close

Вход

Забыли?

вход по аккаунту

?

796

код для вставкиСкачать
?????
???. 13: 515?528 (1997)
Mechanisms of Salt Tolerance Conferred by
Overexpression of the HAL1 Gene in
Saccharomyces cerevisiae
GABINO RIOS, ALEJANDRO FERRANDO AND RAMON SERRANO*
Instituto de Biolog??a Molecular y Celular de Plantas, Universidad Polite?cnica de Valencia-CSIC,
Camino de Vera s/n, 46022 Valencia, Spain
Received 1 July 1996; accepted 20 October 1996
Overexpression of the HAL1 gene improves the tolerance of Saccharomyces cerevisiae to NaCl by increasing
intracellular K + and decreasing intracellular Na + . The effect of HAL1 on intracellular Na + was mediated by the
PMR2/ENA1 gene, corresponding to a major Na + efflux system. The expression level of ENA1 was dependent on
the gene dosage of HAL1 and overexpression of HAL1 suppressed the salt sensitivity of null mutants in calcineurin
and Hal3p, other known regulators of ENA1 expression. The effect of HAL1 on intracellular K + was independent
of the TRK1 and TOK1 genes, corresponding to a major K + uptake system and to a K + efflux system activated by
depolarization, respectively. Overexpression of HAL1 reduces K + loss from the cells upon salt stress, a phenomenon
mediated by an unidentified K + efflux system. Overexpression of HAL1 did not increase NaCl tolerance in galactose
medium. NaCl poses two types of stress, osmotic and ionic, counteracted by glycerol synthesis and sodium extrusion,
respectively. As compared to glucose, with galactose as carbon source glycerol synthesis is reduced and the
expression of ENA1 is increased. As a consequence, osmotic adjustment through glycerolsynthesis, a process not
affected by HAL1, is the limiting factor for growth on galactose under NaCl stress. ? 1997 by John Wiley & Sons,
Ltd.
Yeast 13: 515?528, 1997.
No. of Figures: 11. No. of Tables: 2.
No. of References: 31.
??? ????? ? HAL1; ENA1; calcineurin; sodium transport; potassium transport; Saccharomyces cerevisiae
INTRODUCTION
The genetic analysis of the mechanisms of salt
tolerance in Saccharomyces cerevisiae has disclosed
several crucial reactions for cation homeostasis
and toxicity. At the cytoplasmic level, the Na +
sensitivity of the phosphatase encoded by the
MET22/HAL2 gene limits growth in media containing NaCl (Glaser et al., 1993). This enzyme
is required for methionine biosynthesis and it
specifically hydrolyses the 3*-phosphoadenosine5*-phosphate produced in the sulfate activation
and reduction pathway. The Na + inhibition of the
Hal2p phosphatase is counteracted by K + and
*Correspondence to: Ramon Serrano.
Contract grant sponsor: Spanish CICYT Biotechnology
Program (Madrid)
Contract grant sponsor: Project of Technological Priority of the
European Union (Brussels)
CCC 0749-503X/97/060515?14 $17.50
? 1997 by John Wiley & Sons Ltd
therefore it is the Na + /K + ratio that determines
growth inhibition (Murgu??a et al., 1995). In the
presence of methionine the salt-sensitivity of the
Hal2p phosphatase is bypassed and other as
yet unidentified salt-sensitive enzymes would be
responsible for growth inhibition by NaCl.
Intracellular cation homeostasis is mostly determined by the concerted action of two major
transport systems not well characterized at the
biochemical level. The sodium-efflux system
affected by mutations in the PMR2/ENA1 gene
(Haro et al., 1991) is the major determinant of
intracellular sodium levels. Although there are
several genes in tandem which encode isoforms of
the ENA (Efflux of NAtrium) ATPase (Wieland
et al., 1995), the first repeat, ENA1, is the most
expressed gene and the one which determines
salt tolerance (Garciadeblas et al., 1993). The
?. ???? ?? ??.
516
potassium influx system affected by mutations in
the TRK1 gene (Gaber, 1992) also participates in
salt tolerance, although it is less important than
the ENA1 system (Haro et al., 1993). There is a
related TRK2 gene much less expressed than
TRK1 and therefore less important for cation
homeostasis in wild-type strains (Gaber, 1992).
The emerging picture of salt-tolerance mechanisms
in yeast, based on salt-sensitive enzymes and salt
uptake and efflux systems, may illuminate the
situation with the less tractable higher plants
(Haro et al., 1993; Serrano, 1996).
Many genes have recently been isolated by either
?gain of function? or ?loss of function? strategies
which identify regulatory components of salt
tolerance in S. cerevisiae (Serrano, 1996). Overexpression of either HAL1 (Gaxiola et al., 1992)
or HAL3 (Ferrando et al., 1995) increases salt
tolerance. Pharmacological inhibition (Nakamura
et al., 1993) or inactivating mutations (Mendoza
et al., 1994) implicate the protein phosphatase
calcineurin as a positive factor in salt tolerance.
Null mutations on the Ppzp1,2 protein phosphatases increase salt tolerance (Posas et al., 1995)
while null mutations on casein kinase II decrease it
(Bidwai et al., 1995). These results indicate that
salt tolerance is regulated by multiple signal transduction pathways, some of them including novel
regulatory proteins such as Hal1p and Hal3p.
The interaction of these regulatory components
with the cation influx and efflux systems described
above has only started to be investigated.
Calcineurin (Mendoza et al., 1994), Hal3p
(Ferrando et al., 1995) and Ppzp1,2 (Posas et al.,
1995) modulate the expression level of ENA1 and
therefore the capability of yeast cells for sodium
extrusion. In the case of calcineurin (Mendoza
et al., 1994) and Hal3p (Ferrando et al., 1995),
some effect on K + transport has also been
observed, although the mechanism is unknown.
In the present work we have investigated the
mechanisms of salt tolerance conferred by overexpression of the HAL1 gene, a potent modulator
of ion homeostasis in yeast (Gaxiola et al., 1992).
