close

Вход

Забыли?

вход по аккаунту

?

965

код для вставкиСкачать
American Journal of Medical Genetics 80:481–486 (1998)
Expression of the RET Proto-Oncogene in
Human Embryos
Tania Attié-Bitach,1 Marc Abitbol,2 Marion Gérard,2 Anne-Lise Delezoide,1 Joelle Augé,1
Anna Pelet,1 Jeanne Amiel,1 Vassilis Pachnis,3 Arnold Munnich,1 Stanislas Lyonnet,1 and
Michel Vekemans1*
1
Départment de Génétique et Unité de Recherches sur les Handicaps Génétiques de l’Enfant, Hôpital Necker-Enfants
Malades, Paris, France
2
Centre d’Etude et de Recherche Thérapeutique en Ophtalmologie, Faculté de Médecine Necker-Enfants Malades,
Paris, France
3
MRC, The Ridgeway, Mill Hill, London, United Kingdom
The patterns of RET proto-oncogene expression in mouse, rat, and chicken and the
anomalies observed in targeted RET mutants suggest that RET plays a major role in
development of mouse enteric nervous system and in kidney organogenesis. Here,
we report on in situ hybridization studies
describing the pattern of RET protooncogene expression during early development of human embryos between 23 and 42
days. We show that the RET gene is expressed in the developing kidney (nephric
duct, mesonephric tubules, and ureteric
bud), the presumptive enteric neuroblasts
of the developing enteric nervous system,
cranial ganglia (VII+VIII, IX, and X) and in
the presumptive motor neurons of the spinal cord. Yet, despite the high level of RET
gene expression in the kidney and in the motor neurons of the developing central nervous system in human embryos, only rare
cases with renal agenesis have been reported in Hirschsprung disease patients,
and no clinical evidence of spinal cord involvement has been shown in patients carrying RET germline mutations (i.e., multiple
endocrine neoplasia syndromes and Hirschsprung disease). Am. J. Med. Genet. 80:481–
486, 1998. © 1998 Wiley-Liss, Inc.
Contract grant sponsor: The Association Française contre les
Myopathies (AFM); Contract grant sponsor: The Association pour
la Recherche contre le Cancer (ARC); Contract grant sponsor: The
Caisse Nationale des Assurances Maladies (CANAM); Contract
grant sponsor: IMAGE; Contract grant sponsor: The Projet Hospitalier de Recherche Clinique; Contract grant number: PHRC
AOA 94060.
*Correspondence to: Michel Vekemans, Département de Génétique et Unité de Recherches sur les Handicaps Génétiques de
l’Enfant, INSERM U-393, Hôpital Necker-Enfants Malades, 149,
rue de Sèvres, 75743 Paris Cedex 15, France. E-mail: michel.
vekemans@nck.ap.hop.paris.fr
Received 14 April 1998; Accepted 3 August 1998
© 1998 Wiley-Liss, Inc.
KEY WORDS: RET proto-oncogene; gene
expression; human embryos;
in situ hybridization; Hirschsprung disease
INTRODUCTION
The RET proto-oncogene encodes a tyrosine-kinase
receptor of unknown function that requires ligands for
dimerization (Glial cell-derived neurotrophic factor,
GDNF [Durbec et al., 1996; Trupp et al., 1996], or neuturin, NTN [Baloh et al., 1997; Klein et al., 1997;
Kotzbauer et al., 1996]). RET germline mutations
cause Hirschsprung disease [Edery et al., 1994; Romeo
et al., 1994] and familial predispositions to cancer,
namely multiple endocrine neoplasia type 2A (MEN 2A
[Donis-Keller et al., 1993; Mulligan et al., 1993]), 2B
(MEN 2B [Carlson et al., 1994; Eng et al., 1994; Hofstra
et al., 1994]), and familial medullary thyroid carcinoma
(FMTC [Donis-Keller et al., 1993; Mulligan et al,
1994]). The functional role of c-Ret during development
was clarified by targeted mutagenesis experiments.
Homozygous ret−/− mice have malformations of the
urinary excretory system with lack of enteric neurons
and die soon after birth [Schuchardt et al., 1994]. Moreover, expression studies in mouse [Pachnis et al.,
1993], rat [Tsuzuki et al., 1995], and chicken [Schuchardt et al., 1995] have further confirmed the role of
c-Ret in kidney and enteric nervous system development.
