close

Вход

Забыли?

вход по аккаунту

?

472

код для вставкиСкачать

Yeast 15, 1255–1267 (1999)
Disruption and Functional Analysis of Seven ORFs on
Chromosome IV: YDL057w, YDL012c, YDL010w,
YDL009c, YDL008w (APC11), YDL005c (MED2) and
YDL003w (MCD1)
KATHLEEN N. SMITH1††, LESLEY IWANEJKO1**††, SOPHIE LOEILLET1, FRANCIS FABRE1† AND
ALAIN NICOLAS1*
1
Institut Curie, Section de Recherche, CNRS UMR 144, 26, Rue d’Ulm, 75248 Paris Cedex 05, France
In the context of the EUROFAN project, we have carried out the systematic disruption of seven ORFs on
chromosome IV of Saccharomyces cerevisiae using the long flanking homology technique to replace each ORF with
the KanMX cassette. Targeted disruption of YDL057w, YDL012c, or YDL010w with YDL009c (the two ORFs
overlap) confers no overt defects in haploid growth on a variety of media at different temperatures, in mating, or in
the sporulation of diploids homozygous for the disruption. By contrast, YDL008w and YDL003w disruptants are
non-viable. The product of YDL008w (elsewhere identified as APC11) is a component of the anaphase promoting
complex. YDL003w (also termed MCD1) is a homologue of Schizosaccharomyces pombe rad21, an essential gene
implicated in DNA double-strand break repair and nuclear organization in fission yeast. In budding yeast, this ORF
has been shown by several laboratories to encode a protein involved in sister chromatid cohesion and chromosome
condensation. The remaining ORF, YDL005c (also termed MED2), encodes a component of the transcriptional
activator complex known as Mediator. Disruption of YDL005c confers a modest slow growth phenotype on rich
medium and a more severe phenotype on minimal medium, aberrant cellular morphology, and mating defects;
diploids homozygous for the disruption cannot sporulate. Copyright 1999 John Wiley & Sons, Ltd.
  — Saccharomyces cerevisiae; EUROFAN; APC11; MED2; MCD1
INTRODUCTION
In the framework of the EUROFAN program,
whose purpose is the functional analysis of yeast
genes of unknown function (Dujon, 1998), we have
disrupted seven open reading frames which were
*Correspondence to: A. Nicolas, Institut Curie, Section de
Recherche, CNRS UMR 144, 26 Rue d’Ulm, 75248 Paris
Cedex 05, France. Tel: (33) 1 42 34 64 36; fax: (33) 1 42 34 64 38;
e-mail: alain.nicolas@curie.fr.
**Current address: Department of Genetics and Microbiology
(Donnan Laboratories), University of Liverpool, Liverpool
L69 3BX, UK.
†Current address: CEA. DSV. DRR, Bâtiment 5, Pièce A103,
60–68 Avenue du General Leclerc, 92265 Fontenay-aux-Roses,
France.
††Both authors contributed equally to this work..
CCC 0749–503X/99/121255–13$17.50
Copyright 1999 John Wiley & Sons, Ltd.
identified in the course of the systematic sequencing of Chromosome IV (Jacq et al., 1997). Of
these, six are positioned on the left arm and tightly
linked to the centromere (see Figure 1), and the
seventh, YDL057w, is located roughly 80 kb
upstream. General features of the ORFs are
described in Table 1. Following EUROFAN
guidelines for the characterization of these
disruptants, we have carried out a preliminary
phenotypic analysis of the mutant strains thus
derived. During the course of this work, three of
the ORFs were identified by other groups as
encoding proteins involved in chromosome
segregation, transcriptional activation and DNA
repair.
Received 8 January 1999
Accepted 26 April 1999
1256
K. N. SMITH ET AL.
