close

Вход

Забыли?

вход по аккаунту

?

212

код для вставкиСкачать
Yeast
Yeast 2000; 16: 539±545.
Research Article
Identi®cation by functional analysis of the gene
encoding a-isopropylmalate synthase II (LEU9) in
Saccharomyces cerevisiae
Enrico Casalone2*, Claudia Barberio1, Duccio Cavalieri1 and Mario Polsinelli1
1
2
Dipartimento di Biologia Animale e Genetica, UniversitaÁ di Firenze, via Romana 17±19, I-50125 Firenze, Italy
Dipartimento di Scienze Biomediche, UniversitaÁ di Chieti, via dei Vestini, I-66100 Chieti, Italy
* Correspondence to:
E. Casalone, Dipartimento di
Biologia Animale e Genetica,
UniversitaÁ di Firenze via Romana
17, 50125 Florence, Italy.
E-mail: casalone@dbag.uni®.it
Received: 2 November 1999
Accepted: 23 January 2000
Abstract
The function of the open reading frame (ORF) YOR108w of Saccharomyces cerevisiae has
been analysed. The deletion of this ORF from chromosome XV did not give an identi®able
phenotype. A mutant in which both ORF YOR108w and LEU4 gene have been deleted
proved to be leucine auxotrophic and a-isopropylmalate synthase (a-IPMS)-negative. This
mutant recovered a-IPMS activity and a Leu+ phenotype when transformed with a
plasmid copy of YOR108w. These data and the sequence homology indicated that
YOR108w is the structural gene for a-IPMS II, responsible for the residual a-IPMS
activity found in a leu4D strain. The leu4D strain appeared to be very sensitive to the
leucine analogue tri¯uoroleucine. In the absence of leucine, its growth was not much
impaired in glucose but more on non-fermentable carbon sources. Copyright # 2000 John
Wiley & Sons, Ltd.
Keywords:
disruption
a-isopropylmalate synthase; leucine metabolism; LEU4; YOR108w; gene
Introduction
In Saccharomyces cerevisiae the activity of aisopropylmalate synthase (a-IPMS), the ®rst
enzyme of the leucine biosynthetic pathway, is
provided by at least three forms of a-IPMS (Voss
et al., 1997; Beltzer et al., 1988; Chang et al., 1985).
a-IPMS I, the major isozyme responsible for about
80% of the total activity, is encoded by LEU4, a
gene that has been extensively characterized (Chang
et al., 1984; Beltzer et al., 1986; Beltzer et al., 1988;
Cavalieri et al., 1999). The gene LEU4 encodes
mitochondrial and non-mitochondrial forms of
a-IPMS (Beltzer et al., 1988). In mutant strains
carrying the total deletion of the LEU4 gene, a
residual a-IPMS activity of about 20%, designated
a-IPMS II activity, is still present (Chang et al.,
1985). Four genes, LEU5 (Baichwal et al., 1983;
Chang et al., 1984, 1985), LEU6, LEU7 and LEU8
(Drain and Schimmel, 1988), whose mutations led
to a Leux phenotype in a leu4 background, were
considered candidates to encode a-IPMS II. LEU5
Copyright # 2000 John Wiley & Sons, Ltd.
and LEU6 are required for both a-IPMS II activity
and non-fermentable energy source metabolism, but
genetic and biochemical analysis showed that LEU5
does not actually encode an a-IPMS (Drain and
Schimmel, 1986, 1988). LEU7 and LEU8 are
required only for a-IPMS II activity (Drain and
Schimmel, 1988). The recent sequencing of the entire
S. cerevisiae genome has shown the occurrence of
many duplicate genes; among them, the putative
ORF YOR108w, on chromosome XV, is highly
homologous to LEU4 (Voss et al., 1997) and for this
reason it could be a good candidate to encode aIPMS II. However, computational analysis cannot
be the sole criterion to assign a function to a gene;
deletions of all the homologous genes are needed.