Our results indicate that HAL1 has two different
targets: the Na + efflux system determined by the
ENA1 gene and an unidentified K + efflux system
activated by salt stress. We have also determined
that salt tolerance on galactose medium is not
affected by HAL1. In this medium the osmotic
stress posed by NaCl, not affected by HAL1, is
more important for growth inhibition than sodium
toxicity.
? 1997 by John Wiley & Sons, Ltd.
MATERIALS AND METHODS
Yeast strains and growth media
The yeast strains used in the present work are
listed in Table 1. Yeast culture and manipulation
were performed by standard methods (Guthrie and
Fink, 1991). SD minimal medium contained 2%
glucose, 0� yeast nitrogen base without amino
acids (Difco), 50 m?-2-(N-morpholino) ethanesulfonic acid adjusted to pH 6�with Tris, and the
amino acids (100 靏/ml leucine or tryptophan,
30 靏/ml histidine) and uracil (30 靏/ml) required
by the strains. Rich medium contained 1% yeast
extract (Difco), 2% Bacto Peptone (Difco) and 2%
glucose (YPD medium) or 2% galactose (YPGal
medium). Solid media included 2% agar. NaCl or
LiCl were added as indicated.
Plasmid construction and yeast transformation
The pRS699 multicopy vector, carrying the
URA3 marker and the promoter and transcription
termination regions of the PMA1 ATPase gene
(Serrano and Villalba, 1995) was used to achieve a
high and constitutive level of HAL1 expression.
The HAL1 coding region was subcloned as a NsiI
fragment into plasmid pSL301 (Invitrogen, San
Diego, CA, U.S.A.). The SmaI-HpaI fragment in
the polylinker was deleted to remove ATG triplets.
The HAL1 reading frame was obtained from this
plasmid as a XhoI-SalI fragment and cloned into
the XhoI site of pRS699 to yield pRS341. This
plasmid is referred in the text as YEpHAL1. This
construction contained 240 bp (70 bp from pSL301
and 170 bp from pRS699) between the HAL1
ATG and the transcription initiation site of the
PMA1 promoter. As transcription initiation from
the HAL1 promoter occurs about 40 bp upstream
of the ATG (J. A. Marquez and R. Serrano,
unpublished observations), HAL1 transcripts from
pRS341 are about 0�kb larger than chromosomal
transcripts. pRS903 is a multicopy URA3 plasmid
with the 2� kb BglII-HindIII fragment including
the HAL1 gene with its own promoter (Gaxiola
et al., 1992).
To delete the TOK1/YCK1 gene (Ketchum et al.,
1995; Zhou et al., 1995), polymerase chain reaction
(PCR) standard procedures were used. The
primers 5*-CAAGAGCTCGCCTAAGCAGTAG
TATC, containing a SacI site (underlined) and
5*-CAAGGATCCGCTGTTCATGAACCTTG,
containing a BamHI site (underlined) were
used to amplify a 470 bp fragment upstream
of the TOK1 coding region from genomic DNA
?????
???. 13: 515?528 (1997)
???1 ???? ??? ???? ?????????
Table 1.
Yeast strains used.
Strain
RS16
RS347
RS348
RS904
RS41
RS462
RS956
RS461
RS564
RS566
RS1095
RS1096
RS521
RS533
RS545
RS48
RS1134
RS1135
RS1131
RS1132
RS1133
DBY746
RH16.6
RH2.2
RS825
RS827
RS841
RS843
RS836
RS839
517
Genotype
Source or reference*
MATa leu2-3,112 ura3-251,328,372
RS16 [pRS699]
RS16 [pRS341]
RS16 [pRS903]
RS16 [YCp50] [pSB32]
RS348 [YEp351]
RS16 hal1::LEU2
RS956 [pRS699]
RS16 URA3::ENA1-lacZ
RS564 [YEp351]
RS956 URA3::ENA1-lacZ
RS564 [pRS1097]
RS16 cnb1::LEU2
RS521 [YEp352]
RS521 [pRS341]
RS16 hal3::LEU2
RS48 [pRS699]
RS48 [pRS341]
RS16 tok1::LEU2
RS1131 [pRS699]
RS1131 [pRS341]
MAT� leu2-3,112 ura3-52 his3-�trp1-289
DBY746 ena1�:LEU2::ena4�
DBY746 trk1::LEU2
DBY746 [YEp352] [pSB32]
DBY746 [pRS341] [pSB32]
RH16.6 [YEp352]
RH16.6 [pRS341]
RH2.2 [YEp352]
RH2.2 [pRS341]
Gaxiola et al. (1992)
Gaxiola et al. (1992)
Ferrando et al. (1995)
Ferrando et al. (1995)
YGSC
Haro et al. (1993)
Haro et al. (1993)
Ferrando et al. (1995)
Ferrando et al. (1995)
*Unless otherwise indicated, from this study; YGSC, Yeast Genetic Stock Center, Berkeley CA,
U.S.A.
of the S. cerevisiae RS16 strain. The primers
5*-CCCTCTAGAATACAAACACCCGAAGC,
containing a XbaI site (underlined) and 5*-CAA
CTGCAGGTGGAACGGATTTACAC, containing a PstI site (underlined) were used to amplify a
downstream fragment of 350 bp. Both fragments
were introduced sequentially into the pJJ283 plasmid (Jones and Prakash, 1990) flanking the LEU2
gene. RS16 was transformed with a PvuII digest of
this plasmid and transformants (Gietz et al., 1995)
were analysed by Southern blot hybridization with
the downstream PCR fragment described above
as a probe. Wild-type DNA digested with ClaI
exhibited a hybridization band of 6�kb which
shifted to 1�kb in the digested DNA from the
gene disruption.
? 1997 by John Wiley & Sons, Ltd.
Measurement of intracellular cation contents
For K + and Na + measurements, 20 ml of exponentially growing cells in minimal medium were
harvested by centrifugation at 4)C after mixing
with 20 ml of precooled washing solution (20 m?MgCl2 and sorbitol with the same osmolarity as
the culture medium). Two centrifugation washes
were made in the case of normal medium and four
if the medium contained NaCl. After resuspension
in 0�ml of 20 m?-MgCl2, intracellular water was
estimated according to Gaxiola et al. (1992) and
ions were extracted by incubation at 95)C for
12 min. For Li + accumulation experiments, LiCl
was added to the exponential cultures to a final
concentration of 100 m? and 20 ml aliquots were
?????
