close

Вход

Забыли?

вход по аккаунту

?

879

код для вставкиСкачать
YEAST
VOL.
12: 17-29 (1996)
H A M l , The Gene Controlling
6-N-Hydroxylaminopurine Sensitivity and Mutagenesis
in the Yeast Saccharomyces cerevisiae
V. N. NOSKOV,'*2,3K. STAAK,' P. V. SHCHERBAKOVA,' S. G. KOZMIN,' K. NEGISHI,3 B.-C. ON0,2
H. HAYATSU~AND Y. I. PAVLOV~*
'Department of Genetics, Sankt-Petersburg University, Sankt-Petersburg, 199034, Russia
2Faculty of Pharmaceutical Sciences, Okayama University, Tsushima, Okayama 700, Japan
3Gene Research Center, Okayama University, Tsushima, Okayama 700, Japan
Received 20 January 1995; accepted 20 July 1995
The haml mutant of yeast Saccharomyces cerevisiae is sensitive to the mutagenic and lethal effects of the base analog,
6-N-hydroxylaminopurine (HAP). We have isolated a clone from a centromere-plasmid-based genomic library
complementing HAP sensitivity of the haml strain. After subcloning, a 3.4 kb functional fragment was sequenced.
It contained three open reading frames (ORFs) corresponding to proteins 353, 197 and 184 amino acids long.
LEU2' disruptions of the promoter and N-terminal part of the gene coding 197 amino acids long protein led to
moderate and strong sensitivity to HAP, respectively, and were allelic to the original haml-1 mutation. Thus this
ORF represents the HAMI gene. The deduced amino acid sequence of HAM1 protein was not similar to any protein
sequence of the SwissProt database. The H A M l gene was localized on the right arm of chromosome X between cdc8
and cdcll. Spontaneous mutagenesis was not affected by the haml::LEU2 disruption mutation.
KEY WORDS - Saccharomyces cerevisiae; 6-N-hydroxylaminopurine; hypermutability; molecular cloning and
sequencing; purine metabolism
INTRODUCTION
Analogs of natural precursors of nucleic acids are
valuable tools for studies relevant to DNA structure and DNA synthesis (Kornberg and Baker,
1992). Some of them can provoke replication
mistakes due to ambivalent pairing capacity and
are strong mutagens (Freese, 1959). Recently it
was shown that some base analogs, such as
8-oxoguanine, may be formed in vivo, thus being
a normal cellular component affecting replication
fidelity (Michaels and Miller, 1992). A specialized
multicomponent enzyme system has evolved to
protect organisms from such dangerous intrinsic
mutagens. In the bacterium Escherichia coli, this
system consists of the products of at least three
genes-mut Y, mutM and mutT. Mutations in these
genes lead to a strong mutator phenotype (see
Michaels and Miller, 1992). A mammalian
*Corresponding author: Department of Genetics, SanktPetersburg University, Universitetskaya emb., 7/9, SanktPetersburg, 199034, Russia.
CCC 0749-503X/96/010017-13
0 1996 by John Wiley & Sons Ltd
counterpart of mutT has been already described
(Mo et al., 1992).
6-N-hydroxylaminopurine (HAP) is one of the
potent base analog mutagens effective both for
eukaryotes and prokaryotes (see Pavlov et al.,
1991 and references therein). This base analog
might like 8-oxoguanine be responsible for spontaneous mutagenesis because, in vitro, it can be
formed from adenine by P-450 monooxygenases
(Clement and Kunze, 1990).
In an attempt to reveal the genes controlling
HAP mutagenesis in yeast, we isolated the haml-1
mutant which was hypersensitive to HAP-induced
growth inhibition and mutagenesis (Pavlov, 1986).
The observed sensitivity was HAP-specific (no
sensitivity to UV or EMS and even the related
base analog, 2-amino-6-N-hydroxylaminopurine).
It was shown that the haml-1 mutation did not
influence spontaneous mutation and recombination rates but strongly reduced the capability of
adenine-requiring ade2 haploid strains to grow on
minimal medium with HAP as the sole adenine
18
V. N. NOSKOV ET AL.
Table 1. Saccharomyces cerevisiae strains used in this study.
Source or
reference
Genotype
Strain
Al-D795
YAH559
4A-D776
4078-8-2a
MATa ade2-1 CANI
MATa ade2-I CAN1 haml-1
MATa leu2-3,112 gal7 tyrl ura4 h a d - I
MATa ura3 ade2-1 h a d - 1
MATa leu2-3,112 lysX his7-1 ade2 trpl-289 ura3 haml-1
MATa leu2-3,IIZ his3-11,IS ura3-52 trpl-289
MA Ta his7-2 ura3-52 leu2-3,112 ade5-1 trpl-289 CANI
Same, but ura3-A lys2-Tn5-13
MATaIMATa his7-21+ ura3-52Iura3-52 leu2-3,11211eu2-3,112
ade5-llade.5-1 trpl-289Itrpl-28Y +lhis3-11,14 H A Mllhaml:: LEU2
CANI ICANI
Same, but haml::LEU2/ham I:: LEU2
MATa cdc6 leu2-1 arg3 his3 ura2
MATa ilv3 ade5 trpl his7 met5
MATa ura3-52 his7 leu2-3.112 cdc8-1
IS488-9B
M A Ta arg4 aro7-1 his6 ilv3 leu2-1 lysll trp3 ura2 cdcl I
197l2d
hml-197l2d
139-D326
4-D365
57-D550
DBU746
CG379
CG379A
Al-D794
Cox and Parry (1968)
Pavlov (1986)
Noskov (1988)
This work'
This work'
Dr D. Botstein
Morrison et al. (1991)
Shcherbakova et al. (1995)
This work'
This work'
Okayama Univ. collection
This work4
Dr Barbara Garvick,
University of Washington
Okayama Univ. collection
'Segregate of diploid D365 from cross hml-l97/2d x XS122-57D (MATa ura3 rad52, Dr R. Mortimer).
'Segregate of the diploid D550 from a cross of 35G-D508 (MATa ura3 lys2-24 haml-1) and 33G-D373 (strain with high
competence to lithium transformation, Kushnirov et al., 1990).