We report here the construction of three knock-out
mutants, two carrying a deletion in YOR108w or in
LEU4 ORF, and one carrying both the deletions.
YOR108w has been cloned and used to establish its
role in encoding a-IPMS II in S. cerevisiae. The
deletion mutants have been characterized to establish their capability of growth on different media.
540
E. Casalone et al.
Materials and methods
Strains, media and methods
Yeast strains used are listed in Table 1; they were
routinely grown on the complete medium YPD
(Rose et al., 1990). Synthetic minimal medium (SD),
glycerol complete medium (YPG) and sporulation
medium (SM) were prepared as reported by Rose
et al. (1990). SD medium supplemented with
appropriate requirements was used to make COM
minus media (Rose et al., 1990). COM minus
leucine and threonine was used to test strain
sensitivity to tri¯uoroleucine (TFL). G418-resistant
strains were grown on YPD plates containing
200 mg/ml G418 (Roche). Escherichia coli XL1-blue
supercompetent cells from Stratagene were used for
the propagation of plasmids.
All procedures for manipulating DNA employed
standard methods. Mating, sporulation and tetrad
analysis were performed as described by Spencer
and Spencer (1988). Transformation of yeast was
performed by the lithium±acetate procedure,
according to Gietz and Woods (1994). After transformation with the yor108w::HIS3MX6 cassette,
washed cells were plated directly on COM minus
histidine. For the selection of the leu4::kanMX4
transformants, cells were resuspended in 2.5 ml
YPD and grown for 5 h at 30uC before spreading
on YPD containing 200 mg/ml G418.
Plasmids
Plasmid pDCT2 (Cavalieri et al., 1999) was the
source of LEU4 sequence. Plasmids pFA6a±
KanMX4 (Wach et al., 1994) and pFA6a±
HIS3MX6 (Wach et al., 1997) were the source of
the heterologous markers KanMX4, conferring
geneticin-resistance (G418R), and HIS3MX6 complementing his3 mutation, respectively.
Plasmid pYCG_YOR108w is a derivative of
pRS416 (Sikorski and Hieter, 1989), in which a
2643 bp long EcoRI±HindIII DNA fragment containing ORF YOR108w was inserted into the
unique EcoRI and HindIII restriction sites. The
EcoRI±HindIII DNA fragment was synthesized
by PCR using two oligonucleotides, WT1 GGGAATTCGCTCTTCCTTCTGCATGGCG
and
WT2 GGAAGCTTGCTAGCCTCCTTTCAGGTTC, derived from the published ORF YOR108w
sequence (Voss et al., 1997) and extended with
EcoRI (WT1) and HindIII (WT2) recognition
sequences (underlined). The 2643 bp long PCRsynthesized fragment contained the entire
YOR108w ORF plus 345 bp upstream and 477 bp
downstream.
Procedure of disruption of LEU4 and
YOR108w
Deletion cassettes were constructed by PCR following the long ¯anking homology (LFH) regions
procedure of Wach (1996). This PCR procedure
generated the 3.2 Kb long leu4::KanMX4 and
2.2 Kb long yor108w::HIS3MX6 deletion cassettes,
in which 1650 bp of the coding sequences of LEU4
(from the 21st codon after ATG to the 4th codon
before the stop codon) and 1754 bp of that of
YOR108w (from the 5th codon after ATG to the
14th before stop codon) were replaced by KanMX4
(1510 bp) and HIS3MX6 (1350 bp) sequences,
respectively.
Correct integration of the deletion cassettes
leu4::KanMX4 and yor108w::HIS3MX6 into the
genome was veri®ed by PCR, using whole yeast
cells as a source of target DNA (Wach et al., 1994).
Two sets of three primers each were used to analyse
G418-resistant leu4::KanMX4 transformants and
His+ yor108w::HIS3MX6 transformants.