However, nothing is known regarding the pattern of
RET gene expression during human embryonic development. Here, we study the pattern of RET gene expression in developing kidney and central and enteric
nervous system of human embryos. Considering the
high level of RET gene expression in motor neurons of
the developing central nervous system and kidney, it is
surprising that patients carrying RET germline mutations show no clinical evidence of spinal cord involvement and rarely show renal involvement [Calabrese et
al., 1994].
482
Attié-Bitach et al.
MATERIALS AND METHODS
Sections
The tissue sections were taken from whole human
embryos, ranging from Carnegie stages 11 to 16, obtained after induced abortions performed according to
the French Legislation and after allowance of the Ethical Committee. Two embryos were studied at each of
the following stages (Table I): Carnegie 11 (24 to 26
days), 12 (26 to 28 days), 13 (28 to 32 days), and 16 (37
to 41 days). Tissues were frozen using powdered dry ice
and stored at −80°C. Cryostat sections (15 ␮m) were
mounted on slides, fixed for 20 min with 2% paraformaldehyde, rinsed briefly in water, dehydrated in a
graded ethanol series (70, 95, and 100%), air-dried, and
stored at −80°C. This procedure was devised to protect
embryonic mRNAs from rapid degradation.
Hybridization Probes
Hybridization probes were 45- and 60-mer oligonucleotides for the short and long RET mRNA isoforms,
respectively (Genset, Paris, France). The 45-mer oligonucleotide specific for the short RET9 isoform encompassed the 3⬘ end of exon 19 and the 5⬘ end of intron 19
(reverse, antisense: 5⬘-AGCATCACAGAGAGGAAGGATAGTGCAGAGGGGACAGCGGTGCTA-3⬘; forward, sense: 5⬘-TAGCACCGCTGTCCCCTCTGCACTATCCTTCCTCTCTGTGATGCT-3⬘). The 60-mer oligonucleotide was in exon 20 (reverse antisense:
5⬘-AACCCAGTGTTAGTGCCATCAGCTCTCGTGAGTGGTACAGGACTCTCTCCAGGCCAGTTC3⬘; forward sense: 5⬘-GAACTGGCCTGGAGAGAGTCCTGTACCACTCACGAGAGCTGATGGCACTAACACTGGGTT-3⬘) and thus could hybridize some
RET9 transcripts also [Tahira et al., 1990]. Probes
were 3⬘ end-labelled with ␣( 35 S)dATP (Dupont of
Nemours, Mechelen, Belgium) using deoxyribonucleotidyl transferase (Gibco-BRL Life Technologies, Cergy
Pontoise, France) at a specific activity of 7.108 cpm/mg,
purified on Biospin Columns (Bio-Rad, Ivry sur Jeine,
France) and stored at −20°C.
In Situ Hybridization
The hybridization mixture contained 50% formamide, 4× SSC, 1× Denhardt’s solution, 0.25 mg/ml tRNA,
0.25 mg/ml denatured herring sperm DNA, 0.25 mg/ml
poly(A), 10% dextran sulphate, 100 mmol/L DTT, and
␣(35S)dATP-labeled probes (6.106 cpm/ml). 100 ␮l of
TABLE I. Summary of RET Expression During
Human Embryogenesis
Carnegie stage
(age in days)
11
(23–26 days)
12
(26–30 days)
13
(28–32 days)
16
(37–42 days)
Kidney
Cranial
ganglia
(VII+VIII,
IX, X)
Enteric
nervous
system
Ventral
neural
tube
Wolffian duct
−
−
−
Wolffian duct
mesonephric
tubules
Wolffian duct
mesonephric
tubules
Ureteric bud
+
+
−
+
+
+
+
+
+
the hybridization solution was deposited on each section. The sections were then incubated in a humidified
chamber at 43°C for 20 hr. After hybridization, the sections were washed twice in decreasing SSC solutions.
After dehydration, the sections were exposed to Amersham Betamax X-ray films for 10 days and then to
Kodak NTB-2 photographic emulsion for 10 weeks at
+4°C. After revelation and fixation, the sections were
counterstained, coverslipped with Eukitt, and analyzed using a microscope Leitz with dark field and
bright field illumination.
RESULTS
At 23 to 26 days (Carnegie 11), the RET mRNAs are
only detected in the differentiating mesonephric duct
(Fig. 1). At 26 to 30 days, the RET gene is also expressed in the mesonephric tubules and in the Wolffian
duct merging with the cloaca (Carnegie 12, Fig. 1). At
37 to 42 days, RET is expressed in the ureteric bud but
not in the surrounding metanephric blastema. The
gene expression in the developing excretory system is
intense and homogeneous throughout all stages.