???. 13: 515?528 (1997)
?. ???? ?? ??.
518
collected at different times. Samples were centrifuged after mixing with 20 ml of precooled washing solution (see above). After resuspension in
10 ml of washing solution, cells were collected on
glass microfibre filters (Whatman GF/C) and
washed on the filter twice. Ions were extracted by
incubation at 95)C and centrifugation as above.
Ion content in the clarified extracts was determined
by using an atomic absorption spectrometer
(Varian) in flame emission mode.
�-Galactosidase assays
An ENA1-lacZ fusion, containing the promoter
of the ENA1 gene fused to the lacZ coding region
in plasmid YIp356R, was a gift of Prof. Alonso
Rodr??guez-Navarro (Mendoza et al., 1994). The
fusion was integrated at the URA3 locus of strains
RS16 (wild type; Ferrando et al., 1995) and RS956
(hal1::LEU2; Gaxiola et al., 1992). Cultures
were incubated for 1�h after addition of solid
NaCl to obtain different salt concentrations.
�-Galactosidase activity was measured in permeabilized cells as described previously (Gaxiola et al.,
1992). Units of activity were normalized to cell
density.
Glycerol determination
For intracellular glycerol determination, 1 ml of
log-phase cells in YPD or YPGal media was
filtered through a glass microfibre filter (Whatman
GF/C) and washed twice with 5 ml of 20 m?MgCl2 with an iso-osmotic concentration of
sorbitol. The cells were resuspended in 1 ml of
0�?-Tris?HCl pH 7�and heated at 95)C for
12 min. After centrifugation, the supernatant was
used to measure the internal glycerol content. For
extracellular glycerol determination, 1 ml of the
culture was centrifuged to discard cells and the
supernatant was used for glycerol assay. Glycerol
content was determined by means of an enzymatic
assay kit (Boehringer Mannheim cat. no. 148270).
The internal glycerol content was normalized to
the cell density.
RESULTS AND DISCUSSION
HAL1 overexpression modulates salt tolerance
and cation homeostasis
We have previously reported the cloning and
partial characterization of the yeast HAL1 gene,
encoding a novel regulatory protein which confers
salt tolerance when overexpressed from its own
? 1997 by John Wiley & Sons, Ltd.
Figure 1. Analysis of HAL1 expression in strains with different expression plasmids. Northern (A) and Western (B) analysis
of cells with control plasmid (strain RS347; lanes 1 and 2), cells
with pRS903 plasmid (overexpressing HAL1 from its own
promoter, strain RS904; lanes 3 and 4) and cells with pRS341
plasmid (overexpressing HAL1 from the PMA1 promoter,
strain RS348; lanes 5 and 6). Yeast cells were grown in minimal
medium with (lanes 2, 4 and 6) or without (lanes 1, 3 and 5)
1 ?-NaCl and harvested during exponential phase (absorbance
at 660 nm 0�0�. The positions of the 1�and 3�kb
ribosomal RNAs (A) and of protein molecular weight markers
of 68, 43 and 26 kDa (B) are indicated at the right. The HAL1
mRNA corresponds to the hybridization bands of 1�(lane 4)
and 1�(lanes 5 and 6) kb in (A). This change in size is due to
differences in the plasmid constructions (see Materials and
Methods). The position of the 32 kDa HAL1 protein recognized by the antibody (Gaxiola et al., 1992) is indicated by an
asterisk (*) in (B).
promoter in a multicopy vector (Gaxiola et al.,
1992). The promoter of HAL1 has a relatively low
level of expression inducible by osmotic stress
(Gaxiola et al., 1992). To improve the phenotypic
features associated with overexpression of HAL1,
we transformed yeast with an episomal plasmid
(pRS341 or YEpHAL1) containing the HAL1
coding region under control of the PMA1 promoter (Serrano and Villalba, 1995). This promoter
confers to HAL1 a strong and constitutive transcriptional activity, as demonstrated by both
Northern and Western analysis (Figure 1). We
tested the NaCl tolerance of this strain and
?????
???. 13: 515?528 (1997)
???1 ???? ??? ???? ?????????
519
Figure 2. Effect of HAL1 gene dosage on salt tolerance. Growth of cells with
control plasmid (strain RS347; circles), cells with pRS903 plasmid (overexpressing HAL1 from its own promoter, strain RS904; squares) and cells with pRS341
plasmid (overexpressing HAL1 from the PMA1 promoter, strain RS348; diamonds) was monitored by absorbance measurements at 660 nm in normal
medium (closed symbols) and in medium supplemented with 1�?-NaCl (open
symbols). Fresh stationary cultures were diluted 100 times at time zero. The
experiment was repeated three times with similar results.
concluded that the increased production of Hal1p
is connected with a higher growth rate in media
containing NaCl. Duplication times were determined in strain RS16 transformed with different
plasmids and growing in minimal medium
supplemented with 1�?-NaCl (Figure 2). Cells
containing control plasmid (pRS699; 11 h), plasmid with HAL1 expressed from its own promoter
(pRS903; 8 h) and plasmid with HAL1 expressed
from the PMA1 promoter (pRS341; 5 h) exhibited
the expected correlation between HAL1 expression
level and salt tolerance.
The known capacity of HAL1 to maintain a
high K + internal concentration after salt stress
(Gaxiola et al., 1992) was corroborated in strain
DBY746 transformed with pRS341 (RS827 of
Table 1). The K + content in this strain doubled
that of the control strain after incubation with
1 ?-NaCl. This effect of HAL1 overexpression on
K + levels was also observed in trk1 and ena1?4
mutants (Table 2), suggesting that it is not mediated by an interaction of Hal1p with either
the TRK1-dependent cation influx system or the
ENA1-dependent cation efflux system.
The additional halotolerance conferred by overexpression of HAL1 from the PMA1 promoter
over that conferred by overexpression of HAL1
from its own promoter (Figure 2) correlates with a
? 1997 by John Wiley & Sons, Ltd.