3Diploids D794 and D795 were obtained from cross of tl-CG379 (ham1::LEUZ) to DBU746 or t2-DBU746 (haml::LEU2),
respectively. Mitotic adenine-requiring segregants (add-llade.5-I) of these diploids were obtained after UV-light irradiation
(35 J / M ~ ) .
4Meiotic segregate of XS195-23B (Dr R.K. Mortimer) and hum1 disruption transformant of CG379. Has been used for meiotic
mapping (chromosome X right arm markers ilv3 and m e d ) .
source. On the basis of these observations, it was
proposed that this mutation interferes with HAP
metabolism in the yeast cell (Pavlov, 1986).
In this study we have cloned, mapped and
sequenced the HAMl gene. This enabled us to
obtain haml disruption mutants in various strains.
We have shown that haml/haml diploid strains
can grow on HAP as the adenine source, thus this
mutation does not interfere with HAP conversion
to adenine precursors. We have shown that spontaneous mutation frequency is unaffected by the
haml disruption mutation, thus endogenous HAP
does not contribute to spontaneous mutation
under normal growth conditions. The possible role
of the HAMl gene product in HAP mutagenesis in
yeast is discussed.
haml-1. The pol2-1 mutants of the strain CG379A
and its haml::LEU2 derivative were constructed
by gene disruption as described (Shcherbakova
et al., 1995). Escherichia coli strains HB101,
DH5a, MW1184 and JM103 (Sambrook et al.,
1989) were used for plasmid propagation.
MATERIALS AND METHODS
Yeast genomic DNA library and basic plasmids
Yeast genomic DNA library constructed on a
centromere plasmid p366 was kindly provided by
Dr P. Hieter. p366 is a derivative of YCp.50 with
the LEU2 selective marker and is 8.2 kb long
(P. Hieter, personal communication). pFL44 is a
multicopy yeast-E. coli shuttle vector (Bonneaud
et al., 1991). Single-stranded mp19/mp18 vectors
or phagemids pUCl18/119(KS+/KS - ) were used
for subcloning for DNA sequence determination
(see Sambrook et al., 1989).
Yeast and bacterial strains
Basic yeast strains used in this study and their
genotypes are listed in Table 1. We named the
previously isolated haml allele (Pavlov, 1986) as
Media and supplies
Standard yeast YPD and minimal (SD) media
were used (see Sherman et al., 1986). SD medium
with appropriate supplements and L-canavanine
19
HAMl GENE
(40 mg/l) was used for selection of Can‘ mutants.
The medium for selection of Adp’ mutants,
capable of growing on a-aminoadipic acid as the
sole nitrogen source, was as described by Chatoo
et al. (1979). Escherichia coli minimal medium, LB,
and 2 x YT media were prepared as described
(Miller, 1972).
6-N-hydroxylaminopurine was synthesized
from 6-chloropurine according to the method of
Giner-Sorolla and Bendich (1958). 2-amino-6-Nhydroxylaminopurine was a gift of Dr F. J. deSerres (Research Triangle Institute, USA). Both
were dissolved in dimethylsulfoxide (DMSO).
Restriction endonucleases and other DNA metabolism enzymes were either from ‘Fermentas’
(Lithuania) or ‘Takara’ (Japan). DNA size
markers (1-kb ladder) were from BRL (USA).
Genetic methods
Yeast transformation was performed according
to Ito et al. (1983). Other standard methods were
as described by Sherman et al. (1986). All incubations were at 30°C. HAP-mutability of individual
clones was analysed as described (Pavlov, 1986).
Briefly, strains to be tested were streaked on a
YEPD master plate (usually no more than ten
strains per plate). For strains containing unstable
plasmids, SD medium was used to select for the
plasmid marker. After 2-3 days of incubation, cells
were replica-plated onto three plates with the same
medium. Then, a long strip of filter paper soaked
with DMSO or HAP solution (20pg and 200pg
per strip) was placed perpendicular to the streaks
on the corresponding plate. The plates were incubated for 2 days. HAP mutagenesis occurred during this incubation. Then cells were replica-plated
onto medium selective for Canr or Adp’ mutants.
The density of resistant colonies appearing in the
vicinity of the HAP-treated area was an indicator
of mutagenesis. Wild-type strains are immutable at
the low HAP dose and moderately mutable at the
high dose (phenotype Hamf). The haml mutants
are mutable at low doses and hypermutable at high
doses.
For the growth test on SD medium with HAP as
a sole adenine source, a diluted yeast suspension
(an equal cell concentration for all strains) was
spread onto adenineless SD medium. Then a paper
strip soaked with adenine or HAP solution was
applied. One version of this test is to plate cells of
several strains on one plate in a radial fashion and
apply a paper square in the center of the plate
(Figure 1).
The spontaneous frequency of Canr mutants
was measured as follows. Ten independent colonies of each strain to be tested were inoculated
into 1 ml of liquid YEPD medium and grown to
stationary phase. 10 ml of each resulting culture
were inoculated in 10 ml of liquid YEPD medium
and incubated with good aeration for 15-17 h.
Then cells were plated onto canavanine-containing
medium and YEPD medium (after 105-fold dilution). Mutant frequency was calculated for each of
ten cultures according to the formula:
F= M1N.k
where M = a number of mutants, N=number of
colonies on YPD, k=dilution factor.
Frequencies for ten cultures of each strain were
compared using Krusker-Wallis non-parametric
criteria.
Other methods
The molecular genetic methods such as subcloning, restriction analysis, blot hybridization and
DNA preparation for sequencing were performed
according to Sambrook et al. (1989). A deletion set
for DNA sequence determination was constructed
using the kit from ‘Takara’ (Japan) according to
the published protocol. DNA sequence analysis
was performed using an ABI Model 373A automatic sequencer according to the protocol of
the manufacturer. Initial mapping of the cloned
gene by hybridization with pulse-electrophoresisseparated yeast chromosomes was performed on
the blot commercially available from Clonetech
Labs (USA).