At 26 to 30 days, RET mRNAs are also detected in
the neural crest-derived part of the facioacoustic ganglion complex (VII+VIII; Fig. 2). A weak RET signal is
also observed in developing neural crest-derived ganglia of the Xth and XIth cranial nerves (data not
shown). In each of these ganglia, the RET mRNAs are
still detected at 37 to 42 days (Carnegie 16), whereas
they were never detected in the Vth ganglion in our
study.
In the enteric nervous system, RET expression starts
in the foregut at 26 to 30 days (Carnegie 12) and is
subsequently detected in midgut and hindgut until 37
to 42 days (Carnegie 16; Fig. 3). In the mesenchyme of
the gut wall, the RET signal appears punctate, suggesting an expression in coalescent groups of cells.
In neural tube, the RET mRNAs are detected at 28 to
32 days (Carnegie 13; Fig. 4). The signal extends along
the anteroposterior axis in the ventral half of the developing spinal cord in which the presumptive motor
neurons are differentiating. This signal persists until
37 to 42 days (Carnegie 16).
In order to study the differential expression of the
short and long RET mRNAs isoforms (RET9 and
RET51 (19–21)), two different probes were used: a 45nt-long probe specific of the short isoform (ret9) and a
60-nt-long probe that could hybridize with both species
(ret51). Both probes give similar signals suggesting
that the long isoform is not specifically associated with
early development in human (data not shown). Finally,
no hybridization signal is detected with the sense
probes, confirming that the hybridization patterns observed with antisense probes are specific.
DISCUSSION
The pattern of RET gene expression during embryonic development has been previously studied in various species including mouse, rat, and chicken [Pachnis
et al., 1993; Schuchardt et al., 1995; Tsuzuki et al.,
1995]. However, nothing is known regarding the pat-
RET Proto-Oncogene in Human Embryos
483
Fig. 1. RET expression in the Wolffian duct. a,c,e: Photomicrographs of sections under bright-field illumination; b,d,f: photomicrographs of the same
series of sections under dark-field illumination. a,b: Transverse section through the dorsal region of a Carnegie stage 11 embryo; c,d: same section at a
higher magnification view showing a signal restricted to the Wolffian duct (w). e,f: Transverse section through the caudal region of a Carnegie stage 12
embryo; the signal is observed in the Wolffian duct merging in the cloaca (cl). n, neural tube; c, intraembryonic coelom; pi, primitive intestine. Bars,
200 ␮m.
tern of RET gene expression during human embryonic
development. Here, we describe the sequential expression of the RET gene in the developing excretory system, the VII+VIII cranial ganglia, presumptive enteric
neuroblasts, and motor neurons of the spinal cord
(Table I).
In human embryos, RET mRNAs are detected in the
Wolffian duct prior to ureteric bud formation. Human
RET gene expression is also observed in the mesonephric tubules. In the developing mouse, RET transcripts
have been detected in the nephric duct (day 8.5 to 10.5),
the ureteric bud epithelium (day 10 to 11.5), and the
growing tips of the renal collecting ducts (day 13.5 to
17.5). Additional investigations at later stage human
484
Attié-Bitach et al.
Fig. 2. RET expression in the facioacoustic ganglion (VII+VIII). Bright-field (a) and dark-field (b) photomicrographs of a transverse section through
the otic vesicle region of a Carnegie stage 12 embryo. A strong signal is observed in the facioacoustic ganglion (VII+VIII) localized immediately anterior
to the otic vesicle (ov). Bars, 200 ␮m.
embryos are being performed to determine whether
RET is also expressed in the derivatives of the ureteric
bud in the metanephros. Because kidney organogenesis
is based on mesenchyme-epithelium reciprocal induction [Saxen, 1987], it has been postulated that RET
was the receptor for a signal from the mesenchyme that
would induce the growth and/or branching of the ureteric bud. Our results in human embryos along with
the recent identification of GDNF as RET ligand
[Durbere et al., 1996; Trupp et al., 1996] and its ex-
Fig. 3. RET expression in the enteric nervous system. a,b: Bright-field and dark-field photomicrographs of a transverse section through the midgut
(mg) of a Carnegie stage 13 embryo at a high magnification view. c,d: Bright-field and dark-field photomicrographs of a parasagittal section through the
midgut of a Carnegie stage 16 embryo at high magnification view. The signal is observed in the mesenchyme of the gut wall in groups of cells that start
to coalesce to form the enteric ganglia. Bars, 200 ␮m.
