операции полипропиленовый протез фиксируется лигатурами, которые затем удаляются в раннем послеоперационном периоде. Количество общих послеоперационных осложнений составило 6,5 %. Местные послеоперационные осложнения наблюдалось в 4,3 % случаев. Рецидив заболевания составил 4,9 %. Предложенный
способ позволяет расположить полипропиленовый протез в предбрюшинном пространстве с протезированием всего послеоперационного рубца.
Ключевые слова: послеоперационная вентральная грыжа, герниопластика, полипропиленовый протез.
Актуальность хирургического лечения
больных с послеоперационными вентральными грыжами (ПОВГ) сохраняется до настоящего времени. Частота их возникновения после
лапаротомий достигает, по данным различных
авторов, 18 %, а после ургентных операций −
58 % [1−3].
Результаты хирургического лечения больных с ПОВГ остаются неудовлетворительными
из-за высокой частоты рецидивов заболевания
после различных видов аутопластических способов герниопластики [4−6].
Неудовлетворенность результатами лечения
способствовала появлению многочисленных
исследований, направленных на разработку более совершенных способов оперативного вмешательства, позволяющих улучшить результаты лечения больных с ПОВГ. Получившие в
последнее время широкое распространение ненатяжные способы герниопластики с применением различных видов синтетических материалов привели к улучшению результатов лечения
больных, позволили снизить вероятность развития абдоминального компартмент-синдрома,
количество рецидивов и частоту осложнений
[7−9].
Цель исследования − разработать и внедрить
способ аллопластики с предбрюшинным расположением протеза и фиксацией его съемными
лигатурами при лечении пациентов с послеоперационными вентральными грыжами, изучить
ближайшие и отдаленные результаты лечения
больных предложенным способом.
МАТЕРИАЛ И МЕТОДЫ
В основу работы положены результаты хирургического лечения 46 больных с ПОВГ, оперированных в отделении хирургии МЛПУ ГКБ
№ 1 г. Новокузнецка. Больным выполнялась
экстраперитонеальная протезирующая пластика грыжевых ворот с применением полипропиленового сетчатого протеза «Surgipro» разработанным в клинике способом. Кроме общепринятых стандартных методов обследования
обязательным считали исследование функции
внешнего дыхания и выполнение УЗИ брюшной полости. В послеоперационном периоде
проводили УЗИ передней брюшной стенки для
выявления жидкостных скоплений в зоне оперативного вмешательства.
Для предупреждения инфекционных осложнений применяли интраоперационную ан-
Хохлов К.С. – зав. хирургическим отделением, e-mail: loser1973@yandex.ru
Михайлова Н.Н. – д.б.н., проф., зав. лабораторией экспериментальных гигиенических исследований
Халепа В.И. – зам. главного врача по хирургической работе
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
99
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Хохлов К.С., Михайлова Н.Н., Халепа В.И. Способ ненатяжной герниопластики… /c. 99–102
Рис. 1. Устройство для проведения лигатур
тибиотикопрофилактику. С целью профилактики тромбоэмболии легочной артерии больным
проводили эластическую компрессию нижних
конечностей и назначали гепарин и низкомолекулярные гепарины. В качестве обезболивающих препаратов применяли наркотические
анальгетики.
Среди прооперированных больных мужчин
было 10 (22 %), женщин – 36 (78 %). Средний
возраст составил 55,3 ± 1,8 года. По локализации: со срединными (М) грыжами был 91 %
обследованных, с боковыми (L) – 9 %. Сроки
грыженосительства − 5,8 ± 0,71 года. По ширине грыжевых ворот: W1 – 85 %, W2 – 15 % пациентов. Первичные грыжи наблюдали в 93 %,
рецидивные − в 7 % случаев. Больных без сопутствующей соматической патологии было
17 %, наличие сопутствующих заболеваний
отмечено в 83 % случаев. Герниопластика выполнялась способом, разработанным в клинике хирургии МЛПУ ГКБ № 1 г. Новокузнецка
(патент № 2313293 РФ «Способ герниопластики
вентральных грыж»). Для реализации способа нами было разработано устройство (рис. 1),
позволяющее просто и малотравматично вывести лигатуры, фиксирующие протез, на кожу
(патент № 2320282 РФ «Устройство для проведения лигатур при герниопластике»).
Отличительной чертой предложенного метода является то, что в ходе операции протез
фиксируется лигатурами, которые удаляются
в раннем послеоперационном периоде. Проводится разрез кожи на длину грыжевых ворот с
иссечением старого послеоперационного рубца.
Выделяется грыжевой мешок до грыжевых ворот, подкожная клетчатка вокруг грыжевых ворот не мобилизуется. Избытки грыжевого мешка иссекаются, края сшиваются, восстанавливая
непрерывность брюшины. В предбрюшинном
100
пространстве по окружности грыжевых ворот
создается карман для укладки полипропиленового протеза. Края грыжевых ворот временно
сводятся и удерживаются в сведенном положении. На кожу поверх раны укладывают полиэтиленовую пленку и выкраивают из нее шаблон таким образом, чтобы он заступал за края
грыжевых ворот на 5 см. По углам шаблона,
отступя от его края на 0,5 см, делают насечки.
На коже, в проекции выполненных насечек на
шаблоне, выполняют подобные насечки скальпелем. Затем накладывают шаблон на полипропиленовую сетку и по нему выкраивают полипропиленовый протез. В проекции насечек на
шаблоне протез прошивают лигатурами. Свернутый полипропиленовый протез помещают в
предбрюшинное пространство, два конца каждой лигатуры устройством для проведения лигатур из предбрюшинного пространства через
всю толщу передней брюшной стенки выводят
на кожу в местах ранее помеченных насечками.
После того как концы лигатур вывели на кожу,
края грыжевых ворот сшивают и ушивают операционную рану послойно наглухо. Подтягивая
за лигатуры, расправляют полипропиленовый
протез и завязывают лигатуры на пелотах, в
качестве которых используются обычные пуговицы (рис. 2). На 7–8 сутки лигатуры, фиксирующие протез, удаляют.
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
Интраоперационных осложнений при проведении хирургического вмешательства не
было. Из осложнений общего характера у одного (2,1 %) больного наблюдали развитие сердечно-легочной недостаточности. После проведения интенсивной терапии эти явления были
купированы. В одном (2,1 %) случае после
пластики грыжевого дефекта возникали явления выраженного послеоперационного пареза
кишечника, потребовавшие интенсивной те-
Рис. 2. Схема герниопластики съемными лигатурами
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Хохлов К.С., Михайлова Н.Н., Халепа В.И. Способ ненатяжной герниопластики… /c. 99–102
рапии: инфузий растворов, сифонной клизмы,
паранефральных новокаиновых блокад и контроля за пассажем бариевой взвеси по кишечнику. После проведенного комплекса консервативных мероприятий явления послеоперационного
пареза были устранены. Еще у одного (2,1 %)
больного была диагностирована послеоперационная пневмония. После проведения курса антибактериальной терапии наступило выздоровление. Количество общих послеоперационных
осложнений составило 6,5 %.
Местные послеоперационные осложнения
мы встретили у двух (4,3 %) больных. Основное место в ряду местных послеоперационных
осложнений при протезирующей пластике грыжевых ворот занимают серомы. В наших наблюдениях серома послеоперационной раны
была выявлена в одном (2,1 %) случае на 4-е
сутки при помощи УЗИ тканей передней брюшной стенки. Небольшое количество осложнений
достигнуто за счет уменьшения травматизации
тканей, отсутствия мобилизации подкожной
клетчатки для фиксации протеза. Тем самым
до минимума сведено формирование остаточных полостей после вмешательства. Отсутствие
контакта протеза с подкожной клетчаткой также снижает частоту формирования послеоперационных сером.
Еще в одном (2,1 %) наблюдении была выявлена гематома послеоперационной раны. Гематома опорожнена через рану. В дальнейшем
на рану наложены вторичные швы. Инфекционных осложнений при проведении хирургического вмешательства не наблюдали, что, по
нашему мнению, достигнуто обязательным
проведением интраоперационной антибиотикопрофилактики.
Отдаленные результаты лечения больных
были изучены в сроки от 1,5 до 2 лет. Всего
отдаленные результаты учтены у 41 больного
(89,1 %). При динамическом наблюдении проводили физикальный осмотр больного. Рецидив
вентральной грыжи выявлен у двух пациентов.
При изучении сроков возникновения рецидива
установлено, что у всех больных он наступил
в течение первого года после операции. Эти
больные были повторно оперированы в нашем
отделении.
В одном наблюдении после аппендэктомии
грыжа располагалась в правой подвздошной
области, близость грыжевых ворот к крылу
подвздошной кости не позволила установить
под мышечно-апоневротический слой имплантат достаточных размером и вывести лигатуры
на переднюю брюшную стенку, что и послуБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
жило причиной рецидива. Во время повторной
операции между крылом подвздошной кости и
плотным соединительнотканным рубцом обнаружены грыжевые ворота размером 4 × 3 см. Во
втором случае, после герниопластики по поводу срединной грыжи, вновь сформировавшаяся
грыжа находилась выше ранее установленного
протеза. Причиной рецидива заболевания, по
нашему мнению, явился не выявленный на первой операции дополнительный дефект в апоневрозе передней брюшной стенки, который
в дальнейшем после пластики основных грыжевых ворот привел к формированию грыжи.
Исходя из этого, мы пришли к выводу, что при
герниопластике по поводу ПОВГ необходимо
проводить протезирование всего послеоперационного рубца. Общий процент рецидива заболевания составил 4,9 %.
Таким образом, к преимуществам разработанного нами способа необходимо отнести следующие. Соблюдается принцип отграничения
протеза от подкожной клетчатки. В предбрюшинном пространстве создается ложе для протеза любых размеров, таким образом, возможно протезирование всего послеоперационного
рубца. При помощи устройства для проведения
лигатур можно установить и расправить протез
любой площади. При этом лигатуры, прошитые
за край протеза, служат вначале как направляющие при проведении и расправлении протеза
в предбрюшинном пространстве, а затем, выведенные на кожу и фиксированные на пелотах, не позволяют протезу сместиться. Такая
фиксация протеза не требует дополнительного увеличения операционной раны, мобилизации подкожной клетчатки, тем самым снижая
травматичность и не создавая дополнительных
полостей между апоневрозом и клетчаткой. Отсутствие постоянных лигатур при сокращении
протеза позволяет избежать прорезывания тканей мышечно-апоневротического слоя и создания предпосылок для рецидива заболевания.
Принимая во внимание данные о сокращении
площади протеза, способ не ограничивает возможности применения протеза любых размеров. Ограничением для применения данного
способа могут служить выраженные рубцовые
изменения тканей передней брюшной стенки,
не позволяющие сформировать в предбрюшинном пространстве ложе для протеза. Необходимость во всех случаях пластики сшивать
края грыжевых ворот для создания опоры для
протеза, при ширине ворот более 10 см, может
привести к развитию синдрома абдоминальной
гипертензии.
101
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Хохлов К.С., Михайлова Н.Н., Халепа В.И. Способ ненатяжной герниопластики… /c. 99–102
ВЫВОДЫ
1. Устройство для проведения лигатур через
переднюю брюшную стенку позволяет расположить полипропиленовый протез в предбрюшинном пространстве с протезированием всего
послеоперационного рубца, снижая при этом
травматичность операционного вмешательства.
2. Способ герниопластики послеоперационных вентральных грыж со съемными лигатурами уменьшает количество послеоперационных
осложнений и рецидивов заболевания.
СПИСОК ЛИТЕРАТУРЫ
1. Мариев А.И., Ушаков Н.Д. Наружные грыжи
живота. Петрозаводск: ПетрГУ, 1998. 192 с.
Mariev A.I., Ushakov N.D. External hernias of a
stomach. Petrozavodsk: PetrGU, 1998. 192 p.
2. Чистяков А.А., Богданов Д.Ю. Хирургическое лечение послеоперационных вентральных
грыж. М.: Медицинское информационное агентство, 2005. 104 с.
Chistyakov A.A., Bogdanov D.Yu. Surgery of
postoperative ventral hernias. М: Meditsinskoe informatsionnoe agentstvo, 2005. 104 p.
3. O’Dwyer P.J., Courtney C.A. Factors involved
in abdominal wall closure and subsequent Incisional
hernia // Surgeon. 2003. (l). 17–22.
4. Седов В.М., Гостевской А.А. Послеоперационные вентральные грыжи. СПб.: Человек, 2010.
162 с.
Sedov V.M., Gostevsky A.A. Postoperative ventral
hernias. SPb.: Chelovek, 2010. 162 p.
5. Тимошин А.Д., Юрасов А.В., Шестаков А.Л.
Хирургическое лечение паховых и послеоперационных грыж брюшной стенки. М.: Триада X,
2003. 144 с.
Timoshin A.D., Yurasov A.V., Shestakov A.L. Surgery of inguinal and postoperative hernias of abdominal wall. М.: Triada X, 2003. 144 p.
6. Luijendijk R.W., Lemmen V.H., Hop W.C. et al.
Incisional hernia recurrence following «vest-overpants» or vertical Mayo repair of primary hernias of
the midline // World J. Surg. 1997. 21. (1). 62–65.
7. Егиев В.Н. Современное состояние и перспективы герниологии // Герниология. 2006. (2).
5–10.
Egiev V.N. Current state and prospects of herniology // Gerniologija. 2006. (2). 5–10.
8. Славин Л.Е., Федоров И.В., Сигал Е.И. Осложнения хирургии грыж живота. М.: Профиль,
2005. 176 с.
Slavin L.E., Feodorov I.V., Sigal E.I. Complications of stomach hernias surgery. М.: Profil`, 2005.
176 p.
9. Schumpelick V., Klinge U., Junge K. et al. Incisional abdominal hernia: the open mesh repair // Langenbecks Arch. Surg. 2004. 389. (1). 1–5.
THE METHOD OF NON-PULL RECONSTRUCTIVE SURGERY IN TREATMENT
OF PATIENTS WITH POSTOPERATIVE VENTRAL HERNIA
Konstantin Sergeevich KHOKHLOV1, Nadezhda Nikolaevna MIKHAILOVA2,
Vladimir Ivanivich KHALEPA1
1 Public
medical and preventive treatment facility «City Clinical Hospital №1»
654041, Novosibirsk, Bardin av., 30
2 Research
Institute for Complex Problems of Hygiene and Occupational Diseases SB RAMS
654041, Novokuznetsk, Kutuzov str., 23
The method of reconstructive surgery of hernias was developed for treatment of patients with postoperative ventral
hernias. The device for polypropylene fixing prosthesis was worked out. The nearest and remote results of treatment
of 46 patients were investigated. The distinctive feature of the offered method is that during operation polypropylene
prosthesis was fixed with sutures, which then were taken away in early postoperative period. The amount of common
postoperative complications was 6,5 %. Local postoperative complications were observed in 4,3 % of cases. The
relapse of disease has taken place in 4,9 %. The offered method allows arranging polypropylene prosthesis in front
of peritoneal space with reconstruction of all postoperative scars.
Key words: postoperative ventral hernia, hernioplasty, polypropylene prosthesis.
Khokhlov K.S. – head of the surgery department, e-mail: loser1973@yandex.ru
Mikhailova N.N. – doctor of biological sciences, professor, head of the laboratory for experimental hygienic
investigations
Khalepa V.I. – deputy chief doctor for surgery
102
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК 616.441–006
ФОНОВАЯ ПАТОЛОГИЯ ЩИТОВИДНОЙ ЖЕЛЕЗЫ КАК ПРОГНОСТИЧЕСКИЙ
ФАКТОР ЗАБОЛЕВАЕМОСТИ РАКОМ ЩИТОВИДНОЙ ЖЕЛЕЗЫ
Сергей Петрович ШЕВЧЕНКО1,2, Елена Владимировна КАРПИНСКАЯ2,
Сергей Васильевич СИДОРОВ1, Алексей Александрович ДЫМОВ2,
Денис Николаевич РОВЕНСКИХ2
1 ГОУ
ВПО Новосибирский государственный университет
630090, г. Новосибирск, ул. Пирогова, 2
2 МБУЗ
Городская клиническая больница № 1
630047, г. Новосибирск, ул. Залесского, 6, корп. 7
Рак щитовидной железы (РЩЖ) – самая часто встречаемая злокачественная опухоль органов эндокринной
системы. Важную роль в развитии РЩЖ играет наличие фоновых заболеваний в ткани щитовидной железы. Например, наличие аденоматозного зоба значительно повышает риск возникновения карциномы. Вопрос взаимосвязи рака и «фоновых» процессов является одним из основных в онкотиреоидологии, так как
он касается причинно-следственных отношений в канцерогенезе. По данным некоторых авторов, частота
раннего рака щитовидной железы на фоне неопластических заболеваний (аденома) составляет 65,1 %, при
хроническом тиреоидите – 18,9 %, при узловом зобе – 4,7 %. Без предшествующих изменений в ткани ЩЖ
рак диагностирован у 11,3 % пациентов. Возможность малигнизации доброкачественных узлов в настоящее
время отрицает ряд авторов, а случаи выявления рака в узлах ЩЖ, признанных коллоидными (по результатам тонкоигольной аспирационной биопсии), связывают с недостатками техники проведения биопсии или
ошибкой цитолога. Материал и методы. В нашей работе был проведен анализ 247 историй болезни пациентов, леченных в VI онкологическом отделении МБУЗ г. Новосибирска Городская клиническая больница № 1
(ГКБ № 1) по поводу рака щитовидной железы в период с 2005 по 2007 год включительно. Диагноз РЩЖ
был диагностирован на основании планового морфологического исследования, выполненного в патоморфологическом отделении больницы. Выводы. Процент аденоматозных изменений явно уменьшился по сравнению с данными прошлых лет (с 65,1 до 10,9 %). В 20,8 % случаях РЩЖ развился на фоне тиреотоксических
процессов, в 37,9 % − на фоне коллоидного зоба.
Ключевые слова: рак щитовидной железы, коллоидный узел, аденома.
Рак щитовидной железы (РЩЖ) – наиболее часто встречаемая злокачественная опухоль органов эндокринной системы. Удельный
вес ее в структуре онкологической патологии
составляет 1–3 %. В настоящее время отмечается неуклонный рост частоты возникновения
РЩЖ, особенно в зонах мультифакторного загрязнения окружающей среды. Во многих странах мира прирост заболеваемости увеличился в
1,3–2 раза за последние 5 лет [1, 2].
Важная роль в развитии РЩЖ принадлежит
фоновым заболеваниям в ткани щитовидной же-
лезы. Так, наличие аденоматозного зоба значительно повышает риск возникновения карциномы.
Под термином «узел» в клинической практике подразумевается новообразование в щитовидной железе любого размера, имеющее
капсулу, определяемое пальпаторно либо при
помощи любой визуализирующей методики.
Этим термином объединяют наиболее часто
встречающийся узловой коллоидный, в разной
степени пролиферирующий зоб, фолликулярную аденому, «псевдоузлы» при аутоиммунном
Шевченко С.П. – к.м.н., доцент кафедры хирургических болезней, медицинского факультета Новосибирского государственного университета, зав. VI онкологическим отделением Муниципального бюджетного
учреждения здравоохранения г. Новосибирска Городская клиническая больница № 1,
e-mail: shevchenko_sp@mail.ru
Карпинская Е.В. – врач-онколог VI онкологического отделения, e-mail: lena-len@mail.ru
Сидоров С.В. – д.м.н., проф., зав. кафедрой хирургических болезней, e-mail: svsidorov@yandex.ru
Дымов А.А. – врач-онколог VI онкологического отделения, e-mail: alex.dim.2006@rambler.ru
Ровенских Д.Н. – врач-онколог VI онкологического отделения, e-mail: rovenskihd@mail.ru
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
103
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Шевченко С.П., Карпинская Е.В., Сидоров С.В. и др. Фоновая патология щитовидной… /c. 103–107
тиреоидите, различные варианты РЩЖ и ряд
других заболеваний.
В последние годы активное использование
ультразвуковых аппаратов с высокой разрешающей способностью увеличило выявляемость
узлового зоба. Оказалось, что узлы определяются у 34,7–67 % обследованного населения.
Количество пациентов с узловым зобом возрастает в пожилом возрасте, когда узлы при УЗИ
выявляют у подавляющего большинства обследованных [3].
Папиллярный рак, будучи ведущим морфологическим вариантом РЩЖ, составляет, по
разным данным, от 55 до 75 % от всех случаев
заболевания. Наиболее агрессивный вариант,
анапластический рак щитовидной железы, обнаруживают не более чем в 1–4 % наблюдений,
оставляя, таким образом, на долю фолликулярной и медуллярной карциномы соответственно
по 15–20 и 3–7 % [4]. В 10 % случаев папиллярный рак вызывает развитие отдаленных метастазов, для фолликулярного рака этот показатель составляет 25 % [4].
В ряде регионов России, Украины и Белоруссии рост заболеваемости РЩЖ в 80–90-е
годы связывают с последствиями аварии на
Чернобыльской АЭС [5]. Это во многом связано
с выбросом большого количества радиоактивного йода (I131) на пострадавшие территории [6].
Среди причин увеличения количества случаев
РЩЖ считают необоснованно широкое использование лучевых методов лечения и диагностики в 30–40-е годы [7]. Остается актуальным
вопрос о дефиците йода в употребляемой пище
и влиянии этого фактора на заболеваемость
РЩЖ [8].
За прошедшее столетие выдвигалось несколько концепций происхождения РЩЖ. Многие из них получили экспериментальное и клиническое подтверждение, некоторые интересны
сегодня лишь в историческом аспекте.
Вопрос взаимосвязи рака и «фоновых»
процессов является весьма важным в онкотиреоидологии, так как он касается причинно-следственных отношений в канцерогенезе.
Установлено, что дефицит йода в организме
служит основной причиной гиперплазии щитовидной железы. Обычно такая гиперплазия является компенсаторной, но иногда становится
необратимой. Этому процессу могут способствовать также факторы, блокирующие синтез
тиреоидных гормонов. Таким образом, развитию злокачественных новообразований в железе нередко предшествуют узловой зоб, диффуз-
104
ная и узловая гиперплазии, доброкачественные
аденомы [9].
В настоящее время широко обсуждаются
особенности клинического проявления рака
щитовидной железы и возможности дооперационной диагностики «малого» рака, т. е. опухолей размерами до 1,0 см на фоне неизмененной
либо зобно-трансформированной железы [8].
Встречается тиреоидитоподобная форма рака
ЩЖ, по клиническому течению весьма схожая
с тиреоидитом Хашимото или зобом Риделя.
По данным некоторых авторов [4], частота
малого рака щитовидной железы на фоне неопластических заболеваний (аденома) составляет
65,1 %, при хроническом тиреоидите – 18,9 %,
при узловом зобе – 4,7 %. Без предшествующих
изменений в ткани ЩЖ рак диагностирован у
11,3 % обследованных. Таким образом, наиболее часто ранний рак выявляется на фоне аденом и аденоматоза щитовидной железы, однако
и гиперпластические заболевания могут быть
фоновыми для развития злокачественной опухоли щитовидной железы (в 23,6 % случаев).
Это доказывает необходимость морфологической верификации любого узлового новообразования в щитовидной железе.
Возможность малигнизации доброкачественных узлов в настоящее время отрицает ряд
авторов, а случаи выявления рака в узлах ЩЖ,
признанных коллоидными (по результатам тонкоигольной аспирационной биопсии) связываются с недостатками техники проведения биопсии или ошибкой цитолога [10, 11].
Цель нашего исследования − выявление фоновых изменений, которые могут привести к
развитию РЩЖ.
МАТЕРИАЛ И МЕТОДЫ
Исследование проводилось на базе VI онкологического отделения МБУЗ г. Новосибирска
ГКБ № 1. Выполнен анализ 247 историй болезни пациентов, леченных по поводу РЩЖ в
период с 2005 по 2007 год включительно. Диагноз был установлен на основании планового
морфологического исследования щитовидной
железы, проведенного в патоморфологическом
отделении больницы. На дооперационном этапе использовали определение уровней тиреоидных гормонов (тироксина, трийодтиронина,
тиреотропина), ультразвуковое исследование
ЩЖ, тонкоигольную аспирационную биопсию
под контролем УЗИ, сцинтиграфию, магнитнорезонансную томографию.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Шевченко С.П., Карпинская Е.В., Сидоров С.В. и др. Фоновая патология щитовидной… /c. 103–107
Таблица 1
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
РЩЖ диагностирован у 218 (88,3 %) женщин и 29 (11,7 %) мужчин. Возраст больных составил от 17 до 78 лет у женщин и от 25 до 66
лет у мужчин, пик заболеваемости приходился
на возраст от 50 до 59 (29,5 % пациентов).
При анализе гистологических заключений
по поводу фоновой патологии возник ряд проблем.
Во-первых, пришлось исключить часть больных в связи с недостаточной информацией о
фоновом процессе. Некоторые гистологические
заключения были столь лаконичны, что позволяли говорить лишь о варианте РЩЖ.
Во-вторых, не существует единого мнения
среди морфологов о наличии или отсутствии
фона, на котором развился РЩЖ.
Нами установлено, что фоновой патологией
практически в 100 % случаев являются коллоидный зоб, токсический зоб, аденомы, аутоиммунный тиреоидит и фолликулярные опухоли
(табл. 1).
Обращает на себя внимание следующее.
Процент аденоматозных изменений явно
уменьшился по сравнению с данными прошлых
лет (с 65,1 до 10,9 %). Это можно объяснить тем,
что в настоящий момент аденома считается облигатным предраковым заболеванием, вследствие чего во всем мире принята агрессивная
тактика при ее диагностировании. Таким образом, удельный вес РЩЖ на фоне аденом резко
снизился. И это позволяет говорить о том, что
выбранная тактика уменьшила количество случаев малигнизации аденоматозных узлов.