RESULTS
Cloning of the HAMl gene by functional
complementation of haml-1 mutation
Saccharomyces cerevisiae strain 139-D326
(hamf- I , phenotype Ham -) was transformed with
the yeast genomic library to Leu’. Transformants
were individually tested for their Ham phenotype.
From 3185 transformants tested, 137 were HAPimmutable at low dose (presumably Ham+).
Seventy-seven of them were unable to grow
on non-fermentable carbon source, i.e. were
respiratory-deficient. Since low HAP-mutability of
these transformants is at least partially attributable
to their very slow growth, they were discarded. The
remaining 60 transformants were tested for Ham
phenotype after plasmid loss. It was found that 58
20
V. N. NOSKOV ET AL.
A.
CG379A
ham I:: LE U2
pol2-1 haml::LEU2
pol2-I
B.
CG379A
ham 1::LE U2
~ 0 1 2 - Ihaml::LEU2
po12-I
Figure 1. Growth on minimal medium with adenine or HAP as the sole adenine
source of the strain CG379-A and its disruption mutants, haml::LEUZ, po12-I
and the double mutant, haml::LEUpo12-1.30 p1 of cell suspension of each strain
was applied as a small spots forming a rectangle. (A) Paper strip soaked with
adenine solution (2 mg total); (B) paper strip soaked with HAP solution (2 mg
total).
clones were still immutable, so their low mutability
was associated with changes in chromosomal genes
or in strain ploidy. For example, they might be
diploids, which are at least one order of magnitude
less mutable after HAP exposure than haploids
(Pavlov et al., 1991).
Thus, we obtained two clones possessing the
plasmid-associated Hamf phenotype. From the
two transformants, plasmid DNA was rescued
after E. coli retransformation. Restriction analysis
revealed that the plasmids were p366 derivatives
with different inserts. Strain 139-D326 containing
one of them was H a m- on a-aminoadipic acid
medium but was completely HAP-immutable on
canavanine medium. This plasmid likely contained
a cloned CAN1 gene as it conferred canavanine
HAMI GENE
x
H
x
RIS H G2 G2
p366HAM1
AB-B
=
=
21
HAP hypermutability
-
AB-G2
AH-H
AS-S
+
+
1 kbp
Figure 2. Restriction map of original insert containing the H A M l gene and its
deletion derivatives. Insert of the yeast DNA in the plasmid p366HAM1 is represented
by a solid bar. Dashed bar is the vector sequence. Restriction sites are above the insert
map. Note that the left Hind111 site is in the vector sequence. The boundaries of
deletion variants are below the insert map. Phenotype of the strain 57-D550 transformed with plasmid variants is shown in the right part of the Figure. H, HindIII;
S, Sufi; X, XhoI; B, BamHI; RI, EcoRI; G2, BglII.
sensitivity to the yeast strain DC5 which carries the
can1 mutation. Transformants with the second
plasmid had typical Ham+ phenotype in both
forward mutation systems. Thus, only one plasmid carried the gene complementing haml-1. The
plasmid was named p366HAM1.
The restriction map of insert in p366HAM1
plasmid is shown in Figure 2. Several deletion
variants of this plasmid were constructed: deletion
of the central BamHI fragment (AB-B), deletion of
the left part of the insert flanked with HindIII
sites (AH-H), deletion of the BamHI-BglII region
(AB-G2), deletion of the SalI region (AS-S). Yeast
strain 57-D550 (haml-I) was transformed with
these plasmid variants and also the original plasmid p366HAM 1 and transformants were examined
for the level of HAP mutability. The gene conferring Ham+ phenotype was located at the left part
of the cloned region as only variants AB-B and
AB-G2 complemented the haml-1 mutation. We
cloned the 3.4 kb HindIII-BamHI DNA fragment
into the autonomously replicating plasmid pFL44
and demonstrated that it was capable of restoring
the Ham- phenotype in haml-1 strains, 57-D550
and 4-D365. To verify that we have cloned the gene
itself and not its suppressor, we constructed an
integrative plasmid p366HI with selectable URA3
marker. For this purpose, the parent plasmid
p366HAM1 was cleaved with BglII, and the resulting HAMI-pBR322 fragment was ligated with the
BgnI fragment of the URA3 gene isolated from
pFL44. The resulting plasmid was linearized with
BamHI (see Figure 2 for the map of the insert) and
used for transformation of the yeast strain 4-D365
to Ura+. All ten transformants tested were Ham+.
The Ura+ phenotype was stable, indicating that
the plasmid was really integrated. We crossed one
of these transformants with the strain DBU746
(HAM1 ura3-52, see Table 1). Resulting diploids
were sporulated and subjected to tetrad analysis.
Of 17 tetrads analysed, 16 showed 2:2 Ura+:Uraand 4:O Ham+:Ham- segregation, which is expected if integration occurred into the HAMl
locus. One tetrad showed 3:l segregation for both
markers and probably resulted from plasmid
excision. This analysis confirmed that we really
had cloned the gene of interest.