Table 1. Saccharomyces cerevisiae strains
Strain
Genotype
Source
FY1679
YNN281
YNN282
YMR1
YMR2
YMRX12
a/a ura3-52/ura3-52 leu2D1/+ trp1D63/+ his3D200/+
MATa trp1-D his3-D200 ura 3-52 lys2-801 ade2-1
MATa trp1-D his3-D200 ura3-52 lys2-801 ade2-1
MATa trp1-D his3-D200 ura 3-52 lys2-801 ade2-1 leu4::KanMX4
MATa trp1-D his3-D200 ura3-52 lys2-801 ade2-1 yor108w::HIS3MX6
MATa/MATa trp1-D/trp1-D his3-D200/his3-D200 ura3-52/ ura3-52
lys2-801/lys2-801 ade2-1/ade2-1 leu4::KanMX4/ LEU4 yor108w::HIS3MX6/ YOR108w
MATa trp1-D his3-D200 ura3-52 lys2-801 ade2-1 leu4::KanMX4 yor108w::HIS3MX6
Winston et al. (1995)
YGSC (Berkeley)
YGSC (Berkeley)
This work
This work
This work
YMRX-3B
Copyright # 2000 John Wiley & Sons, Ltd.
This work
Yeast 2000; 16: 539±545.
Identi®cation of the a-isopropylmalate synthase II gene
541
Table 2. Growth characteristics and a-IPMS activity of S. cerevisiae strains
Growth
Strain
YPD
YPD+G418
COM-histidine
COM-leucine
YPG
a-IPMS activityb
(%)
YNN281
YNN282
YMR1
YMR2
YMRX12
YMRX-3B
YMRX-3B/pYCG_YOR108w
+
+
+
+
+
+
+
x
x
+
x
+
+
+
x
x
x
+
+
+
+
+
+
+
+
+
x
+
+
+
+
+
+
+
+
100
98
20
79
ndc
0
29
a
a
a
a
a
a
See Strains and media section.
Activity is reported as a percentage of YNN281 values; speci®c activities are 0.325, 0.318, 0.256, 0.065, 0.000, 0.003 and 0.094 mmol CoA
released per hour per mg protein for strains YNN281, YNN282, YMR1, YMR2, YMRX-3B and YMRX-3B/pYCG_YOR108w, respectively. Values
are the mean of two independent determinations.
c
nd=not determined.
b
Enzyme activity
Crude extracts were obtained by grinding
pre-weighted humid cells, from a 70 ml COM
minus leucine and threonine culture containing
2r108 cells/ml, in a cold mortar with alumina
(type 305, Sigma); 50 mM Tris±HCl±1.5 mM phenylmethylsulphonyl ¯uoride, pH 7.5, as added 1 : 2
(w/v) and the suspension was centrifuged at 4uC
for 30 min at 39 000rg. The supernatants were
collected and stored at x20uC until needed. aIPMS activity was measured according to the end
point assay of Kohlhaw (1988) by determining the
amount of CoA liberated in 10 min with Ellman's
reagent (Sigma).
Results and discussion
Identi®cation of YOR108w as the gene
encoding a-IPMS II
To determine the function of the YOR108w gene
product, the leu4::KanMX4 and yor108w::HIS3MX6
cassettes were constructed (see Materials and methods) and used to transform YNN281 to G418
resistance and YNN282 to histidine prototrophy,
generating the YMR1 (leu4::KanMX4) and YMR2
(yor108w::HIS3MX6) deletion mutants, respectively.
The occurrence of homologous recombination events
was veri®ed by PCR (data not shown).
Strains YMR1 and YMR2 were crossed, diploids
were selected for G418-resistance and histidine
prototrophy, and the G418R His+ YMRX12
diploid strain was isolated. Ten asci from
Copyright # 2000 John Wiley & Sons, Ltd.
YMRX12 were dissected and their spores analysed;
all the tetrads segregated 2 : 2 for both G418R:
G418S and His+:Hisx (data not shown). One
G418R His+ segregant, the YMRX-3B (leu4::
KanMX4 yor108w::HIS3MX6) deletion mutant,
was further analysed.