Фоновые процессы у обследованных
больных РЩЖ
Количество пациентов
Абсолютное
%
Фоновая патология
Коллоидный зоб
Токсический зоб
Аденомы
Аутоиммунный тиреоидит
Фолликулярная опухоль
Зоб Хашимото
Гюртлеклеточная опухоль
Зоб Риделя
Зоб де Кервена
ВСЕГО
69
38
20
20
14
12
7
1
1
182
37,91
20,88
10,99
10,99
7,69
6,59
3,85
0,55
0,55
100,0
Ранее считалось, что РЩЖ на фоне тиреотоксического заболевания (особенно с тиреотоксическими кризами) развивается крайне редко – в 1,5 % случаев. В последние годы
появилась информация, что это далеко не так.
Наше исследование показывает, что в 20,8 %
случаев РЩЖ формируется на фоне тиреотоксикоза. Следует отметить, что не во всех случаях тиреотоксический процесс сопровождался
клинической картиной и даже лабораторными
изменениями.
И, конечно, следует обратить внимание на
коллоидный зоб как фоновое заболевание, который встречается у 37,9 % пациентов с РЩЖ.
По литературным источникам, коллоидный зоб
как фоновый процесс составляет всего 4,7 %.
Почему же наши данные столь существенно
Таблица 2
Зависимость формы РЩЖ и фонового процесса
Форма РЩЖ, n (%)
Фоновый процесс
Коллоидный зоб
Аутоиммунный
тиреоидит
Аденомы
Зоб Хашимото
Гюртлеклеточная
опухоль
Зоб Риделя
Токсический зоб
Фолликулярная
опухоль
Зоб де Кервена
ВСЕГО
Папиллярный рак Фолликулярный рак Медуллярный рак
Низкодифференцированный рак
ВСЕГО
49 (26,92)
17 (9,34)
1 (0,55)
2 (1,10)
69 (37,9)
15 (8,24)
4 (2,20)
1 (0,55)
0 (0,00)
20 (10,9)
6 (3,30)
7 (3,85)
13 (7,14)
3 (1,65)
0 (0,00)
2 (1,10)
1 (0,55)
0 (0,00)
20 (10,9)
12 (6,59)
5 (2,75)
2 (1,10)
0 (0,00)
0 (0,00)
7 (3,85)
1 (0,55)
20 (10,99)
0 (0,00)
14 (7,69)
0 (0,00)
4 (2,20)
0 (0,00)
0 (0,00)
1 (0,55)
38 (20,8)
11 (6,04)
3 (1,65)
0 (0,00)
0 (0,00)
14 (7,69)
1 (0,55)
115 (63,18)
0 (0,00)
56 (30,76)
0 (0,00)
8 (4,39)
0 (0,00)
3 (1,60)
1 (0,55)
182 (100)
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
105
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Шевченко С.П., Карпинская Е.В., Сидоров С.В. и др. Фоновая патология щитовидной… /c. 103–107
отличаются от результатов других исследователей?
Во-первых, ряд специалистов считает, что
РЩЖ может развиваться в неизмененной ЩЖ,
т. е. на фоне абсолютного благополучия возникает злокачественный процесс. Тогда остается
открытым вопрос о мультицентричном росте
РЩЖ. Морфологи ГКБ № 1 г. Новосибирска
считают, что для развития РЩЖ необходима
предшествующая патология. Мы поддерживаем
данную точку зрения.
Во-вторых, возможно, данный факт отражает некую региональную особенность. Действительно, месторасположение региона имеет
важное значение: наш город находится в эндемичном районе по развитию заболеваний ЩЖ.
И, несмотря на постоянную профилактику, заболеваемость все же не уменьшается.
Однако все перечисленные факторы не могут объяснить того факта, что частота развития РЩЖ на фоне коллоидного зоба в нашем
исследовании более чем в 2 раза выше, нежели
обнаруженная другими авторами. Возможно,
что многие исследователи исходили из того,
сколько случаев РЩЖ выявлено среди всех пациентов с коллоидным зобом, мы же анализировали, какова встречаемость коллоидного зоба
как фоновой патологии при РЩЖ.
В нашем исследовании функция ЩЖ у
37,9 % больных определена как эутиреоидная,
у 18,7 % гипотиреоидная, у 20,9 % − как гипертиреоидная. Аденомы и фолликулярные опухоли составили 22,5 %. В табл. 2 представлена
зависимость между видами РЩЖ и фоновыми
патологиями.
Установлено, что коллоидный зоб в 42,6 %
случаев является фоновой патологией для папиллярного рака.
ВЫВОДЫ
1. Отмечен рост заболеваемости РЩЖ г. Новосибирске за период 2005–2007 гг. в 1,4 раза.
2. Впервые на основе собственного материала проанализирована фоновая патология как
этиологический фактор возникновения РЩЖ.
Установлено, что наиболее частыми фоновыми
процессами являются коллоидный зоб, токсический зоб, аденомы и аутоиммунный тиреоидит.
3. Уменьшение заболеваемости РЩЖ на
фоне аденоматозного узла связано с агрессивной тактикой в отношении аденом и признание
их как облигатного предрака.
4. Тиреотоксикоз не является гарантией от
возникновения РЩЖ и встречается у 20,8 %
больных РЩЖ.
106
5. Необходимо признать, что коллоидный
зоб является фоновой патологией возникновения РЩЖ.
СПИСОК ЛИТЕРАТУРЫ
1. Зинкевич О.И., Зинкевич И.В., Кудинов В.И.
Рак щитовидной железы в Ростовской области //
Актуальные проблемы современной эндокринологии: тез. IV Всерос. конгресса эндокринологов.
СПб., 2001. 303.
Zinkevich O.I., Zinkevich I.V., Kudinov V.I. Thyroid cancer in Rostov district // Actual problems of
modern endocrinology: Proceedings of IV All-Russian Congress of endocrinologists. SPb., 2001. 303.
2. Reiners C., Farahati J. 131I therapy of thyroid
cancer patients // Quart. J. Nucl. Med. 1999. 43. (4).
324 – 335.
3. Ezzat S., Sarti D.A., Cain D.R. et al. Thyroid
incidentalomas: prevalence by palpation and ultrasonography // Arch. Intern. Med. 1994. 154. 1838–
1840.
4. Подвязников С.О. Рак щитовидной железы
(клиника, диагностика, лечение) // Рус. мед. журн.
1998. (6). 658–664.
Podvyaznikov S.O. Thyroid cancer (clinical
picture, diagnostics, treatment) // Rus. med. zhurn.
1998. (6). 658–664.
5. Комисаренко И.В., Рыбаков С.И., Коваленко А.Е. Рак щитовидной железы у детей и подростков Украины после аварии на Чернобыльской
АЭС // Современные аспекты хирургической эндокринологии: тез. VIII Рос. симп. по хирургич.
эндокринологии. Казань; М., 1999. 180–184.
Komisarenko I.V., Rybakov S.I., Kovalenko A.E.
Thyroid cancer in children and adolescents of Ukraine
after Chernobyl NPP accident // Modern aspects of
surgical endocrinology: Proceedings VIII All-Russian symposium on surgery endocrinology. Kazan;
M., 1999. 180–184.
6. Williams D. Thyroid cancer and the Chernobyl accident // J. Clin. Endocr. Metab. 1996. 81. (1).
6–7.
7. Robbins J., Merino M.J., Boice J.D. et al. Thyroid cancer: A lethal endocrine neoplasm // Ann. Intern. Med. 1991. 115. (2). 133–147.
8. Ron E., Modan B. Benign and malignant thyroid neoplasms after childhood irradiation for tinea
capitis // J. Natl. Cancer Inst. 1980. 65. 7–11.
9. Пачес А.И., Пропп Р.М. Рак щитовидной железы. 2-е изд., перераб. и доп. М.: Центр внедрения достижений науки и техники «Москва», 1995.
370 с.
Paches A.I., Propp R.M. Thyroid cancer. 2nd
edition. M.: Center of implementation of achievements
of science and technique «Moscow», 1995. 370 p
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Шевченко С.П., Карпинская Е.В., Сидоров С.В. и др. Фоновая патология щитовидной… /c. 103–107
10. Gharib H., Papini E., Valcavi R. et al. American Association of Clinical Endocrinologists and Associazione Medici Endocrinologi medical guidelines
for clinical practice for the diagnosis and manage-
ment of thyroid nodules // Endocr. Pract. 2006. 12.
63–102.
11. Hamburger J.I. Diagnosis of thyroid nodules
by fine needle biopsy: use and abuse // J. Clin. Endocrinol. Metab. 2004. 79. 335–339.
BACKGROUND PATHOLOGY OF THE THYROID GLAND —
AS A PROGNOSTIC FACTOR OF THYROID CANCER MORBIDITY
Sergey Petrovich SHEVCHENKO1, 2, Elena Vladimirovna KARPINSKAYA2,
Sergey Vasil’evich Sidorov1, Aleksey Aleksandrovich DYMOV2,
Denis Nikolaevich ROVENSKIKH2
1 Novosibirsky
State University
630090, Novosibirsk, Pirogov str., 2
2 City
Clinical Hospital № 1
630047, Novosibirsk, Zalessky str., 6, bd. 7
Thyroid cancer (TC) is the most common malignant tumor of the endocrine system. The presence of background
diseases in the thyroid gland plays a key role in the development of thyroid cancer. For example, the presence of
adenomatous goiter significantly increases the risk of carcinoma. The problem on the interconnection between cancer and «background» processes is a principal item in thyroidology as it deals with the cause–and–effect relations
in carcinogenesis. According to the data from several authors the occurrence of early cancer of the thyroid gland
against the background of other diseases is as follows: neoplastic diseases (adenoma) – 65.1 %, chronic thyroiditis – 18.9 %, nodular goiter – 4.7 %. The cancer was diagnosed in 11.3 % patients without prior changes in thyroid
gland tissue. The possibility of malignancy of benign nodes now has been denied by several authors, while the cases
of cancer disclosure in thyroid nodes recognized as colloid (subsequent to the results of FNA) have been associated
with deficiencies of biopsy technique, or with a cytologist inaccuracy. Materials and methods. 247 medical cases of
the patients treated in the VI oncologic department of Novosibirsk Municipal Clinical Hospital № 1 for cancer of the
thyroid gland during the period from 2005 up to and including 2007 have been analyzed. The diagnosis of thyroid
cancer was made on the basis of the planned histological study carried out in the pathologic department of the hospital. Conclusions. The percentage of adenomatous changes obviously decreased compared with the previous years
data (from 65.1 % to 10.9 %). The thyroid cancer developed in 20.8 % of cases against the background of thyrotoxic
processes, and in 37.9 % of cases – against the background of colloid goiter.
Key words: thyroid cancer, colloidal node, adenoma.
Shevchenko S.P. – candidate of medical sciences, associate professor of the chair for surgery diseases, head of
the VI oncological department, e-mail: shevchenko_sp@mail.ru
Karpinskaya E.V. – oncologist of of the VI oncological department, e-mail: lena-len@mail.ru
Sidorov S.V. – doctor of medical sciences, professor, head of the chair for surgery diseases,
e-mail: svsidorov@yandex.ru
Dymov A.A. – oncologist of the VI oncological department, e-mail: alex.dim.2006@rambler.ru
Rovenskikh D.N. – oncologist of the VI oncological department, e-mail: rovenskihd@mail.ru
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
107
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК: 612.821+612.822.3
ДИНАМИКА РЕАКТИВНОСТИ ОСЦИЛЛЯТОРОВ ГОЛОВНОГО МОЗГА
И АРТЕРИАЛЬНОГО ДАВЛЕНИЯ В ОБОРОНИТЕЛЬНОМ РЕФЛЕКСЕ СЕРДЦА
У БОЛЬНЫХ С ГИПЕРТОНИЕЙ
Любомир Иванович АФТАНАС, Ольга Михайловна ГИЛИНСКАЯ,
Иван Викторович БРАК, Сергей Валентинович ПАВЛОВ, Наталия Владимировна РЕВА
НИИ физиологии СО РАМН
630117, г. Новосибирск, ул. Тимакова, 4
Цель работы. Оборонительный рефлекс сердца (ОРС) характеризуется динамическим профилем специфических изменений артериального давления (АД) и частоты сердечных сокращений (ЧСС) в ответ на интенсивный безусловный аверсивный раздражитель и отражает активацию оборонительной мотивационной
системы и программ оборонительного копинга. Цель настоящего исследования – в условиях активации оборонительной мотивационной системы в модели ОРС по данным анализа динамики кардиоваскулярной реактивности и сопутствующей осцилляторной активности различных областей коры головного мозга оценить
роль осцилляторных систем мозга в патогенетических механизмах нарушения центральной регуляции кардиоваскулярной стресс-реактивности у пациентов с артериальной гипертонией (АГ). Материал и методы.
Исследованы здоровые испытуемые (n = 19) и пациенты с впервые выявленной артериальной гипертонией
1–2 степени без лечения (n = 17). Использовали сочетанную динамическую регистрацию 64-канальной ЭЭГ
и «поударного» («beat-by-beat») артериального давления (систолического и диастолического, САД и ДАД)
во время индукции трех последовательных ОРС. Осцилляторную динамику оценивали с помощью технологии вызванной синхронизации/десинхронизации ЭЭГ в различных частотных диапазонах. Результаты. По
данным анализа осцилляторной активности ЭЭГ впервые установлено, что в ОРС длиннолатентное повышение АД у пациентов характеризовалось отсутствием фазы вызванной альфа-2-синхронизации (10–12 Гц)
в центральном и центрально-теменном участках коры обоих полушарий мозга. Напротив, у здоровых фаза
альфа-2-синхронизации в этих же областях коры сопутствовала периоду сниженной длиннолатентной реактивности АД. Заключение. Высокочастотные альфа-осцилляторы центрально-теменной коры вовлекаются
в механизмы центрального нисходящего («top-down») тормозного контроля стресс-реактивности АД, а АГ
характеризуется ослаблением активности этих механизмов.
Ключевые слова: осцилляторная активность мозга, электроэнцефалограмма (ЭЭГ), высокочастотные
альфа-осцилляции (10–12 Гц), эмоции, оборонительная мотивационная система, система борьбы-бегства, оборонительный рефлекс сердца, кардиоваскулярная реактивность, нелеченная артериальная гипертония.
В традиционных подходах к изучению
стресс-реактивности и риска возникновения
АГ и ИБС главное внимание акцентируется
на периферических индикаторах реактивности
(изменения АД, вариабельности ритма сердца
и пр.) и их ассоциациях с будущими заболеваниями. По данным мета-анализа проспективных когортных исследований, повышенная
стресс-реактивность и замедленное восстановление АД на лабораторные стрессоры достоверно предсказывает ухудшение общего кардиоваскулярного статуса, увеличение толщины
intima media и частоты возникновения АГ [5].
Однако данные о нейробиологических механизмах взаимодействий в системе «мозг–тело»,
сопрягающих обработку острых стрессоров в
центральной нервной системе с периферическими проявлениями кардиоваскулярных реакций и связанных с риском развития АГ и ИБС,
до настоящего времени представлены лишь в
единичных исследованиях [12, 13, 17]. Между
тем сведения о механизмах нейровисцеральной
интеграции и их нарушениях необходимы для
развития ориентированных на функции мозга
Афтанас Л.И. – д.м.н., проф., академик РАМН, зав. лабораторией психофизиологии,
e-mail: l.aftanas@physiol.ru
Гилинская О.М. – зав. отделением клиники, e-mail: olga.gilinskaya@gmail.com
Брак И.В. – научный сотрудник лаборатории психофизиологии, e-mail: brack@physiol.ru
Павлов С.В. – старший научный сотрудник лаборатории психофизиологии, e-mail: pavlov@physiol.ru
Рева Н.В. – старший научный сотрудник лаборатории психофизиологии, e-mail: n.v.reva@physiol.ru
108
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Брак И.В. и др. Динамика реактивности осцилляторов… /c. 108–121
стратегий терапии, предсказания и стратификации риска АГ и ИБС [19].
Практически невостребованный подход для
решения данной проблемы – анализ механизмов сопряжения активности мотивационных
систем мозга – аверсивной/оборонительной и
положительного подкрепления, инициирующих каскады когнитивных, эмоциональных,
вегетососудистых и моторных реакций [14, 22].
Поскольку кардиоваскулярная активность является ведущим эффектором мотивационной
активности, характер облигатных «подстроек» гемодинамики к выбранным программам
адаптивного поведения определяется работой
механизмов нейровисцеральной интеграции,
эффективность которых варьирует в норме и
нарушается при АГ и ИБС [31, 32].
Настоящее исследование посвящено изучению механизмов оборонительного поведения
у больных эссенциальной гипертонией (ЭГ).
Одной из важнейших эмоций для выживания
является страх – аверсивное эмоциональное
состояние, вызванное сигналами угрозы, активирующими
аверсивную/оборонительную
мотивационную систему. С помощью реакций
обездвиженности или активной обороны система готовит организм к конфронтации с угрозой [14]. Оценка реактивности этой системы
основывается на психофизиологическом тесте
кардиоваскулярной реактивности, в котором
предъявление неожиданного дискретного аверсивного (акустического или болевого электрического) раздражителя вызывает специфический профиль гемодинамических изменений
(прежде всего, ритма сердца), известный как
«оборонительный рефлекс сердца» («cardiac
defense response», ОРС) [35]. ОРС длится на
протяжении 80 с и, по отношению к исходному уровню, включает коротко- и длиннолатентный комплексы ускорения/замедления ЧСС.
По данным вегетативного контроля, в профиле
ОРС во время первого коротколатентного ускорения/замедления ЧСС доминирует парасимпатическая активность, а симпато-парасимпатические реципрокные взаимодействия с преобладанием симпатической активации связаны
с длиннолатентным ускорением/замедлением.
Нами ранее было установлено, что профиль
изменений АД во многом повторяет динамику
ЧСС, но со сдвигом во времени: в коротколатентном сегменте ОРС подъем АД соответствует первому замедлению ЧСС, в длиннолатентном – повышение АД соответствует периоду
второго замедления ЧСС [2]. С точки зрения
когнитивно-мотивационных процессов, коротБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
колатентный комплекс изменений ЧСС и АД
связан с привлечением механизмов внимания к
стимулу, а длиннолатентный – с фазой активной обороны [35].
В ОРС наибольший клинический интерес
представляют комплексы длиннолатентного
увеличения ЧСС и АД, отражающие активацию
аверсивной мотивационной системы и сопутствующую мобилизацию ресурсов и программ
оборонительного копинга [2, 33, 35]. Интерес
обусловлен тем, что у здоровых длительная во
времени повышенная активация мотивационной оборонительной системы поведения выступает в качестве «эффективного» патогенетического механизма повышения и удержания АД на
уровне аномальных значений с последующим
развитием ЭГ и ИБС [5, 21, 29]. А в клинике ЭГ
гиперактивность аверсивной мотивационной
системы может лежать в основе резистентных
форм заболевания, в том числе с неблагоприятной суточной динамикой АД («non-dipper»,
«riser») [23].
С учетом изложенного выше была сформулирована следующая цель исследования: в
условиях активации оборонительной мотивационной системы в модели оборонительного
рефлекса сердца, по данным анализа динамики
кардиоваскулярной реактивности и сопутствующей осцилляторной активности различных
областей коры головного мозга, оценить роль
осцилляторных систем мозга в патогенетических механизмах нарушения центральной регуляции кардиоваскулярной стресс-реактивности
у пациентов с АГ.
В качестве индикатора мозговой активности в работе исследовали осцилляторную
активность ЭЭГ, которая адекватно отражает
вовлечение мозговых специализированных систем в механизмы когнитивно-эмоциональной
активации и нейровисцеральной интеграции, a
системы изучали по данным непрерывной регистрации «поударных» значений АД и других
гемодинамических показателей с помощью технологии Finapres®.
МАТЕРИАЛ И МЕТОДЫ
В исследовании приняли участие 17 контрольных (здоровых) испытуемых (КИ) и 19 пациентов с впервые выявленной АГ без лечения.
Все – мужчины, правши, с индексом массы тела
≤ 30 кг/м2. Измерение «офисного» артериального давления проводили методом Короткова
с помощью механического тонометра Microlife
BP AG1-10 (Швейцария) и фонендоскопа в положении сидя трехкратно с интервалом 5 минут.
109
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Брак И.В. и др. Динамика реактивности осцилляторов… /c. 108–121
В исследование не включались индивиды с показателями АД, соответствующими, согласно
классификации Европейского общества кардиологов, критериям артериальной гипертонии
1–2-й степени (САД > 140 мм рт. ст.; ДАД > 90
мм рт. ст.).
Группа АГ включала ранее не леченных
пациентов или прекративших прием гипотензивных препаратов более чем за две недели до
включения в исследование. На исследование
было получено разрешение этического комитета НИИ физиологии СО РАМН.
С помощью опросников у каждого испытуемого оценивались уровни личностной тревожности (STAI), депрессивности (BDI), алекситимии (TAS), агрессивности (STAXI), экстраверсии, нейротизма, психотизма, социальной
желательности (EPQ), преобладания положительных или отрицательных эмоций (PANAStrait), а также активности систем активации и
торможения поведения (BIS/BAS). Для оценки
концентраций тромбоцитарного (тромбоциты/
мл) и плазменного (нмоль/л) серотонина (5-HT)
использовался метод высокоэффективной жидкостной хроматографии с элетрохимической
детекцией [3].
ОРС вызывали с помощью предъявления
трех последовательных интенсивных звуковых
стимулов (белый шум 115 дБ SPL, длительность
1000 мс, мгновенное нарастание и падение
фронтов) с фиксированным межстимульным интервалом 110 с [2]. ЭЭГ (62 канала, полоса пропускания 0,3–120,0 Гц, 6 дБ, ≥ 12 дБ/октаву, частота дискретизации 1000 Гц) регистрировали
монополярно с помощью программы BrainProduct Acquisition 1.1 и многоканального усилителя
QuickAmp (Brain Product GmBh, Германия) и
модифицированной 64-канальной шапочки со
встроенными Ag/AgCl электродами (QuikCap,
NeuroSoft Inc., США). Референтный электрод
располагался на кончике носа, заземляющий —
в центре лба. Поддерживалось сопротивление
≤ 5 кОм. Для контроля глазодвигательных артефактов регистрировались вертикальная и
горизонтальная электроокулограммы. Электрокардиограмму (ЭКГ) и кожно-гальваническую
реакцию (КГР) регистрировали согласно ранее
описанной технологии [4]. Для характеристики кожно-гальванической реакции использовали два показателя – количество и амплитуду
(мкСм) спонтанных реакций в заданном интервале (критерий наличия реакции: амплитуда
> 0,02 мкСм при скорости роста > 0,01 мкСм/с).
Для нормализации данных амплитуды КГР проводили логарифмирование исходных значений
(lg[КГР(А)+1]). Синхронно с ЭЭГ непрерывную
110
регистрацию АД осуществляли способом Penaz
(«volume-clump») при помощи монитора FinometerTM (Finapres Medical System BV, Нидерланды)
и наложенной микроманжеты на среднем пальце левой руки обследуемого. Поударные («beatby-beat») значения гемодинамических показателей определяли off-line с помощью пакета лицензионных алгоритмов Beatscope 1.1 (Finapres
Medical System BV). Рассчитывали следующие
показатели: САД и ДАД, ударный объем (УО),
сердечный выброс (СВ) и общее периферическое сопротивления сосудов (ОПСС).
Под визуальным контролем и с помощью метода анализа независимых компонент
(Independent Components Analysis, ICA) проводили коррекцию глазодвигательных, миографических и других артефактов. Показатели активности постстимульной ЭЭГ преобразовывали в значения вызванной синхронизации/десинхронизации ЭЭГ (ВД/ВС), рассчитываемой как
разность мощностей в пост- и предстимульном
интервалах, выраженная в процентах к мощности в предстимульном интервале. Предстимульный (референтный) интервал включал
период времени –15…0 с, а четыре постстимульных – 1,5–20 (первые 1,5 с постстимульной
ЭЭГ, артефактные у большинства испытуемых,
исключались из анализа), 20–50, 50–70, 70–95 с.
Анализ ВД/ВС ЭЭГ, сопутствующей вызываемым ОРС, проводили в 9 частотных диапазонах: дельта (2–4 Гц), тета-1 (4–6 Гц), тета-2
(6–8 Гц), альфа-1 (8–10 Гц), альфа-2 (10–12 Гц),
альфа-3 (12–14 Гц), бета-1 (14–20 Гц), бета-2
(20–30 Гц) и гамма (30–45 Гц). Показатели ВД/
ВС для отдельных отведений усредняли в пределах 24 топографических зон, формирующих
3 фактора – Каудальность (6: лобные – F, лобно-центральные – FC, центральные – C, центрально-теменные – CP, теменные – P, теменнозатылочные – PO), Сагиттальность (2: медиальные, латеральные), Полушарие (2: левое полушарие, правое полушарие) (табл. 1). ВД/ВС ЭЭГ
каждого диапазона подвергали 6-факторному
дисперсионному анализу по схеме Группа (ГР
2: КИ, АГ) × ОРС (ОРС 2: ОРС № 1, ОРС № 3)
× Время (ВР 4: 1.5–20, 20–50, 50–70, 70–95 с)
× Каудальность (КАУД 6: F, FC, C, CP, P, O) ×
Полушарие (ПШ 2: левое, правое) × Саггитальность (САГ 2: медиальная и латеральная кора)
с повторными измерениями по 5 последним
факторам. В случае необходимости проводили
модифицированный дисперсионный анализ и
сравнения средних с помощью критерия Стъюдента, а также коррекцию значений уровней
статистической достоверности с помощью поправок Гринхауза – Гейссера. Апостериорный
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Брак И.В. и др. Динамика реактивности осцилляторов… /c. 108–121
Таблица 1
Топография 24 электродных кластеров, сформированных из одиночных электродных отведений
в латеральной и медиальной коре левого и правого полушарий головного мозга
Зоны коры
Латеральная
Медиальная
F
FC
C
CP
P
PO
F
FC
C
CP
P
PO
анализ выполняли с помощью теста Тьюки и
плановых сравнений.