Open reading frames (ORFs) found in the 3.4 kb
DNA fragment carrying the HAMl gene
We have determined the nucleotide sequence of
the 3.4 kb HindIII-BamHI DNA fragment after
cloning its sub-fragments into phagemid vectors
and creation of a nested deletion set. Three ORFs
V. N. NOSKOV ET AL.
22
1800
60
C W L T C C R C A C G T T G C T G T G C T G T G T G A A C T G G C C
CTATTAGRATGTCRTGAGGTACCACACCAGCTAATTCTTCCACTT~~AGAAGTTATGT
^Ball
"BamHI
120
CCATGGAGGTGCCAAGGATATTGCAACAATCCCTATACTCGAGlATTGACCC
^Xho i
180
~CCCACCTCTACCATTAGAAAAGGATGCTACCATCCCAGAACTACAGGCCTTATTGRA
1920
TTCTC~GTCACCTGCCGAARTGTCCAAGATCCT~TCC~CTCCATCATCACATTTRA
240
TGATCCTAAGCMCCTTTGTTCCAIIAGATAAACC~~~CCATGTTCAGACTGA~~GATATCffi
1980
300
'LACPGRTGAAGCAA? CCT(jGCCTTUjCCA~TGLTTTCAGTtiC~TCT'rCCCTTT1
CAA
CATlTTCTTGlTCGCTGATAAACCTCAAA~TCRATC~ATlACTTGCGTCT~CTT
'Ball
360
2040
TGRATCTAAATTTGCGCT~C~TCRATRATlCTTGTCACATAATTAC
GCATGAAATCGiCTACGTCTTCU;TC~TAGGTAGTCCGGCTGCTGTC~C-TTTGAT
420
"NheI
2100
RAATCRAACAGRATCTTGTTACTCCTGRATAGGTTTCCATTGTTCTACGT~SGCACTCT
TGrlP-GTTTTGGGCAGAAAGGARGAAGCTCCAATG5TTAGGCATW.AGCTGCTGAAGCCTT
480
GGGTGCCATTGCTTCICCAGAAGlTGTCGACGTCTlGAAATCTTACCTCAACGATGAAGT
"SalG1
2160
540
GTGCATCGGCAGTCATTGAATCGGCCTCATC~GRAlAATGATCTTATACGGTGGGCACG
(CGTTG~~A~it~~~~~GA~CTG'(Tjr'lAjlC
600
CGAACTAGAAT~)TGCTCCAACTGCTAATlA~;RA~~TCAG=AT~TCAATAATGATAGTA
2220
GATAGTTCTCCAhGTCATGllT~CTACCCTTC~ATACACTCAATCTTC~TTTTTTA
""Y
ACAh~AATCATTGTATAATCTTGlATTTTATACTTTTCETTCCGTTATA
720
2280
CCTTTTCTCTTACRATAGAGATA~CA~~TTCG~CAGL%CGTTCRRCrCCRATA~~CTTG
TATACNMTCTATCAAATACCAAAARAATTATTTATTTTCGNMCCGTTCTCTCGAGCTT
.
"Xhu 1
"SSP1
780
2340
ATTTCATCARGTCGGGTCCATATRATTCTTTTCTTIICCGCT~TGGTAGA~GTTTTAC
CAGCTTTCRACACTGGTCTTCAIIAGCAlAGGRAACACTCACATAGAGATATClAAWdCG
840
M S N N E I V F V T G N A N K
RACGATAGCAGAATGliCCA-~T~;TATTTGTCACTGGCRATGCCRAC-TTA
L
1
6
2400
CAGTTCCTWjGWjACCATRCAACATAlGTGGTAGATTAGCTGACTllAAGGTTTTCT
^NdeI
800
K
E
V
Q
S
I
L
T
Q
E
V
D
N
N
N
K
T
I
H
L
3
6
AAGGRAGTGCAGTCGATTTTGACTCRAGAWTCGACAACRACAhCAAMCCATCCACTTA
"SSJGI
~~~
~
960
I N E A L O L E E L Q D T D L N A I A L 5 6
ATCAhTGAGGCCTTAGACCTGGAAG2*RTTGCAGGACACGGATCTGRATGCCATlGCGllA
2460
TCIllVUlCAGTAACGGCATGATCTTGAGCTSlCACTTCATCTAGGTTTTTGGGCCTGTATT
2520
TCTCRACCCRGGGTTGTTGTGCCAATGATTGCTCTGCGGCGCT
A
K
G
K
Q
A
V
A
A
L
G
K
G
K
P
V
F
V
E
D
7
6
GCTAAUiGARAGCAAGCTGlTGCGXCTTGGGTRAGGGTAAGCCAGTGTTTGTGGRAGAC
1080
T A L R F D E F N G L P G A Y I K W F L 9
ACTGCGTTGAGATTTGACGAATTTAACGGTCTACCAGGTGCTTATATAAMTGGTTTTTA
2580
TTTTATTTGGACLRARCCCTTCAAACATCTCRAGTGATTGCCAATACTTTCCCC~TAT
6
2640
I140
S M G L E K I V K M L E P F E N K N A 1 1 6
AAGAGCATGGGAlTGTGTGAPAATGTTGGRACCCTTTGAAMTAAWdCGCT
TTCTCGCTGTCTTTCTATTTTACTTCTCTTATAGCATTGACTTGTTCGCTTGAGTTACTT
K
1200
G I36
E A V T T I C F A D S R G E Y H F F Q
GAAGCAGTTACLACCATTTGTT 1TGCTtiAT1'CSC(*%j(iTljAA',ATCA~,'T~STTC~T
1260
I T R ti K 1 V P S R G P T T F O W D S I 1 5 6
ATTACRAGAGTCRAGATCGTTCCL%CCGGGGACCCACTACATTCKXTGGGATTC?ATT
2700
CCTGATTGCTTTGRAATACGCGAAGC~lGAAAAATAACGATGAGAAAGSTTTTT
2760
GATAGAAGA~~AACAAAAAXXAACAGTGCTACRATAGTATATA@.GXTGTCG?ATACTTG
2820
GGRCGATGTATG(~GCATCAGACAGTGATGTCGAAACTGAACGATCTCCAGATTTAGT~
2880
1320
B P F D S H G L 1 Y A E M S K D A K N176
TTTCAACCTTTTGAT~=TCAT~A=TGACTl'ACCCAGACATG~C~ACG~GAAT
GTTAAGA~A-TCAlAG~GAMjGGGTACTTUjACGGAATAGTGAGllCT~G~A
B
2940
RAAGCTGCAAGRA~TTTCRATUjTGG1TTCCCRAC~GCTRAATTA~AAAC-T
1380
A
I
S X K ti K A F A Q F K 6 Y L Y 0 N 0 1 3 6
G C T A T T T C T C A T C ~ T G G T - G C ~ T ~ C G C T C R S T T T A A R
3000
TGGCATAATTATGGGGATTTTACTT~~~CCTACGAACACGTTTTGGTGATGRAGATGA~
1440
F
197
TTTTAGGTGATGTGCTGACRAGATAAGA~TTATffiATAGATTTTlTTTTTTTATTCT
CCTCAGlRAMjCATATATTTGATGCTCAAAAAGAGTTACGCATTRACRAAGTACTlAGTAA
3060
3120
1500
TACTTTATGTCGCCTCTA~ATT~AATTATArNMGATGCCTGTAlATTAGAGTT~ATA
GTCCATATTTGATCCACAGGACGGGTGTGGTCGCCATGATCGCGTAGTCGATAGTGSCTC
3180
CAAGTAGCGRAGCGAGCAGSACTGGGCGGCGGCCAAAGCGSTCGGACAGTGCTCCGAW
1560
TTTTAAIIICCAATARGTTTAATAATTGGA~~~~CTCGTTCGTTCCGTTGTT~AATCTGGAAT
~~-
.