Figure 1. Schematic of location of disrupted ORFs on chromosome IV, adapted
from the Chromosomal Features Map program of the Saccharomyces Genome
Database (http://genome-www.stanford.edu/Saccharomyces/). The positions of
ORFs disrupted in this work (indicated in bold) are shown in the context of
neighbouring ORFs and other chromosomal elements, including the centromere,
tRNAs, and Ty motifs.
MATERIALS AND METHODS
Strains and media
Specific ORFs were disrupted in the EUROFAN strain FY1679 (a/á ura3-52/ura3-52 leu2Ä1/
+ trp1Ä63/+ his3Ä200/+), a s288c derivative
(Winston et al., 1995), and in ORD2904, a diploid
in the W303 background, created by crossing
BMA64-1A (a ura3-1 leu2-3,112 trp1Ä2 his3-11
ade2-1 can1-100) and BMA64-1B (á ura3-1 leu23,112 trp1Ä2 his3-11 ade2-1 can1-100). FY1679,
BMA64-1A, and BMA64-1B were obtained from
P. Philippsen. FY1679-derived haploids with disruptions of the ORFs YBR016w or YBR014c were
obtained from EUROSCARF. The Escherichia
coli strains XL-1 Blue (F::Tn10 proA+B+ lacIq
Ä(lacZ)M15/recA1 endA1 gyrA96 (Nalr) thi
hsdR17 (rK-mK + ) supE44 relA1 lac) and GM2163
(F-ara-14 leuB6 thi-1 fhuA31 lacY1 tsx-78 galK2
galT22 supE44 hisG4 rpsL136 (Strr) xyl-5 mtl-1
dam13::Tn9 (Camr) dcm-6 mcrB1 hsdR2 (rK-mK + )
mcrA) (New England Biolabs) served as vectors in
the construction and propagation of the plasmids
described in this work. The latter strain was used
for preparing plasmids that were to be digested
with the dam methylation-sensitive enzyme NruI
(see Table 4). Media (LB, YT, YPD, YPG, synthetic complete, and the presporulation medium
SPS) and general methods as described (Ausubel
et al., 1987) were employed for culturing yeast and
bacteria. For sporulation, single colonies grown
on solid YPD were inoculated into SPS and
Copyright 1999 John Wiley & Sons, Ltd.
shaken for 1–2 days until the culture approached
saturation. The cells were washed and resuspended in sporulation medium (1% K acetate)
and incubated for 2–3 days. For diploids with
the W303 background, presporulation and sporulation media were supplemented for all nutritional
auxotrophies. Tetrads were digested with
â-glucuronidase (Sigma) and dissected with the
aid of a Singer MSM System micromanipulator
(Singer Instruments).
Molecular biology techniques and reagents
Yeast genomic DNA used in PCR manipulations was prepared as described (Ausubel et al.,
1987). Standard cloning procedures (Ausubel
et al., 1987) were employed in the construction of
plasmids bearing disruption cassettes and cognate
ORFs. Restriction enzymes, T4 DNA ligase, and
other enzymes utilized in cloning were purchased
from New England Biolabs. All plasmids were
purified from bacteria with Qiagen kits (Qiagen),
following the instructions of the manufacturer.
Targeted inactivation of ORFs by the long
flanking homology method
Disruption cassettes in which most or all of the
ORF was replaced by the KanMX4 sequence,
which confers resistance to both kanamycin and
geneticin (G418), were constructed using the long
flanking homology technique (Wach et al., 1994).
Yeast 15, 1255–1267 (1999)
Chromosomal
coordinates
(size of ORF in nt)
Size of predicted
protein in
amino acids
YDL057w
YDL012c
351433–352416 (984)
431513–431469, 431382–431107
(contains a putative intron) (321)
328
107
YDL010w
432326–433018 (693)
231
YDL009c
YDL008w APC11
432924–433244 (321)
433493–433987 (495)
107
165
YDL005c
MED2
441013–442305 (1293)
431
YDL003w MCD1
444679–446376 (1698)