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
Основные антропометрические, физиологические и психометрические характеристики
в группах здоровых (КИ) и пациентов (АГ)
представлены в табл. 2. Как видно из таблицы, по показателям возраста и индекса массы
тела группы не различались. Офисное АД у КИ
было в пределах нормы, а у пациентов превышало нормативные значения. На личностном
уровне пациенты характеризовались повышенными показателями системы активации поведения и ее субшкалы «подкрепление», негативизма, враждебности, чувства вины, обиды. У
пациентов также установлены достоверно более низкие концентрации тромбоцитарного серотонина (см. табл. 2).
ОРС: динамика кардиоваскулярной реактивности. Средние значения гемодинамических показателей в предстимульные и постстимульные периоды трех последовательных ОРС
представлены на рис. 1 и 2, а результаты 2-факторного дисперсионного анализа с факторами
Группа (ГР 2: КИ, АГ) × ОРС (ОРС 3: № 1, № 2
и № 3) – в табл. 3.
Как видно на рис. 1, в отличие от здоровых, пациенты с АГ в предстимульный период ожидания неизбегаемого аверсивного раздражителя, реализующего повторные ОРС, на
фоне достоверно более высоких фоновых показателей демонстрируют повышенную реактивность САД и ДАД. Об этом свидетельствуют
данные общего факторного анализа (см. табл.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Левое полушарие
Правое полушарие
AF7, F7, F5
FT7, FC5
T7, C5
TP7, CP5
P7, P5
PO7, O1
F3, F1
FC3, FC1
C3, C1
CP3, CP1
P3, P1
PO5, PO3
F6, F8, AF8
FC6, FT8
C6, T8
CP6, TP8
P6, P8
O2, PO8
F2, F4
FC2, FC4
C2, C4
CP2, CP4
P2, P4
PO4, PO6
3), а также взаимодействие ГР × ОРС и эффекты
фактора ОРС при раздельном анализе для группы АГ (САД: F(2,36) = 20, 67, p < 0,001; среднее АД, СрАД: F(2,36) = 16,73, p < 0,001; ДАД:
F(2,36) = 13,38, p < 0,001). ОПСС также было
достоверно выше у пациентов (фактор ГР), но
реактивность показателя в целом не зависела от
порядкового номера ОРС (см. рис. 1).
В постстимульный период ОРС № 1 пациенты также характеризовались достоверно большей реактивностью коротколатентной и длиннолатентной реактивности АД – соответственно, абсолютные максимумы первого подъема
САД (F(1,34) = 8,18, p < 0,007) и СрАД (F(1,34)
= 7,09, p < 0,012) и усредненные по интервалу
40–80 с значения второго подъема САД и ДАД
(взаимодействие ГР × ОРС) (см. рис. 2).
В целом для большинства исследованных
показателей в группах здоровых лиц и пациентов с АГ наблюдается угашение повторно вызываемых ОРС – в ОРС № 3 коротко- и длиннолатентные индикаторы кардиоваскулярной
реактивности были достоверно меньше, чем в
ОРС № 1 (см. рис. 2, табл. 3 – фактор ОРС).
ОРС: динамика сопутствующей осцилляторной активности ЭЭГ. Среди всех исследованных диапазонов ЭЭГ только в альфа-2-полосе выявлены особенности осцилляторной динамики, связанные с повышенной длиннолатентной реактивностью АД у пациентов (рис. 3).
Достоверные взаимодействия, включающие
фактор Группа (ГР × ВРЕМЯ × САГИТ: F(3, 102)
= 3,64; p < 0,032 и ГР × ВР × КАУД × САГИТ:
F(15, 510) = 2,85; p < 0,033), а также приближающиеся к достоверности взаимодействия с факторами ОРС (ГР × ОРС × ВР: F(3, 102) = 2,55;
111
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Брак И.В. и др. Динамика реактивности осцилляторов… /c. 108–121
Таблица 2
Антропометрические, психометрические и гуморальные показатели испытуемых в группах КИ и АГ
КИ
(n = 17)
M(SD)
АГ
(n = 19)
M(SD)
t
p
САД, мм рт. ст. (офис)
ДАД, мм рт. ст. (офис)
Возраст, лет
Индекс массы тела
127,2 (12,5)
81,5 (5,21)
36,5 (7,14)
25,90 (3,84)
146,8 (11,3)
98,5 (8,37)
38,9 (7,79)
26,17 (2,80)
–4,865
–7,239
–0,920
–0,229
0,000
0,000
0,364
0,820
Ситуативная тревожность
37,38 (6,48)
40,11 (9,09)
–0,005
0,322
41,75 (8,05)
45,95 (6,43)
–1,714
0,096
0,56 (0,96)
8,87 (4,67)
7,38 (3,93)
6,56 (3,60)
16,73 (4,12)
4,67(1,23)
4,26 (1,75)
4,80 (2,24)
2,07 (1,33)
3,27 (1,53)
4,47 (1,96)
6,53(1,51)
4,33 (2,02)
7,73(2,91)
16,00(3,63)
15,75 (2,84)
23,44 (2,14)
1,00 (2,10)
10,42 (5,28)
7,95 (4,77)
7,53 (2,29)
14,63 (3,56)
3,88 (1,26)
4,94 (1,18)
6,06 (2,02)
3,31 (1,35)
4,88 (1,75)
4,88 (1,78)
7,00(2,13)
6,00 (1,83)
9,75(2,49)
16,94(3,53)
17,45 (2,20)
25,42 (2,99)
–0,664
–0,908
–0,382
–0,960
1,486
–1,77
–1,26
–1,65
–2,580
–2,717
–0,61
–0,70
–2,411
–2,076
–0,73
–2,024
–2,282
0,450
0,370
0,704
0,344
0,147
0,088
0,219
0,110
0,015
0,011
0,548
0,489
0,022
0,046
0,472
0,051
0,029
10,31 (1,49)
11,21 (1,08)
–2,058
0,048
64,18 (8,53)
63,63 (9,79)
0,177
0,860
381,5 (199,3)
262,4 (110,9)
2,186
0,036
Алекситимия
Серотонин (5HT тромбоцитов/мл)
STAXI
B-D
BIS/BAS
Ситуативная гневливость
Личностная гневливость
Гнев, направленный на себя («anger IN»)
Гнев, направленный вовне («anger OUT»)
Контроль гнева
Физическая агрессия
Косвенная агрессия
Раздражение
Негативизм
Обида
Подозрительность
Вербальная агрессия
Вина
Индекс враждебности
Индекс агрессивности
Система торможения поведения
Система активации поведения
Система активации поведения,
подкрепление
TAS-26
Личностная тревожность
STAI
Показатель
П р и м е ч а н и е : STAI – опросник ситуативной и личностной тревожности Спилбергера; STAXI – опросник ситуативной и личностной гневливости Спилбергера; B-D – опросник агрессивности Басса-Дарки; BIS-BAS – опросник
систем активации и торможения поведения Карвера и Уайта; TAS-26 – Торонтская шкала алекситимии; n – количество
испытуемых; t – значения t-критерия Стъюдента для независимых выборок; p – достоверность различий. Курсивом
выделены статистически значимые различия.
p < 0,082; ГР × ОРС × ВР × САГИТ: F(3, 102) =
2,91; p < 0,068 и ГР × ОРС × ВРЕМЯ × КАУД ×
× САГИТ: F(15, 510) = 1,86; p < 0,119), свидетельствуют о различной динамике ВС/ВД ЭЭГ
в группах в зависимости от порядкового номера
и фазы рефлекса, а также от топографического
распределения осцилляторной активности ЭЭГ.
Статистически значимые различия между
здоровыми людьми и пациентами с АГ оказались наиболее надежными и убедительными в
ОРС № 1, а далее, в связи с развивающимся уга112
шением (см. выше), различия между группами
сглаживались. В целом в ОРС № 1 ЭЭГ здоровых
лиц характеризовалась явлениями вызванной
синхронизации, а пациентов с АГ – вызванной
десинхронизации (ГР: F(1, 37) = 4,39; p < 0,043).
А взаимодействия ГР × ВРЕМЯ (F(3,102) = 4,02;
p < 0,034; ГР × ВРЕМЯ × САГИТ: F(3,102) = 5,33;
p < 0,008; ГР × ВРЕМЯ × КАУД × САГИТ: F(15,
510) = 3,39; p < 0,020) ясно указывают на групповые различия временной динамики осцилляторной активности (см. рис. 3 и 4): если в коБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Брак И.В. и др. Динамика реактивности осцилляторов… /c. 108–121
Рис. 1. Динамика АД, ОПСС, амплитуды и количества КГР (M ± m) в предстимульном интервале (–15 –0 с)
ОРС № 1, № 2 и № 3 в группах здоровых и пациентов с АГ
ротколатентной фазе ОРС (1,5–20 с) обе группы обнаруживали ВД, то в длиннолатентной у
здоровых людей развивалась ВС, а у больных с
АГ мощность возвращалась к предстимульному уровню. Топографически достоверное увеличение мощности у здоровых наблюдалось
в интервале 50–70 с в медиальных центральных и центрально-теменных, а также в латеральных центрально-теменных, центральных
и теменных областях коры (ГР: F(1,34) = 4,59;
p < 0,040), в интервале 70–95 с (ГР × САГИТ:
F(1, 34) = 6,34; p < 0,017; ГР × КАУД × САГИТ:
F(5, 170) = 3,43; p < 0,044) – только в медиальных центрально-теменных и теменных областях коры обоих полушарий мозга. В ОРС № 3
достоверных взаимодействий с фактором группы не установлено (см. рис. 3 и 4).
ОБСУЖДЕНИЕ
Выше нами было отмечено, что ОРС отражает активность аверсивной/оборонительной
мотивационной системы или, в современной
интерпретации, – системы борьбы/бегства/замирания. Как одна из базовых мотивационных
систем мозга (две другие – системы достижения/активации поведения и торможения поведения), она активируется аверсивными стимулами
всех категорий (безусловными, врожденными и
условными), выдавая на выходе реакции обездвиженности и активной обороны [9, 20]. Сердечно-сосудистая система является одним из
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
ведущих эффекторов аверсивной мотивационной системы, а вызванные угрозой облигатные
«подстройки» гемодинамики определяются текущими формами оборонительного поведения
[14, 22]. В реальной жизни при взаимодействии
источника угрозы и индивида тревога активирует механизмы оценки рисков («risk assessment»), направленные на непрерывный сбор
информации о возможности изменения баланса
поведенческих тенденций «избегание–приближение». Баланс сдвигается в сторону избегания
(активация системы борьбы/бегства/замирания),
если угроза оказалась больше предполагаемой
и начинает доминировать эмоция страха, или
в сторону приближения (вовлечение системы
активации поведения), если угроза воспринимается неоднозначно и в условиях нарастающей тревоги ее источник требует детализации
[20]. Такая инкубация мотивационного возбуждения поддерживает механизмы оборонительного поведения в состоянии непрерывной
«боевой готовности», что клинически отражается в удержании повышенного системного
АД. В условиях частых повторов со временем
физиологические траты усиливаются, поэтому
чрезмерная кардиоваскулярная реактивность
на острые стрессоры ускоряет неадаптивный
«износ» («wear-and-tear») мозга и соматических систем, подрывая устойчивость к стрессу
и здоровье [19]. Это согласуется с теоретическими представлениями о том, что устойчивая
активация только оборонительной мотивацион113
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Брак И.В. и др. Динамика реактивности осцилляторов… /c. 108–121
Рис. 2. Усредненная динамика реактивности АД, ЧСС, УО и СВ в ОРС № 1, № 2 и № 3 в группах здоровых и
пациентов с АГ
ной системы либо в комбинации с системой активации поведения, отражающей динамическое
решение конфликта «приближения–избегания»,
квалифицируется как стресс, длительное переживание которого приводит к клиническим
последствиям [35].
В результате проведенного исследования
в модели оборонительного реагирования удалость установить вовлечение осцилляторных
систем мозга в патогенетические механизмы
нарушения центральной регуляции кардиоваскулярной стресс-реактивности у пациентов с
АГ. Применение в исследовании акустического
раздражителя для индукции ОРС оказалось оправданным с точки зрения не только результата, но и экологической валидности постановки.
Именно такого рода раздражитель является,
114
пожалуй, наиболее распространенными в естественных условиях, а его негативные последствия для здоровья, развития аффективной
и психосоматической патологии хорошо документированы в литературе [11, 34].
С точки зрения вегетативной регуляции
парасимпатическая нервная система является
важнейшим тормозным эффектором в общих
механизмах кардиоваскулярной стресс-реактивности [32], что в полной мере справедливо
и для механизмов ОРС [35]. Коротколатентные
ускорение/замедление ЧСС опосредуются главным образом снижением/усилением активности
n. vagus. В динамике длиннолатентных ускорения/замедления ЧСС отражается реципрокность
парасимпато-симпатических взаимоотношений:
во время ускорения ЧСС доминирование симпаБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Брак И.В. и др. Динамика реактивности осцилляторов… /c. 108–121
Таблица 3
Результаты 2-факторного дисперсионного анализа показателей кардиоваскулярной реактивности
и КГР в предстимульном (–15…0 с) и постстимульных (0–10, 10–40 и 40–80 с) интервалах ОРС
у исследованных испытуемых
Показатель
САД
ДАД
СрАД
ЧСС
УО
СВ
ОПСС
КГР n
КГР A
–15…0 с
df
0-10 с
F
p
ГР
1, 34
26,14
0,000
F
10-40 с
p
F
н. д.
34,55
40-80 с
p
F
н. д.
0,000
p
н. д.
ОРС
2, 68
17,78
0,000
н. д.
32,35
0,000
ОРС × СТ
2, 68
6,32
0,006
н. д.
н. д.
8,35
0,001
ГР
1, 34
27,23
0,000
н. д.
н. д.
ОРС
2, 68
12,13
0,000
41,62
0,000
ГР × ОРС
2, 68
3,29
0,048
н. д.
ГР
1, 34
43,96
0,000
н. д.
ОРС
2, 68
14,20
0,000
ГР × ОРС
2, 68
6,37
16,12
0,005
0,000
21,37
н. д.
0,000
н. д.
н. д.
16,17
10,62
0,000
5,00
0,012
н. д.
0,000
17,39
0,000
7,56
0,001
н. д.
н. д.
н.д.
н. д.
н. д.
н. д.
н. д.
ГР
1, 34
н. д.
ОРС
2, 68
н. д.
ГР × ОРС
2, 68
н. д.
н. д.
н.д.
н. д.
ГР
1, 34
н. д.
н. д.
н.д.
н. д.
10,68
0,000
ОРС
2, 68
н. д.
ГР × ОРС
2, 68
н. д.
н. д.
н. д.
н. д.
ГР
1, 34
н. д.
н. д.
н. д.
н. д.
ОРС
2, 68
н. д.
ГР × ОРС
2, 68
н. д.
ГР
1, 34
ОРС
2, 68
ГР × ОРС
2, 68
н. д.
н. д.
н. д.
н. д.
н. д.
н. д.
н. д.
н. д.
4,81
9,73
0,000
3,38
0,042
63,50
26,94
н. д.
0,035
н. д.
0,000
0,000
28,46
8,65
н. д.
0,001
н. д.
н. д.
6,00
0,020
н. д.
н. д.
23,49
0,000
н. д.
ГР
1, 34
ОРС
2, 68
ГР × ОРС
2, 68
н. д.
н. д.
н. д.
н. д.
ГР
1, 34
н. д.
н. д.
н. д.
н. д.
ОРС
2, 68
н. д.
12,78
0,000
н. д.
н. д.
ГР × ОРС
2, 68
н. д.
3,59
0,047
н. д.
16,01
0,000
н. д.
23,35
0,000
0,000
57,74
4,36
0,000
0,030
П р и м е ч а н и е . Факторы Группа (ГР 2: КИ, АГ), ОРС (3: № 1, № 2 и № 3) и их взаимодействие (ГР × ОРС); F – критерий Фишера; p – достоверность различий; df – число степеней свободы; н. д. – эффекты недостоверны.
тического контроля сочетается с торможением
парасимпатического, а в период ее замедления
усиление парасимпатического контроля ритма
сердца снижает симпатическую активацию.
Изменения АД во многом повторяют динамику
ЧСС, но с небольшим запаздыванием – коротколатентный подъем АД соответствует первому замедлению ЧСС, длиннолатентный – второму. Благодаря активности барорецепторного
рефлекса ЧСС и САД изменяются в противоположных направлениях – в сегментах коротко- и
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
длиннолатентных гемодинамических изменений повышения АД соответствуют замедлениям ЧСС и наоборот [2, 27]. А с точки зрения
когнитивно-эмоциональных процессов связанные с ОРС кардиоваскулярные изменения
функционально отражают последовательный
переход от непроизвольной импульсивной фазы
мобилизации внимания на восприятие угрозы
к рефлексивной фазе мотивационной защиты.
В импульсивную фазу коротколатентный комплекс кардиоваскулярных изменений связан с
115
Рис. 3. Динамика распределения мощности ЭЭГ (ВД/ВС) в альфа-2-диапазоне (1) и статистических различий ее изменений между группами здоровых и
пациентов с АГ (2) в постстимульных интервалах ОРС № 1 и № 3 (1,5–20, 20–50, 50–70 и 70–95 с) в ассоциации с групповой динамикой реактивности САД. Вертикальными линиями выделены области статистически достоверных различий при p < 0,05 (t-критерий Стъюдента)
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Брак И.В. и др. Динамика реактивности осцилляторов… /c. 108–121
116
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Брак И.В. и др. Динамика реактивности осцилляторов… /c. 108–121
Рис. 4. Динамика ВД/ВС ЭЭГ в альфа-2-диапазоне в латеральных (1), медиальных (2) и срединных (3) областях
коры в ОРС № 1 и № 3 у здоровых и пациентов с АГ
прерыванием текущей активности, усилением
внимания к аверсивному стимулу, регистрацией угрозы и ее потенциала, отражая упрощенную и биологически наиболее общую форму
триггерного действия эмоции (в данном случае
страха) в изменении мотивационного состояния. В рефлексивную фазу длиннолатентный
комплекс кардиоваскулярных изменений отражает мобилизацию ресурсов активной обороны
и актуализацию реакций дефенсивного копинга, вызванных активацией аверсивной мотивационной системы [2, 8, 25, 35].
Комплекс коротколатентных кардиоваскулярных изменений ОРС и его наличие у всех
исследованных ясно показывает, что на этапе
импульсивной обработки стрессора у здоровых
и страдающих АГ людей успешно происходит регистрация его мотивационной сигнатуры – сигнал воспринимается как важный для
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
выживания. Далее, в группе здоровых компонента длиннолатентного увеличения АД практически не формируется. Вероятно, в следующую – рефлексивную фазу по данным расширенной оценки стимул оценивается как неопасный, что приводит к «отмене» его угрожающей
коннотации, предотвращая активацию системы
борьбы-бегства [8, 15]. В результате у здоровых
формируется «упрощенный» ОРС без отчетливо
выраженного длиннолатентного комплекса изменений ЧСС и АД, и к концу постстимульного
интервала ОРС показатели гемодинамики возвращаются практически к исходному уровню.
Иная динамика ОРС характерна для пациентов. Увеличенная амплитуда коротколатентного
подъема САД и СрАД указывает на бóльшую
мобилизацию внимания стрессором, ослабление вагусных, усиление симпатикотонических
влияний и вазоконстрикторной активности пе117
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Брак И.В. и др. Динамика реактивности осцилляторов… /c. 108–121
риферических сосудов [2, 18, 28]. В результате
расширенной когнитивной оценки «отмены»
угрозы не происходит, система борьбы-бегства
демонстрирует готовность к активной обороне
в виде устойчивого длиннолатентного подъема
АД. Физиологическая основа такого подъема –
активация оборонительной мотивационной системы (ее подотдела борьбы/бегства) и программ
дефенсивного копинга, усиление центральных
симпатических влияний наряду с реципрокным
ослаблением вагусных тормозных воздействий
[7, 18, 35]. На эмоционально-когнитивном уровне длиннолатентное ускорение ЧСС/увеличение АД предсказывает экстернализацию внимания и усиление сканирования окружающего
пространства на предмет угрозы [35], преобладание дефенсивной компоненты реагирования
над ориентировочной при восприятии символической угрозы [28], аффективное научение
страху и формирование резистентности к его
угашению в процедуре аверсивного кондиционирования [16] (повышенную негативную эмоциональность в виде тревожного беспокойства
[7], эмоциональной лабильности или даже клинических симптомов тревожных расстройств
[18, 35]). Можно думать, что представленные
выше особенности нейровегетативной регуляции и эмоционально-когнитивных стратегий,
связанных с длиннолатентным подъемом АД в
ОРС, в высокой степени справедливы для пациентов с АГ.
Принято считать, что длиннолатентные
подъемы ЧСС/АД в повторных ОРС быстро
угашаются: повторное предъявление аверсивного раздражителя вызывает ослабленную мотивационную мобилизацию или ее «отмену»,
поскольку после (или в процессе) реализации
первого ОРС индивид убеждается в отсутствии
реальной угрозы [2, 6, 25, 33, 35]. В нашем случае при использовании общепринятой техники
анализа угашения (т. е. расчет изменений ЧСС
и АД по отношению к интервалам, непосредственно предшествующих стимулу) этот тезис представляется справедливым – пациенты
демонстрируют угашение длиннолатентного
подъема АД. Между тем анализ последовательных предстимульных интервалов свидетельствует, что увеличенные абсолютные показатели
АД в ОРС № 1 не возвращаются к исходному
уровню, и развитие ОРС № 2 и № 3 происходит
на фоне уже повышенного АД. Следовательно,
у больных в результате первого удара оборонительная мотивационная система оказывается в
состоянии повышенной тонической активированности на относительно длительное время, и,
по существу, угашение не наступает.
118
Оборонительная активация в сердечнососудистой системе, вызванная аверсивным
акустическим раздражителем, сопровождалась
масштабными изменениями осцилляторной
активности ЭЭГ. По данным обширной по топографии и глубокой по амплитуде супрессии
мощности ЭЭГ в широком диапазоне частот
(от тета-2 до бета-1), у всех исследованных начало первого ОРС происходит на фоне выраженной неспецифической активации центральной нервной системы. Далее, ближе к первой
половине постстимульного интервала, показатели мощности ЭЭГ возвращаются к исходному уровню. К окончанию рефлекса мощность
достоверно повышается в диапазонах тета-2,
альфа-1 и бета-1 в различных областях коры,
отражая, вероятно, компенсаторное снижение
бдительности, релаксацию и «высвобождение»
внимания от стрессора [1]. Изменения осцилляторной активности при повторных предъявлениях стимула были выражены существенно
слабее. Во время 2-го и 3-го ОРС сохраняется
слабо выраженная начальная десинхронизация,
которая носит обширный характер в диапазонах альфа-1 и альфа-2, и более локальный – в
полосах тета-2, альфа-3 и бета-1, а к окончанию
реакции признаки синхронизации мощности отсутствуют. В целом угашение сопутствующей
осцилляторной активности мозга отражалось в
изменении количества вовлеченных частотных
диапазонов и областей коры, уменьшении магнитуды и времени вызванных аверсивным раздражителем изменений ЭЭГ.
Среди всех исследованных только в альфа2-диапазоне (10–12 Гц) ЭЭГ выявлены особенности осцилляторной динамики, связанные с
повышенной реактивностью АД у пациентов с
АГ. В период длиннолатентных изменений АД
отсутствие его подъема у здоровых лиц сопровождалось ослаблением ВД ЭЭГ и ее трансформацией в ВС – увеличение мощности высокочастотной альфа-активности происходило в
центральной и центрально-теменной коре обоих полушарий мозга. Напротив, длиннолатентное повышение АД у пациентов характеризовалось отсутствием фазы альфа-2-синхронизации
в этих областях коры и возвратом вызванной
активности ЭЭГ к предстимульному уровню.
Как было отмечено выше, длиннолатентные
кардиоваскулярные изменения в ОРС соответствуют рефлексивному этапу переработки стрессора – расширенной его оценки, переоценки
и актуализации копинговых стратегий [8, 15].
Синхронизация альфа-активности ЭЭГ традиционно рассматривалась как функциональный
показатель сниженной скорости переработки
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Брак И.В. и др. Динамика реактивности осцилляторов… /c. 108–121
информации или «бездействия» («idling state»)
подлежащей коры [24]. Позднее такая точка
зрения была пересмотрена. Синхронизацию
альфа-активности стали связывать с процессами, требующими интернализации («rejection»)
или внутренней фокусировки внимания (воображение, креативная активность, обращение к
долговременной памяти и пр.), а десинхронизацию – с механизмами экстернализации внимания или поддержания его направленности «вовне» («intake») [26]. Дальнейшие наблюдения за
периодами альфа-синхронизации во время когнитивной деятельности позволили интерпретировать ее как функциональный коррелят механизма избирательного нисходящего контроля
(«top-down control»), функция которого состоит
в торможении когнитивных процессов, напрямую не связанных с текущей когнитивной активностью [10].
Можно думать, что у здоровых сопутствующая второй половине ОРС альфа-2-синхронизация ЭЭГ в лобных, центральных и теменных
областях коры на когнитивном уровне отражает процесс принятия решения об отсутствии
опасности, включающий обращение к долговременной памяти, извлечение и актуализацию
программ переоценки значимости аверсивного
стимула. А на регуляторном – активность механизмов нисходящего («top-down») контроля,
обеспечивающих активное торможение подкорковых образований, контролирующих реализацию ОРС, с целью скорейшего восстановления гемодинамики к исходному состоянию.
Отсутствие синхронизации альфа-2-активности
ЭЭГ в этих же областях коры у больных препятствуют актуализации механизма «отмены
угрозы», в этом случае продолжается внимание
и сканирование окружающего пространства на
предмет угрозы, а подсистема борьбы-бегства
обнаруживает готовность к активной обороне,
отражающуюся в виде увеличенного АД. С
точки зрения сетевой организации мозговых
специализированных систем («cеть значимости», «сеть когнитивного контроля» и «сеть
режима по умолчанию»), у здоровых людей в
результате «отмены угрозы» и перехода в фоновый режим ненаправленного ассоциативного мышления («mind-wandering») происходит
синхронизация альфа-активности и усиление
тормозного «top-down» контроля, указывая на
активацию «сети режима по умолчанию». Напротив, у пациентов сохраняющаяся актуальность угрозы удлиняет во времени активность
не только «cети значимости», но и «сети когнитивного контроля», препятствуя развитию
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
альфа-2-синхронизации и актуализации «сети
режима по умолчанию» [30].