~~~~~~~~~
~
.
~
~~
1620
CCGTACTAIIACAGCAhCCRAGATATTTGATTTTTG~TTCGTATC~TTATCGTTGG
3240
CGGGTGCGCATRGAMTTGCRTCAACGCATATAGCGCTAGCAGCACGCCATAGTGACTGG
"Nhel
3300
CGATGCTGTCGGAATGGZCGATATCCCGCAAGAGGCCCGGCAGTACCGSCATRACCRAGC
3360
CTATGCCTACAGCATCCAGGGTGACGGTGCCGAffiATGACGATGAG~GCATTGTTAGAT~
"SSPPl
^HpaI
1740
ALCGTA~TGACCTATTTCTT~T~T=A~~AAMT~CCAC~TTTGACTTTTT~CAhTTT
3421
TCATACACffiTGCCTGACTGCGTTAGCRATTTAkCTGTGATAIIACTACCGCATT~T
"Hind111
Figure 3 . Nucleotide sequence of the 3.4 kb DNA fragment containing the HAMl gene. Only a few restriction
sites, used for plasmid construction, are marked. Amino acid sequence deduced from the HAMl reading frame
is shown above the nucleotide sequence. ORFl corresponding to the RFC2 gene is underlined.
23
HAMl GENE
HAP hypermutability
X Ba
H
N
Nd SP N
Hp
'p
S X
S B a t i ,
B
pFL44HAMI
-
AN-N
-
ORF2
ORFl
r
-
',,ORF3
ABa-Ba
AX-X
AS-S
+/-
+
1kbp
'
Figure 4. Deletions in 3.4 kb DNA fragment containing the H A M l gene: map
position and phenotypes of appropriate mutants. Yeast strain 57-D550 was
transformed with plasmid variants to Ura' and their Ham phenotypes analysed
as described in Materials and Methods. See text for other explanations. Nd, NdeI;
Ba, Ban; X, XhoI; SaA; N, NheI; Ss, SspI.
(ORF1, ORF2 and ORF3) have been found,
which might encode proteins 353, 197 and 184
amino acids long, respectively (Figures 3 and 4).
ORFl appeared to be a gene with a deduced
amino acid sequence similar to several subunits of
human replication factor C, bacterial z subunit of
replicative DNA polymerase I11 and gene 44 product of bacteriophage T4, and was called RFC2
gene (Noskov et al., 1994). Amino acid sequences
deduced from ORF2 and ORF3 had no similarity
to any of the protein sequences of the SwissProt
database. ORF3 had an ATG codon but not a
promoter sequence, thus it is likely a truncated
gene.
Efects of the deletionlinsertion mutations in ORF2
Several deletion mutations were constructed
using the 3.4 kb DNA fragment cloned in pFL44
(Figure 4). Strain 57-D550 (ade2 ura3 haml-I) was
transformed with the pFL44-HAM1 deletion
derivatives, and phenotypes of transformants were
scored. Deletions AX-X and AS-S failed to complement the ham1 -1 mutation, suggesting that
ORF2 is the H A M l gene; note that the deletion
AX-X which leads to the intermediate Ham+'phenotype (Figure 4) does not cover ORF2 itself
but the majority of the promoter region of the
gene, while deletion AS-S removes part of the
coding region.
For further characterization of these mutant
alleles, we have constructed disruption mutations
analogous to AX-X and AS-S. Fragments flanked
by XhoI and SalI sites, respectively, were replaced
by the LEU2 gene. Plasmid LHAM was constructed on the basis of p366HAM1 (see section on
HAMl cloning) by replacing the small XhoI-XhoI
fragment with the 2.2 kb LEU2 gene SalI fragment. For construction of HLAM plasmid we
have used pUCll9 carrying the 3.4 kb H A M l
fragment. We cut it with SalI and ligated the
LEU2 gene Sun fragment to a larger fragment.
Linear DNA fragments with disruption were
released from the plasmids HLAM and LHAM by
cleavage with Hind111 and BamHI. The yeast
strain CG379 was transformed with these DNA
fragments to Leu+. DNA isolated from five
transformants of each variant was analysed by
Southern blot hybridization to verify an expected
disruption (results not shown). Then the transformants were tested for HAP mutability and
growth on HAP as the sole adenine source (note
that adenine biosynthesis is blocked by the ade5
mutation in strain CG379). All transformants with
AX-X::LEU2 were Hamf'-, and all transformants with AS-S::LEU2 were Ham- by these two
criteria (see Figure 1 for example of typical result
of the growth test). Complementation testing
showed that insertion mutations were allelic to
24
V . N. NOSKOV ET AL.
Table 2. Spontaneous Can‘ mutant frequencies in the CG379 strain and its haml::LEU2
derivatives.
Culture
number
1
2
3
4
5
6
I
8
9
10
Canavanine-resistant mutants frequencies ( x 10 ‘) in strains:
CG379
LHAM-CG379
HLAM-CG379
0.8 1
0.80
0.75
2.30
6.10
0.85
0.74
1.70
0.80
3.15
2.87
0.96
0.29
0.29
0.29
0.40
0.40
7.96
0.38
1.03
0.26
0.40
6.95
0.51
0.30
1.23
1.oo
0.74
0.36
0.30
haml-1 (cross to 4-D365). The data prove that
ORF2 represents the H A M l gene.