Table 2. Effect of HAL1 overexpression on cation
content of trk1 and ena1-4 mutants.
Intracellular cations (m?)
Strain
Wild type
trk1
ena1-4
YEpHAL1
"
+
"
+
"
+
[K + ](1)
[K + ](2)
[Na + ](2)
254&7
78&1 185&4
263&30 142&28 135&19
198&18 73&14 185&9
227&23 115&21 203&10
322&9
65&5 236&18
352&16 116&5 254&9
Wild-type strain DBY746 and mutant strains RH2.2
(trk1::LEU2) and RH16.6 (ena1�:LEU2::ena4�) were transformed with the pRS341 HAL1 plasmid (YEpHAL1 +) or with
a control vector (YEpHAL1 "). Strain numbers are: RS825
(wt "), RS827 (wt +), RS836 (trk1"), RS839 (trk1+), RS841
(ena1-4") and RS843 (ena1-4+). Cation measurements were
made before salt addition (1) and 3 h after incubation with
1 ?-NaCl (2). Results are the average (& standard deviation)
of four determinations.
novel effect on Na + homeostasis not apparent in
our previous report (Gaxiola et al., 1992). Overexpression of HAL1 from the strong PMA1
promoter in wild-type yeast lowers the net accumulation of Na + (Table 2). This effect, however, is
not observed in trk1 and ena1?4 mutants (Table 2).
?????
???. 13: 515?528 (1997)
?. ???? ?? ??.
520
Figure 3. Effects of HAL1 gene dosage on intracellular K + and Na +
during salt stress. Exponentially growing cells were supplemented at time
zero with NaCl to a final concentration of 0� ?. Samples were taken at
different times and K + (A) and Na + (B) contents were determined as
described in Materials and Methods. Closed circles: RS347 strain (wild
type; control plasmid); open circles: RS348 strain (overexpressing HAL1
from the PMA1 promoter); squares: RS461 strain (hal1::LEU2; control
plasmid). Results are the average of three determinations differing less than
5%. The experiment was repeated three times with similar results.
Therefore, opposite to the situation with potassium homeostasis, both a functional TRK1dependent cation influx system and a functional
ENA1-dependent cation efflux system are required
for Hal1p to modulate sodium homeostasis.
Interaction of Hal1p with potassium and sodium
transport systems
A possible mechanism for the effect of HAL1 on
K + homeostasis was suggested by the kinetic study
of Figure 3A. Overexpression of HAL1 greatly
? 1997 by John Wiley & Sons, Ltd.
reduces K + loss from the cells induced by NaCl
addition. Apparently, a K + efflux system is activated by salt stress and overexpression of Hal1p
greatly reduces the activity of this system. The
nature of this transporter, however, remains
unknown. A K + efflux system encoded by the
TOK1/YCK1 gene and activated by depolarization
has recently been described (Ketchum et al., 1995;
Zhou et al., 1995). Disruption of this gene has no
effect on salt tolerance and it prevents neither K +
loss induced by NaCl nor the effect of HAL1 on
?????
???. 13: 515?528 (1997)
???1 ???? ??? ???? ?????????
Figure 4. HAL1 functions in a tok1 deleted strain. The TOK1
(Tok1 + , wt) strains with control plasmid and with the pRS341
HAL1 plasmid (wt+YEpHAL1) correspond to RS347 and
RS348, respectively (Table 1). The tok1::LEU2 disruption
strains (Tok1 " , tok1) with control plasmid and with the
pRS341 HAL1 plasmid (tok1+YEpHAL1) correspond to
strains RS1132 and RS1133, respectively (Table 1). (A) Halotolerance tests: fresh saturated cultures were diluted 100-fold
with water and 3 靗 dropped on plates with salts as indicated.
(B) K + content in cells with control plasmid (open bars) and
with the pRS341 HAL1 plasmid (YEpHAL1; filled bars) was
measured before (") or after (+) incubation for 3 h with
1 ?-NaCl. Results are the average (&standard deviation) of
four determinations. The experiment was repeated three times
with similar results.
intracellular K + and salt tolerance (Figure 4). It
would be interesting to determine if HAL1 effects
on K + levels are mediated by a recently described
K + /H + antiporter (Camarasa et al., 1996). The
corresponding gene, however, has not yet been
identified.
Overexpression of HAL1 was able to improve
the growth of the trk1 mutant in YPD medium
with a NaCl content as high as 1 ? (Figure 5A).
This mutant is only slightly more salt sensitive
? 1997 by John Wiley & Sons, Ltd.
521
than wild type (Haro et al., 1993). The ena1?4
mutant, however, is much more salt sensitive than
wild type (Haro et al., 1993) and HAL1 overexpression was effective only at NaCl concentrations
lower than 0�?. These growth phenotypes have
been correlated with the kinetics of Li + uptake by
the different strains. Li + has the same transport
systems (Haro et al., 1993) and toxicity targets
(Murgu??a et al., 1995) as Na + but is more
convenient for non-radioactive transport studies
(Haro et al., 1996).
Overexpression of HAL1 reduced the net accumulation of Li + in wild-type cells but had no effect
in either trk1 or ena1?4 mutants (Figure 5B). The
initial rate of Li + uptake (first 15 min) was the
same in wild type and in the ena1?4 mutant
(Figure 5B). Later on the operation of the ENA1
efflux system results in less Li + accumulation in
wild type compared to the ena1?4 mutant. This
ENA1-dependent decrease in Li + accumulation
was potentiated by overexpression of HAL1,
suggesting that Hal1p may activate the ENA1
system. Hal1p has no effect on Li + accumulation
by the ena1?4 mutant and this is in accordance
with the lack of effect of HAL1 on Na + accumulation by this mutant (Table 2). Therefore, the
limited salt tolerance conferred by overexpression
of HAL1 in the ena1?4 mutant (Figure 5A) is
exclusively due to the effect of Hal1p on K + efflux
(Figure 3A) and intracellular K + (Table 2).