Таким образом, в результате проведенного
исследования установлено следующее.
1. По сравнению со здоровыми людьми пациенты с АГ в различные фазы оборонительного рефлекса сердца характеризуются аномально
высокой реактивностью АД – в предстимульный период ожидания неизбегаемого аверсивного раздражителя (–15…0 с: САД, СрАД) и
в постстимульный коротколатентный (0–10 с:
САД, СрАД) и длиннолатентный (40–80 с: САД
и ДАД) периоды активации аверсивной мотивационной системы.
2. В альфа-2-диапазоне ЭЭГ (10–12 Гц) выявлены особенности осцилляторной динамики,
связанные с различной длиннолатентной реактивностью АД у пациентов с АГ и здоровых
лиц. Отсутствие длиннолатентного подъема АД
у здоровых сопровождалось усилением вызванной синхронизации высокочастотной альфа-активности в медиальных отделах центральной и
центрально-теменной коры обоих полушарий
мозга. Напротив, длиннолатентное повышение
АД у пациентов характеризовалось отсутствием фазы альфа-2-синхронизации в этих областях и возвратом альфа-активности к предстимульному уровню.
3. В целом можно заключить, что оборонительный рефлекс сердца у пациентов с АГ характеризуется гиперреактивностью коротко- и
длиннолатентных компонентов АД, обусловленной со стороны центральной нервной системы ослаблением нисходящего («top-down»)
тормозного контроля стресс-реактивности АД,
реализуемого с вовлечением альфа-осцилляторов медиальных отделов центрально-теменной
коры обоих полушарий мозга.
СПИСОК ЛИТЕРАТУРЫ
1. Афтанас Л.И. Эмоциональное пространство человека. Новосибирск, 2000. 126 с.
Aftanas L.I. The human emotional space.
Novosibirsk, 2000. 126 p.
2. Афтанас Л.И., Брак И.В., Гилинская О.М.
и др. Индивидуальная вариабельность сердечнососудистой реактивности при реализации защитного кардиорефлекса у человека // Рос. физиол.
журн. 2008. 94. (2). 163–173.
Aftanas L.I., Brak I.V., Gilinskaia O.M. et al.
Individual variability of cardiovascular reactivity
during protective cardiac reflex in humans // Ros.
fiziol. zhurn. 2008. 94(2). 163–175.
119
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Брак И.В. и др. Динамика реактивности осцилляторов… /c. 108–121
3. Гилинский М.А., Латышева Т.Е., Семенова Л.П. Определение катехоламинов, серотонина и
5-гидроксииндолуксусной кислоты в одной пробе
крови // Клин. лаб. диагностика. 2007. (6). 25–28.
Gilinskii M.A., Latysheva T.E., Semenova L.P.
Determination of catechelamines, serotonin and 5hydroxyindoleacetic acid in a blood sample // Klin.
lab. diagnostika. 2007. 6. 25–28.
4. Aftanas L.I., Varlamov A.A., Pavlov S.V. et
al. Time-dependent cortical asymmetries induced
by emotional arousal: EEG analysis of event-related
synchronization and desynchronization in individually defined frequency bands // Int. J. Psychophysiol.
2002. 44. (1). 67–82.
5. Chida Y., Steptoe A. Greater cardiovascular
responses to laboratory mental stress are associated
with poor subsequent cardiovascular risk status: a
meta-analysis of prospective evidence // Hypertension. 2010. 55. (4). 1026–1032.
6. Cook E.W., Turpin G. Differentiating orienting, startle, and defense response: the role of affect
and its implications for psychopathology // Attention
and Orienting / Eds. P.J. Lang, R.F. Simons, M.T. Balaban. Hillsdale: Erlbaum, 1997. 137−164.
7. Delgado L.C., Guerra P., Perakakis P. et
al. Psychophysiological correlates of chronic worry:
cued versus non-cued fear reaction // Int. J. Psychophysiol. 2009. 74. (3). 280–287.
8. Frijda N.H. Impulsive action and motivation // Biol. Psychol. 2010. 84. (3). 570–579.
9. Gray J.A., McNaughton N. The neuropsychology of anxiety: an enquiry into the functions
of the septo-hippocampal system (second edition).
Oxford: Oxford University Press, 2000.
10. Klimesch W., Sauseng P., Hanslmayr S. EEG
alpha oscillations: the inhibition-timing hypothesis //
Brain Res. Rev. 2007. 53. (1). 63–88.
11. Kryter K.D. The effect of noise in man. London: Acad. Press, 1970.
12. Lane R.D., Waldstein S.R., Chesney M.A.
et al. The rebirth of neuroscience in psychosomatic
medicine, part I: historical context, methods and relevant basic science // Psychosom. Med. 2009. 71.
117–134.
13. Lane R.D., Waldstein S.R., Critchley H.D.
et al. The rebirth of neuroscience in psychosomatic
medicine, part II: clinical applications and implications for research // Psychosom. Med. 2009. 71. 135–
151.
14. Lang P.J., Bradley M.M. Emotion and the motivational brain // Biol. Psychol. 2010. 84. 437−450.
15. Lazarus R.S., Folkman S. Stress, appraisal,
and coping. N.Y.: Springer, 1984.
16. Lуpez R., Poy R., Pastor M.C. et al. Cardiac
defense response as a predictor of fear learning // Int.
J. Psychophysiol. 2009. 74. (3). 229–235.
120
17. Lovallo W.R., Gerin W. Psychophysiological
reactivity: mechanisms and pathways to cardiovascular disease // Psychosom. Med. 2003. 65. 36–45.
18. Marfil M.N.P., Santaella M.C.F., Leуn A.G. et
al. Individual differences associated with cardiac defence response: psychophysiological and personality
variables // Psychol. Spain. 1999. 3. (1). 54–62.
19. McEwen B.S., Gianaros P.J. Central role of
the brain in stress and adaptation: links to socioeconomic status, health, and disease // Ann. N. Y. Acad.
Sci. 2010. 1186. 190–222.
20. McNaughton N., Corr Ph. J. A two-dimensional neuropsychology of defense: fear/anxiety and
defensive distance // Neurosci. Biobehav. Rev. 2004.
28. 285–305.
21. Newton T.L. Cardiovascular functioning,
personality, and social world the domain of hierarchical power // Neurosci. Biobehav. Rev. 2009. 33.
145–159.
22. Obrist P.A. Cardiovascular psychophysiology: A perspective. N.Y.: Plenum Press, 1981.
23. Patel P.V., Wong J.L., Arora R. The morning blood pressure surge: therapeutic implications //
J. Clin. Hypertens. (Greenwich). 2008. 10. (2). 140–
145.
24. Pfurtscheller G., Stancбk A. Jr., Neuper C.
Event-related synchronization (ERS) in the alpha
band--an electrophysiological correlate of cortical
idling: a review // Int. J. Psychophysiol. 1996. 24.
(1–2). 39–46.
25. Ramirez I., Sánchez M.B., Fernández M.C. et
al. Differentiation between protective reflexes: cardiac defense and startle // Psychophysiology. 2005.
42. 732–739.
26. Ray W.J., Cole H.W. EEG activity during
cognitive processing: influence of attentional factors
// Int. J. Psychophysiol. 1985. 3. (1). 43–48.
27. Reyes del Paso G., Vila J., Garcнa A. Physiological significance of the defense response to intense
auditory stimulation: a pharmacological blockade
study // Int. J. Psychophysiol. 1994. 17. 181–187.
28. Sбnchez-Navarro J.P., Martнnez-Selva J.M.,
Romбn F., Ginesa T. The effect of content and physical properties of affective pictures on emotional responses// Span. J. Psychol. 2006. 9. (2). 145–153.
29. Sgoifo A., Costoli T., Meerlo P. et al. Individual differences in cardiovascular response to social
challenge // Neurosci. Biobehav. Rev. 2005. 29. (1).
59–66.
30. Sridharan D., Levitin D.J., Menon V. A critical role for the right fronto-insular cortex in switching between central-executive and default-mode networks // Proc. Natl. Acad. Sci. USA. 2008. 105. (34).
12569–12574.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Брак И.В. и др. Динамика реактивности осцилляторов… /c. 108–121
31. Thayer J.F., Lane R.D. The role of vagal
function in the risk for cardiovascular disease and
mortality // Biol. Psychol. 2007. 74. 224–242.
32. Thayer J.F., Lane R.D. Claude Bernard and
the heart–brain connection: further elaboration of a
model of neurovisceral integration // Neurosci. Biobehav. Rev. 2009. 33. 81–88.
33. Turpin G., Schaefer F., Boucsein W. Effects
of stimulus intensity, rise time, and duration on autonomic and behavioral responding: Implication for
the differentiation of orienting, startle, and defense responses // Psychophysiology. 1999. 36. 453–463.
34. Vera M.N., Vila J., Godoy J.F. Cardiovascular
effects of traffic noise: the role of negative self-statements // Psychol. Med. 1994. 24. 817–827.
35. Vila J., Guerra P., Muсoz M.A. et al. Cardiac
defense: from attention to action // Int. J. Psychophysiol. 2007. 66. (3). 169–182.
BRAIN OSCILLATIONS AND ARTERIAL BLOOD PRESSURE
REACTIVITY DYNAMICS DURING CARDIAC DEFENSE
IN TREATMENT NAIVE HYPERTENSIVES
Lyubomir Ivanovich AFTANAS, Olga Mikhailovna GILINSKAYA, Ivan Viktorovich BRACK,
Sergey Valentinovich PAVLOV, Natalia Vladimirovna REVA
Institute of Physiology SB RAMS
630117, Novosibirsk, Timakov str., 4
Objectives. Assessment of defensive behavior in the cardiovascular system is based on the presentation of an intense aversive unexpected stimulus that prompts a specific phasic cardiovascular reactivity pattern (usually HR and
arterial BP reactivity) coined as the cardiac defense response (CDR). The CDR indexes activity of the defensive
motivational system and behavioral coping programs. Using the CDR as a model of defensive behavior, the aim
was to analyze putative contribution of brain oscillations into central mechanisms of enhanced cardiovascular stress
reactivity in arterial hypertension patients. Material and Methods: To address this issue the CDR was elicited in controls (n = 19) and naive unmedicated hypertensives (n = 17). Heart rate (HR) and arterial blood pressure (BP), based
on the beat-by-beat technology (Finometer®) along with 64-channel EEG were simultaneously recorded while the
3 CDR were sequentially evoked. As for the neurophysiological analysis of the CDR’s time-course the event-related
synchronization/desynchronization (ERD/ERS) of EEG in different frequency bands was calculated throughout the
all recorded CDRs. Results: It was revealed that long-latency BP increases in hypertensives were marked by lack
of the alpha-2 (10-12 Hz) ERS over the central and centro-parietal cortex bilaterally. On the contrary, the controls manifested alpha-2 ERS over these regions which was concomitant to the lowered long-latency BP reactivity.
Conclusions. High frequency brain alpha oscillations of the centro-parietal cortex are involved into the top-down
inhibitory control of BP stress reactivity, and arterial hypertension may be associated with the deficiency of this
mechanism.
Key words: brain oscillations, electroencephalogram, high frequency alpha (10–12 Hz) oscillations, event-related
EEG, emotion, defensive motivational system, fight-flight system, cardiac defense, cardiovascular reactivity, arterial
hypertension, naive hypertensives.
Aftanas L.I. – doctor of medical sciences, professor, academician of RAMS, head of the psychophysiology
laboratory, e-mail: l.aftanas@physiol.ru
Gilinskaya O.M. – head of the in-patient department, e-mail: olga.gilinskaya@gmail.com
Brack I.V. – researcher of the psychophysiology laboratory, e-mail: brack@physiol.ru
Pavlov S.V. – senior researcher of the psychophysiology laboratory, e-mail: pavlov@physiol.ru
Reva N.V. – senior researcher of the psychophysiology laboratory, e-mail: n.v.reva@physiol.ru
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
121
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК: 612.821+612.822.3
ПСИХОФИЗИОЛОГИЧЕСКИЙ АНАЛИЗ БАЛАНСА АКТИВНОСТИ
ОБОРОНИТЕЛЬНОЙ И ПОДКРЕПЛЯЮЩЕЙ МОТИВАЦИОННЫХ СИСТЕМ
У БОЛЬНЫХ С ГИПЕРТОНИЕЙ
Любомир Иванович АФТАНАС, Ольга Михайловна ГИЛИНСКАЯ,
Владимир Викторович КОРЕНЕК, Иван Викторович БРАК,
Сергей Валентинович ПАВЛОВ, Наталия Владимировна РЕВА
НИИ физиологии СО РАМН
630117, г. Новосибирск, ул. Тимакова, 4
Цель работы. У пациентов с артериальной гипертонией (АГ) в модели вызванных эмоций по данным субъективной компоненты переживания положительной и отрицательной эмоциональной активации, сопутствующей осцилляторной активности различных областей коры головного мозга и гемодинамики, выявить
особенности баланса активности оборонительной и подкрепляющей мотивационных систем мозга и их возможный вклад в центральные механизмы повышенной стресс-реактивности артериального давления (АД).
Материал и методы. Исследованы здоровые испытуемые (n = 16) и пациенты с впервые выявленной артериальной гипертонией 1–2-й степени без лечения (n = 16). Использовали сочетанную динамическую регистрацию 64-канальной ЭЭГ и «по-ударного» («beat-by-beat») артериального давления в условиях вызванных
эмоций с помощью метода реактивации в воображении («recall generation») следов недавних аффективных
событий. Результаты. В состоянии физиологического покоя пациенты с АГ характеризуются признаками
повышенной тонической активированности левого полушария, отражающимися в асимметричном снижении
дельта- и тета-1-мощности в его центральной и теменной коре. Также установлены сниженные концентрации серотонина тромбоцитов крови. В сценариях эмоциональной активации у пациентов с АГ снижена
интенсивность переживания положительных эмоций, сочетающаяся, по данным осцилляторной активности,
со значимо более выраженным подавлением активности осцилляторов дельта (2–4 Гц) и тета (поддиапазоны
4–6 и 6–8 Гц) в теменно-затылочной коре (зоны P и PO) обоих полушарий мозга. Заключение. Полученные
данные свидетельствуют о гипоактивации подкрепляющей мотивационной системы мозга у пациентов и
повышенном напряжении осцилляторных систем («electrocortical effort») в процессе генерации положительной эмоциональной активации. Обнаруженный феномен рассматривается авторами в качестве одного из
важных патогенетических факторов нарушения центральных механизмов регуляции стресс-реактивности
АД при АГ.
Ключевые слова: осцилляторная активность мозга, электроэнцефалограмма, дельта- и тета-осцилляции,
положительные эмоции, кардиоваскулярная реактивность, подкрепляющая мотивационная система, нелеченная
артериальная гипертония.
Высокая потребность в понимании нарушений механизмов мозговых функций при АГ
у человека обусловлена тем обстоятельством,
что состояние мозга является важным фактором в терапии заболевания. С одной стороны,
появляются доказательства, что фармакологическая нормализация периферического АД не
приводит к обратимости ассоциированных с
заболеванием изменений функций, структуры
и организации мозговых процессов, а показатели, например, ускоренного старения мозга и
объема серого вещества прогрессивно ухудшаются [17]. С другой, АГ по-прежнему остается
трудно контролируемым состоянием, и по эпидемиологическим данным показатели контроля
АД не превышают 30 % даже в самых успеш-
Афтанас Л.И. – д.м.н., проф., академик РАМН, зав. лабораторией психофизиологии,
e-mail: l.aftanas@physiol.ru
Гилинская О.М. – зав. отделением клиники НИИ физиологии, e-mail: olga.gilinskaya@gmail.com
Коренек В.В. – научный сотрудник лаборатории психофизиологии, e-mail: korenyok@physiol.ru
Брак И.В. – научный сотрудник лаборатории психофизиологии, e-mail: brack@physiol.ru
Павлов С.В. – старший научный сотрудник лаборатории психофизиологии, e-mail: pavlov@physiol.ru
Рева Н.В. – старший научный сотрудник лаборатории психофизиологии, e-mail: n.v.reva@physiol.ru
122
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Коренек В.В. и др. Психофизиологический анализ баланса… /c. 122–134
ных странах мира [3]. Можно думать, что как
первое, так и второе во многом обусловлены
неэффективным «администрированием» мозговых и нейровисцеральных патогенетических
механизмов АГ в силу их недостаточной изученности [17].
С приходом в клинику современных методов психофизиологии и нейровизуализации
взгляды на роль мозга в возникновении АГ, его
влияние на ранние стадии заболевания и развитие функциональных нарушений, поддерживающих его прогрессирование, а также дальнейшее развитие идеи «первичности мозга» («brain
as essential») в эссенциальной гипертонии получили новое дыхание [18]. Установлено, что изменения структуры мозга и функциональной организации мозговых процессов коррелируют с
наличием ранних стадий заболевания. Выделены несколько категорий мозговых нарушений –
когнитивный дефицит (снижение внимания,
памяти и абстрактного мышления), изменения
мозгового кровотока и ускоренное старение.
В то же время практически неизученными
остаются особенности нарушений центральных
механизмов регуляции мотивационного поведения, эмоций, кардиоваскулярной реактивности
и нейровисцеральной интеграции, осуществляющих важнейший вклад в генез и злокачественность течения АГ [17, 24]. Лишь в немногочисленных работах показано, что наряду с
гипертрофированной стресс-реактивностью АД
[22] у пациентов наблюдается уплощение эмоционального пространства и развитие алекситимии (эмоциональной слепоты), нарушаются
центральные и нейровегетативные механизмы
восприятия и переживания болевых ощущений
[19].
С учетом изложенного выше была сформулирована следующая цель настоящей работы:
у пациентов с АГ в модели вызванных эмоций
по данным субъективной компоненты переживания положительной и отрицательной эмоциональной активации, сопутствующей осцилляторной активности различных областей коры
головного мозга и гемодинамики, выявить особенности баланса активности оборонительной
и подкрепляющей мотивационных систем мозга и их возможный вклад в центральные механизмы повышенной стресс-реактивности АД.
тела ≤ 30. Измерение «офисного» артериального
давления (АД) проводили методом Короткова с
помощью механического тонометра Microlife
BP AG1-10 (Швейцария) и фонендоскопа в положении сидя трехкратно с интервалом 5 минут. В исследование не включались индивиды с
показателями АД, соответствующими, согласно
классификации Европейского общества кардиологов (2010), критериям артериальной гипертонии 1–2-й степени (систолическое АД (САД)
> 140 мм рт. ст., диастолическое АД (ДАД) >
90 мм рт. ст.). Группа АГ включала ранее не леченых пациентов или прекративших прием гипотензивных препаратов более чем за 2 недели
до включения в исследование. На исследование
было получено разрешение этического комитета НИИ физиологии СО РАМН.
С помощью опросников у каждого испытуемого оценивались уровни личностной тревожности (STAI), депрессивности (BDI), алекситимии (TAS), агрессивности (STAXI), экстраверсии, нейротизма, психотизма, социальной
желательности (EPQ), преобладания положительных или отрицательных эмоций (PANAStrait), а также активности систем активации и
торможения поведения (BIS/BAS). Для оценки
концентраций тромбоцитарного (тромбоциты/
мл) и плазменного (нмоль/л) серотонина (5-HT)
использовался метод высокоэффективной жидкостной хроматографии с элетрохимической
детекцией [2].
У каждого испытуемого эмоции радости и
гнева индуцировали с использованием метода воспроизведения из памяти недавних персонально и эмоционально значимых событий
(«recall generation method» [6]). Испытуемым
предлагалось вспомнить из своего недавнего
прошлого и последовательно воспроизвести в
воображении ситуации межличностных взаимодействий, связанных с сильным переживанием эмоций гнева (сценарий «Гнев») и радости
(сценарий «Радость»). Для оценки эффективности воспроизведения каждого из предложенных
сценариев использовали 9-балльные шкалы с
факторами «Легкость» (легкость извлечения
ситуации из памяти: от «не удалось» до «очень
легко»), «Отчетливость» (отчетливость представления в воображении: от «нет образа» до
«отчетливый образ»), «Интенсивность» (интенсивность переживания эмоции: от «совсем нет»
до «очень сильно»). Специфичность индукции
МАТЕРИАЛ И МЕТОДЫ
целевых эмоций радости и гнева оценивали с
В исследовании приняли участие 16 конт- помощью шкал эмоциональных профилей с
рольных (здоровых) испытуемых (КИ) и 16 па- факторами «Грусть», «Страх», «Тревога», «Рациентов с впервые выявленной АГ без лечения. дость», «Расслабленность», «Гнев», «ОтвращеВсе – мужчины, правши, с индексом массы ние» (от «совсем нет» до «очень сильно») [6].
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
123
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Коренек В.В. и др. Психофизиологический анализ баланса… /c. 122–134
ЭЭГ (62 канала, полоса пропускания 0,3–
120,0 Гц, 6 дБ, ≥ 12 дБ/октаву, частота дискретизации 1000 Гц) регистрировали монополярно
с помощью программы BrainProduct Acquisition 1.1 и многоканального усилителя QuickAmp (BrainProducts GmBh, Германия) и модифицированной 64-канальной шапочки со
встроенными Ag/AgCl электродами (QuikCap,
NeuroSoft Inc., США). Референтный электрод
располагался на кончике носа, заземляющий
— в центре лба. Поддерживалось сопротивление ≤ 5 кОм. Для контроля глазодвигательных
артефактов регистрировались вертикальная
и горизонтальная электроокулограммы. Под
визуальным контролем и с помощью метода
анализа независимых компонент (Independent
Components Analysis, ICA) проводилась коррекция глазодвигательных, миографических и
других артефактов. Безартефактные фрагменты ЭЭГ покоя при открытых (ОГ) и закрытых
глазах (ОГ), и при воспроизведении сценариев
«Гнев» и «Радость» разделялись на эпохи длиной 2 с (2048 отсчетов АЦП) и подвергались
быстрым преобразованиям Фурье (FFT) с перекрытием в 50 % и использованием окна Парзена. Для каждого испытуемого, каждого экспериментального условия и каждого отведения
полученные значения мощности усреднялись в
пределах дельта- (2–4 Гц), тета1- (4–6 Гц), тета2(6–8 Гц), альфа1- (8–10 Гц), альфа2- (10–12 Гц),
альфа3- (12–14 Гц), бета1- (14–20 Гц), бета2(20–30 Гц) и гамма- (30–45 Гц) частотных полос и для нормализации распределения подвергались логарифмированию (lnP). Непрерывную
регистрацию АД осуществляли способом Penaz
(«volume-clump») при помощи стационарного
монитора FinometerTM (Finapres Medical System
BV, Нидерланды). Расcчитывались показатели
систолического и диастолического АД, ударного объема, сердечного выброса, общего периферического сопротивления сосудов и времени
сокращения левого желудочка [1].
Регистрировали фоновые значения активности ЭЭГ при открытых и закрытых глазах
(ОГ и ЗГ) по схеме: ОГ (90 с), ЗГ (90 с), ОГ
(90 с), ЗГ (180 с). Фоновые показатели сердечнососудистой системы регистрировали в течение
110 с. Далее, в соответствии с протоколом, испытуемый при закрытых глазах в течение 110 с
воспроизводил сценарии «Гнев» и «Радость».
Начало эффективной генерации заданного сценария индицировалось испытуемым с помощью поднятия указательного пальца правой
руки. Через 110 секунд оператор давал команду
«Прекратить генерацию», после чего начинался
период восстановления. Порядок воспроизведе124
ния сценариев был сбалансирован между всеми
испытуемыми. Перерыв между эмоциональными сценариями составлял 5 мин и заполнялся
актуализацией в воображении эмоционально
нейтральных ситуаций. Для каждого испытуемого рассчитывались усредненные значения
гемодинамических показателей для состояния
покоя (фоновые показатели) и отдельно для
сценариев «Гнев» и «Радость». Реактивность
гемодинамических показателей рассчитывали
по формуле: [значение показателя в сценарии –
значение показателя в состоянии физиологического покоя].
Данные субъективных отчетов и кожногальванической реакции (КГР) оценивали методами непараметрической статистики (с помощью критерия знаковых рангов Уилкоксона),
гемодинамические показатели – с помощью
дисперсионного анализа с повторными измерениями по схеме: экспериментальное условие
(ЭУ 3: состояние покоя, сценарии «Радость» и
«Гнев»). Для анализа спектральной мощности ЭЭГ все электроды были распределены на
24 электродных кластера (по 12 для каждого
полушария) (табл. 1). Значения спектральных
мощностей ЭЭГ для отдельных электродов,
входящих в кластер, усреднялись между собой для каждого экспериментального условия.
Эффекты эмоциональной активации ЭЭГ анализировали с помощью 4-факторного дисперсионного анализа с повторными измерениями
по схеме: ЭУ (ЭУ 3: состояние покоя, сценарии
«Гнев» и «Радость») × Полушарие (ПШ 2: левое, правое) × Сагитальность (САГ 2: медиальная и латеральная кора) × Каудальность (КАУД
6: F, FC, C, CP, P, O). Во всех случаях эффекты
взаимодействий анализировали с помощью раздельного дисперсионного анализа, множественных и апостериорных (Шеффе, Тьюки) сравнений. При необходимости применялась коррекция значений уровней статистической значимости с помощью поправки Гринхауза – Гейссера.