Features of HAM 1 gene and its predicted product
The coding region of the H A M l gene is 591
nucleotides long. Its 5’ and 3’ flanking regions have
sequences common to many yeast genes (see
Breathnach and Chambon, 1981): the promoter
region of the gene contains at least three putative
TATA boxes (starting from positions - 178,
- 163 and - 135, Figure 3); positions - 3 and
- 1 are occupied by ‘A’. The promoter lacks
ACGCGT (MZu1)-like sequences which are necessary for coordinated expression during S-phase.
Proposed termination and polyadenylation consensus T A G . . . TATGT . . . TTT is found at base
37 after the termination codon.
The H A M l gene ORF encodes a 197 amino
acids long protein, the predict isoelectric point of
which is 5.27. Searches for amino acid sequence
similarity with known sequences using FASTA
and DNASUN programs showed only weak
homologies with short stretches of unrelated genes
of different origin.
Additional H A M phenotypes
Availability of the H A M l gene disruption
mutants enabled us to study the Ham- phenotype
in comparison with isogenic wild-type strains.
First, we addressed the question of whether the
inability of ade5 adenine-requiring strains with
hum1 mutations to grow on HAP as the sole
adenine source is due to accumulation of recessive
lethal mutations or due to an intrinsic defect of
HAP salvage as an adenine source. In the latter
case, adenine-requiring strains, blocked in de novo
adenine synthesis reactions prior to IMP formation, and carrying huml mutation, would be
unable to grow on HAP as the sole adenine source.
We constructed two sets of strains: diploids
Al-D794 and Al-D795 (Table 1) which should
tolerate recessive lethal mutations (see Pavlov
et al., 1991) and derivatives of strain CG379A with
haml::LEU2, pol2-1 mutations (the latter is the
HAP-antimutator mutation; Shcherbakova et al.,
1995) and a double huml::LEU2 po12-1 mutation.
Both haml::LEU2lhaml::LEU2 diploid (results
now shown) and haml::LEU2 po12-1 double
mutant haploids were able to grow on HAP as the
sole adenine source, albeit at a reduced rate as
compared to wild-type strains (Figure 1A and B).
Thus, inability of the ham1 adenine-requiring haploid strains to grow on HAP as the sole adenine
source is not a result of the defect of HAP utilization as adenine. We propose that HAP is much
more mutagenic on SD medium than on YPD due
to the absence of competing adenine in the former,
and hypermutable haml strains stop growth due to
accumulation of lethal mutations.
Spontaneous mutation frequency in isogenic
wild-type and haml strains
To address the question of whether possible
endogenous HAP contributes to spontaneous mutation, we have analysed spontaneous Can‘ mutant
frequencies in the strain CG379 and its huml
derivatives obtained by one-step gene disruption
(see previous section). The results of one of the two
25
HAM1 GENE
experiments performed are presented in Table 2.
Statistical analysis indicated that differences
between all variants are not significant (p> 0.05).
Thus, haml strains (which are at least two orders
of magnitude more sensitive to HAP-induced
mutagenesis) are not distinguishable from the isogenic wild-type by spontaneous mutability. The
result suggests that either yeast cytochrome P450 is
unable to convert adenine to HAP or its expression
under conditions used is insufficient to produce
HAP. It was noted that HAP production from
adenine by mammalian microsomes is inefficient,
which questions the biological relevance of this
reaction (Clement and Kunze, 1991).
Chromosome mapping of the HAMl gene
The 3.4 kb DNA fragment containing the
H A M l gene was oligolabeled to high specific
activity and hybridized to blotted separated yeast
chromosomes. A strong positive signal was detected with chromosome X (result not shown). To
map the H A M l gene in the chromosome, strain
hml- 197/2d was crossed to several strains carrying
chromosome X markers and standard genetic
mapping was performed; haml segregation was
followed by its HAP-mutability phenotype. It was
shown that haml is linked to ilv3 and met5
markers of the right chromosomal arm, but not to
arg3 and cdc6 on the left arm. For precise mapping, a strain carrying ham1::LEUZ was crossed
to cdc8 and cdcl I marker strains and segregation
of the ham1 mutation was monitored by segregation of Leuf phenotype. Thus haml was located
between cdc8 and cdcll (Figure 5A and B).
DISCUSSION
We cloned and sequenced a gene controlling HAP
mutagenesis in the yeast S. cerevisiae. The analysis
of predicted amino-acid sequence coded by this
gene gave no direct clues as to its function. Availability of the cloned gene enabled us to study the
effects of mutations in this gene in a strictly
isogenic background. Examination of the phenotypes of disruption mutants permits consideration
of several hypothesis on the nature of the product
of this gene.
It is important to consider pathways of dATP
synthesis to understand the possible mechanism
of HAP mutagenesis (Figure 6). Both de novo synthesis and salvage of adenine have the same
intermediate-IMP. It is known that yeast strains
A.
PD NPD
haml-met5
haml-ilv3
haml-cdc8
haml-cdcll
43
28
67
67
T
4
56
3
69
23
9
0
0
Map distance
(cM)*
38.8
43.3
12.8
5.9
chromosome X~ight
Figure 5 Mapping of the HAM1 gene (A) Tetrad analysis
data *Map distance was calculated according to the formula
Xp=(100/2)x [(T+6NPD)/CPD+NPD+T)] (Barratt et u l ,
1954) (B) Position of hum1 on genetic map of chromosome X
with defects in purine biosynthesis de novo, prior to
the IMP+AMP conversion step (most adeninerequiring mutants, Figure 6), can utilize various
6-substituted purine analogs as the adenine source,
while mutants with a block of the IMP+AMP
step cannot (Abbondandolo et al., 1971). This
observation is explained by the broad specificity of
aminohydrolase, an enzyme converting adenine
and its 6-substituted analogs into hypoxanthine.
Hypoxanthine is converted further to AMP, unless
synthesis and conversion of adenylosuccinate is
blocked (mutants adel2 and adel3, Figure 6). This
seems to be the case with HAP, too. Both ade2 and
ade5 mutants are able to grow on HAP as the sole
adenine source (Pavlov, 1986; this study, Figure 1)
but, according to preliminary unpublished data of
S. G. Kozmin, A. M. Zekhnov and D. V. Domkin,
yeast adel2 mutants are not able to grow on HAP.