The deletion mutants YMR1, YMR2, YMRX12,
YMRX-3B, the parental strains YNN281 and
YNN282 and the plasmid transformed strain
YMRX±3B/pYCG_YOR108w were characterized
for their ability to grow on different media and for
a-IPMS activity. The results, reported in Table 2
and Figure 1, showed that YMR1 (leu4::KanMX4)
and YMR2 (yor108w::HIS3MX6) still retained
part of a-IPMS activity (79% and 20% of that of
the YNN282 wild-type strain, respectively) and
were Leu+; YMRX-3B (leu4::KanMX4 yor108w::
HIS3MX6) showed no enzyme activity and was
Leux. When a plasmid copy of YOR108w was
introduced in the deletion mutant YMRX-3B, aIPMS activity, as well as the Leu+ phenotype, were
recovered. These results indicated that YOR108w is
the structural gene for a-IPMS II, responsible for
the residual a-IPMS activity in the leu4::KanMX4
strain, and that only two a-IPMS encoding genes
are present in S. cerevisiae.
Furthermore, the growth of YMR2 on nonfermentable carbon sources (Figure 1) indicated
that the YOR108w gene is different from LEU6,
in fact leu6 mutants did not growth on nonfermentable carbon sources, showing a petite
phenotype (Drain and Schimmel, 1988). Mutants
bearing leu7 or leu8 alleles were able to grow
on non-fermentable carbon sources (Drain and
Yeast 2000; 16: 539±545.
542
Figure 1. Growth of deletion mutants and parental strains
on COM solid media with 2% different carbon sources in the
absence and in the presence of 0.1 mg/l leucine. Cells were
grown overnight at 30uC on YPD, washed and resuspended
in water at different cell density. Five ml each suspension
were spotted on to the plates. The plates were incubated for
2 days at 30uC
Schimmel, 1988), but unfortunately it was not
possible to test the genetic identity of YOR108w
to LEU7 or LEU8, since the suitable mutants were
not available. We designated YOR108w as LEU9.
Comparison of the sequences of LEU9 and
LEU4 genes and of their protein products
YOR108w (LEU9) is a member of a cluster of nine
genes on chromosome XV that is related to a
similar cluster of eight genes on chromosome XIV
carrying the LEU4 gene. Wolfe and Shields (1997)
formulated the hypothesis that clusters like this
arise from whole-genome duplication events. LEU4
and LEU9 are highly homologous genes (82%
Copyright # 2000 John Wiley & Sons, Ltd.
E. Casalone et al.
identity in the ORF regions), whereas no identity
was found in the 1500 bp long region upstream
from the start codon of LEU4 and LEU9. However, as in LEU4 (Beltzer et al., 1986) putative
consensus sequences for Gcn4p (Hinnebusch,
1988) (TGACTCT x1173; AGTCA x762 and
TGACTCA x257) and for Leu3p (Friden
and Schimmel, 1987) (CCGGTAACGG x277 and
GGCCTTGCC x232) were present in LEU9,
which could put LEU9 under the general control
of amino acid biosynthesis (Hinnebusch, 1992) and
leucine-speci®c control (Baichwal et al., 1983;
Brisco and Kohlhaw, 1990), respectively. Moreover,
comparative analysis showed the presence in both
LEU9 (x525) and LEU4 (x594) of the palindromic sequence (TTTACTTCATTT), whose role is
unknown. However, as shown by the capability of
plasmid pYCG_YOR108w to transform the Leux
YMRX-3B strain to leucine prototrophy (see
above), the ®rst 345 bp upstream from the start
codon of YOR108w seem to be enough for the
functionality of the gene.
a-IPMS I and a-IPMS II showed a high degree of
amino acid identity (82%) and conservation (97%).