RET Proto-Oncogene in Human Embryos
485
Fig. 4. RET expression in the ventral neural tube. Bright-field (a) and dark-field (b) photomicrographs of a transverse section through the neural tube
of a Carnegie stage 13 embryo at high magnification view. A strong signal is detected in the motor neuron columns (mn) of the ventral part of the neural
tube (n). Bars, 200 ␮m.
pression in the metanephric mesenchyme [Durbec et
al., 1996; Hellmich et al., 1996; Suvanto et al., 1996]
suggest that the RET signaling pathway plays a major
role in kidney organogenesis. In keeping with this, it is
worth remembering that both c-ret−/− and gdnf−/−
mouse knock-out mutants have kidney agenesis [Moore
et al., 1996; Pichel et al., 1996; Sanchez et al.,. 1996;
Schuchardt et al., 1994].
The human RET gene is also expressed early in neural crest cells migrating rostro-caudally into the gastrointestinal tract. Both the location and the punctated
aspect of the RET signal are suggestive of RET expression in groups of cells that might coalesce to form the
presumptive enteric ganglia. Consistently, ret gene expression in mouse developing gut has been detected in
presumptive neuroblasts of the vagal crest (day 9.5 to
11.5) and in myenteric ganglia (day 13.5 to 14.5 [Pachnis et al., 1993]).
In humans, RET mRNAs were detected in the neural
crest-derived part of the facioacoustic ganglion complex
and, to a lesser extent, in that of the Xth and XIth cranial nerve complex ganglia. The RET gene was never
expressed in the Vth ganglion in our study. By contrast,
mouse ret transcripts were first detected in neural
crest cells migrating from rhombomere 4 (day 8.5 to
9.5), then in the facioacoustic ganglion complex (day
9.5), the inferior ganglia of the IXth and Xth cranial
nerve ganglion complexes (day 10.5), and finally in all
ganglia, including the IXth and Xth superior ganglia
and the trigeminal ganglion (day 13.5 to 14.5 [Pachnis
et al., 1993]). These results differ therefore from that
observed in early human embryos in which RET gene
expression is limited to the neural crest-derived part of
the cranial ganglia.
In human neural tube, RET gene expression is first
detected in the motor neurons at day 28 to 32 and is
still present at day 37 to 42. No RET expression was
detected in neuroepithelial cells of the neural tube. In
mouse, however, ret transcripts were detected early in
the neuroepithelial cells of the ventral half of the neural tube (day 8.75) prior to expression in the motor
neurons of the spinal cord (day 10.5 to 14.5) and some
motor neurons of the hindbrain [Pachnis et al., 1993].
As far as pathological findings in patients with RET
germline mutations are concerned, our study supports
the role of RET in the development of the enteric nervous system and fits well with the absence of ganglia in
the distal colon of HSCR patients. Consistently, enteric
nervous system ganglia are lacking throughout the
gastrointestinal tract of c-ret−/− mice [Schuchardt et
al., 1994]. By contrast, as renal abnormalities are rare
in HSCR patients (only 3 in 200 in our series), both
c-ret−/− and gdnf−/− mutant mice display kidney agenesis or dysgenesis {Moore et al., 1996; Pichel et al.,
1996; Sanchez et al., 1996; Schuchardt et al., 1994].
The discrepancy between human and mouse could be
related to either gene dosage effect or to redundancy in
human developing kidney. Interestingly, as most patients carrying heterozygous RET mutations do not
display cranial nerve anomalies, it is worth remembering that the congenital central hypoventilation syndrome (CCHS, Ondine’s curse) was observed occasionally in HSCR patients [Nakahara et al., 1995; Verloes
et al., 1993]. Most of these patients failed to have RET
or GDNF mutations [Amiel et al., 1998; Bolk et al.,
1996a]. These data suggest a low susceptibility of neural crest-derived cells of the central nervous system to
RET or GDNF mutations [Amiel et al., 1998] and the
possible involvement of other genes in CCHS patients
[Bolk et al., 1996b]. Finally, as RET gene expression in
the motor neurons is particularly high in the developing central nervous system, the question of why RET
mutations have apparently no clinical expression in
spinal cord both in mouse and human remains unanswered.
ACKNOWLEDGMENTS
We thank the medical staff of Orthogeny Center
(Hôpital Broussais) and of Gynecology Department
(Hopital Boucicaut) and J.L. Dufier (Ophtalmologie,
Hôpital Necker) for their cooperation. We also thank A.