Thus, HAP cannot substitute adenine per se, via
phosphoribosyl transferase reaction. It should be
converted to hypoxanthine.
The main feature of the haml-1 point mutation and the haml::LEU2 null allele is recessive
HAP-hypermutability (Pavlov, 1986; this study).
We have shown, in the present work, that inability of ade2 ham1 or ade5 ham1 mutants to
26
V. N. NOSKOV ET AL.
exogeneous adenine
Adenine biosynthesis
de novo
4
1
1
4
i
ude4
ade5
ude8
ade6
ade7
ade2
adel
adel3
minohydrolase
,/
hypoxanthine
I
HGPRT
/
.(
AF’RT
inosinate (IMP)
,,/
4
inosinate (IMP)
adel2
adenylosuccinate synthase
udel2
adenylosuccinate synthase
.c
1
adenylate lunase
nucleoside
diphosphate lanase
grow efficiently on SD minimal medium containing HAP as the sole adenine source (Pavlov,
1986; present study) is a manifestation of their
hypermutability, and not their HAP salvage
defect. Strains bearing a hamZ mutation but resistant to HAP-induced mutagenesis (diploid and
antimutator) were apparently proficient in HAP
reutilization.
To find a possible role for the HAMZ gene
product, let us consider a hypothetical pathway
leading to mutation induction by HAP (Figure 7).
According to available data, HAP produces
27
HAM/ GENE
HAP
extracellular
hypoxanthine
IMP
-
AMP
I
aminohydrolase
kinase
i
HAPDP
I
ribonucleotide
diphosphate reductase
I
nucleotide
diphosphate b a s e
I
base selection, proof-reading
by DNA polymerases
dHAPDP
dHAPMP
triphosphatase
4
dHAPTP
HAP incorporated into DNA
i
base selection, proof-reading
by DNA polymerases
HAP-containing templates
I
repair
mutation
Figure 7. Hypothetical pathway of HAP mutagenesis. Explanations are in the text
mutations during DNA replication, thus it should
be converted into dHAPTP in the yeast cell (see
discussion in Shcherbakova et al., 1995). The
product of the HAMI gene should act during some
stage of the HAP mutagenicity pathway (Figure 7)
to prevent HAP incorporation into DNA and its
further persistence in DNA templates. It is evident
that haml cannot be a transport defect or a defect
in phosphoribosyl transferases. It is well known
that such defects lead to resistance to base analogs
(Woods et al., 1983; Sahota et al., 1987) unless
enzyme activity is increased (Lomax and Woods,
1969). The latter event should lead to a dominant
effect and it is hard to expect this from the null
allele.
We may assume that, in wild-type strains, HAP
is quickly metabolized to adenine by a novel
reaction catalysed by xanthine oxidase (Clement
and Kunze, 1992), or to hypoxanthine or IMP by
corresponding aminohydrolases (Figure 7). If this
pathway is blocked in haml mutants, more HAP
would be available for further conversion to the
deoxytriphosphate form. Both possibilities are
unlikely. The first pathway does not contribute to
HAP destruction significantly, as HAP utilization
is mediated by the hypoxanthine pathway (see
above, results with adel2 mutants). Moreover,
Ham1 protein has no homologies to rat xanthine
oxidase, the protein sequence of which is known.
The second pathway is evidently not impaired in
28
ham1 mutants as they can utilize HAP as the
adenine source. AMP deaminase, which has been
cloned and sequenced in yeast (Meyer et al., 1989),
has no similarity to Hamlp.
We can propose that the HAM1 gene product
is involved in some unidentified set of reactions
protecting cells from HAP, either on the level of
deoxynucleoside triphosphate or the DNA level
(Figure 7). Such a system is known for the endogenous analog, 8-oxoguanine (see Michaels and
Miller, 1992). This proposal raises the question of
why such a system might be necessary, as we have
shown that endogenous HAP does not contribute
to the spontaneous mutation rate in yeast (at least
under standard growth conditions in rich media)
and thus is not a common cellular component.
Further biochemical characterization of HAMI
gene product is in progress to test the possibilities
discussed.
It may be of interest to mention that strains of
Salmonella typhimurium and E. coli bearing a
deletion encompassing the uwB-bio region share
some common properties (HAP hypermutability
and hypersensitivity) with ham1 mutant (Pavlov
et al., 1991; Pavlov et al., in preparation). This
defect is due to deletion of some unidentified
gene. Thus genes analogous to HAMI might be
widespread.
ACKNOWLEDGEMENTS
We are grateful to Dr M. G. Samsonova for help
with computer searches of homology and Dr
V. D. Domkin for interest in this work. We are
grateful to referees for helpful comments. This
work was supported in part with All-Russia
Program ‘Frontiers in Genetics’, Russian Fund for
Fundamental Research and Japanese Society of
Promotion of Science. Part of this work was made
possible in part by grant #JDH100 from the
International Science Foundation and Russian
Government to Y.I.P.
REFERENCES
Abbondandolo, A,, Weyer, A,, Heslot, H. and Lambert,
M. (1971). Study of adenine aminohydrolase in the
yeast, Schizosaccharomyces pombe. J. Bacteriol. 108,
959-963.
Barratt, R. W., Newmeyer, D., Perkins, D. D. and
Garnjobst, L. (1954). Map construction in Neurospora
crassa. Adv. Genet. 6, 1-93.
Bonneaud, N., Ozier-Kalogeropoulos, O., Li, G.,
Labouesse, M., Minvielle-Sebastia, L. and Lacroute,
V. N. NOSKOV ET AL.
F. (1991). A family of low and high copy replicative,
integrative and single-stranded S. cerevisiaelE. coli
shuttle vectors. Yeast 7, 609-615.
Breathnach, R. and Chambon, P. (1981). Organization
and expression of eukaryotic split genes coding €or
proteins. Annu. Rev. Biochem. 50, 349-383.
Chatoo, B. B., Sherman, F., Azubalis, D., Fjellstedt,
T. A., Mehnert, D. and Ogur, M. (1979). Selection of
lys2 mutants of the yeast Saccharomyces cerevisiae by
the utilization of a-aminoadipate. Genetics 93, 5 1-65.