566
ORF
Gene
Features/function
Hypothetical protein
Strongly similar to a hypothetical protein encoded by
YBR016w; weakly similar
to hypothetical protein
Ydr210w; glutamine-rich
Similar to a hypothetical
protein encoded by
YBR014c and to glutaredoxins
Questionable ORF
Component of the
anaphase-promoting complex required for mitotic
chromosome segregation
Component of the mediator complex required for
transcriptional activation
of RNA Pol II
Phenotypes
4 . . . 1024 None observed
7 . . . 435 None observed
20 . . . 944 None observed
25 . . . 939 None observed
13 . . . 515 Lethal
47 . . . 1310 Slow growth; poor growth
on minimal media; cannot
grow on acetate and glycerol; aberrant cell shape;
mating defect; sporulation
defect
7 . . . 1710 Lethal
1257
Yeast 15, 1255–1267 (1999)
Involved in sister chromatid cohesion and chromosome condensation during
the mitotic cell cycle;
homologous to S. pombe
rad21 + , implicated in DSB
repair
Coordinates of
deletion
SEVEN ORF ON YEAST CHROMOSOME IV
Copyright 1999 John Wiley & Sons, Ltd.
Table 1. Attributes of ORFs disrupted in this study and summary of phenotypes of disruptants. The chromosomal coordinates of each ORF are as
specified by MIPS (http://speedy.mips.biochem.mpg.de/mips/yeast/index.htmlx). The coordinates for a given deletion refer to nucleotides replaced by
the KanMX cassette, where 1=A of the first ATG of the ORF.
1258
K. N. SMITH ET AL.
Table 2. Oligonucleotides used for constructing ORF-specific LFH targeting cassettes. Those used in the
amplification of 5 flanking sequences are indicated by the prefixes L1 and L2; those used in the amplification of 3
sequences are indicated by the prefixes L3 and L4. Characters in italics represent untemplated nucleotides, including
those with homology to the KanMX4 module and, in some cases, those added to create a specific restriction site in
the amplified sequence. Engineered or endogenous restriction sites (shown in parentheses) used in the subsequent
cloning of cognate ORFs by gap repair (see Table 4) are indicated by underlining. Characters in normal type are
derived from the genomic sequence.
Primer
Sequence
YDL057w
L1D2558
GTTTGATTATGTGGGCAGCAC
L2D2558
GGGGATCCGTCGACCTGCAGCGTACCCATTTCGACTTGGTTATTTGAC
L3D2558
AACGAGCTCGAATTCATCGATGATAAGCGCTGAGTTTGGTCACTTTGC (Eco47III)
L4D2558
GGATGGAAAAACAAAGCAGTAG
YDL012c
L1D2880
TTAAACGCGGATGAACTACG
L2D2880
GGGGATCCGTCGACCTGCAGCGTACTACGTATTTGCTTGGTTTATGGGC (SnaBI)
L3D2880
AACGAGCTCGAATTCATCGATGATAAACCCTTTCACACAAATCCAC
L4D2880
CGTGTGGTCATGCATTTTG
YDL010w/YDL009c
L1D289590
CCGATTAGTGTTGTTGACTTTTC
L2D289590
GGGGATCCGTCGACCTGCAGCGTACAAACCGCTAGGTTGCTAAGG
L3D289590
AAC GAGCTCGAATTCATCGATGATATCGCGATGTTTACAATAACTTCTATCCTTTG
(NruI)
L4D289590
CAGATGTGCTAGGGATGTGC
YDL008w
L1D2900
AATAAAGAGGTCGT GAATGATTAGG
L2D2900
GGGGATCCGTCGACCTGCAGCGTACTACGTATTGCCACTTTGCTTGTTAAAC (SnaBI)
L3D2900
AACGAGCTCGAATTCATCGATGATACACAATTAGCTATATTTCCATACGG
L4D2900
TAGTAATGTGGAGATCATCGGTTC
YDL005c
L1D2930
TTTTATTGCAAGGCCAGAGC
L2D2930
GGGGATCCGTCGACCTGCAGCGTACGTTAACTATCTTGAGACCAGAACATCTATTG
(HpaI)
L3D2930
AACGAGCTCGAATTCATCGATGATATGTTAACTATTGACTTGTAAACCGTG (HpaI)
L4D2930
GGAAAATGG CACAACAGATAATG
YDL003w
L1D2940
TCGCGTCTTTCTACTCTCACAG
L2D2940
GGGGATCCGTCGACCTGCAGCGTACAACCATTGTCGTGTTTCTTGTAAAG
L3D2940
AACGAGCTCGAATTCATCGATGATAGTTAACCTAGTTACGCCGAGGG (HpaI)
L4D2940
AAGAAGATTGTTTGGCCTGG
Oligonucleotides (Table 2) were purchased from
Gibco BRL and Eurogentec. In a first round of