Личностные и нейрогормональные различия между выделенными группами оценивали
с помощью t-теста Стъюдента для независимых
выборок. Данные субъективных отчетов, фоновые значения КГР (число реакций и амплитуда) и гемодинамических показателей сравнивали с помощью 2-факторного дисперсионного анализа с повторными измерениями: ГР (2:
КИ, АГ) × Знак сценария (ЗС 2: «Радость»,
«Гнев»). Межгрупповые сравнения фоновой
ЭЭГ осуществляли с помощью 5-факторного
дисперсионного анализа: ГР (2: КИ, АГ) × ЭУ
(2: ЗГ, ОГ) × ПШ (2: левое, правое) × САГ (2:
медиальная, латеральная) × КАУД (6: F, FC, C,
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Коренек В.В. и др. Психофизиологический анализ баланса… /c. 122–134
Таблица 1
Топография 24 электродных кластеров, сформированных из одиночных электродных отведений
в латеральной и медиальной коре левого и правого полушарий головного мозга
Зона коры
Латеральная
Медиальная
F
FC
C
CP
P
PO
F
FC
C
CP
P
PO
CP, P, PO). Сравнения ЭЭГ в условиях эмоциональной активации оценивали по 5-факторной
схеме ГР (2: КИ, АГ) × ЭУ (3: ЗГ, «Радость»,
«Гнев») × ПШ (2: левое, правое) × САГ (2: медиальная, латеральная) × КАУД (6: F, FC, C,
CP, P, PO). Эмоциональную реактивность ЭЭГ
сравнивали по 5-факторной схеме ГР (2: КИ,
АГ) × ЗС (2: «Радость», «Гнев») × ПШ (2: левое,
правое) × Латеральность (ЛАТ 2: медиальная,
латеральная) × КАУД (6: F, FC, C, CP, P, PO). Во
всех случаях эффекты взаимодействий анализировали с помощью раздельного дисперсионного анализа, множественных и апостериорных
(Шеффе, Тьюки) сравнений. При необходимости применялась коррекция значений уровней
статистической значимости с помощью поправки Гринхауза – Гейссера.
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
Основные антропометрические, физиологические и психометрические характеристики в
группах здоровых (КИ) и пациентов представлены в табл. 2. Как видно из таблицы, по показателям возраста и индексу массы тела группы
не различались. Офисное АД у КИ было в пределах нормы, а у пациентов превышало нормативные значения. Пациенты также характеризовались повышенными показателями личностной
и ситуативной тревожности, активности системы поведенческого торможения. Анализ конструкта агрессивности выявил у больных повышенные значения показателей раздражения,
негативизма, обиды и чувства вины наряду со
сниженными показателями физической агрессии. По показателям нейрогуморального стаБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Левое полушарие
Правое полушарие
AF7, F7, F5
FT7, FC5
T7, C5
TP7, CP5
P7, P5
PO7, O1
F3, F1
FC3, FC1
C3, C1
CP3, CP1
P3, P1
PO5, PO3
F6, F8, AF8
FC6, FT8
C6, T8
CP6, TP8
P6, P8
O2, PO8
F2, F4
FC2, FC4
C2, C4
CP2, CP4
P2, P4
PO4, PO6
туса у больных установлено сниженное содержание серотонина тромбоцитов (ГР: F1,23 = 6,15,
p = 0,021) (см. табл. 2).
Качество генерации эмоциональных сценариев «Радость» и «Гнев» по показателям
«легкость извлечения» (ГР × ЗС: F1,29 = 1,42,
p = 0,244) и «отчетливость воспроизведения»
(ГР × ЗС: F1,29 < 0,01, p = 0,945) в группах здоровых и больных испытуемых значимо не различалось (рис. 1). В то же время анализ средних
взаимодействий ГР × ЗС (F1,28 = 4,66, p = 0,040)
свидетельствует о достоверном снижении интенсивности переживания целевой эмоции радости (рис. 2).
Объективно общие эффекты эмоциональной
активации характеризовались ростом КГР, АД,
частоты сердечных сокращений (ЧСС), сердечного выброса и общего периферического сосудистого сопротивления (ОПСС) в сочетании со
снижением ударного объема и времени выброса
у всех испытуемых без достоверных различий
между группами (табл. 3).
Сравнительный анализ фоновой осцилляторной активности ЭЭГ выявил снижение дельта- (ГР × ПШ × КАУД: F5,150 = 3,06, p = 0,038) и
тета-1- (ГР × ПШ × КАУД: F5,150 = 3,45, p = 0,023)
мощности в задней коре левого полушария. В
раздельном дисперсионном анализе для пар
электродов в каждом из этих диапазонов установлены взаимодействия факторов ГР × ПШ:
в дельта-полосе — для P7–P8 (F1,30 = 6,18,
p = 0,019) и PO5–PO6 (F1,30 = 5,12, p = 0,031), в
тета-1-полосе – для P7–P8 (F1,30 = 4,31, p = 0,046),
анализ которых указывает на достоверно более
низкую мощность в теменно-затылочной коре
левого полушария по сравнению с правым у
125
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Коренек В.В. и др. Психофизиологический анализ баланса… /c. 122–134
Таблица 2
Значения антропометрических, психометрических и гуморальных показателей в группах здоровых
(контрольных) испытуемых и больных АГ
КИ (n = 16)
АГ (n = 16)
t
p
8,33
8,64
-6,82
-5,70
<0,001
<0,001
39,13
7,92
-0,26
0,795
4,58
26,14
2,78
-0,60
0,554
5,59
42,63
9,16
-2,05
0,050
40,80
7,42
46,5
5,06
-2,51
0,018
Ситуативная гневливость
0,20
0,56
1,13
2,28
-1,53
0,137
Личностная гневливость
8,53
4,09
10,25
5,11
-1,03
0,312
6,73
3,59
8,31
4,73
-1,04
0,306
Показатель
SD
Средние
SD
Систолическое АД, мм рт. ст.
Диастолическое АД, мм рт. ст.
128,73
77,04
6,41
6,36
147,24
92,84
Возраст, лет
38,44
6,90
Индекс массы тела
25,31
Ситуативная тревожность
37,00
Гнев, направленный на себя («anger in»)
Гнев, направленный вовне («anger out»)
STAXI
Личностная тревожность
STAI
Средняя
6,87
4,00
7,13
2,60
-0,21
0,832
Контроль гнева («anger control»)
16,58
5,24
13,94
3,97
1,59
0,123
Физическая агрессия
4,93
1,64
3,77
1,24
2,06
0,050
Косвенная агрессия
3,93
1,82
4,77
1,42
-1,33
0,195
Вербальная агрессия
6,29
2,20
6,85
2,34
-0,64
0,527
Индекс агрессивности
15,50
4,47
16,85
3,78
-0,84
0,408
1,79
4,23
1,79
1,32
0,198
2,16
6,23
2,05
-2,39
0,024
Негативизм
2,00
1,18
3,46
1,39
-2,95
0,007
Обида
3,14
1,03
4,85
1,99
-2,82
0,009
Чувство вины
3,71
1,68
6,31
1,80
-3,87
0,001
Индекс враждебности
8,29
2,05
9,08
2,99
-0,81
0,427
Система торможения поведения
15,60
2,44
17,75
2,18
-2,59
0,015
23,33
2,87
25,06
2,02
-1,95
0,061
10,20
1,52
11,13
1,15
-1,92
0,065
63,93
9,75
66,19
7,93
-0,71
0,485
2,58
0,20
2,39
0,17
2,48
0,021
Система активации поведения, подкрепление
Алекситимия
Содержание серотонина, тромбоцитов/мл
BIS-BAS
Система активации поведения
B-D
5,14
4,29
Раздражение
TAS-26
Подозрительность
П р и м е ч а н и е . SD – среднеквадратичное отклонение; n — количество испытуемых; t, p — значения t-критерия
Стъюдента для независимых выборок и критерия Пирсона соответственно; B-D — тест Басса–Дарки. Курсивом выделены статистически значимые различия.
больных, в то время как у КИ значимые эффекты асимметрии не обнаруживаются (см. рис. 2).
Общие для всех центральные эффекты эмоциональной активации характеризовались ростом мощности ЭЭГ в частотных диапазонах
альфа-2 (по всему корковому плану), альфа-3
(в задних областях коры), бета-1 – гамма (преимущественно в латеральных областях коры),
а также снижением мощности в дельта-диапазоне (по всему корковому плану) (рис. 3). Кро126
ме того, в альфа-2-полосе, вне зависимости от
знака эмоции, увеличение мощности у здоровых людей характеризовалось ее асимметрично большем увеличением в правом полушарии,
а у больных – в левом (ГР × ПШ: F1,29 = 10,41,
p = 0,003).
Межгрупповые различия, зависящие от
знака эмоции, установлены в диапазонах дельта (ГР × ЭУ: F2,60 = 4,41, p = 0,023; ГР × ЭУ ×
КАУД: F10,300 = 3,43, p = 0,020), тета-1 (ГР × ЭУ:
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Коренек В.В. и др. Психофизиологический анализ баланса… /c. 122–134
Рис. 1. Субъективные оценки (M ± m) легкости извлечения сценария из памяти (ЛИ), отчетливости представления в воображении (ОВ) сценариев «Радость» и «Гнев» вызванных эмоций радости и гнева у здоровых людей
и пациентов с АГ (1). Средние значения по шкале эмоциональных профилей, отражающие специфичность
индукции вызванных целевых эмоций сценариях «Радость» и «Гнев» у здоровых людей и пациентов с АГ (2).
Для (1) по вертикали – значения оценок в баллах. Для (2) по горизонтали – профиль вызванных эмоций/
состояний в сценариях «Радость» и «Гнев». Ромбами отмечены достоверные различия между оценками
интенсивности переживания гнева от других эмоций в сценарии «Гнев», а кружками – достоверные
различия между оценками интенсивности переживания радости от других эмоций в сценарии «Радость»
(все различия при p < 0,01). *** – достоверные межгрупповые различия при p < 0,01
F2,58 = 5,97, p = 0,011; ГР × ЭУ × КАУД:F10,290 =
= 2,60, p = 0,052) и тета-2 (ГР × ЭУ × КАУД:
F10,300 = 3,62, p = 0,019). Анализ средних обнаруженных различий в диапазонах медленноволновой активности свидетельствует о достоверно большем снижении мощности в теменнозатылочной коре (зоны P и PO) обоих полушарий при переживании радости у пациентов по
сравнению со здоровыми людьми (см. рис. 3).
Это подтверждается достоверными эффектами фактора Знак Сценария (ЗС) в раздельном
дисперсионном анализе в группе АГ (дельта: F1,15 = 17,12, p = 0,001; тета-1: F1,15 = 12,49,
p = 0,003; тета-2: F1,15 = 7,47, p = 0,015).
В результате проведенного исследования установлено, что пациенты характеризовались повышенными показателями личностной и ситуативной тревожности, активности системы поведенческого торможения, а анализ конструкта
агрессивности выявил у больных повышенные
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
значения показателей раздражения, негативизма, обиды и чувства вины. Это согласуется с
хорошо известными данными о доминировании
в индивидуальном когнитивно-эмоциональном
пространстве пациентов с АГ тревоги и враждебности в сочетании с чувством вины [38].
У исследованных нами больных обнаружены также сниженные концентрации тромбоцитарного серотонина.
На уровне гуморальной регуляции, серотонин – вазоконстриктор, хранящийся в тромбоцитах. Его действие опосредуется различными
типами рецепторов и прекращается серотониновым транспортером. Транспортер является
главным механизмом регуляции концентраций
плазменного серотонина с целью предотвращения вазоконстрикции и обеспечения стабильного тока крови [10, 39]. Отмеченное нами, как и
другими авторами, снижение содержания серотонина тромбоцитов при АГ может быть обусловлено тем, что в гипертензивном состоянии
127
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Коренек В.В. и др. Психофизиологический анализ баланса… /c. 122–134
Рис. 2. Особенности распределения мощности ЭЭГ (ln
μV2/Hz) в состоянии физиологического покоя
(усреднено для ЗГ и ОГ) в дельта- и тета1-диапазонах в теменно-затылочной коре левого и правого полушарий в группах КИ и АГ;
** и *** – достоверность различий при p <
0,01 и p < 0,001 соответственно (1). Карты
статистических различий (сагиттальная проекция) между группами КИ и АГ по показателям мощности ЭЭГ; черными линиями выделены
области статистически достоверных различий
при p < 0,05 (t-критерий Стъюдента) (2)
повышенные концентрации серотонина в плазме вызывают потерю функции захвата тромбоцитами в результате снижения плотности молекул серотонинового транспортера на плазматической мембране [10].
В то же время рядом авторов тромбоциты
рассматриваются в качестве модели серотонинергических нервных терминалей, а содержание серотонина в тромбоцитах и показатели его
обмена в головном мозге коррелируют между
собой [9, 39]. Гипотеза, согласно которой недостаточность функции этой нейромедиаторной
системы в мозге ассоциируется с рядом психосоциальных, биологических и поведенческих
факторов, увеличивающих риск развития сердечно-сосудистых заболеваний, сформулирована сравнительно недавно [41] и с течением времени стала получать убедительное подтверждение в различных исследованиях. Так, например,
в широко распространенном клиническом тесте
оценки состояния серотонинергической функ128
ции в центральной нервной системе (ЦНС) сниженный пролактиновый ответ на внутривенное
введение селективного антагониста обратного
захвата серотонина циталопрама коррелирует
с выраженностью доклинических форм атеросклероза, оцениваемого по толщине интимамедиа. В контексте индивидуальной вариабельности функций эндофенотипы, характеризующиеся снижением функции серотонинергической системы в ЦНС, рассматриваются в
качестве важного патогенетического звена развития сердечно-сосудистых заболеваний [26].
Возникает закономерный вопрос – с помощью
каких механизмов дисфункция серотониновой
системы в ЦНС оказывает влияние на патогенез сердечно-сосудистых заболеваний?
В качестве такого вероятного эндофенотипа выступает опосредованная симпатической
нервной системой стресс-реактивность АД.
Серотониновые рецепторы в ЦНС регулируют
эффекты симпатической нервной системы на
функцию кардиоваскулярной реактивности с
помощью рецепторов 5HT1A и 5HT2, опосредующих соответственно снижение и повышение
активности симпатической нервной системы
[40]. В экспериментальных работах показано,
что увеличение нейротрансмиссии в серотониновой системе путем введения 5-гидрокситриптофана снижает активность симпатических нервов в сердечно-сосудистой системе
[21], а стимуляция 5HT1A-рецепторов ядер шва
продолговатого мозга приводит к сочетанному
снижению активности симпатических нервов и
величины АД [29]. Лечение селективными ингибиторами обратного захвата серотонина связано с уменьшением симпатического выброса
[34] и сниженным риском развития сердечнососудистых заболеваний [33], в то время как
острое истощение серотонина в ЦНС приводит,
например, к повышению кардиоваскулярной
реактивности на ментальный стресс у вылеченных пациентов с тревожными расстройствами
[15]. Таким образом, угнетение активности серотониновой системы мозга приводит к увеличению проявлений повышенной кардиоваскулярной реактивности на стресс, враждебность
и другие психосоциальные факторы, а также
биоповеденческие механизмы, связанные с повышенным риском развития сердечно-сосудистых заболеваний [42], а также ассоциировано с
возрастанием экспрессии большинства компонентов метаболического синдрома [26].
Безусловно, в анализе роли серотониновой
системы мозга в механизмах кардиоваскулярной стресс-реактивности невозможно не учиБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Коренек В.В. и др. Психофизиологический анализ баланса… /c. 122–134
Таблица 3
Реактивность кардиоваскулярных и частоты КГР в группах здоровых (контрольных) испытуемых
и больных АГ при переживании эмоций радости и гнева
КИ (n = 16)
Показатель
САД, мм рт. ст.
ДАД, мм рт. ст.
СрАД, мм рт. ст.
ЧСС, уд/мин
Ударный объем, мл
МО, л/мин
ОПСС, мм рт. ст. × с/мл
Время выброса, с
Количество КГР
Радость
АГ (n = 16)
Гнев
Радость
Гнев
Средняя
SD
Средняя
SD
Средняя
SD
Средняя
SD
10,77
6,77
9,06
3,18
-4,72
-0,04
0,10
-0,01
1,11
5,84
4,58
4,86
3,46
8,57
0,52
0,10
0,01
3,34
10,68
6,88
8,84
6,02
-6,16
0,06
0,08
-0,01
2,11
9,54
4,99
6,43
6,77
11,23
0,74
0,11
0,01
4,36
10,33
6,30
8,59
2,68
-2,64
0,16
0,04
0,00
2,11
8,26
6,12
6,56
4,17
16,08
1,25
0,31
0,01
4,89
12,63
7,54
10,06
4,95
-3,66
0,31
0,04
-0,01
2,07
6,55
5,81
5,63
5,70
16,01
1,17
0,29
0,01
5,16
F
df
p
40,93
36,08
47,89
23,59
3,40
1,06
1,92
11,57
10,30
2, 60
2, 60
2, 60
2, 60
2, 60
2, 60
2, 60
2, 60
2,48
< 0,001
< 0,001
< 0,001
< 0,001
0,060
0,333
0,167
< 0,001
< 0,001
П р и м е ч а н и е . Показатели реактивности рассчитаны по отношению к фону; SD – среднеквадратичное отклонение; n — количество испытуемых; F, df и p — значения критерия Фишера, число степеней свободы и статистическая значимость для фактора экспериментального условия в 2-факторном дисперсионном анализе ГР (2: КИ, АГ) × ЭУ
(3: фон, сценарии «Радость», «Гнев»).
тывать вклад генетических факторов. Важное
место в данном ряду занимают гены, вовлеченные в регуляцию синтеза, высвобождения,
обратного захвата и метаболизма серотонина,
а также в кодирование рецепторов, опосредующих эффекты серотонина на эндофенотипы,
характеризующиеся склонностью к развитию
заболеваний сердечно-сосудистой системы
[40]. Установлено, например, что функциональный полиморфизм генов серотонинового транспортера (5HTTLPR) и моноаминооксидазы А
(MAOA-uVNTR) модулируют пролактиновый
ответ на агенты, увеличивающие содержание серотонина в синапсах ЦНС [23]. Генотип
5HTTLPR влияет на уровни ведущего метаболита серотонина в мозге – 5-оксииндолуксусной кислоты [42], ассоциируется с повышенной
реактивностью САД, ДАД и ЧСС на ментальный и эмоциональный стресс [11, 28, 42].
С учетом изложенного выше выявленное
нами снижение концентрации тромбоцитарного серотонина у пациентов с высокой вероятностью отражает элементы недостаточности
функций серотонинергической системы в головном мозге, что, в свою очередь, обусловливает
целый ряд психоэмоциональных (повышенная
тревожность, раздражительность, негативизм,
чувства обиды и вины) и поведенческих (повышенная активность «серотониновой» по сути
системы торможения поведения [25]) характеристик пациентов и, возможно реципрокно,
сниженную активность или гипоактивацию
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
мотивационной системы положительного подкрепления.
В качестве индикатора мозговой активности в работе исследована осцилляторная активность ЭЭГ, адекватно отражающая вовлечение
мозговых специализированных систем в механизмы эмоциональной активации и нейровисцеральной интеграции. С помощью избирательно распределенных нейрональных дельта-,
тета-, альфа-, бета- и гамма-сетей осцилляторная активность мозга, формирующая ЭЭГ, управляет его наиболее общими передаточными
функциями, а согласно принципу суперпозиции осцилляций в частотных диапазонах ЭЭГ
интегративные функции мозга формируются
в результате комбинированного действия множественных осцилляторов [8]. По данным фоновой ЭЭГ, пациенты с АГ характеризуются
признаками повышенной тонической активированности левого полушария, отражающиеся
в асимметричном снижении дельта- и тета-1мощности в его центральной и теменной коре.
Как показано в исследованиях с использованием сочетанной регистрации ЭЭГ и КГР, амплитудно-частотный профиль биоэлектрической
фоновой активности мозга, характеризующийся
снижением мощности в низкочастотных диапазонах ЭЭГ в центральной и теменной коре, свидетельствует о базальной нестабильности центральных (корковых) механизмов тонической
активации и их повышенной активированности
[7, 13]. А латерализация снижения в левое полу129
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Коренек В.В. и др. Психофизиологический анализ баланса… /c. 122–134
Рис. 3. Топографическое распределение средних значений (M) реактивности мощности (Δ lnP, μV2/Hz) в 9 исследованных частотных диапазонах при переживании эмоций радости и гнева (по сравнению с состоянием
физиологического покоя) у здоровых людей и пациентов с АГ (1). Достоверность межгрупповых различий
в реактивности мощности ЭЭГ для радости и гнева; черными линиями выделены области статистически достоверных различий при p < 0,05 (t-критерий Стъюдента) (2)
шарие отражает ментальный статус пациентов
с АГ, характеризующийся непрерывной актуализацией в индивидуальном когнитивно-эмоциональном пространстве (внутренний диалог,
генерация образов и пр.) сценариев, связанных
с важнейшим компонентом тревожного стиля
совладания с угрозой – тревожного опасения,
спроецированного в будущее [5, 16, 37].
130
В настоящей работе, целью которой явилась
оценка баланса активности оборонительной и
подкрепляющей мотивационных систем, дизайн исследования подразумевал использование
симметричной (бивалентной) модели «умеренной» эмоциональной активации, основанной на
индукции у испытуемых сопоставимых по выраженности активации, но различающихся по
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Коренек В.В. и др. Психофизиологический анализ баланса… /c. 122–134
знаку, эмоций гнева и радости. «Умеренность»
активации должна была позволить проанализировать характер тонких настроек центральных
и нейровегетативных механизмов, отличающих
пациентов с АГ от здоровых людей. Негативная эмоция гнева выбрана в качестве одной из
мишеней исследования, поскольку враждебный
темперамент, в основе которого лежат частые
эпизоды переживания гнева, сопряженные с
повышенной кардиоваскулярной реактивностью на когнитивно-эмоциональные стрессоры,
предсказывает негативную суточную динамику АД [31], отсутствие его ночного снижения
(«nondipping») [32], развитие симптомов и исходов ЭГ и ИБС [24, 38]. Другой мишенью оказалась эмоция радости, поскольку в последнее
время установлены важные ассоциации положительных эмоций с риском возникновения и
клинической динамикой АГ и ИБС. Показано,
что различные аспекты увеличения экспрессии
положительного аффекта положительно коррелируют с более благоприятными показателями
офисного АД [1] и восстановления после академического стресса [30]. Результаты изучения вариабельности фонового АД в домашних
условиях у 985 женщин и 777 мужчин в возрасте 20–55 лет убедительно показывают, что
только позитивная ре-интерпретация стрессовых событий была значимо ассоциирована с
более благоприятными значениями АД [27]. А
в проспективных исследованиях установлена
обратная корреляция между экспрессией положительного аффекта и частотой возникновения
ИБС и АГ [12, 14].
В нашем случае оказалось, что умеренно гипертензивные пациенты не обнаружили значимо большей кардиоваскулярной реактивности
по сравнению с нормотензивными. Это связано
с природой предлагаемого стрессора (умеренный по выраженности эмоциональной активации и не требующий активного поведенческого
совладания) и соответствует данным других авторов [20]. Не установлены значимые различия
в кардиоваскулярном ответе и на положительную эмоциональную активацию. В то же время
в субъективном пространстве пациентов интенсивность переживания положительных эмоций
оказалась достоверно сниженной. А по данным
анализа сопутствующей осцилляторной активности мозга у больных это сопровождается достоверно более выраженным подавлением мощности в низкочастотных диапазонах ЭЭГ дельта (2–4 Гц), тета-1 (4–6 Гц) и тета-2 (6–8 Гц)
преимущественно в теменно-затылочной коре
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
(зоны P и PO) обоих полушарий мозга. Полученные данные свидетельствуют о гипоактивации подкрепляющей мотивационной системы
мозга у пациентов и повышенном напряжении
осцилляторных систем («electrocortical effort»)
в процессе генерации положительной эмоциональной активации [4]. Повышенное «усилие»
осцилляторных систем отражает сложности в
символизации позитивного аффекта, обусловленные развивающимся уплощением индивидуального эмоционального пространства при
АГ [4, 19]. А поскольку протективная функция
позитивного аффекта подразумевает сниженные фоновые концентрации кортизола и ЧСС
в амбулаторных условиях, а также сниженную
реакцию фибриногена на стандартизованные
ментальные стрессоры [35, 36], обнаруженный
феномен гипоактивации можно рассматривать
в качестве одного из важных патогенетических
факторов нарушения центральных механизмов
регуляции стресс-реактивности АД.
Таким образом, в результате проведенного
исследования установлено следующее.
1. По сравнению со здоровыми людьми,
больные АГ 1–2-й степени характеризуются повышенной личностной и ситуативной тревожностью, раздражением, негативизмом, обидой и
чувством вины, сочетающимися со сниженной
активностью системы торможения поведения.
По данным гуморальных показателей у больных АГ установлены сниженные концентрации
серотонина тромбоцитов.
2. По данным фоновой биоэлектрической
активности мозга пациенты с АГ характеризуются признаками повышенной тонической
активированности левого полушария, отражающимися в асимметричном снижении дельтаи тета-1-мощности в центральной и теменной
коре этого полушария.
3. В сценариях вызванной эмоциональной
активации у пациентов с АГ снижена интенсивность переживания положительных эмоций.
По данным анализа сопутствующей осцилляторной активности мозга у больных это сопровождается достоверно более выраженным, чем
у здоровых лиц, подавлением мощности в низкочастотных диапазонах ЭЭГ дельта (2–4 Гц),
тета-1 (4–6 Гц) и тета-2 (6–8 Гц) преимущественно в теменно-затылочной коре (зоны P и PO)
обоих полушарий мозга.
4. Полученные данные свидетельствуют о
гипоактивации подкрепляющей мотивационной системы мозга у пациентов и повышенном
напряжении осцилляторных систем («electro131
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Коренек В.В. и др. Психофизиологический анализ баланса… /c. 122–134
cortical effort» [4]) в процессе генерации положительной эмоциональной активации. Обнаруженный феномен рассматривается авторами в
качестве одного из важных патогенетических
факторов нарушения центральных механизмов
регуляции стресс-реактивности АД при АГ.
СПИСОК ЛИТЕРАТУРЫ
1. Афтанас Л.И., Брак И.В., Гилинская О.М. и
др. Индивидуальная вариабельность сердечно-сосудистой реактивности при реализации защитного
кардиорефлекса у человека // Рос. физиол. журн.