The initial rate of Li + uptake was greatly increased by the trk1 mutation (Figure 5B), probably
because this mutation affects the capacity of the
cation uptake system to discriminate between K +
(present in the medium) and Li + (Gaber, 1992;
Haro et al., 1993; Gomez et al., 1996). Apparently,
under the conditions of enhanced Li + uptake of
the trk1 mutant, the effect of overexpression of
HAL1 on ENA1-mediated Li + efflux described
above could not significantly decrease net Li +
accumulation. Therefore, the salt tolerance
conferred by overexpression of HAL1 in the
trk1 mutant (Figure 5A) is exclusively due to the
effect of Hal1p on K + efflux (Figure 3A) and
intracellular K + level (Table 2).
Hal1p is an effector of ENA1 expression
An array of different effectors, including calcineurin (Mendoza et al., 1994), Hal3p (Ferrando
et al., 1995) and Ppz protein phosphatases
(Posas et al., 1995) have been described to alter
Na + and Li + homeostasis by regulating ENA1
?????
???. 13: 515?528 (1997)
?. ???? ?? ??.
522
Figure 5. Effects of overexpression of HAL1 on trk1 and ena1?4
mutants. (A) Salt tolerance of strains RS825 (wild type with control
plasmids; wt), RS827 (wild type with pRS341 HAL1 plasmid;
wt+YEpHAL1), RS836 (trk1::LEU2 with control plasmid; trk1), RS839
(trk1+YEpHAL1), RS841 (ena1?4::LEU2 with control plasmid; ena1?4)
and RS843 (ena1?4+YEpHAL1). Halotolerance tests were as in Figure
4A. (B) Lithium uptake in wild type (circles), ena1?4: mutant (triangles)
and trk1 mutant (squares). Open symbols: strains carrying control
plasmid YEp352; closed symbols: strains carrying the pRS341 HAL1
plasmid (YEpHAL1). Cells were supplemented at time zero with 0�?LiCl and samples were taken at different times to measure the internal
lithium concentration as described in Materials and Methods. The
experiment was repeated three times with similar results.
transcriptional activity. To determine if ENA1
transcription is affected by Hal1p, we integrated an
ENA1 promoter-lacZ reporter fusion gene into the
genome of wild type, hal1 null mutant and the
strain overexpressing HAL1. �-Galactosidase
activity, corresponding to ENA1 expression, was
shown to be dependent on HAL1 gene dosage.
? 1997 by John Wiley & Sons, Ltd.
Both the basal (Figure 6A) and salt-induced
(Figure 6B) levels of expression were minimal in
the hal1 mutant and greatest in the strain overexpressing HAL1. Therefore, Hal1p seems to
modulate Li + and Na + transport by regulating
the expression level of the cation efflux system
dependent on ENA1. Hal1p affects basal (Figure
?????
???. 13: 515?528 (1997)
???1 ???? ??? ???? ?????????
Figure 6. Expression of an integrated ENA1-lacZ fusion in
yeast cells with differences in HAL1 gene dosage. (A) Cells
grown in YPD medium without salt. (B) Cells grown in YPD
medium were incubated for 1�h with the indicated NaCl
concentrations. Squares: strain RS461 (hal1::LEU2 mutant
with control plasmid; hal1); closed circles, RS41 (wild type with
control plasmids; wt); open circles: RS462 (wild type carrying
the pRS341 HAL1 plasmid; wt+YEpHAL1).
6A) and salt-induced (Figure 6B) levels of ENA1
expression to a similar extent. Therefore, the saltinduction factor (�-galactosidase activity after
growth with salt/�-galactosidase activity after
growth without salt) is very similar (from 20 to 40)
in wild type, hal1 null mutant and in the strain
overexpressing HAL1. This suggests that Hal1p
modulates the overall activity of the ENA1 promoter but it does not participate in the signal
transduction pathway mediating increased
transcription of ENA1 by salt.
HAL1 suppresses the salt sensitivity of cnb1 and
hal3 mutants
We have tested if the halotolerance effects of
HAL1 are mediated by the two previously estab? 1997 by John Wiley & Sons, Ltd.
523
Figure 7. Overexpression of HAL1 suppresses the salt sensitivity and lithium overaccumulation of hal3 and cnb1 null
mutants. (A) Halotolerance test in salt plates after incubation
for 3 days. (B) Intracellular Li + content following 1�h incubation with 0�?-LiCl. Wt: strain RS41 with control plasmids;
wt+YEpHAL1: strain RS342 with pRS341 HAL1 plasmid;
hal3: strain RS1134 with hal3::LEU2 mutation and control
plasmid; hal3+YEpHAL1: strain RS1135 with hal3::LEU2
mutation and pRS341 HAL1 plasmid; cnb1: strain RS533 with
cnb1::LEU2 mutation and control plasmid; cnb1+YEpHAL1:
strain RS533 with cnb1::LEU2 mutation and pRS341 HAL1
plasmid. In (B) filled bars represent strains with the pRS341
HAL1 plasmid (YEpHAL1) and open bars strains with control
plasmids.
lished pathways defined by calcineurin and Hal3p
(Mendoza et al., 1994; Ferrando et al., 1995). As
indicated in Figure 7A, overexpression of HAL1
suppresses the salt sensitivity of null mutants in
calcineurin (cnb1) and hal3. The halotolerance
phenotypes correlate with a decrease in Li +
accumulation, probably reflecting the activity of
the ENA1 system. These results indicate that
?????
???. 13: 515?528 (1997)
?. ???? ?? ??.
524
Figure 8. Effect of overexpression of HAL1 on salt tolerance
in rich medium with glucose (YPD) or galactose (YPGal) as
carbon source. Wt: strain RS347 with control plasmid;
wt+YEpHAL1: strain RS348 with pRS341 HAL1 plasmid.
Media were supplemented with 1�?-NaCl or 0�?-LiCl as
indicated and incubated for 3 days after drop inoculation.
Hal1p does not require the presence of either
calcineurin or Hal3p to confer salt tolerance.
Therefore Hal1p either defines a novel transduction pathway for ENA1 expression or it is a
downstream component of the calcineurin or
Hal3p pathways. The second possibility is unlikely
because gene disruption of either calcineurin
(CNB1) or HAL3 results in much greater salt
sensitivity than disruption of HAL1 (Gaxiola
et al., 1992; Ferrando et al., 1995).