Clement, B. and Kunze, T. (1990). Hepatic microsomal
N-hydroxylation of adenine to 6-N-hydroylaminopurine. Biochem. Pharmacol. 39, 925 -933.
Clement, B. and Kunze, T. (1992). The reduction of
6-N-hydroxylaminopurine to adenine by xanthine
oxidase. Biochem. Pharmacol. 44, 1501-1 509.
Cox, B. S. and Parry, J. M. (1968). The isolation,
genetics, and survival characteristics of ultravioletsensitive mutants in yeast. Mutat. Res. 6, 3746.
Freese, E. (1959). The difference between spontaneous
and base-analogue induced mutations of phage T4.
Proc. Natl. Acad. Sci. USA. 45, 622-633.
Ginner-Sorolla, A. and Bendich, A. (1958). Synthesis
and properties of some 6-substituted purines. J. Amer.
Chem. Soc. 80, 3932-3937.
Ito, H., Fukuda, Y., Murata, K. and Kimura, A. (1983).
Transformation of intact yeast cells treated with alkali
cations. J. Bacteriol. 153, 163-168.
Jones, E. W. and Fink, G. R. (1982). Regulation of
aminoacid and nucleotide biosynthesis in yeast. In
Strathern, J. N., Jones, E. W. and Broach, J. R. (Eds),
The Molecular Biology of the Yeast Saccharomyces.
Cold Spring Harbor Laboratory, Cold Spring
Harbor, NY.
Kornberg, A. and Baker, T. A. (1992). DNA Replication.
W.H. Freeman and Company, New York.
Kushnirov, V. V., Ter-Avanesyan, M. D., Didichenko,
S. ’A. et al. (1990). Divergence and conservation
of SUP2(SUP35) gene of yeast Pichia pinus and
S. cerevisiae. Yeast 6,461472.
Lomax, C. A. and Woods, R. A. (1969). Mutant of yeast
sensitive to 2,6-diaminopurine. J. Bacteriol. 100,
817-822.
Meyer, S., Kvalnes-Krick, K. L. and Schramm, V. L.
(1989). Characterization of A M D , the AMP deaminase gene in yeast. Production of amd strain,
cloning, nucleotide sequence, and properties of the
protein. Biochemistry 28, 873&8743.
Michaels, M. L. and Miller, J. H. (1992). The GO system
protects organisms from the mutagenic effect of the
spontaneous lesion 8-hydroxyguanine (7,8-dihydro8-oxoguanine). J. Bacteriol. 174, 6321-6325.
Miller, J. H. (1972). Experiments in Molecular Genetics.
Cold Spring Harbor Laboratory, Cold Spring
Harbor, NY.
Mo, J.-Y., Maki, H. and Sekiguchi, M. (1992). Hydrolytic elimination of a mutagenic nucleotide,
H A M I GENE
29
8-oxodGTP, by human 18-kilodalton protein: Sahota, A., Ranjekar, P. K., Alfonco, J., Lewin, A. S.
sanitization of nucleotide pool. Proc. Nutl. Acud. Sci.
and Taylor, M. S. (1987). Mutants of Succharomyces
USA 89, 11021-11025.
cerevisiue deficient in adenine phosphoribosyltransMorrison, A., Bell, J. B., Kunkel, T. A. and Sugino, A.
ferase. Mutation. Res. 180, 81-87.
(1991). Eukaryotic DNA polymerase aminoacid se- Sambrook, J., Fritsch, E. F. and Maniatis, J. (1989).
quence required for 3l-5' exonuclease activity. Proc.
Molecular Cloning: A Laboratory Manual. Cold
Nutl. Acud. Sci. USA 88, 9473-9477.
Spring Harbor Laboratory, Cold Spring Harbor, NY.
Noskov, V. N., Maki, S., Kawasaki, Y., et ul. (1994). Shcherbakova, P. V., Noskov, V. N., Pshenichnov,
The RFC2 gene encoding a subunit of replication
M. R. and Pavlov, Y. I. (1995). Base analog 6-Nfactor C of Succhuromyces cerevisiue. Nucl. Acids.
hydroxylaminopurine mutagenesis in yeast Succharomyces cerevisiue is controlled by replicative DNA
Res. 22 (9), 1527-1535.
Noskov, V. N. (1988). The studies of the mutapolymerases. Mutation Res., submitted.
genic action of 6-N-hydroxylaminopurine and b- Sherman, F., Fink, G. R. and Hicks, J. B. (1986).
propiolactone in diploid yeast Succhuromyces cereviLaboratory Course Manual for Methods in Yeast
Genetics. Cold Spring Harbor Laboratory, Cold
siae strains. PhD Thesis, University of Leningrad.
Pavlov, Y. I. (1986). Sacchuromyces cerevisiue mutants
Spring Harbor, NY.
highly sensitive to the mutagenic action of 6-N- Woods, R. A,, Roberts, D. G., Friedman, T., Jolly, D.
and Filpula, D. (1983). Hypoxanthine: guanine
hydroxylaminopurine. Soviet Genetics 22, 1099-1 107.
phosphoribosyltransferase mutants in Succharomyces
Pavlov, Y. I., Noskov, V. N., Lange, E. K.,
Moiseeva, E. V., Pshenichnov, M. R. and Khromovcerevisiue. Mol. Gen. Genet. 191, 401412.
Borisov, N. N. (1991). The genetic activity of N6- Woods, R. A,, Roberts, D. G., Stein, D. S. and Filpula,
D. (1984). Adenine phosphoribosyltransferase muhydroxyadenine and 2-amino-N6-hydroxyadenine
in Escherichiu coli, Sulmonellu typhimurium and
tants in Succhuromyces cerevisiue. J. Gen. Microbiol.
Succhuromyces cerevisiue. Mutut. Res. 253, 3346.
130, 2629-2637.
Документ
Категория
Без категории
Просмотров
2
Размер файла
923 Кб
Теги
879
1/--страниц
Пожаловаться на содержимое документа