The putative catalytic site of a-IPMS I (Patek et al.,
1994) is completely conserved in the N-terminal
moiety of a-IPMS II. Major differences are present
at the C-terminal end of the two isozymes, where
the so-called regulatory region (R-region) of aIPMS I, of 39 amino acids, is also located. This
region is responsible for the enzyme resistance to
leucine inhibition and Zn++-mediated CoA inactivation in seven different T¯R mutants (Cavalieri
et al., 1999). This region shares 87% identity with
the corresponding region of a-IPMS II. In this
region, a serine, whose absence is responsible for
resistance to leucine feedback inhibition in a
mutated a-IPMS I (Cavalieri et al., 1999), is
replaced by an alanine in a-IPMS II. This amino
acid difference could be responsible for the lower
sensitivity to leucine observed in a-IPMS II respect
to a-IPMS I (Chang et al., 1985).
Physiological characterization of the deletion
mutants
a-IPMS activity was in¯uenced by the carbon
source: (a) growth on acetate induced a form of aIPMS more sensitive to leucine inhibition (Brown
et al., 1975), which could very likely be a-IPMS I;
(b) induction of LEU4 but not of YOR108w
Yeast 2000; 16: 539±545.
Identi®cation of the a-isopropylmalate synthase II gene
543
Figure 2. Growth curves of deletion mutants and parental strains in COM medium in the presence or absence of 0.1 mg/l
leucine at 30uC
(LEU9) occurred in the correspondence of the
metabolic shift from fermentation of glucose to
respiration of ethanol (De Risi et al., 1997);
(c) leucine is released in the medium during the
®nal stage of fermentation (Henschke and Jiranek,
1993) when glucose is exhausted.
In order to assess the effect of the deletion of
LEU4 and LEU9 on the ability to grow on different carbon sources, YNN281, YNN282, YMR1,
YMR2 and YMRX-3B were grown on plates of
minimal medium containing glucose or one of the
following non-fermentable carbon sources: glycerol,
ethanol, lactate, pyruvate and acetate. The results
are shown in Figure 1. The growth of all strains was
always extremely low on pyruvate and practically
undetectable on acetate (not shown). YMRX-3B
always failed to grow in the absence of leucine. On
glucose, in the presence or absence of leucine, no
differences in the growth of YMR1 mutants was
observed compared with its parental strain. On
non-fermentable carbon sources in the absence of
leucine, mutant YMR1 showed always reduced
growth, particularly on glycerol; if leucine was
added, all the strains grew worse but YMR1 and,
as expected, YMRX-3B. YMR2 always grew like
the parental strain.
These results indicated that the presence of a
Copyright # 2000 John Wiley & Sons, Ltd.
functional LEU4 gene, but not of LEU9, was
critical to maintain normal growth levels on nonfermentable carbon sources when leucine was
absent. Conversely, the slight better growth of
YMR1 on non-fermentable carbon sources in the
presence of leucine could be due to the lack of a
functional LEU4 gene, whose absence, reducing the
unnecessary synthesis of leucine, makes acetyl CoA
available for the Krebs cycle. Nevertheless, a role of
the transcription factor Leu3p (Hu et al., 1995),
whose activity is modulated by a-IPM, cannot be
excluded.
Unlike the solid glucose medium, in liquid COM
medium with glucose, slight growth differences were
observed among strains. In the absence of leucine,
strain YMR1, unlike YMR2 (Figure 2B), which
lacks a-IPMS I, had a longer initial lag-phase than
its parental strain (Figure 2A). This phenotype is
due to an impaired synthesis of leucine, as shown
by its reversion following leucine addition. It should
be also noted that, with the exception of YMR1, a
slight decrease in the growth rate of all strains
occurred when leucine was added to the medium, as
already observed and discussed for the growth on
plates with unfermentable carbon sources.
Further characterization of the strains was
performed by growing them on TFL-containing
Yeast 2000; 16: 539±545.
544
E. Casalone et al.
Figure 3. Sensitivity of deletion mutants and parental strains to TFL. Cells were grown overnight at 30uC on YPD, washed
and resuspended in water at different cell density. Five ml of each suspension were spotted on COM minus leucine plates. The
plates were incubated for 2 days at 30uC
media. Results in Figure 3 showed that strain
YMR1 was more sensitive to TFL than the parental
and YMR2 strains. These results con®rmed the
main role of a-IPMS I in counteracting TFL toxic
effects by the production of the analogue competitor, leucine (Baichwal et al., 1983; Casalone et al.,
1997; Cavalieri et al., 1999).