HAL1 does not confer halotolerance in galactose
media
Many aspects of yeast physiology are modulated
by the nature of the carbon source in growth
media, with glucose often playing a differential
role with respect to other sugars such as galactose
and to non-fermentable carbon sources such as
ethanol (Gancedo and Serrano, 1989). Therefore,
we have investigated the effect of HAL1 overexpression on salt tolerance with different carbon
sources. As indicated in Figure 8, HAL1 overexpression was not able to improve growth of
yeast cells in galactose medium (YPGal) with
1�?-NaCl, a salt concentration which could be
overcome by HAL1 in glucose medium (YPD). On
the other hand, HAL1 improved growth in YPGal
and in YPD with 0�?-LiCl. Overexpression of
HAL1 was also unable to improve growth of yeast
cells in ethanol medium with 1�?-NaCl (data not
shown). Due to slow yeast growth on ethanol
media, the phenomenon was further investigated
in galactose media.
The fact that overexpression of HAL1 in
galactose-growing cells conferred tolerance to
0�?-LiCl but not to 1�?-NaCl suggested that
the osmotic component of high NaCl concentrations could be acting as the growth-limiting step
? 1997 by John Wiley & Sons, Ltd.
in galactose medium. The effect of halotolerance
determinants specific for Na + toxicity, such as the
HAL1 gene (Gaxiola et al., 1992), would become
masked by the osmotic deficiency prevailing in
galactose medium.
NaCl poses two types of stress to cells: osmotic
stress and sodium toxicity (Serrano, 1996). Our
previous work has demonstrated that, in glucose
medium equivalent concentrations of KCl and
sorbitol are less inhibitory to yeast growth than
NaCl (Gaxiola et al., 1992). KCl and sorbitol only
cause osmotic stress while NaCl also contributes
sodium toxicity. Therefore, in glucose medium the
sodium toxicity of NaCl is more important for
growth inhibition than non-specific osmotic stress.
As indicated in Figure 9, NaCl is more toxic
than KCl in glucose medium but in galactose
medium both solutes are equally inhibitory.
Similar results were obtained with sorbitol (data
not shown). This suggested that the factor which
determines growth inhibition in galactose medium
is the osmotic component of NaCl, and not
sodium toxicity.
The accumulation of compatible solutes (osmolytes) inside the cell is the best known response to
osmotic stress (Serrano, 1996). In yeast, glycerol is
the main osmolyte accumulated to counterbalance
the external osmotic pressure (Blomberg and
Adler, 1989). Figure 10A describes the effect of
addition of 1 ?-NaCl on the production of glycerol. In glucose medium, the intracellular glycerol
content increases from 50 m? to about 1 ? within
the first 3�h. In YPGal, after a small increase
during the first hour, a glycerol content of about
70 m? remained constant during the experiment.
The external glycerol concentration, invariable
during the experiment, was 2�m? in YPD and
0�m? in YPGal. This allowed us to discard
differences in glycerol retention between glucose
and galactose. GPD1, which encodes the cytoplasmic glycerol-3-phosphate dehydrogenase, accounts
for the increased synthesis of glycerol at high
external osmolarity (Albertyn et al., 1994). In
addition, stressed cells improve glycerol retention
by lowering the plasma membrane permeability
for the osmolyte (Luyten et al., 1995). This useful
mechanism, working from the first minutes, could
explain the initial glycerol rise in galactosegrowing cells.
The relative metabolic incapacity of galactosegrowing cells to effectively produce glycerol would
cause a defect in adaptation to osmotic stress.
Although it is not readily apparent from Figure 9,
?????
???. 13: 515?528 (1997)
???1 ???? ??? ???? ?????????
525
Figure 9. Inhibition of growth of strain RS16 in YPD (open symbols)
and YPGal (closed symbols) by different salts. LiCl (triangles), NaCl
(squares) and KCl (circles) were used at the indicated concentrations.
Measurements were made 26 h after inoculation for YPD cultures and
49 h for YPGal cultures. Optical densities of cultures without salt were
considered to be 100% and reached absolute values between 3 and 4
(late exponential phase).
Figure 10. Intracellular glycerol in YPD (open circles) and YPGal (closed circles) cultures of
strain RS16. (A) Exponential cultures without salt were supplemented with 1 ?-NaCl at time
zero and samples were taken at the indicated times for glycerol determination as described
in Materials and Methods. (B) Samples were taken from exponential cultures (absorbance at
660 nm about 1) growing in glucose or galactose media with 1 ?-NaCl.
galactose-grown cells are more sensitive to high
concentrations of KCl than glucose-grown cells
(closed circles versus open circles). At 0�?-KCl,
residual growth in galactose was 9% of controls,
while in glucose it was 19%. At 1 ?-KCl, the values
were <1% in galactose (no growth detected) and
? 1997 by John Wiley & Sons, Ltd.
3% in glucose. Therefore, although the differences
in growth rates between glucose and galactose
media make comparisons difficult, these relative
values suggest that high osmotic concentrations
are more deleterious to galactose-growing cells
than to glucose-growing cells.
?????
???. 13: 515?528 (1997)
?. ???? ?? ??.
526
The reasons for the defective glycerol synthesis
in galactose-growing cells may be multiple. As
glucose substitution by galactose induces respiratory enzymes, both glycerol-3-phosphate and
NADH produced by the glycolytic pathway would
be consumed by respiration and glycerol synthesis
would be inhibited (Gancedo and Serrano, 1989).
In addition, with galactose the glycolytic flux rate
is smaller than with glucose, further reducing the
supply of glycerol-3-phosphate and NADH for
glycerol synthesis.