Beauvais, C. Esculpavit, S. Fahy, and P. Brice for technical assistance. This study was supported by the Association Française contre les Myopathies (AFM), the
486
Attié-Bitach et al.
Association pour la Recherche contre le Cancer (ARC),
the Caisse Nationale des Assurances Maladies
(CANAM), the association IMAGE, and the Projet Hospitalier de Recherche Clinique (PHRC AOA 94060).
REFERENCES
Amiel J, Salomon R, Attié T, Pelet A, Mokhtari M, Trang H, Gaultier C,
Munnich A, Lyonnet S (1998): Mutations of the RET-GDNF signalling
pathway in Ondine’s curse. Am J Hum Genet 62:715–717.
Baloh R, Tansey M, Golden J, Creedon D, Heuckeroth R, Keck C, Zimonjic
D, Popescu N, Johnson Jr E, Milbrandt J (1997): TrnR2, a novel receptor that mediates Neurturin and GDNF signalling through Ret. Neuron
18:793–802.
Bolk S, Angrist M, Schwartz S, Silvestri J, Weese-Mayer D, Chakravarti A
(1996a): Congenital central hypoventilation syndrome: Mutation
analysis of the receptor tyrosine kinase RET. Am J Hum Genet 63:603–
609.
Bolk S, Angrist M, Xie J, Yanagisawa M, Silvestri J, Weese-Mayer D,
Chakravarti A (1996b): Endothelin-3 framehift mutation in congenital
central hypoventilation syndrome. Nat Genet 13:395–396.
Calebrese C, Franchi PG, Stuppia L, Mingarelli R, Rossi C, Ramenghi L,
Marino M, Morizio M, Peila E, Antonucci A, Palka G (1994): A newborn
with ring chromosome 10, aganglionic megacolon, and renal hypoplasia. J Med Genet 31:804–806.
Carlson K, Dou S, Chi D, Scavarda N, Toshima K, Jackson C, Wells S,
Goodfellow P, Donis Keller H (1994): A single missense mutation in the
tyrosine kinase catalytic domain of the RET proto-oncogene is associated with multiple endocrine neoplasia type 2B. Proc Natl Acad Sci
(USA) 91:1579–1583.
Donis-Keller H, Dou S, Chi D, Carlson K, Toshima K, Lairmore T, Howe J,
Moley J, Goodfellow P, Wells A (1993): Mutations in the RET protooncogene are associated with MEN 2A and FMTC. Hum Molec Genet
7:851–856.
Durbec P, Marcos-Gutierrez C, Kilkenny C, Grigoriou M, Wartiowaara K,
Suvanto P, Smith P, Ponder B, Costantini F, Saarma M, Sariola H,
Pachnis V (1996): GDNF signalling through the Ret receptor tyrosine
kinase. Nature 381:789–793.
Edery P, Lyonnet S, Mulligan L, Pelet A, Dow E, Abel L, Holder S, NihoulFekete C, Ponder B, Munnich A (1994): Mutations of the RET protooncogene in Hirschsprung’s disease. Nature 367:378–380.
Eng C, Smith D, Mulligan L, Nagai M, Healey C, Ponder M, Gardner E,
Sheumann G, Jackson C, Tunnacliffe A, Ponder B (1994): Point mutation within the tyrosine kinase domain of the RET proto-oncogene in
multiple endocrine neoplasia type 2B and related sporadic tumors.
Hum Molec Genet 3:237–241.
Hellmich HL, Kos L, Cho ES, Mahon KA, Zimmer A (1996): Embryonic
expression of glial cell-line derived neurtrophic factor (GDNF) suggests
multiple developmental roles in neural differentiation and epithelialmesenchymal interactions. Mech Dev 54:95–105.
Hofstra R, Landsvater R, Ceccherini I, Stulp R, Stelwagen T, Luo Y, Pasini
B, Höppener J, Ploos van Amstel H, Romeo G, Lips C, Buys C (1994):
A mutation in the RET proto-oncogene associated with endocrine neoplasia type 2B and sporadic medullary thyroid carcinoma. Nature
367:375–376.
Klein R, Sherman D, Ho W, Stone D, Bennett G, Moffat B, Vandlen R,
Simmons L, Gu Q, Hongo J, Devaux B, Poulsen K, Armanini M, Nozaki
C, Asai N, Goddard A, Phillips H, Henderson C, Takahashi M, Rosen-
thal A (1997): A GPI-linked protein that interacts with Ret to form a
candidate neurturin receptor. Nature 387:717–721.
