close

Вход

Забыли?

вход по аккаунту

?

75

код для вставкиСкачать

Yeast 15, 1297 (1999)
Erratum
Yeast 15, 507–511 (1999). Heterologous URA3MX
Cassettes for Gene Replacement in Saccharomyces
cerevisiae. A. L. Goldstein, X. Pan and J. H. McCusker
The following errors in five of the primer sequences in Table 1 need to be corrected:
JM7: (i) a C should be added to the 5 end and (ii) AGTGGATCTG should be added to the 3 end
PH8: the first three nucleotides should be CTA (instead of ACT)
PH15: the first two nucleotides should be CC (instead of GG)
PR60: the 33rd nucleotide should be A (instead of T)
PR79: the first three nucleotides should be CGC (instead of GCG)
The correct sequences of all the primers in Table 1 are given below:
JM7 CCTCATAAGCAGCAATCAATTCCATCTATACTTTAAAGCATAGGCCACTAGTGGATCTG
JM8 CTTTTATTACATACAACTTTTTAAACTAATATACACATTTCAGCTGAAGCTTCGTACGC
JM37 CCTCGACATCATCTGCCC
PH7 CGCAAGTCCTGTTTCTATGC
PH8 CTACGTTGCCTCCATCG
PH14 GTATTGAGAAGGGCAACGG
PH15 CCAGTACACCTTATCGGC
PR59 TTCTCACATCACATCCGAACATAAACAACCATGACAGTCAACACTAAGACCTATAGTG
PR60 AAACAACAATCTTTTTATTGTCAGTACTGATTATAATTGGCCAGTCTTTTTCAAATAAG
PR78 CCTTGACAGTCTTGACGTGC
PR79 CGCACTTAACTTCGCATCTG
*Correspondence to: John H. McCusker, Department of Microbiology, 3020 Duke University Medical Center, Durham,
NC 27710, U.S.A.
CCC 0749–503X/99/121297–01$17.50
Copyright 1999 John Wiley & Sons, Ltd.
Документ
Категория
Без категории
Просмотров
7
Размер файла
60 Кб
Теги
1/--страниц
Пожаловаться на содержимое документа