If the only noticeable difference between YPD
and YPGal were the salt adaptation time of glycerol metabolism, we would expect in salt-adapted
cells a similar internal glycerol concentration for
both media. But intracellular glycerol measurements of cells growing exponentially in YPGal
with 1 ?-NaCl rendered too low values, about
0�?, unable to balance the external osmotic pressure (Figure 10B). Glucose-grown cells had much
higher glycerol levels (about 1�?). The apparent
osmotic imbalance of galactose-grown cells could
be explained by the accumulation of other osmolytes such as trehalose (Blomberg and Adler,
1992). Preliminary results indicate that, at variance
with glucose-growing cells which only produce
glycerol, galactose-growing cells can produce both
glycerol and trehalose as compatible solutes for
osmotic adjustment (G. Rios, J. M. Belle?s and
R. Serrano, unpublished observations).
ENA1 is regulated by carbon source
The next question arose from the increased LiCl
tolerance of yeast cells in YPGal as compared
with YPD medium observed in Figure 9. Lithium
accumulates much less in cells growing in YPGal
as compared to cells growing in YPD (Figure 11A)
and this suggests a different activity of the ENA1
efflux system. By using the integrated ENA1-lacZ
promoter-reporter fusion we concluded that, in the
absence of salt stress, galactose increases ENA1
expression by a factor of 25-fold as compared to
glucose. In the presence of 0�?-NaCl there is only
a 60% increase in expression in galactose medium,
while in the case of glucose the induction factor
is 13-fold (Figure 11B). Therefore the increased
Li + tolerance and decreased Li + accumulation of
galactose-growing cells compared with glucosegrowing cells can be explained by the differences
in expression of the ENA1 ATPase in these two
media.
? 1997 by John Wiley & Sons, Ltd.
Figure 11. Li + accumulation and ENA1-lacZ expression in
YPD (open circles) and YPGal (closed circles) cultures of strain
RS564 (RS16 with an integrated ENA1-lacZ promoter-reporter
fusion). (A) Time course of Li + uptake after addition of
0�?-LiCl at time zero. (B) �-Galactosidase activity in basal
medium (open bars) and in medium supplemented with 1 ?NaCl for 1�h (filled bars).
These results indicate that the ENA1 gene is
controlled by one or several of the sugar-sensing
pathways of yeast (Thevelein, 1994). The protein
kinase A pathway, activated by glucose metabolism (Thevelein, 1994) has recently been shown to
negatively modulate ENA1 expression (Marquez
and Serrano, 1996). More recently, we have
obtained evidence that the Snf1 pathway, inhibited by glucose metabolism (Thevelein, 1994),
positively modulates ENA1 (P. M. Alepuz,
J. A. Marquez, R. Serrano and F. Estruch,
unpublished observations).
?????
???. 13: 515?528 (1997)
???1 ???? ??? ???? ?????????
The complex regulation of cation homeostasis
in yeast
The present work on the modulation of ion
transport in yeast by the HAL1 gene constitutes a
molecular genetics approach to the mechanisms of
ion homeostasis. The regulation and integration of
transport systems to achieve homeostasis is one
of the most fundamental features of living cells but
the molecular mechanisms involved are largely
unknown (Stein, 1990). As first demonstrated in
the field of metabolism, in addition to enzyme
catalysts, a multitude of regulatory proteins play a
central role in integrating diverse cellular functions
(Alberts et al., 1994). In the case of alkali cation
transport in yeast, a few transporter genes such as
TRK1, TOK1 and ENA1 have been identified
(Gaber, 1992; Serrano, 1996). These few catalytic
systems are controlled by a plethora of regulatory
proteins including protein kinases, protein phosphatases and proteins of unknown mechanism
such as Hal1p (Serrano, 1996). These regulatory
components are as crucial for salt tolerance as the
transporters themselves. We have traced back
the effects of Hal1p on salt tolerance and ion
homeostasis to the inhibition of a K + efflux
system activated by salt stress and to the transcriptional activation of the ENA1 sodium efflux
system. Hal1p itself is induced by salt stress
(Gaxiola et al., 1992) and therefore we have an
example of a modulator of ion transport synthesized under conditions of perturbed ion homeostasis to help to restore a normal intracellular
medium.
It is hoped that further genetic and biochemical
analysis on the interactions between transport
and regulatory proteins such as Hal1p could provide a molecular mechanism for the homeostasis
of the intracellular ions in the model organism
S. cerevisiae. This would be useful not only from
the point of view of basic knowledge (Stein, 1990),
but also for the generation of transgenic crops with
improved performance under salt stress (Serrano,
1996).
ACKNOWLEDGEMENTS
This work was supported by grants of the Spanish
CICYT Biotechnology Program (Madrid) and the
Project of Technological Priority of the European
Union (Brussels). G. R. is a fellow of the Spanish
Ministerio de Educacion y Ciencia (Madrid) and
A. F. was a fellow of the Conselleria de Educacio?
? 1997 by John Wiley & Sons, Ltd.
527
i Ciencia (Valencia). We thank Dr Avelino Corma
and Maria Jesus Lacruz (Instituto de Tecnologia
Quimica, Valencia, Spain) for making available
their atomic absorption spectrophotometer and
for assistance with ion measurements.
REFERENCES
Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K.
and Watson, J. D. (1994). Molecular Biology of the
Cell. Garland Publishing, New York.
Albertyn, J., Hohmann, S., Thevelein, J. M. and Prior,
B. A. (1994). GPD1, wich encodes glycerol-3phosphate dehydrogenase, is essential for growth
under osmotic stress in Saccharomyces cerevisiae, and
its expression is regulated by the high-osmolarity
glycerol response pathway. Mol. Cell. Biol. 14, 4135?
4144.
Bidwai, A., Reed, J. C. and Glover, C. V. C. (1995).
Cloning and disruption of CKB1, the gene encoding
the 38-kDa b subunit of Saccharomyces cerevisiae
casein kinase II (CKII). Deletion of CKII regulatory
subunits elicits a salt-sensitive phenotype. J. Biol.
Chem. 270, 10395?10404.
Blomberg, A. and Adler, L. (1989). Roles of glycerol
and glycerol-3 phosphate dehydrogenase (NAD + ) in
acquired osmotolerance of Saccharomyces cerevisiae.
J. Bacteriol. 171, 1087?1092.
Blomberg, A. and Adler, L. (1992). Physiology of
osmotolerance in fungi. Adv. Microbiol. Physiol. 33,
145?212.