The identi®cation of LEU9 as the gene encoding
a-IPMS II, and the construction of deletion
mutants lacking one or both the structural genes
for a-IPMS activity in S. cerevisiae, can be very
useful to study the physiological role of the two
isozymes. Furthermore, a leu4D leu9D genetic background should be ideal to isolate and investigate
new leucine transport mutants (Stella et al., 1999),
or as a recipient strain of new vectors carrying
LEU4 markers for leucine prototrophy and/or TFL
resistance (Bendoni et al., 1999).
References
Baichwal VR, Cunningham TS, Gatzek PR, Kohlhaw GB. 1983.
Identi®cation of two genes (LEU4, LEU5) that affect aisopropylmalate synthase activity and evidence that LEU1
and LEU2 gene expression is controlled by a-isopropylmalate
and the product of a regulatory gene. Curr Genet 7: 369±377.
Beltzer JP, Chang LL, Hinkkanen AE, Kohlhaw GB. 1986.
Structure of yeast LEU4. The 5k-¯anking region contains
features that predict two modes of control and two productive
translational starts. J Biol Chem 261: 5160±5167.
Beltzer JP, Morris SR, Kohlhaw GB. 1988. Yeast LEU4 encodes
mitochondrial and non-mitochondrial forms of a-isopropylmalate synthase. J Biol Chem 263: 368±374.
Bendoni B, Cavalieri D, Casalone E, Polsinelli M, Barberio C.
1999. Tri¯uoroleucine resistance as a dominant molecular
marker in transformation of strains of Saccharomyces cerevisiae isolated from wine. FEMS Microbiol Lett 180: 229±233.
Brisco PRG, Kohlhaw GB. 1990. Regulation of yeast LEU2.
J Biol Chem 265: 11667±11675.
Copyright # 2000 John Wiley & Sons, Ltd.
Brown HD, Satynarayana T, Umbarger HE. 1975. Biosynthesis
of branched-chain amino acids in yeast: effect of carbon source
on leucine biosynthetic enzymes. J Bacteriol 12: 959±969.
Casalone E, Fia G, Barberio C, Cavalieri D, Turbanti L,
Polsinelli M. 1997. Genetic and biochemical characterisation
of Saccharomyces cerevisiae mutants resistant to tri¯uoroleucine. Res Microbiol 148: 613±623.
Cavalieri D, Casalone E, Bendoni B, Fia G, Polsinelli M,
Barberio C. 1999. Tri¯uoroleucine resistance and regulation of
a-isopropyl malate synthase I in Saccharomyces cerevisiae. Mol
Gen Genet 261: 152±160.
Chang LL, Cunningham TS, Gatzek PR, Chen W, Kohlhaw GB.
1984. Cloning and characterization of yeast LEU4, one of two
genes responsible for alpha-isopropylmalate synthase. Genetics
108: 91±106.
Chang LL, Gatzek PR, Kohlhaw GB. 1985. Total deletion of
yeast LEU4: further evidence for a second a-isopropylmalate
synthase and evidence for tight LEU4±MET4 linkage. Gene 33:
333±339.
De Risi JL, Iyer VR, Brown PO. 1997. Exploring the metabolic
and genetic control of gene expression on a genomic scale.
Science 278: 680±686.
Drain P, Schimmel P. 1986. Yeast LEU5 is a PET-like gene that
is not essential for leucine biosynthesis. Mol Gen Genet 204:
397±403.
Drain P, Schimmel P. 1988. Multiple new genes that determine
activity for the ®rst step of leucine biosynthesis in Saccharomyces cerevisiae. Genetics 119: 13±20.
Friden P, Schimmel P. 1987. LEU3 of Saccharomyces cerevisiae
encodes a factor for control of RNA levels of a group of
leucine-speci®c genes. Mol Cell Biol 7: 2708±2717.