2008. 94. (2). 163–173.
Aftanas L.I., Brak I.V., Gilinskaia O.M. et al. Individual variability of cardiovascular reactivity during protective cardiac reflex in humans // Ros. fiziol.
zhurn. 2008. 94. (2). 163–173.
2. Гилинский М.А., Латышева Т.Е., Семенова Л.П. Определение катехоламинов, серотонина и
5-гидроксииндолуксусной кислоты в одной пробе
крови // Клин. лаб. диагностика. 2007. (6). 25–28.
Gilinskii M.A., Latysheva T.E., Semenova L.P.
Determination of catechelamines, serotonin, and 5hydroxyindoleacetic acid in a blood sample // Klin.
lab. diagnostika. 2007. (6). 25–28.
3. Кобалава Ж.Д., Котовская Ю.В. Артериальная гипертония: ключи к диагностике и лечению.
М., 2007. 432 c.
Kobalava Zh.D., Kotovskaya Yu.V. Arterial hypertension: keys to diagnostics and treatment. M., 2007.
432 p.
4. Aftanas L., Varlamov A. Associations of alexithymia with anterior and posterior activation asymmetries during evoked emotions: EEG evidence of
right hemisphere «electrocortical effort» // Int. J.
Neurosci. 2004. 114. (11). 1443–1462.
5. Aftanas L.I., Koshkarov V.I., Pokrovskaja V.L.
et al. Pre- and post-stimulus processes in affective
task and еvent-related desynchronization (ERD): do
they discriminate anxiety coping styles // Int. J. Psychophysiol. 1996. 24. 197–212.
6. Aftanas L.I., Lotova N.V., Koshkarov V.I. et al.
Non-linear dynamic complexity of the human EEG
during evoked emotions // Int. J. Psychophysiol.
1998. 28. 63–67.
7. Barry R.J., Clarke A.R., Johnstone S.J. et al.
EEG differences between eyes-closed and eyes-open
resting conditions // Clin. Neurophysiol. 2007. 18.
(12). 2765–2673.
8. Başar E. Oscillations in «brain-body-mind» –
a holistic view including the autonomous system //
Brain Res. 2008. 1235. 2–11.
9. Bianchi M., Moser C., Lazzarini C. et al. Forced swimming test and fluoxetine treatment: in vivo
evidence that peripheral 5-HT in rat platelet-rich plasma mirrors cerebral extracellular 5-HT levels, whilst
132
5-HT in isolated platelets mirrors neuronal 5-HT
changes // Exp. Brain Res. 2002. 143. 191–197.
10. Brenner B., Harney J.T., Ahmed B.A. et al.
Plasma serotonin levels and the platelet serotonin
transporter // J. Neurochem. 2007. 102. (1). 206–
215.
11. Brummett B.H., Siegler I.C., Ashley-Koch A.,
Williams R.B. Effects of 5HTTLPR on cardiovascular
response to an emotional stressor // Psychosom. Med.
2011. 73. (4). 318–222.
12. Clark A., Seidler A., Miller M. Inverse association between sense of humor and coronary heart
disease // Int. J. Cardiol. 2001. 80. (1). 87–88.
13. Clark C.R., Galletly C.A., Ash D.J. et al.
Evidence-based medicine evaluation of electrophysiological studies of the anxiety disorders // Clin. EEG
Neurosci. 2009. 40. (2). 84–112.
14. Das S., O’Keefe J.H. Behavioral cardiology:
recognizing and addressing the profound impact of
psychosocial stress on cardiovascular health // Curr.
Hypertens. Rep. 2008. 10. (5) . 374–381.
15. Davies S.J., Hood S.D., Argyropoulos S.V. et
al. Depleting serotonin enhances both cardiovascular
and psychological stress reactivity in recovered patients with anxiety disorders // J. Clin. Psychopharmacol. 2006. 26. 414–418.
16. Engels A.S., Heller W., Mohanty A. et al.
Specificity of regional brain activity in anxiety types
during emotion processing // Psychophysiology. 2007.
44. (3). 352–363.
17. Gianaros P.J., Sheu L.K. A review of neuroimaging studies of stressor-evoked blood pressure reactivity: emerging evidence for a brain-body pathway
to coronary heart disease risk // Neuroimage. 2009.
47. (3). 922–936.
18. Jennings R.J., Zanstra Y. Is the brain the essential in hypertension? // Neuroimage. 2009. 47.
914–921.
19. Jula A., Salminen J.K., Saarijдrvi S. Alexithymia: a facet of essential hypertension // Hypertension. 1999. 33. (4). 1057–1061.
20. Kaushik R.M., Mahajan S.K., Rajesh V.,
Kaushik R. Stress profile in essential hypertension //
Hypertens. Res. 2004. 27. (9). 619–624.
21. Lehnert H., Lombardi F., Raeder E.A. et al.
Increased release of brain serotonin reduces vulnerability to ventricular fibrillation in the cat // J. Cardiovasc. Pharmacol. 1987. 10. 389–397.
22. Lovallo W.R. Cardiovascular responses to
stress and disease outcomes. A test of the reactivity
hypothesis // Hypertension. 2010. 55. (4). 842–843.
23. Manuck S.B., Flory S.B., Ferrell R.E., Muldoon M.F. Socio-economic status covaries with central nervous system serotonergic responsivity as a
function of allelic variation in the serotonin transporter gene-linked polymorphic region // Psychoneuroendocrinology. 2004. 29. 651– 668.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Коренек В.В. и др. Психофизиологический анализ баланса… /c. 122–134
24. McEwen B.S., Gianaros P.J. Central role of
the brain in stress and adaptation: links to socioeconomic status, health, and disease // Ann. N. Y. Acad.
Sci. 2010. 1186. 190–222.
25. McNaughton N., Corr Ph.J. A two-dimensional neuropsychology of defense: fear/anxiety and
defensive distance // Neurosci. Biobehav. Rev. 2004.
28. 285–305.
26. Muldoon M.F., Mackey R.H., Sutton-Tyrrell K. et al. Lower central serotonergic responsivity
is associated with preclinical carotid artery atherosclerosis // Stroke. 2007. 38. 2228–2233.
27. Nyklícek I., Vingerhoets A. «Adaptive» psychosocial factors in relation to home blood pressure:
a study in the general population of southern Netherlands // Int. J. Behav. Med. 2009. 16. (3). 212–218.
28. Ohira H., Matsunaga M., Isowa T. et al. Polymorphism of the serotonin transporter gene modulates
brain and physiological responses to acute stress in
Japanese men // Stress. 2009. 12. (6). 533–543.
29. Orer H.S., Clement M.E., Barman S.M. et al.
Role of serotonergic neurons in the maintenance of
the 10-Hz rhythm in sympathetic nerve discharge //
Am. J. Physiol. Regul. Integr. Comp. Physiol. 270.
1996. 39. R174–R181.
30. Papousek I., Nauschnegg K., Paechter M. et
al. Trait and state positive affect and cardiovascular
recovery from experimental academic stress // Biol.
Psychol. 2010. 83. (2). 108–115.
31. Pavek K., Taube A. Personality characteristics
influencing determinacy of day and night blood pressure and heart rate // Blood Press. 2009. 18. (1–2).
30–35.
32. Routledge F., McFetridge-Durdle J. Nondipping blood pressure patterns among individuals with
essential hypertension: a review of the literature //
Eur. J. Cardiovasc. Nurs. 2007. 6. (1). 9–26.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
33. Sauer W.H., Berlin J.A., Kimmel S.E. Selective serotonin reuptake inhibitors and myocardial
infarction // Circulation. 2001. 104. 1894–1898.
34. Shores M.M., Pasculaly M., Lewis N.L. et al.
Short-term sertraline treatment suppresses sympathetic
nervous system activity in healthy human subjects //
Psychoneuroendocrinol. 2001. 26. 433–439.
35. Steptoe A., O’Donnell K., Badrick E. et al.
Neuroendocrine and inflammatory factors associated
with positive affect in healthy men and women: the
Whitehall II study // Am. J. Epidemiol. 2008. 167.
(1). 96–102.
36. Steptoe A., Wardle J., Marmot M. Positive
affect and health-related neuroendocrine, cardiovascular, and inflammatory processes // Proc. Natl. Acad.
Sci. USA. 2005. 102. 6508–6512.
37. Stewart J.L., Levin-Silton R., Sass S.M. et
al. Anger style, psychopathology, and regional brain
activity // Emotion. 2008. 8. (5). 701–713.
38. Treiber F.A., Kamarck T., Schneiderman N.
et al. Cardiovascular reactivity and development of
preclinical and clinical disease states // Psychosom.
Med. 2003. 65. 46–62.
39. Watts S.W. The love of a lifetime: 5-HT in
the cardiovascular system // Am. J. Physiol. Regul.
Integr. Comp. Physiol. 2009. 296. (2). R252–R256.
40. Williams R.B. Lower central nervous system
serotonergic function and risk of cardiovascular
disease: where are we, what’s next? // Stroke. 2007.
38. 2213–2214.
41. Williams R.B. Neurobiology, cellular and
molecular biology, and psychosomatic medicine //
Psychosom. Med. 1994. 56. 308–315.
42. Williams R.B., Marchuk D.A., Siegler I.C.
et al. Childhood socioeconomic status and serotonin
transporter gene polymorphism enhance cardiovascular
reactivity to mental stress // Psychosom. Med. 2008.
70. (1). 32–39.
133
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Афтанас Л.И., Гилинская О.М., Коренек В.В. и др. Психофизиологический анализ баланса… /c. 122–134
PSYCHOPHYSIOLOGICAL ANALYSIS OF DEFENSIVE
VS. APPETITIVE MOTIVATIONAL SYSTEMS ACTIVITY BALANCE
IN TREATMENT NAIVE HYPERTENSIVES
Lyubomir Ivanovich AFTANAS, Olga Mikhailovna GILINSKAYA,
Vladimir Viktorovich KORENYOK, Ivan Viktorovich BRACK,
Sergey Valentinovich PAVLOV, Natalia Vladimirovna REVA
Institute of Physiology SB RAMS,
630117, Novosibirsk, Timakov str., 4
Objectives. Using recall generation method for evoking emotions to carry out psychophysiological analysis of the
defensive vs. the appetitive motivational systems activity balance peculiarities and their contribution to central
mechanisms of enhanced cardiovascular stress reactivity in arterial hypertension patients. Materials and Methods.
To address this issue we studied normotensive controls (n = 16) and naive unmedicated hypertensives (n = 16). Heart
rate (HR) and arterial blood pressure (BP), based on the beat-by-beat technology (Finometer®) along with 64-channel EEG were simultaneously recorded while mentally recalling («recall generation» method) recent personal life
events associated with emotional states of anger and joy. Results. At rest the hypertensives exhibited enhanced
basal activation of the left hemisphere as indexed by asymmetrically reduced EEG delta and theta-1 power over the
central and parietal cortex. They also manifested reduced platelet 5-HT concentrations at rest. While experiencing
evoked emotions, the hypertensives were marked by reduced intensity scores of experienced joy that combined
with significantly more pronounced suppression EEG delta (2–4 Hz) and theta (4–6 and 6–8 Hz) sub-bands over
centro-parietal cortex (P and PO regions) bilaterally. Conclusions. The findings evidence that the naive treatmentnaive hypertensives manifest reduced activity of the appetitive motivational system along with enhanced oscillatory
effort («electrocortical effort» – Aftanas, Varlamov, 2004) while generating positive affect. All of the above may
be considered as a putative pathogenetic link to the disturbed central mechanisms of distorted cardiovascular stress
reactivity arterial hypertension.
Key words: brain oscillations, electroencephalogram, delta and theta oscillations, positive emotions, cardiovascular
reactivity, appetitive motivational system, arterial hypertension, naive hypertensives.
Aftanas L.I. – doctor of medical sciences, professor, academician of RAMS, head of the psychophysiology
laboratory, e-mail: l.aftanas@physiol.ru
Gilinskaya O.M. – head of the in-patient department, e-mail: olga.gilinskaya@gmail.com
Korenyok V.V. – researcher of the psychophysiology laboratory, e-mail: korenyok@physiol.ru
Brack I.V. – researcher of the psychophysiology laboratory, e-mail: brack@physiol.ru
Pavlov S.V. – senior researcher of the psychophysiology laboratory, e-mail: pavlov@physiol.ru
Reva N.V. – senior researcher of the psychophysiology laboratory, e-mail: n.v.reva@physiol.ru
134
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
ПРОФИЛАКТИЧЕСКАЯ МЕДИЦИНА
УДК 614.2 : 312.6
ЗДОРОВЬЕ И ФУНКЦИОНАЛЬНОЕ СОСТОЯНИЕ ОРГАНИЗМА ЧЕЛОВЕКА
С ПОЗИЦИЙ ОБЩЕЙ ТЕОРИИ СИСТЕМ
Иван Павлович АРТЮХОВ, Олег Михайлович НОВИКОВ,
Владимир Федорович КАПИТОНОВ, Александр Владимирович БАННИКОВ
ГОУ ВПО Красноярский государственный медицинский университет Минздравсоцразвития РФ
660022, г. Красноярск, ул. Партизана Железняка, 1
С позиций общей теории систем представлено определение «состояние здоровья», которое оценивается по
группам здоровья. В качестве количественной оценки состояния здоровья индивида авторами предложен
формализованный показатель «потенциал здоровья», значения которого определены экспертным путем от 0
до 1,0. Обсуждается понятие «функциональное состояние организма». Предложены онтогенетические уровни функционального состояния организма, которые могут быть применимы при разработке гигиенических
нормативов (стандартов) к работе различного характера и вида как у взрослых, так и у детей.
Ключевые слова: состояние здоровья, потенциал здоровья, функциональное состояние организма, онтогенетические уровни функциональных состояний.
С позиций общей теории систем организм
человека − это сложная открытая система. Из
множества определений системы нами использовано определение М.А. Гайдеса [1]: «система – это группа целенаправленно взаимодействующих элементов». В качестве элементов в
организме выступают подсистемы, которые, по
сути, представляются как специализированные
системы. Например, система кровообращения,
система гомеостаза и т. д.
Генеральной целью организма человека как
системы, по нашему мнению, является сохранение его здоровья на всех этапах онтогенеза.
Таким образом, здоровье является результатом
действия системы «организм».
Возникает вопрос: как оценить здоровье
организма? Существует множество различных
определений термина «здоровье», что указывает на нерешенность методологического аспекта
при оценке деятельности организма как целостной системы [2]. Среди определений «здоровья»
четких критериев для его оценки нами не найдено.
Между тем в научных исследованиях и в
практическом здравоохранении довольно час-
то используется термин «состояние здоровья».
«Состояние здоровья – это та степень приближения к полному здоровью, в которой человек
находится в данный момент» [3]. Руководствуясь этим определением, для оценки состояния
здоровья детей С.М. Громбах [4] предложил
следующие критерии: наличие или отсутствие
хронической патологии, функциональное состояние основных систем организма, резистентность (устойчивость к заболеваниям) организма, уровень и гармоничность физического и
психического развития.
На основе представленных критериев разработана классификация групп здоровья, которая
применяется в практическом здравоохранении
при профилактических осмотрах.
Комплексная оценка состояния здоровья
каждого ребенка или подростка с формализацией результата в виде отнесения к одной из
«групп здоровья» дается с обязательным учетом
всех перечисленных критериев (Приказ Минздрава РФ от 10.12.2003 № 621 «О комплексной
оценке состояния здоровья детей»). Аналогичным образом проводится комплексная оценка
состояния здоровья взрослых.
Артюхов И.П. – д.м.н., проф., зав. кафедрой управления, экономики здравоохранения и
фармации, ректор, e-mail: rеktоrkgти@rаmblеr.rи
Новиков О.М. – д.м.н., проф., рук. академической лаборатории «Здоровье семьи»,
е-mail: oтпovikovl@yaпdex.ru или oтпovikov2@yaпdex.ru
Капитонов В.Ф. – д.м.н., проф. кафедры управления, экономики здравоохранения и фармации,
e-mail: vkарit5@уапdех.rи
Банников А.В. – младший научный сотрудник академической лаборатории «Здоровье семьи»,
e-mail: alex87baп@yaпdex.ru
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
135
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Артюхов И.П., Новиков О.М., Капитонов В.Ф., Банников А.В. Здоровье и функциональное…/c. 135–140
Возвращаясь к критериям здоровья, следует
отметить, что ведущим критерием, по нашему
мнению, является функциональное состояние
основных систем организма. Функциональные
системы реагируют на любое внешнее воздействие. Если его скорость больше скорости изменения функционального состояния организма,
то возникает патология, которая характеризуется либо дефектом (патологическое состояние),
либо болезнью (патологический процесс) [1].
Чаще всего речь идет о таких системах, как дыхание, кровообращение, центральная нервная,
пищеварительная.
Можно полагать, что наряду с функциональным состоянием «частей организма» существует категория функционального состояния целостного организма (ФСО). Это понятие
содержит в себе определенное диалектическое
противоречие, так как включает одновременно
и функцию как динамический процесс, и «состояние» («статус») как статическую характеристику живой системы, которая представлена
категориями «здоровье – болезнь». То есть речь
идет о непрерывно-дискретных характеристиках живой системы при ее взаимодействии с
внешней средой, в том числе с патогенными
факторами. Исходя из изложенного, следует,
что ФСО – это интегральная характеристика
состояния здоровья, которая отражает адаптивные возможности организма и оценивается по
данным изменений функций и структур в текуТаблица 1
щий момент при взаимодействии с факторами
Классификация групп (потенциалов) здоровья
внешней среды [5].
В поисках возможностей количественной
Потенциал
Группа здоровья
оценки
ФСО мы воспользовались периодами
здоровья
клеточного цикла, из 200 типов клеток выбрав
Первая
нейроны. Дело в том, что нейроны с рождения
1,0
(Здоровый ребенок)
до конца жизни организма не подлежат делеВторая А
нию. Основным их свойством является способ(Группа риска. Минимальная степень
ность воспринимать раздражение, возбуждать0,9–0,95
риска формирования хронической
ся, вырабатывать импульс и передавать его дапатологии)
лее по цепи.
Вторая Б
Нервная система регулирует функции всех
(Группа риска. Максимальная степень
тканей и органов, объединяет их в единый ор0,85–0,8
риска формирования хронической
ганизм путем передачи информации по всем
патологии)
звеньям и осуществляет связь с окружающей
Третья
средой.
(Больной ребенок с хронической
0,75–0,7
Нетрудно провести аналогию между клепатологией в стадии компенсации)
точным циклом и жизнью человека. Основные
Четвертая
периоды клеточного цикла – рождение, созре(Больной ребенок с хронической
0,65–0,6
вание, активное функционирование, угасание и
патологией в стадии субкомпенсации)
гибель – в целом соответствуют периодам жизПятая
ни человека.
(Больной ребенок с хронической патоло0,5–0,3
От момента рождения ребенок не только расгией в стадии декомпенсации – инвалид)
тет физически (развивается его костно-мышечная система, увеличивается рост и масса тела),
Таким образом, состояние здоровья организма, которое можно оценить, используя критерии
здоровья, с позиций общей теории систем является результатом действия системы. При этом
результат можно представить в виде качественных категорий состояния здоровья: первая
группа – хорошее, вторая – удовлетворительное
(риска), третья – плохое, четвертая – очень плохое, пятая – критическое (инвалидность).
Количественную оценку состояния здоровья, по нашему мнению, может представить
формализованный показатель – потенциал здоровья.
Потенциал здоровья – это уровень достигнутого или сохранившегося здоровья индивида
к определенному возрасту.
Экспертным путем, следуя логике, нами
определено, что первая группа здоровья – это
100 % здоровье, или 1,0. Другие группы здоровья имеют потенциал ниже 1,0 (табл. 1).
Эмпирические данные свидетельствуют о
том, что в пределах одной группы здоровья потенциал здоровья индивида может иметь разные значения (в пределах интервала). Например, у ребенка с перинатальным поражением
цент ральной нервной системы (группа здоровья
вторая Б) на третьем году жизни возникло косоглазие, которое было устранено путем операции. Потенциал здоровья этого ребенка с 0,8
увеличился до 0,85.
136
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Артюхов И.П., Новиков О.М., Капитонов В.Ф., Банников А.В. Здоровье и функциональное…/c. 135–140
но и «созревает» функционально (постепенно
активируются ферментные системы печени и
желудочно-кишечного тракта, стабилизируется
терморегуляция, претерпевают функциональные изменения система кровообращения, дыхательная и другие системы).
В пубертатный период начинает меняться
гормональный фон, организм готовится к выполнению репродуктивных функций. По разным источникам, до 20–25 лет развитие организма идет по нарастающей, далее наступает
фаза плато (с 25 до 30–35 лет), характеризующаяся максимальной активностью всех функций
организма. После 35 лет постепенно уменьшаются резервные возможности организма, увеличивается интенсивность процессов старения.
Наиболее показательны в этом отношении процессы высшей нервной деятельности и реакции
психики: труднее усваивается новый материал,
больше времени приходится тратить на запоминание информации, усложняются процессы
быстрого реагирования на ситуацию или принятия нестандартных решений. После 60 лет
обычно наблюдается угнетение интеллектуальной деятельности, значительно ухудшается память на текущие события, эмоциональные реакции становятся не всегда адекватными, отмечается склонность к депрессии, что обусловлено
ухудшением кровоснабжения и обмена веществ
в головном мозге, уменьшением числа нейронов
и возрастными дегенеративными изменениями
нервной системы [6].
На основе информации об интенсивности
метаболизма на различных этапах жизни нервной клетки нами разработана математическая модель жизненного цикла ФСО человека.
За эталон принято ФСО здорового человека с
учетом, что он оставался в таком состоянии на
протяжении всей жизни. В качестве основы математической модели выбрано нормальное распределение, которое задается функцией плотности распределения:
f ( x) =
1
2πσ
2
e
–−
( x−μ ) 2
2σ 2
,
где параметр μ — среднее значение (математическое ожидание) случайной величины и указывает координату максимума кривой плотности распределения, а σ² — дисперсия. Модель
представлена в виде графической функции в
двумерном пространстве. Ось у – функциональное состояние человека в текущем возрасте (варьирует в промежутке от 0 до 1). Ось х – возраст человека. При рождении ребенка его фунБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
кциональное состояние находится на низком
уровне, но все же не можем сказать, что равно
нулю. Допустим, что оно равно 0,05. В процессе развития организма происходит увеличение
уровня функционального состояния (степени
зрелости) организма (до 20 лет). В период от 20
до 40 лет его функциональное состояние находится на максимальном уровне развития, после
40 лет функциональная активность начинает
снижаться. Процесс снижения продолжается до
конца жизни.
Учитывая выше изложенные данные, получаем следующее:
у (0) = 0,05
у (20) = 1
у (40) = 1
10
y1 =
− ( x−20) 2
σe
;
2σ2
у2 = 1;
10
y3 =
− ( x−40) 2
σe
.
2σ2
Данная модель (см. рисунок) учитывает возраст до 80 лет, после 80 лет уровень функционального состояния продолжает снижаться.
Естественно полагать, что наличие патологии
снижает не только уровень его функционального состояния, но и зависимый от него уровень
потенциала здоровья (табл. 2).
Нам представляется, что приведенные уровни функционального состояния организма индивида (см. табл. 2) можно расценивать как
уровни зрелости и угасания функционального
состояния здорового и больного человека на
различных этапах онтогенеза. И это обстоятельство следует учитывать при разработке гигиенических нормативов (стандартов) к работе
различного характера и вида как у взрослых,
так и у детей.
Мы сознаем, что представленная закономерность формирования и угасания функционального состояния организма человека является сугубо ориентировочной, что при ее доказательс-
Рис.