Camarasa, C., Prieto, S., Ros, R., Salmon, J. M. and
Barre, P. (1996). Evidence for a selective and
electroneutral K + /H + -exchange in Saccharomyces
cerevisiae using plasma membrane vesicles. Yeast 33,
in press.
Ferrando, A., Kron, S. J., R??os, G., Fink, G. R. and
Serrano, R. (1995). Regulation of cation transport in
Saccharomyces cerevisiae by the salt tolerance gene
HAL3. Mol. Cell. Biol. 15, 5470?5481.
Gaber, R. F. (1992). Molecular genetics of yeast ion
transport. Int. Rev. Cytol. 137A, 299?353.
Gancedo, C. and Serrano, R. (1989). Energy-yielding
metabolism. In Harrison, J. S. and Rose, A. H. (Eds),
The Yeast, vol. 3, 2nd edn. Academic Press, New
York, pp. 205?259.
Garciadeblas, B., Rubio, F., Quintero, F. J., Ban?uelos,
M. A., Haro, R. and Rodr??guez-Navarro, A. (1993).
Differential expression of two genes encoding isoforms of the ATPase involved in sodium efflux
in Saccharomyces cerevisiae. Mol. Gen. Genet. 236,
363?368.
Gaxiola, R., de Larrinoa, I. F., Villalba, J. M. and
Serrano, R. (1992). A novel and conserved saltinduced protein is an important determinant of salt
tolerance in yeast. EMBO J. 11, 3157?3164.
?????
???. 13: 515?528 (1997)
?. ???? ?? ??.
528
Gietz, R. D., Schiestl, R. H., Willems, R. and Woods,
R. A. (1995). Studies on the transformation of intact
yeast cells by the LiAc/ss-DNA/PEG procedure. Yeast
11, 355?360.
Glaser, H.-U., Thomas, D., Gaxiola, R., Montrichard,
F., Surdin-Kerjan, Y. and Serrano, R. (1993). Salt
tolerance
and
methionine
biosynthesis
in
Saccharomyces cerevisiae involve a putative
phosphatase gene. EMBO J. 12, 3105?3110.
Gomez, M. J., Luyten, K. and Ramos, J. (1996). The
capacity to transport potassium influences sodium
tolerance in Saccharomyces cerevisiae. FEMS
Microbiol. Lett. 135, 157?160.
Guthrie, C. and Fink, G. R. (1991). Guide to Yeast
Genetics and Molecular Biology. Academic Press,
New York.
Haro, R., Garciadeblas, B. and Rodr??guez-Navarro, A.
(1991). A novel P-type ATPase from yeast involved in
sodium transport. FEBS Lett. 291, 189?191.
Haro, R., Ban?uelos, M. A., Quintero, F. J., Rubio, F.
and Rodr??guez-Navarro, A. (1993). Genetic basis for
sodium exclusion and sodium tolerance in yeast. A
model for plants. Physiol. Plant. 89, 868?874.
Jones, J. S. and Prakash, L. (1990). Yeast Saccharomyces cerevisiae selectable markers in pUC18
polylinkers. Yeast 6, 363?366.
Ketchum, K. A., Joiner, W. J., Sellers, A. J.,
Kaczmarek, L. K. and Goldstein, S. A. N. (1995). A
new family of outwardly rectifying potassium channel
proteins with two pore domains in tandem. Nature
376, 690?695.
Luyten, K., Albertyn, J., Fourie Skibbe, W., et al.
(1995). Fps1, a yeast member of the MIP family of
channel proteins, is a facilitator for glycerol uptake
and efflux and is inactive under osmotic stress. EMBO
J. 14, 1360?1371.
Marquez, J. A. and Serrano, R. (1996). Multiple transduction pathways regulate the sodium-extrusion gene
PMR2/ENA1 during salt stress in yeast. FEBS Lett.
382, 89?92.
? 1997 by John Wiley & Sons, Ltd.
Mendoza, I., Rubio, F., Rodr??guez-Navarro, A. and
Pardo, J. M. (1994). The protein phosphatase
calcineurin is essential for NaCl tolerance of
Saccharomyces cerevisiae. J. Biol. Chem. 269, 8792?
8796.
Murgu??a, J. R., Belle?s, J. M. and Serrano, R. (1995).
A salt-sensitive 3*(2*),5*-bisphosphate nucleotidase
involved in sulfate activation. Science 267, 232?234.
Nakamura, T., Liu, Y., Hirata, D., et al. (1993). Protein
phosphatase type 2B (calcineurin)-mediated, FK506sensitive regulation of intracellular ions in yeast is an
important determinant for adaptation to high salt
stress conditions. EMBO J. 12, 4063?4071.
Posas, F., Camps, M. and Arin?o, J. (1995). The PPZ
protein phosphatases are important determinants of
salt tolerance in yeast cells. J. Biol. Chem. 270, 13036?
13041.
Serrano, R. (1996). Salt tolerance in plants and microorganisms: toxicity targets and defense responses. Int.
Rev. Cytol. 165, 1?52.
Serrano, R. and Villalba, J. M. (1995). Expression and
localization of plant membrane proteins in Saccharomyces. Methods Cell Biol. 50, 481?496.
Stein, W. D. (1990). Channels, Carriers and Pumps. An
Introduction to Membrane Transport. Academic Press,
New York, pp. 272?308.
Thevelein, J. M. (1994). Signal transduction in yeast.
Yeast 10, 1753?1790.
Wieland, J., Nitsche, A. M., Strayle, J., Steiner, H. and
Rudolph, H. K. (1995). The PMR2 gene cluster
encodes functionally distinct isoforms of a putative
Na + pump in the yeast plasma membrane. EMBO J.
14, 3870?3882.
Zhou, X., Vaillant, B., Loukin, S. H., Kung, C. and
Saimi, Y. (1995). YKC1 encodes the depolarizationactivated K + channel in the plasma membrane of
yeast. FEBS Lett. 373, 170?176.
?????
???. 13: 515?528 (1997)
Документ
Категория
Без категории
Просмотров
2
Размер файла
665 Кб
Теги
796
1/--страниц
Пожаловаться на содержимое документа