Gietz RD, Woods RA. 1994. High ef®ciency transformation with
lithium acetate. In Molecular Genetics of Yeast: A Practical
Approach, Johnston JR (ed). IRL Press: Oxford; 121±134.
Henschke PA, Jiranek V. 1993. YeastÐmetabolism of nitrogen
compounds. In Wine Microbiology and Biotechnology, Fleet
GH (ed). Harwood Academic: Chur, Switzerland; 77±164.
Hinnebusch AG. 1988. Mechanism of gene regulation in the
general control of amino acid biosynthesis in Saccharomyces
cerevisiae. Microbiol Rev 52: 248±273.
Hinnebusch AG. 1992. General and pathway speci®c regulatory
mechanism controlling the synthesis of amino acid biosynthetic
enzymes in S. cerevisiae. In The Molecular and Cellular Biology
of the Yeast Saccharomyces cerevisiae. Vol.2 Gene Expression,
Yeast 2000; 16: 539±545.
Identi®cation of the a-isopropylmalate synthase II gene
Jones EW, Pringle JR, Broach JR (eds). Cold Spring Harbour
Laboratory Press: New York; 319±414.
Hu Y, Cooper TG, Kohlhaw GB. 1995. The Saccharomyces
cerevisiae Leu3 protein activates expression of GDH1, a key
gene in nitrogen assimilation. Mol Cell Biol 15: 52±57.
Kohlhaw GB. 1988. a-Isopropylmalate synthase from yeast.
Methods Enzymol 166: 414±429.
Patek M, Krumbach K, Eggelin L, Sahm H. 1994. Leucine
synthesis in Corynebacterium glutamicum: enzyme activities,
structure of leuA, and effect of leuA inactivation on lysine
synthesis. Appl Environ Microbiol 60: 133±140.
Rose MD, Winston F, Hieter P. 1990. In Methods in Yeast
Genetics: A Laboratory Course Manual, 2nd edn. Cold Spring
Harbor Laboratory Press: New York; 177±186.
Sikorski RS, Hieter P. 1989. A system of shuttle vectors and
yeast host strains designed for ef®cient manipulation of DNA
in Saccharomyces cerevisiae. Genetics 122: 19±27.
Spencer JFT, Spencer DM. 1988. Yeast genetics. In Yeast: A
Practical Approach, Campbell I, Duffus JH (eds). IRL Press:
Oxford; 65±106.
Stella CA, Korch C, Ramos EH, Bauer A, KoÈlling R, Mattoon
Copyright # 2000 John Wiley & Sons, Ltd.
545
JR. 1999. The Saccharomyces cerevisiae LEP1/SAC3 gene is
associated with leucine transport. Mol Gen Genet 262: 232±241.
Voss H, Benes V, Andrade MA, Valencia A, Rechmann S,
Teodoru C, Schwager C, Paces V, Sander C, Ansorge W. 1997.
DNA sequencing and analysis of 130 kb from yeast chromosome XV. Yeast 13: 655±672.
Wach A, Brachat A, Poehlmann R, Philippsen P. 1994. New
heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10: 1793±1808.
Wach A. 1996. PCR-synthesis of marker cassettes with long
¯anking homology regions for gene disruptions in S. cerevisiae.
Yeast 12: 259±265.
Wach A, Brachat A, Alberti-Segui C, Rebischung C, Philippsen
P. 1997. Heterologous HIS3 marker and GFP reporter
modules for PCR-targeting in Saccharomyces cerevisiae. Yeast
13: 1065±1075.
Winston F, Dollard C, Ricupero-Hovasse SL. 1995. Construction of a set of convenient Saccharomyces cerevisiae strains
that are isogenic to S288C. Yeast 11: 53±55.
Wolfe HW, Shields CS. 1997. Molecular evidence for an ancient
duplication of the entire yeast genome. Nature 387: 708±713.
Yeast 2000; 16: 539±545.
Документ
Категория
Без категории
Просмотров
2
Размер файла
164 Кб
Теги
212
1/--страниц
Пожаловаться на содержимое документа