Онтогенетическая модель динамики функционального состояния здорового человека
137
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Артюхов И.П., Новиков О.М., Капитонов В.Ф., Банников А.В. Здоровье и функциональное…/c. 135–140
Таблица 2
Онтогенетические уровни функционального состояния (уровни зрелости и угасания)
организма человека в зависимости от состояния и потенциала его здоровья
Группы и потенциалы здоровья
Вторая
Третья
Четвертая
Пятая
0,8
0,7
0,6
0,4
3
4
5
6
7
0,135335283
0,121802
0,108268
0,094735
0,081201
0,054134
0,164474457
0,148027
0,13158
0,115132
0,098685
0,06579
3
0,197898699
0,178109
0,158319
0,138529
0,118739
0,079159
4
0,235746077
0,212171
0,188597
0,165022
0,141448
0,094298
5
0,278037301
0,250234
0,22243
0,194626
0,166822
0,111215
6
0,324652467
0,292187
0,259722
0,227257
0,194791
0,129861
7
0,375311099
0,33778
0,300249
0,262718
0,225187
0,150124
8
0,429557358
0,386602
0,343646
0,30069
0,257734
0,171823
9
0,486752256
0,438077
0,389402
0,340727
0,292051
0,194701
10
0,546074427
0,491467
0,43686
0,382252
0,327645
0,21843
Возраст
Первая
А
Б
1
0,9
1
2
1
2
11
0,60653066
0,545878
0,485225
0,424571
0,363918
0,242612
12
0,666976811
0,600279
0,533581
0,466884
0,400186
0,266791
13
0,726149037
0,653534
0,580919
0,508304
0,435689
0,29046
14
0,782704538
0,704434
0,626164
0,547893
0,469623
0,313082
15
0,835270211
0,751743
0,668216
0,584689
0,501162
0,334108
16
0,882496903
0,794247
0,705998
0,617748
0,529498
0,352999
17
0,923116346
0,830805
0,738493
0,646181
0,55387
0,369247
18
0,955997482
0,860398
0,764798
0,669198
0,573598
0,382399
19
0,980198673
0,882179
0,784159
0,686139
0,588119
0,392079
20
21–40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
0,995012479
1
0,995012479
0,980198673
0,955997482
0,923116346
0,882496903
0,835270211
0,782704538
0,726149037
0,666976811
0,60653066
0,546074427
0,486752256
0,429557358
0,375311099
0,324652467
0,278037301
0,235746077
0,895511
0,9
0,895511
0,882179
0,860398
0,830805
0,794247
0,751743
0,704434
0,653534
0,600279
0,545878
0,491467
0,438077
0,386602
0,33778
0,292187
0,250234
0,212171
0,79601
0,8
0,79601
0,784159
0,764798
0,738493
0,705998
0,668216
0,626164
0,580919
0,533581
0,485225
0,43686
0,389402
0,343646
0,300249
0,259722
0,22243
0,188597
0,696509
0,7
0,696509
0,686139
0,669198
0,646181
0,617748
0,584689
0,547893
0,508304
0,466884
0,424571
0,382252
0,340727
0,30069
0,262718
0,227257
0,194626
0,165022
0,597007
0,6
0,597007
0,588119
0,573598
0,55387
0,529498
0,501162
0,469623
0,435689
0,400186
0,363918
0,327645
0,292051
0,257734
0,225187
0,194791
0,166822
0,141448
0,398005
0,4
0,398005
0,392079
0,382399
0,369247
0,352999
0,334108
0,313082
0,29046
0,266791
0,242612
0,21843
0,194701
0,171823
0,150124
0,129861
0,111215
0,094298
138
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Артюхов И.П., Новиков О.М., Капитонов В.Ф., Банников А.В. Здоровье и функциональное…/c. 135–140
Окончание табл. 2
1
2
3
4
5
6
7
58
59
0,197898699
0,164474457
0,178109
0,148027
0,158319
0,13158
0,138529
0,115132
0,118739
0,098685
0,079159
0,06579
60
0,135335283
0,121802
0,108268
0,094735
0,081201
0,054134
61
0,324652467
0,292187
0,259722
0,227257
0,194791
0,129861
62
0,290923807
0,261831
0,232739
0,203647
0,174554
0,11637
63
0,25937256
0,233435
0,207498
0,181561
0,155624
0,103749
64
0,230066299
0,20706
0,184053
0,161046
0,13804
0,092027
65
0,203032796
0,18273
0,162426
0,142123
0,12182
0,081213
66
0,17826398
0,160438
0,142611
0,124785
0,106958
0,071306
67
0,155720293
0,140148
0,124576
0,109004
0,093432
0,062288
68
0,135335283
0,121802
0,108268
0,094735
0,081201
0,054134
69
0,117020264
0,105318
0,093616
0,081914
0,070212
0,046808
70
0,1006689
0,090602
0,080535
0,070468
0,060401
0,040268
71
0,086161606
0,077545
0,068929
0,060313
0,051697
0,034465
72
0,073369651
0,066033
0,058696
0,051359
0,044022
0,029348
73
0,062158903
0,055943
0,049727
0,043511
0,037295
0,024864
74
0,052393141
0,047154
0,041915
0,036675
0,031436
0,020957
75
0,043936934
0,039543
0,03515
0,030756
0,026362
0,017575
76
0,036658042
0,032992
0,029326
0,025661
0,021995
0,014663
77
0,030429372
0,027386
0,024343
0,021301
0,018258
0,012172
78
0,025130489
0,022617
0,020104
0,017591
0,015078
0,010052
79
0,020648718
0,018584
0,016519
0,014454
0,012389
0,008259
80
0,016879884
0,015192
0,013504
0,011816
0,010128
0,006752
тве необходимы дополнительные исследования,
но при этом можно предположить существование подобных закономерностей на популяционном уровне.
ЗАКЛЮЧЕНИЕ
Представленная в первой части статьи информация о состоянии и потенциале здоровья
нашла свое применение в научных исследованиях, касающихся семейного человеческого капитала и капитала здоровья индивида [7]. Вторая
часть носит дискуссионный характер. Во-первых, потому, что само понятие «функциональное состояние организма» еще не является общепринятым. Во-вторых, обсуждению подлежит аппроксимация клеточного цикла на организменный уровень. Проверке, на наш взгляд,
подлежит синхронность снижения уровня потенциала здоровья и уровня функционального
состояния организма при возникновении патологии.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
СПИСОК ЛИТЕРАТУРЫ
1. Гайдес М.А. Общая теория систем (системы и системный анализ). ГЛОБУС-ПРЕСС, 2005.
202 с.
Gaides M.A. General systems theory (systems and
operations analysis). GLOBUS-PRESS, 2005. 202 p.
2. Крутько В.Н. Подходы к «Общей теории
здоровья» // Физиол. человека. 1994. (6). 34−42.
Krut`ko V.N. Approaches to the «General theory
of health» // Fisiol. cheloveka. 1994. (6). 34−42.
3. Громбах С.М. Оценка здоровья детей и подростков // Вестн. АМН СССР. 1973. (7). 3–6.
Grombakh S.M. Assessment of children` and
adolescents` health // Vestn. AMN SSSR. 1973. (7).
3–6.
4. Громбах С.М. Социально-гигиенический аспект оценки состояния здоровья детей и подростков // Вестн. АМН СССР. 1984. (4). 75–80.
Grombakh S.M. Sociohygienic aspect of assessment of children` and adolescents` health condition //
Vestn. AMN SSSR. 1984. (4). 75–80.
5. Воробьев К.П. Клинико-физиологический
анализ категорий функционального состояния ор139
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Артюхов И.П., Новиков О.М., Капитонов В.Ф., Банников А.В. Здоровье и функциональное…/c. 135–140
ганизма в интенсивной терапии // Вестн. интенсивной терапии. 2001. (2). 3–8.
Vorob`ev K.P. Clinical-physiological analysis of
categories of functional state of organism under intensive therapy // Vestn. intensivnoi terapii. 2001. (2).
3–8.
6. Регистр лекарственных средств России
РЛС − Пациент 2003. ООО «РЛС-ПАТЕНТ». 2004.
304 с.
Russian medicinal products register MPR — Patient 2003. Llc «RLS-PATENT». 2004. 304 с.
7. Артюхов И.П., Новиков О.М., Капитонов В. Ф. Семейный человеческий капитал // Проблемы управления здравоохранением. 2008. (1).
32–34.
Artyukhov I.P., Novikov O.M., Kapitonov V.F.
Family human capital assets // Problemy upravleniya
zdravookhraneniem. 2008. (1). 32–34.
HEALТН AND FUNCTIONAL STATE OF HUMAN ORGANIZM FROM
THE PERSPECTIVE OF ТНЕ GENERAL THEORY OF SYSTEMS
Ivan Pavlovich ARTYUKHOV, Oleg Mikhailovich NOVIKOV,
Vladimir Fedorovich КAPITONOV, Aleksandr Vladimirovich BANNIKOV
Krasпoyarsk State Medical University
660022, Krasпoyarsk, Partizan Zheleznyak str., 1
The definition of «health state» estimated at health groups has been interpreted from the position of the general systems theory. The formalized indicator of «health potential» which values аrе defi ned bу expertise from 0 to 1,0 has
been offered as а quantitative estimation of a person health state. The concept of «а functional state of аn organism»
has been discussed. The ontogenetic levels of аn organism functional state have been offered. These levels can be
applied to the development of hygienic specifications (standards) of various character and kind of activities both at
adults and at children.
Keywords: health state, health potential, functional condition of аn organism, levels of ontogenetic functional
conditions.
Artyukhov I.Р. – doctor of medical sciences, professor, head of the chair for managements, economics
of public health services and pharmacy, rector, e-mail: rektorkgmu@rambler.ru
Novikov О.М. – doctor of medical sciences, professor, head of the academic laboratory for family health,
e-mail: omnovikov1@yandex.ru
Kapitonov V.F. – doctor of medical sciences, professor of the chair for managements, economics of public health
services and pharmacy, e-mail: vkapit5@yandex.ru
Bannikov А.V. – junior researcher of the academic laboratory for family health, e-mail: alex87ban@yandex.ru
140
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК 615.277.3
ИССЛЕДОВАНИЕ ПРОЦЕССА ОБРАЗОВАНИЯ КОНЪЮГАТОВ
ДЛЯ СОЗДАНИЯ ВАКЦИННЫХ КОНСТРУКЦИЙ
Екатерина Александровна ВОЛОСНИКОВА
ФБУН ИМБТ ГНЦ ВБ Вектор
633010, Новосибирская обл., г. Бердск, а/я 112
Исследован процесс образования конъюгатов антигенов с полимерным носителем с целью повышения их
иммуногенности. Получаемые конъюгаты предназначались для создания иммуногенов в виде вирусоподобных частиц. Поэтому они содержали кроме белка-антигена и декстрана спермидин для ионной связи молекул конъюгата с центральной нуклеиновой кислотой. Показано, что варьируя количество образующихся
активных групп при активации полимера, длительность реакций конъюгирования и последовательность
внесения компонентов, можно получать конъюгаты с заранее заданными свойствами.
Ключевые слова: иммуногенность, конъюгат, полимеры, гель-фильтрация, окислитель.
Известно, что существенной проблемой при
создании вакцин нередко является слабая иммуногенность антигенов. Одним из способов ее
решения может быть конъюгирование антигенов с полимерными носителями (пегилирование и др.) или создание искусственных иммуногенов. С этой точки зрения большой интерес представляют конструкции, имитирующие
структуру патогена. Как известно, в вирусах
нуклеиновая кислота окружена капсидной оболочкой, состоящей из белков. Ранее Л.Р. Лебедевым с соавторами [1] была предложена структура молекулярной конструкции, так называемой
вирусоподобной частицы, которая может быть
использована для транспортировки и представления как белковых антигенов, так и ДНК-вакцин. Ключевым моментом при сборке такой
конструкции является формирование за счет
ионных сил связи полимерной полисахаридной
матрицы, конъюгированной с молекулами белков-антигенов, с центральной нуклеиновой кислотой, для чего необходимо придать молекулам
матрицы положительный заряд.
В связи с этим целью данной работы являлся подбор количественных соотношений
и исследование условий проведения процесса
конъюгирования компонентов конструкции: декстрана, белка и небольших положительно заряженных молекул спермидина.
МАТЕРИАЛ И МЕТОДЫ
Белок-антиген представлял собой рекомбинантный белок TBI с молекулярной массой
21000 ± 1000 Да, искусственный Т- и В-клеточный иммуноген ВИЧ [2, 3], полученный из
E. coli JM-103/pTBI. Очистку белка проводили
хроматографическими методами [4].
В качестве полимерной матрицы был выбран
биодеградируемый полимер – декстран с молекулярной массой 60000 Да (полиглюкин). Для
придания молекуле конъюгата положительного
заряда использовали спермидин (Sigma), молекулярная масса 145 Да. В качестве центральной
нуклеиновой кислоты при получении частиц
использовали дрожжевую двуспиральную кислоту (дсРНК) (ООО «Диафарм», г. Бердск), полученную из киллерного штамма дрожжей Saccharomyces cerevisiae Y 448.
Для получения конъюгатов использовали реакцию Малапрада (М. р.) [5], которую
проводили при комнатной температуре (+20 –
+25 °С). Растворы декстрана и периодата натрия
cмешивали в соотношении 1 : 25 (моль/моль).
Через выбранные промежутки времени аликвоты раствора подвергали гель-фильтрации на
сефадексе G-25 и к активированному декстрану добавляли спермидин либо антиген – белок
TBI. О полноте прохождения реакции судили,
интерпретируя результаты, полученные с помощью методов гель-фильтрации (на колонке с се-
Волосникова Е.А. – аспирант
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
141
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Волосникова Е.А. Исследование процесса образования конъюгатов… /c. 141–145
фадексом G-150) и денситометрически с помощью электрофореза (в 12%-м полиакриламидном геле в денатурирующих условиях) [6, 7].
Показатель полноты реакции (%) определяли
как отношение количества спермидина/белка
в составе конъюгата к исходному содержанию
компонентов в реакционной смеси.
Результаты указаны в виде среднего арифметического и его стандартного отклонения.
Достоверность различий определяли с использованием критерия Манна–Уитни и считали
статистически значимыми при p < 0,05.
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
В связи с тем, что молекулы белков содержат не одну реакционноспособную аминогруппу, возникает вероятность при избыточной степени окисления декстрана в реакции конъюгирования получить вместо отдельных молекул
конъюгата поперечно сшитый гель. Поэтому
для получения несвязанных между собой молекул конъюгатов реакцию конъюгирования проводили при ограниченной степени окисления
матрицы.
Было изучено действие основных факторов,
оказывающих влияние на процесс образования
конъюгатов.
Влияние времени инкубации окислителя
с декстраном на последующее образование
конъюгатов. Конъюгаты синтезировали, как
описано в разделе «Материал и методы».
О протекании реакции окисления судили по
полноте вхождения компонентов в конъюгат.
Результаты гель-фильтрации показали, что пос-
Рис. 1. Степень включения спермидина в состав конъюгатов декстран–спермидин в зависимости от
длительности активации декстрана
142
ле 15-минутной активации декстрана количество спермидина, вступившего в реакцию, почти
в 2 раза меньше, чем при инкубации смеси в
течение 30 и 60 мин (рис. 1). Аналогичные результаты были получены в реакции конъюгирования декстрана с белком. После 150-минутной
активации декстрана пик образующихся впоследствии конъюгатов на электрофореграмме
был гетерогенным (размытым), что может свидетельствовать о частичном разрушении конъюгата. То есть оптимальная длительность активации декстрана для последующего включения
молекул белка и спермидина в состав конъюгата составляет 30–60 мин, при этом уровень
включения компонентов в конъюгат близок к
100 %.
Влияние соотношения концентраций периодата натрия и декстрана при активации
на скорость реакции и характеристики получаемых конъюгатов. Эксперименты по получению конъюгатов проводили по аналогичной
схеме. Растворы декстрана и периодата натрия
смешивали в соотношении на 1 моль полимера – 5, 10, 20, 40, 80 моль окислителя. Смесь
инкубировали в течение 60 мин.
На рис. 2 представлена электрофореграмма
состава реакционной смеси после проведения
реакции конъюгирования декстрана с белком
TBI.
Видно, что при соотношениях окислитель/декстран (моль/моль) ниже значений 1 : 5
и 1 : 10 последующее образование конъюгатов
декстран-TBI происходит в низких количествах. Полнота реакции (более 95 %) достигалась
при соотношении окислитель/декстран 1 : 20 и
выше. Аналогичные закономерности были обнаружены при анализе конъюгатов декстранспермидин. При меньшей степени окисления
образование конъюгата декстрана со спермидином шло более активно, чем с белком. Возможно, это связано с большей доступностью активированных групп декстрана для спермидина,
по сравнению с молекулами белка. Дело в том,
что, как показывают теоретические расчеты с
учетом молекулярных масс компонентов, активированных мономеров декстрана на поверхности глобулы в доступном для реакции стерическом состоянии (среднестатистически) для
белка TBI может находиться лишь 1 из 10–12, а
для спермидина – 10 из 10–12 [1].
Влияние длительности реакции конъюгирования на характеристики конъюгатов.
Конъюгаты готовили, как описано в разделе
«Материал и методы». Растворы декстрана и
периодата натрия смешивали в соотношении на
1 моль полимера – 20 моль периодата и инкуБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Волосникова Е.А. Исследование процесса образования конъюгатов… /c. 141–145
Рис. 2. Электрофореграмма образцов конъюгатов декстран-TBI в 12%-м полиакриламидном геле. М – белкимаркеры (14400 – 66000 Да); 1 – белок TBI (контроль); 2, 3, 4, 5, 6 – образцы, полученные при соотношении окислитель/декстран 1 : 5, 1 : 10, 1 : 20, 1 : 40 и 1 : 80 соответственно
бировали в течение 60 мин. К активированному декстрану добавляли белок и спермидин в
соотношении на 1 молекулу декстрана – 1 молекула белка TBI/ 10 молекул спермидина.
Данные, представленные на рис. 3, свидетельствуют о том, что практически полное
включение спермидина в конъюгат при использованном соотношении компонентов достигается через 80–120 мин от начала реакции,
белка – через 120–160 мин.
Образование конъюгатов спермидина с декстраном происходит быстрее, чем декстрана
с белком и, следовательно, при одновременном
внесении компонентов на выходе реакции следует ожидать преимущественно молекулы конъюгата декстрана со спермидином. Поэтому для
получения конъюгата с заданными соотношениями (на 1 молекулу декстрана – 1 молекула
белка и 10 молекул спермидина) была предложена следующая схема: после активации полимера и удаления окислителя к нему добавляли
белок (1 моль/1 моль), инкубировали 120 мин,
после этого вносили спермидин (10 моль/1 моль)
и продолжали инкубацию еще 120 мин.
Рис. 3. Динамика образования конъюгатов спермидина
(серые столбики) и TBI (черные столбики) с
декстраном в зависимости от длительности
конъюгирования
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Влияние количества спермидина, введенного в состав конъюгата, на его способность
образовывать вирусоподобные частицы с нуклеиновыми кислотами. Конъюгаты готовили,
как описано в разделе «Материал и методы».
Растворы декстрана (полиглюкина) и периодата натрия смешивали в молярном соотношении
1/20 и инкубировали в течение 60 мин. К раствору активированного полиглюкина добавляли белок TBI в соотношении 1 моль декстрана:
1 моль TBI, и после 120 мин инкубации – раствор спермидина в соотношении на 1 моль полимера – 3, 10 или 50 моль спермидина, инкубировали 120 мин.
Анализ конъюгатов методом гель-фильтрации на сефадексе G-150 показал, что при увеличении количества спермидина, введенного в
конъюгат, более 50 молекул на молекулу полиглюкина молекулярная масса конъюгата сдвигается в низкомолекулярную область. Это, вероятно, является следствием разрывов молекул
декстрана.
Полученные конъюгаты были исследованы
на способность образовывать вирусоподобные
частицы с дсРНК.
На электрофореграмме (рис. 4) видно, что
комплексы, образованные двуспиральной РНК
(в виде L- и M-форм), покрытой конъюгатом
полиглюкин-спермидин, имеют заметно меньшую подвижность, чем дсРНК, в том случае,
если молярное соотношение спермидин/полиглюкин в конъюгатах было выше 10:1. Это
можно объяснить увеличением молекулярной
массы дсРНК в результате образования комплекса и тем, что положительно заряженный
спермидин частично нейтрализует в комплексе
отрицательный заряд РНК.
Факт сборки вирусоподобных частиц, полученных с использованием конъюгатов в молярном соотношении спермидин и полиглюкин
10/1, подтвержден электронно-микроскопичес143
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Волосникова Е.А. Исследование процесса образования конъюгатов… /c. 141–145
конъюгаты полисахаридов с белками-антигенами с заранее заданными свойствами.
БЛАГОДАРНОСТИ
Выражаю благодарность за постоянную помощь в работе научному руководителю д.м.н.
Л.Р. Лебедеву
СПИСОК ЛИТЕРАТУРЫ
Рис. 4. Электрофореграмма препаратов вирусоподобных частиц, полученных при молярных соотношениях спермидин/полиглюкин: 1 – 3 : 1;
2 – 10 : 1; 3 – 50 : 1; к – исходная дсРНК
ким исследованием, в ходе которого показано,
что полученные вирусоподобные частицы имели шарообразный вид с размерами 25–40 нм
[1, 8].
ЗАКЛЮЧЕНИЕ
1. Показано, что оптимальное время активации полисахаридной матрицы (инкубации
окислителя с декстраном) для последующего
образования конъюгатов составляет 30–60 мин,
оптимальное соотношение концентраций компонентов – 1 : 20 (моль/моль).
2. Для образования вирусоподобных частиц
с дсРНК соотношение спермидина и декстрана
в конъюгате должно быть не менее 10 : 1.
3. Установлен порядок внесения компонентов в реакционную смесь для получения конъюгатов заданного состава (на одну молекулу
полиглюкина – одна молекула белка TBI и 10
молекул спермидина). Показано, что для этого
необходимо первоначально к активированной
матрице добавлять белок, после 120 мин инкубации вносить спермидин, продолжая инкубацию реакционной смеси еще 120 мин.
Таким образом, установлено, что варьируя
количество образующихся активных групп при
активации полимера, длительность реакций
конъюгирования с компонентами и последовательность внесения последних, можно получать
144
1. Лебедев Л.Р., Гилева И.П., Карпенко Л.И.,
Ерошкин А.М. Конструирование оригинальных искусственных иммуногенов – кандидатов в вакцины против HIV-I // Молек. генетика, микробиол.
вирусол. 2000. (3). 36–40.
Lebedev L.R., Gileva I.P., Karpenko L.I., Eroshkin A.M., Construction of original artificial immunogens – candidates for a vaccine against HIV-I //
Molek. genetika, mikrobiol. virusol. 2000. (3). 36–
40.
2. Eroshkin A.M., Karginova E.A., Gileva I.P.
et al. Design of four-helix bundle protein as a candidate for HIV vaccine // Protein Eng. 1995. 8. (2).
167–173.
3. Ерошкин А.М., Жилкин П.А., Шамин В.В.
Новый подход к разработке вакцины против
ВИЧ-1, основанный на искусственных белках с
предсказанной третичной структурой // Молек.
биол. 1993. 27. (3). 538–551.
Eroshkin A.M., Zhilkin P.A., Shamin V.V. A new
approach to the development of a vaccine against
HIV-1 based on artificial proteins with the predicted
tertiary structure // Molek. biol. 1993. 27. (3). 538–
551.
4. Волосникова Е.А., Лебедев Л.Р., Акулова Н. И. Очистка рекомбинантного белка TBI – антигена ВИЧ // Биотехнология. 2010. (4). 65–68.
Volosnikova E.A., Lebedev L.R., Akulova N.I.
Purification of the recombinant TBI protein — HIV
antigen // Biotechnologiya. 2010. (4). 65–68
5. http://www.ximicat.com/info.php?id=3292
6. Маниатис Т., Фрич Э., Сэмбрук Дж. Молекулярное клонирование: Пер. с англ. М., 1984.
Maniatis T., Fritsch E., Sambrook J. Molecular
cloning. М., 1984.
7. Laemmli U.K. Cleavage of structural proteins
during the assembly of the head of bacteriophage
T4 // Nature. 1970. (227). 680–685.
8. Lebedev L.R., Karpenko L.I., Poryvaeva V.A.
et al. Construction of virus-like particles exposing
HIV-I epitops // Mol. Biol. 2000. 34. (3). 413–417.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Волосникова Е.А. Исследование процесса образования конъюгатов… /c. 141–145
THE STUDY OF THE PROCESS OF FORMING CONJUGATES
TO CREATE VACCINE CONSTRUCTS
Eсatherine Alexandrovna VOLOSNIKOVA
FSRI SRC VB Vector IMBT
633010, Novosibirsk Region, Berdsk
The process of forming antigens-polymeric carrier conjugates has been studied to improve their immunogenicity.
These conjugates were used to create immunogens in the form of virus-like particles. In addition to protein-antigen
and dextran, they contained spermidine to form ionic bonds of the conjugate molecules with the central nucleic acid.
It has been shown that it is possible to create conjugates with predetermined properties by varying the number of
active groups during activation of the polymer, the duration of the conjugation reactions and the sequence of adding
the components.
Key words: immunogenicity. conjugated polymers, gel-filtration, oxidant.
Volosnikova E.A. – postgraduate student
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
145
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
УДК: 611+577
БИОХИМИЧЕСКИЕ ПОКАЗАТЕЛИ КРОВИ КОРЕННЫХ ЖИТЕЛЕЙ
НИЗКОГОРЬЯ И СРЕДНЕГОРЬЯ ГОРНОГО АЛТАЯ РАЗНЫХ
НАЦИОНАЛЬНОСТЕЙ В СВЯЗИ С ОСОБЕННОСТЯМИ ПИТАНИЯ
Елена Анатольевна ЧАНЧАЕВА1, Роман Иделевич АЙЗМАН2
1 ГОУ
ВПО Горно-Алтайский государственный университет
649000, г. Горно-Алтайск, ул. Ленкина, 1
2 ГОУ
ВПО Новосибирский государственный педагогический университет
645126, г. Новосибирск, ул. Вилюйская, 28
Оценивали особенности питания коренных жителей русской, алтайской и казахской национальностей, проживающих в условиях низкогорья и среднегорья Южного Алтая. Выявлены межпопуляционные различия
в питании жителей этого региона, что отражалось в фактическом потреблении макронутриентов и было
обусловлено климатогеографическими условиями проживания, национальными, возрастно-половыми особенностями и пищевыми стереотипами. Биохимические показатели крови коррелировали с количественным
составом макроэлементов рациона.
Ключевые слова: фактическое питание, биохимические показатели крови, аборигены Южного Алтая,
адаптация.
Питание как экологический фактор оказывает определяющее влияние на тип обмена
веществ, функциональную активность органов
пищеварения и ферментативный статус, которые закрепляются наследственно. Пища, соответствующая сформированным эволюцией механизмам усвоения питательных веществ, обеспечивает адекватное функционирование этих
механизмов у аборигенов в конкретных климатических условиях, соответствует их традиционному образу деятельности и условиям жизни [1, 2]. Известно, что даже в рамках одного
региона существуют индивидуальные особенности метаболизма, а поскольку каждая из ландшафтных зон населена, как правило, людьми
различной этнической, а иногда и расовой принадлежности, становится возможным выявить
особенности гомеостаза в различных этносах,
а также оценить возможность их генетической
детерминации.
Цель исследования заключалась в оценке
биохимических показателей крови в связи с
особенностями питания коренного населения
русской, алтайской и казахской национальностей, проживающих в условиях низкогорья и
среднегорья Горного Алтая.
МАТЕРИАЛ И МЕТОДЫ
В исследовании проведен анализ биохимических показателей крови и фактического питания коренного населения среднегорья (алтайцы
из рода теленгитов и казахи, 1900 м над уровнем моря) и низкогорья (алтайцы из рода алтайкижи и русские, 800 м) Горного Алтая. Всего
обследован 461 человек в возрасте от 20 до 59
лет, из них 119 русских, 111 алтайцев низкогорья, 114 алтайцев среднегорья и 117 казахов.