Kotzbauer P, Lampe P, Heuckeroth R, Golden J, Creedon D, Johnson Jr E,
Milbrandt J (1996): Neurturin, a relative of glial-cell-line-derived neurotrophic factor. Nature 384:467–470.
Moore M, Klain R, Farinas I, Sauer H, Armanini M, Phillips H, Reichart L,
Ryan A, Carver-Moore K, Rosenthal A (1996): Renal and neuronal abnormalities in mice lacking GDNF. Nature 382:76–79.
Mulligan L, Kwok J, Healey C, Elsdon M, Eng C, Gardner E, Love D, Mole
S, Moore J, Papi L, Ponder M, Telenius H, Tunnacliffe A, Ponder B
(1993): Germ-line mutations of the RET proto-oncogene in multiple
endocrine neoplasia type 2A. Nature 363:458–460.
Mulligan L, Eng C, Healey C, Clayton D, Kwok J, Gardner E, Ponder M,
Frilling A, Jackson C, Lehnert H, Neumann H, Thibodeau S, Ponder
BAJ (1994): Specific mutations of the RET proto-oncogene are related
to disease phenotype in MEN 2A and FMTC. Nat Genet 6:70–74.
Nakahara S, Yokomori K, Tamura K, Oku K, Tsuchida Y (1995):
Hirschsprung’s disease associated with Ondine’s curse: A special subgroup? J Pediatr Surg 30:1481–1484.
Pachnis V, Mankoo B, Costantini F (1993): Expression of the c-ret protooncogene during mouse embryogenesis. Development 119:1005–1017.
Pichel J, Shen L, Hui S, Granholm A, Drago J, Grinberg A, Lee E, Huang
S, Saarma M, Hoffer B, Sariola H, Westphal H (1996): Defects in enteric innervation and kidney development in mice lacking GDNF. Nature 382:73–76.
Romeo G, Ronchetto P, Luo Y, Barone V, Seri M, Ceccherini I, Pasini B,
Bocciardi R, Lerone M, Kääriäinen H, Martuciello G (1994): Point mutations affecting the tyrosine kinase domain of the RET proto-oncogene
in Hirschsprung’s disease. Nature 367:377–378.
Sanchez M, Silos-Santiago I, Frisen J, He B, Lira S, Barbacid M (1996):
Renal agenesis and the absence of enteric neurons in mice lacking
GDNF. Nature 382:70–73.
Saxen L (1987): ‘‘Organogenesis of the Kidney.’’ Cambridge University
Press.
Schuchardt A, D’Agati V, Larsson-Blomberg L, Costantini F, Pachnis V
(1994): Defects in the kidney and enteric nervous system of mice lacking the tyrosine kinase receptor Ret. Nature 367:380–383.
Schuchardt A, Srinivas S, Pacnhis V, Costantini F (1995): Isolation and
characterization of a chicken homolog of the c-ret proto-oncogene. Oncogene 10:641–649.
Suvanto P, Hiltunen JO, Arumäe U, Moshnyakov M, Sariola H, Sainio K,
Saarma M (1996): Localization of glial cell line-derived neurotrophic
factor (GDNF) mRNA in embryonic rat by in situ hybridization. Eur J
Neurosci 8:816–822.
Tahira T, Ishizaka Y, Itoh F, Sugimura T, Nagao M (1990): Characterization of ret proto-oncogene mRNAs encoding two isoforms of the protein
product in a human neuroblastoma cell line. Oncogene 5:97–102.
Trupp M, Arenas E, Fainziciber M, Nilsson A, Sieber B, Grigoriou M,
Kilkenny C, Salazar-Grueso E, Pachnis V, Arumäes U, Sariola H,
Saarma M, Ibañez CF (1996): Functional receptor for GDNF encoded
by the c-ret proto-oncogene. Nature 381:785–789.
Tsuzuki T, Takahashi M, Asai N, Iwashita T, Matsuyama M, Asai J (1995):
Spatial and temporal expression of the ret proto-oncogene product in
embryonic, infant and adult rat tissues. Oncogene 10:191–198.
Verloes A, Elmer C, Lacombe D, Heinrichs C, Rebuffat E, Demarquez J,
Moncla A, Adam E (1993): Ondine-Hirschsprung syndrome (Haddad
syndrome): Further delineation in two cases and review of the literature. Eur J Pediatr 152:75–77.
Документ
Категория
Без категории
Просмотров
3
Размер файла
731 Кб
Теги
965
1/--страниц
Пожаловаться на содержимое документа