Все обследованные были разделены на группы по месту проживания, возрасту, половой и
национальной принадлежности. Фактическое
питание оценивали анкетно-весовым методом
[3] в летне-осенний период. Анкетированию
предшествовала разъяснительная работа о целях и задачах проводимого наблюдения. Заполнение анкеты производилось обследователем в
процессе беседы. При изучении питания с помощью анкет устанавливали ассортимент потребляемых пищевых продуктов, их количество,
наименование съеденных блюд, режим питания
семьи в целом и отдельных членов семьи. В анкете предусматривались следующие разделы:
1) характеристика условий труда, позволяющая судить о режиме труда и энерготратах;
Чанчаева Е.А. – к.б.н., доцент кафедры безопасности жизнедеятельности, анатомии и физиологии,
e-mail: chan.73@mail.ru
Айзман Р.И. – д.б.н., проф. кафедры анатомии, физиологии и безопасности жизнедеятельности,
e-mail: roman.aizman@mail.ru
146
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Чанчаева Е.А., Айзман Р.И. Биохимические показатели крови коренных жителей низкогорья… /c. 146–153
2) экономическая характеристика семьи –
бюджет, приусадебное хозяйство; эти сведения
показывают экономические возможности семьи
и позволяют в какой-то мере контролировать
правильность сообщаемых данных о питании;
3) режим питания;
4) качественная и количественная характеристика питания за прошедший день.
Поскольку анкетный метод применялся
лишь для получения ориентировочных предварительных сведений о питании населения, он
дополнялся весовым методом. В качестве обследователей привлекались средние медицинские работники, студенты биологического факультета, медицинских училищ. Обследователи
владели необходимым минимумом санитарногигиенических знаний, были знакомы с питанием, национальным языком и обычаями обследуемого населения. В связи с тем, что для всех
обследованных было характерно однообразное
питание, срок наблюдения опросно-весового
метода был ограничен 7 днями. Непременным
условием для оценки потребления являлось
точное определение количества использованных для питания продуктов. Это достигалось
следующим образом: обследователь ежедневно
посещал все семьи. В начале обследования выяснял, какой посудой пользуется хозяйка при
отмеривании различных продуктов при приготовлении пищи. Краткая табличка емкости
посуды и веса различных продуктов записывалась на полях карты. Сведения о питании в
течение дня заносили в карты «Режим питания
по дням». На основании полученных данных с
помощью таблиц «Химический состав пищевых продуктов» [4, 5] определяли химический
состав продуктов суточного рациона (содержание белков, жиров, углеводов). Оценивали качественный состав жиров: насыщенных (НЖК),
мононенасыщенных (МНЖК), полиненасыщенных жирных кислот (ПНЖК) – ω-6, ω-3.
При участии средних медицинских работников в условиях фельдшерско-акушерского
пункта собирали пробы крови, взятой натощак
из локтевой вены. После центрифугирования
образцов крови отбирали плазму. Замороженную плазму транспортировали в сосуде Дьюара, наполненном жидким азотом, для оценки
биохимических показателей. Биохимический
анализ крови проводили в Республиканской
клинической лаборатории. Процедура проведения эксперимента соответствовала стандартам
Хельсинкской декларации 1983 г. Концентрации
холестерина (ХС), триглицеридов (ТГ), общего
белка, альбуминов, глюкозы (ГЛ) определяли
на автоматическом биохимическом анализатоБЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
ре А-25 «Biosystems» (Италия) энзиматическим
колориметрическим методом, липопротеинов
высокой плотности (ЛПВП) – ферментативным
методом, липопротеинов низкой плотности
(ЛПНП) – расчетным путем [6].
Статистическую обработку результатов исследования проводили, вычисляя среднее арифметическое значение (М), ошибку среднего
арифметического значения (m), и представляли
в виде M ± m. Различия между группами оценивали с помощью t-теста для независимых переменных, достоверными считали результаты при
р < 0,05. Степень согласованности переменных
определяли с помощью линейного коэффициента корреляции Пирсона (r), учитывая только
статистически значимые величины. Оценку значимости влияния различных факторов на показатели фактического питания обследованных
выполняли с помощью теста Вилкоксона [7].
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
Для оценки значимости влияния различных
факторов на показатели фактического питания
обследованных с помощью теста Вилкоксона
был проведен дисперсионный анализ. Установили, что качественный и количественный
состав суточного рациона и биохимические
показатели гомеостаза зависят от места проживания, возраста, пола и национальной принадлежности (табл. 1). В связи с этим оценивали
средние значения макронутриентов суточного
рациона населения Горного Алтая (табл. 2). Отмечена тенденция большего содержания белков
в рационе жителей среднегорья алтайской и казахской национальностей в отличие от русских
и алтайцев из низкогорья. Указанная закономерность подтверждается достоверными различиями. Так, мужчины и женщины казахской
национальности II возрастной группы в отличие от русских достоверно больше потребляют белков: мужчины – на 2,7 г/сут (p = 0,001),
женщины – на 8,7 г/сут (p = 0,013). Мужчиныалтайцы из среднегорья II группы достоверно
больше потребляют белков на 2,7 г/сут в отличие от алтайцев из низкогорья (p = 0,009).
Кроме определения общего содержания белка в суточном рационе оценивали его качественный состав (животные и растительные белки).
В целом содержание животных белков больше
в рационе жителей среднегорья, при этом в популяции жителей низкогорья количество потребляемых белков было выше у русских, а в
среднегорье – у алтайцев. Межпопуляционные
различия в потреблении углеводов заключаются в большем содержании углеводов в суточном
147
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Чанчаева Е.А., Айзман Р.И. Биохимические показатели крови коренных жителей низкогорья… /c. 146–153
Таблица 1
Результаты теста Вилкоксона макронутриентного состава суточного рациона
и биохимических показателей крови коренного населения Горного Алтая
Факторы, влияющие на показатели
фактического питания и биохимические
показатели крови
Место проживания
Возраст
Пол
Национальность
Влияние на показатели
фактического питания
F
p
14,48
8,68
11,27
868,00
рационе у жителей низкогорья, причем среди
жителей низкогорья – у русских, а среди аборигенов среднегорья – у казахов (см. табл. 2). В
качественном составе углеводов суточного рациона жителей низкогорья выявлено более высокое содержание сложных углеводов и пищевых волокон. Жители среднегорья употребляют
больше жиров, чем жители низкогорья. Среди
населения низкогорья содержание жира в рационе выше у русских, среднегорья – у алтайцев
(см. табл. 2). Так, большее потребление жиров
отмечено у русских мужчин по сравнению с
алтайцами низкогорья в I, III и IV возрастных
группах соответственно на 16,8 г/сут (p = 0,001),
19,5 г/сут (p = 0,019), 8,1 г/сут (p = 0,006) (см.
табл. 2). Кроме того, были выявлены достоверные различия в жирно-кислотном составе
рациона жителей по национальному признаку
и месту проживания (табл. 3, мужчины). В целом жирно-кислотный состав рациона жителей
среднегорья отличается более высоким содержанием НЖК и МНЖК, в то время как ПНЖК
больше в рационе жителей низкогорья.
Между содержанием макроэлементов в суточном рационе и биохимическими показателями крови коренного населения выявлены
прямые и обратные корреляции различной
силы. Так, у мужчин-алтайцев среднегорья обнаружена тесная обратная корреляция между
потреблением жиров и содержанием в крови
холестерина (r = –0,73) (см. рисунок В), а также
положительная корреляция между поступлением в организм НЖК и уровнем ЛПВП в крови
(r = 0,51). Таким образом, у алтайских мужчин
из среднегорья на фоне повышенного поступления в организм НЖК (см. табл. 3) отмечается
активация системы, обеспечивающей эффективную утилизацию холестерина плазмы крови
и поддержание липидного гомеостаза. Такая же
картина отмечена у мужчин-казахов, у которых корреляция между потреблением жиров и
уровнем ХС плазмы, а также между содержанием НЖК и ЛПВП составляет соответствен148
0,001
0,001
0,001
0,0015
Влияние на биохимические
показатели крови
F
p
447,00
1297,03
447,00
878,00
0,001
0,001
0,001
0,01
но r = –0,66 (см. рисунок Г) и r = 0,56. У алтаек среднегорья корреляция между потреблением жира и концентрацией липидов в крови
не выявлена. В то же время у казашек между
потреблением жира и простых углеводов и содержанием в крови триглицеридов обнаружена
прямая корреляция средней силы, соответственно r = 0,46 и r = 0,36, что свидетельствует
о напряжении регуляторных систем липидного
гомеостаза. У русских мужчин отмечена тесная
положительная корреляция между потреблением НЖК и уровнем ХС в крови (r = 0,55) (см.
рисунок А) и положительная корреляция средней силы между концентрацией НЖК и ЛПВП
(r = 0,49). Следовательно, несмотря на увеличение уровня ЛПВП при повышенном потреблении НЖК, уровень холестерина плазмы, тем
не менее, не снижается. У русских женщин
выявили прямую слабую корреляцию между
содержанием в рационе НЖК и триглицеридов
в крови (r = 0,36), а также между потреблением
жира и уровнем ЛПВП (r = 0,32). Это позволяет
предположить о напряжении системы регуляции, обеспечивающей липидный гомеостаз у
русского населения.
У алтайских мужчин низкогорья отмечена обратная корреляция между содержанием
МНЖК и ХС (r = –0,33) (см. рисунок Б), МНЖК
и ЛПНП (r = –0,36). У алтаек низкогорья корреляция между потреблением жира и уровнем
липидов в крови не наблюдалась. У русских
мужчин между потреблением пищевых волокон и уровнем ГЛ в крови выявили обратную
корреляцию средней силы (r = –0,42). У алтайских мужчин среднегорья уровень холестерина плазмы находится в обратной зависимости
от потребления пищевых волокон (r = –0,32), у
казахских мужчин между потреблением сложных углеводов и уровнем ХС также отмечена
обратная корреляция (r = –0,59). По всей видимости, в мужском организме сложные углеводы и пищевые волокна оказывают нормализующее влияние на липидный обмен. Выявлена
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Чанчаева Е.А., Айзман Р.И. Биохимические показатели крови коренных жителей низкогорья… /c. 146–153
Таблица 2
Элементный состав суточного рациона населения Горного Алтая (M ± σ)
Возрастная
группа, лет
Место
Национальность (n)
Белки, г
р
Жиры, г
р
Углеводы, г
р
Мужчины
Н
I
20–29
С
Н
II
30–39
С
Н
III
40–49
С
Н
IV
50–59
С
Р (15)
60,3 ± 7,1
84,7 ± 8,8
0,001
304,3 ± 31,3
0,014
А (18)
57,2 ± 9,3
67,9 ± 3,9
0,001
340,3 ± 43,2
А (15)
61,4 ± 8,6
84,4 ± 9,4
0,001
288,9 ± 38,2
К (15)
Р (15)
А (16)
А (15)
57,3 ± 7,6
64,9 ± 8,0
61,6 ± 6,5
70,4 ± 7,5
82,9 ± 10,3
69,2 ± 2,5
68,5 ± 9,2
87,9 ± 6,4
0,019
0,001
0,001
311,7 ± 23,7
313,0 ± 55,2
328,0 ± 56,5
313,1 ± 47,8
0,014
0,001
0,001
0,01
0,01
0,033
К (15)
67,7 ± 7,5
Р (14)
А (11)
А (14)
К (14)
Р (15)
А (10)
64,4 ± 8,4
52,8 ± 7,8
53,6 ± 6,2
54,2 ± 5,7
53,0 ± 7,7
56,4 ± 6,4
А (15)
55,0 ± 8,3
64,0 ± 3,8
К (15)
54,2 ± 7,6
64,7 ± 4,3
276,7 ± 51,3
361,8 ± 28,3
0,001
0,009
0,009
0,001
0,001
0,004
0,004
83,5 ± 8,2
77,9 ± 10,0
58,4 ± 13,8
65,0 ± 6,7
65,0 ± 6,0
65,1 ± 4,5
57,0 ± 8,7
0,001
0,019
0,006
0,006
0,006
0,006
0,01
0,01
344,0 ± 35,4
0,019
0,019
0,033
320,8 ± 52,8
281,0 ± 67,3
259,0 ± 62,4
264,3 ± 62,0
272,7 ± 54,6
319,1 ± 54,9
292,3 ± 47,9
Женщины
Н
I
20–29
С
Н
II
30–39
С
Н
III
40–49
С
Н
IV
50–59
С
Р (15)
62,0 ± 4,0
0,017
68,7 ± 9,1
А (15)
А (15)
К (13)
Р (15)
А (16)
61,4 ± 5,3
63,2 ± 7,7
65,2 ± 7,6
53,6 ± 6,8
57,1 ± 9,5
0,017
64,1 ± 5,9
68,1 ± 7,0
68,6 ± 6,0
68,8 ± 7,1
63,8 ± 4,1
А (15)
63,0 ± 7,6
К (15)
62,3 ± 7,4
Р (15)
А (15)
А (16)
К (15)
Р (15)
А (10)
52,5 ± 10,1
52,7 ± 12,3
56,9 ± 5,5
57,4 ± 5,2
52,3 ± 8,0
55,0 ± 4,3
58,4 ± 13,8
54,7 ± 12,8
68,1 ± 8,6
67,7 ± 8,6
62,0 ± 11,4
58,6 ± 9,3
0,025
0,003
0,003
0,025
0,013
0,002
292,0 ± 64,5
292,0 ± 63,7
266,3 ± 29,3
265,9 ± 33,6
278,3 ± 52,5
312,1 ± 82,1
А (10)
52,5 ± 6,6
69,1 ± 5,0
0,002
269,0 ± 44,6
К (15)
53,5 ± 4,8
69,8 ± 3,6
0,013
274,6 ± 48,0
0,013
69,6 ± 2,3
0,013
0,001
0,001
0,024
0,024
0,001
0,001
69,9 ± 2,3
376,8 ± 25,2
322,3 ± 35,9
333,4 ± 28,9
333,9 ± 49,2
359,1 ± 58,4
0,001
0,001
337,0 ± 36,8
335,6 ± 35,8
П р и м е ч а н и е . Здесь и в табл. 3: Р – русские; А – алтайцы; К – казахи; Н – низкогорье, С – среднегорье; p – достоверные различия между обследуемыми разных национальностей и места проживания в рамках каждой возрастной
группы; M – среднее значение, σ – стандартное отклонение.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
149
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Чанчаева Е.А., Айзман Р.И. Биохимические показатели крови коренных жителей низкогорья… /c. 146–153
Таблица 3
Жирно-кислотный состав суточного рациона мужчин Горного Алтая (M ± σ)
НациональВозрастная
Место
ность
группа, лет
ω-6
p
ω-3
p
0,039
0,039
0,05
0,05
0,3 ± 0,2
0,2 ± 0,1
0,02
0,02
0,02
0,0021
0,001
0,001
37,8 ± 10,6 0,023
28,3 ± 2,8 0,023
2,1 ± 1,7
1,8 ± 0,1
С
44,9 ± 7,7
43,5 ± 5,4
35,3 ± 5,3
0,001
Н
А
К
Р
37,2 ± 9,5
37,2 ± 10,9
29,3 ± 5,7
2,0 ± 1,6
2,0 ± 1,6
4,1 ± 2,0
0,002
0,3 ± 0,2
0,4 ± 0,2
0,5 ± 0,2
С
А
А
35,1 ± 5,9 0,0011
46,0 ± 6,1 0,0011
0,001
46,7 ± 7,1 0,001
42,3 ± 7,6 0,027
31,2 ± 9,0 0,027
33,1 ± 5,9
34,1 ± 6,4
31,0 ± 2,1
30,4 ± 5,5 0,003
37,4 ± 6,6 0,003
30,8 ± 2,1
С
С
К
Р
А
А
К
Р
А
А
К
25,0 ± 6,2
39,7 ± 9,3
0,001
0,001
3,3 ± 1,9
1,9 ± 1,6
0,006
0,006
0,4 ± 0,2
0,3 ± 0,2
0,006
0,006
34,1 ± 9,6
33,0 ± 9,2
20,5 ± 6,0
30,0 ± 6,0
28,9 ± 6,2
32,9 ± 2,3
24,1 ± 8,8
29,2 ± 6,4
32,6 ± 2,3
0,001
0,005
0,005
2,4 ± 1,7
2,2 ± 1,7
3,4 ± 1,9
1,6 ± 1,2
1,8 ± 1,5
1,1 ± 0,1
3,7 ± 1,8
2,1 ± 0,6
1,1 ± 0,1
0,002
0,3 ± 0,2
0,3 ± 0,2
0,4 ± 0,2
0,3 ± 0,2
0,4 ± 0,2
0,2 ± 0,1
0,4 ± 0,2
0,3 ± 0,2
0,2 ± 0,1
0,0021
корреляция между количеством потребляемых
белков и уровнем общего белка и альбуминов
в крови. Так, у мужчин русской и алтайской
национальностей среднегорья уровень общего
белка плазмы крови коррелирует с количеством потребляемых животных белков (соответственно r = 0,48, r = 0,46); у алтаек среднегорья
и казашек общее количество потребляемых
белков также отражается на уровне альбуминов плазмы (r = 0,49, r = 0,47).
Принято считать, что биохимические показатели крови горцев в сравнении с равнинными жителями характеризуются более высоким
содержанием структурных белков (альбуминов), что определяется, в первую очередь, характером питания населения [8]. Известно, что
в условиях холодного климата у аборигенного
населения адекватным их энергосберегающей
стратегии является белково-липидный тип питания [1, 2, 9]. В связи с тем что климатические
условия гор в основном позволяют заниматься
только скотоводством, питание коренных жителей характеризуется низким содержанием
растительных продуктов. Несмотря на то что
в настоящее время жители гор обеспечены в
должной мере овощами и фруктами, данный
вид продуктов не пользуется большим спросом и закупается местным населением в весьма
ограниченных количествах не столько в целях
150
р
44,6 ± 5,7
33,7 ± 3,1
Н
IV
50−59
МНЖК
Р
А
Н
III
40−49
р
Н
I
20−29
II
30−39
НЖК
0,001
0,001
0,001
0,001
0,001
0,001
0,001
0,001
0,001
экономии, сколько по причине уже сложившихся традиционных пищевых стереотипов [10].
Вероятно, выявленные различия в питании населения низкогорья и среднегорья Горного Алтая различных этнических групп обусловлены
климатогеографическими условиями проживания.
Согласно данным литературы, в некоторых
этнических группах, придерживающихся белково-липидного питания, несмотря на высокое
содержание в пище животных жиров, тем не
менее, сравнительно редко встречаются заболевания, связанные с нарушением липидного
обмена [1, 2]. Данный феномен авторы объясняют наличием так называемой популяционной
«технологии» пищеварения, особенности которой можно проследить в составе биологических жидкостей, уровне активности пищеварительных органов [2]. По данным авторов, синтетическая активность печени и гипермоторное состояние желчного пузыря обеспечивают
высокую концентрацию желчи для усвоения
липидной пищи и в то же время способствуют
активной деградации холестерина.
Результаты исследования позволяют прийти к выводу о предрасположенности организма
русского населения и женщин казахской национальности к нарушению липидного гомеостаза в отличие от алтайцев и мужчин-казахов, у
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Чанчаева Е.А., Айзман Р.И. Биохимические показатели крови коренных жителей низкогорья… /c. 146–153
Рис. Корреляции между суточным количеством потребляемых жиров и уровнем холестерина в плазме крови
русских мужчин (А), алтайских мужчин низкогорья (Б), алтайских мужчин среднегорья (В) и казахских
мужчин (Г)
которых активность транспортной системы холестерина находится в прямой зависимости от
количества потребляемых жиров.
ВЫВОДЫ
1. Показатели фактического питания и биохимические показатели крови жителей Горного
Алтая зависят от пола, национальности, места
проживания и возраста.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
2. Рацион жителей среднегорья Алтая характеризуется высоким содержанием животного белка, низким содержанием сложных углеводов и пищевых волокон в отличие от населения низкогорья.
3. Жирно-кислотный состав рациона населения среднегорья отличается более высоким содержанием НЖК, МНЖК и сравнительно низким содержанием ПНЖК.
151
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Чанчаева Е.А., Айзман Р.И. Биохимические показатели крови коренных жителей низкогорья… /c. 146–153
4. Биохимические показатели гомеостаза
жителей Горного Алтая коррелируют с количественными показателями фактического потребления макронутриентов.
5. У мужчин среднегорья при значительном
потреблении жиров, в том числе НЖК, и повышенном уровне ЛПВП содержание липидов
в крови не повышено.
6. У русского населения и казашек при высокой концентрации ЛПВП выявлено закономерное увеличение уровня липидов крови в
связи с повышенным потреблением НЖК.
СПИСОК ЛИТЕРАТУРЫ
1. Панин Л.Е. Гомеостаз и проблемы приполярной медицины (методологические аспекты
адаптации) // Бюл. СО РАМН. 2010. 30. (3). 6–11.
Panin L.E. Homeostasis and north medicine
(methodological aspects of adaptation) // Byul. SO
RAMN. 2010. 30. (3). 6–11.
2. Цуканов В.В., Ноздрачев К.Г., Тонких Ю.Л.
Механизм обратного транспорта холестерина и
холелитиаз у северных народностей // Клин. мед.
2007. 85. (2). 33–35.
Tsukanov V.V., Nozdrachev К.G., Tonkikh Yu.L.
Cholesterol reverse transport mechanism and cholelithiasis of northern population // Klin. med. 2007. 85.
(2). 33–35.
3. Методические рекомендации по вопросам
изучения фактического питания и состояния здоровья населения в связи с характером питания.
МЗ СССР № 2967-84 от 08.02.84 // Перечень основных действующих нормативных и методических документов по гигиене питания. М., 2004.
Methodical recommendations on problems of
factual nutrition and health status of population in
connection with the character of nutrition. МZ SSSR
№ 2967-84 08.02.84 // Main list of operating standardization and methodical documents of nutrition
hygienic. M., 2004.
4. Методические рекомендации МР 2.3.1
2432−08 № 2.1. Рациональное питание. Нормы
физиологических потребностей в энергии и пищевых веществах для различных групп населения
Российской Федерации. 2008.
152
Main reference МR 2.3.1 2432 - 08 № 2.1. Ration nutrition. The physiological needs in energy and
nutritious substances for different groups of population of the Russian Federation Standards. 2008.
5. Скурихин И.М., Тутельян В.А. Таблицы химического состава и калорийности Российских
продуктов питания. М.: ДеЛипринт, 2007. 276 с.
Skurikhin I.M., Tutel`yan V.A. Chemical composition of Russian nutritious products. М.: DeLiprint,
2007. 276 p.
6. Камышников В.С. Справочник по клиникобиохимическим исследованиям и лабораторной
диагностике. М.: МЕДпресс-информ, 2009. 920 с.
Kamyshnikov V.S. Reference book of clinicalbiochemical research and laboratory diagnostic. M.:
MEDpress-inform, 2009. 920 p.
7. Халафян А.А. Статистика 6. Статистический
анализ данных. М.: Бинок-Пресс, 2007. 512 с.
Khalafyan A.A. Statistic 6. Statistic analyze of
dates. M.: Binok-Press, 2007. 512 p.
8. Рычков Ю.Г. Генофонд и геногеография народонаселения. Генофонд населения России и сопредельных стран. СПб., 2000. 611 с.
Rychkov Yu.G. Gene pool and gene geography
of population. Gene pool of Russia and neighboring
countries. SPb., 2000. 611 p.
9. Хаснулин В.И., Геворгян М.М., Бахтина И.А.
Особенности липидного обмена у пришлых жителей Севера, больных артериальной гипертензией
// Мир науки, культуры, образования. 2011. 29. (4).
280–283.
Hasnulin V.I., Gevorgyan M.M., Bakhtina I.A. Lipid metabolism characteristics at the alien inhabitants
of the North with arterial hypertension // Mir nauki,
kul’tuty, obrazovaniya. 2011. 29. (4). 280–283.
10. Чанчаева Е.А. Эволюционная адаптация
аборигенов Южного Алтая к условиям низкогорья и среднегорья // Экология человека. 2011. (5).
60–65.
Chanchaeva E.A. Evolution adaptation of south
Altai’s aboriginal population to the conditions of low
and medium height altitude areas // Ekologiya cheloveka. 2011. (5). 60–65.
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
Copyright ОАО «ЦКБ «БИБКОМ» & ООО «Aгентство Kнига-Cервис»
Чанчаева Е.А., Айзман Р.И. Биохимические показатели крови коренных жителей низкогорья… /c. 146–153
THE BIOCHEMICAL MEASURES OF BLOOD AT THE INDIGENOUS PEOPLE
OF DIFFERENT NATIONALITIES LIVING AT LOW AND MID LEVELS OF GORNY
ALTAI IN CORRELATION WITH SPECIFIC FEATURES OF NUTRITION
Yelena Anatolyevna CHANCHAYEVA1, Roman Idelevich AIZMAN2
1 Gorno-Altaisk
State University
649000, 1Gorno-Altaisk, Lenkin str., 1
2 Novosibirsk
State Pedagogical University
645126, Novosibirsk, Vilyuiskaya str., 28
The nutrition’s features of aborigines of Russian, Altai and Kazakh nationalities living under the low-hill and middle-hill conditions of Southern Altai have been studied. As a result, the interpopulation differences in population’s
nutrition expressed in factual consumption of macronutrients and determined by the geographic and climatic living
conditions, nationality, age and sex and nutritious stereotypes have been revealed. Biochemical parameters of blood
correlated with the quantitative composition of ration’s macronutrients.
Key words: actual nutrition, biochemical measures of blood, indigenous people of the Southern Altai, adaptation.
Chanchaeva Ye.A. – candidate of biological sciences, assistant professor of the chair for life safety, anatomy and
physiology, e-mail: chan.73@mail.ru
Aizman R.I. – doctor of biological sciences, professor of the chair for anatomy, physiology and safety,
e-mail: roman.aizman@mail.ru
БЮЛЛЕТЕНЬ СО РАМН, ТОМ 31, № 6, 2011
153
Документ
Категория
Биологические науки
Просмотров
598
Размер файла
6 197 Кб
Теги
918, рамн, 2011, бюллетень
1/--страниц
Пожаловаться на содержимое документа