PCR, approximately 350 bp 5 and 250 bp 3 flanking each ORF was amplified in two 50 ìl reactions,
each containing about 2 ng genomic DNA (prepared from FY1679 or ORD2904), 0·2 m
each deoxynucleoside triphosphate (Boehringer–
Mannheim), 50 pmol each of primers L1 and
L2 (for the 5 reaction) or L3 and L4 (for the
3 reaction), 2·5 U Pwo DNA polymerase
(Boehringer–Mannheim) in 1Pwo reaction
Copyright 1999 John Wiley & Sons, Ltd.
buffer (100 m Tris–HCl, pH 8·85, 250 m KCl,
50 m (NH4)2SO4, 20 m MgSO4). Amplification
was carried out in an Eppendorf Mastercycler 5330
as follows: 2 min at 94C; 15 s at 94C, 30 s at
55C, 45 s at 72C for 10 cycles; 15 s at 94C, 30 s
at 55C, 45 s+20 s/cycle at 72C for 15 cycles;
7 min at 72C. The sizes of the reaction products
were confirmed by electrophoresis in 2·5% NuSieve
GTG agarose gels (FMC BioProducts). Disruption constructs consisting of the KanMX cassette
flanked by 5 and 3 ORF-specific sequences were
Yeast 15, 1255–1267 (1999)
SEVEN ORF ON YEAST CHROMOSOME IV
generated in a second round of PCR, in 50 ìl
reactions containing 50 ng NotI-digested pFA6aKanMX4, 1 ìl each of the L1+L2 and L3+L4 first
round of reaction products, and 50 pmol each of
primers L1 and L4. Buffer composition, polymerase and dNTPs were as for the first PCR.
Amplification conditions: 2 min at 94C; 15 s at
94C, 30 s at 55C, 60 s at 72C for 10 cycles; 15 s
at 94C, 30 s at 55C, 60 s+20 s/cycle at 72C for
15 cycles; 7 min at 72C. Total reaction products
were ethanol-precipitated and half of each reaction
was transformed by the lithium acetate procedure
(Gietz and Woods, 1994) into FY1679 or
ORD2904. Transformants were selected on YPD
containing 0·2 mg/ml G418 (Life Technologies).
Correct gene replacement was verified by Southern
analysis. Genomic DNA (0·5 ìg) prepared from
each primary transformant was digested with two
different enzymes, and the fragments were resolved
by electrophoresis on an 0·8% agarose TBE gel
and blotted to Hybond N + (Amersham). As a
probe for hybridization, the 1·5 kb NotI fragment
from pFA6aKanMX4, which contains the complete KanMX cassette, was labelled with á32P
dCTP by the random priming method (Rediprime,
Amersham). Hybridization conditions were as
described by Church and Gilbert (1984). Specifically labelled fragments were detected by exposing
the hybridized blot to a phosphorimager screen
(Molecular Dynamics), followed by analysis with
ImageQuant software.
Construction of replacement cassettes and cognate
clones
Genomic DNA was prepared from strains heterozygous for a given disruption and 2 ng was
subjected to PCR with the cognate L1 and L4
primers and Pwo polymerase, using the same reaction components as described above in the initial
construction of targeting cassettes. Cycling conditions were: 2 min at 94C; 15 s at 94C, 30 s at
55C, 3 min at 72C for 10 cycles; 15 s at 94C, 30 s
at 55C, 3 min+20 s/cycle at 72C for 15 cycles;
7 min at 72C. A gel purified band of the size
expected for the disruption was ligated to EcoRVdigested pUG7 (a pBluescript II SK derivative:
U. Güldener, S. Heck, and J. H. Hegemann, in
preparation) and the resulting products transformed into XL-1 Blue. Colonies bearing plasmids
containing the KanMX cassette were selected on
2YT containing 50 mg/l kanamycin (Sigma).
The integrity of the 5 and 3 sequences flanking
Copyright 1999 John Wiley & Sons, Ltd.
1259
the KanMX module was verified by cycle sequencing (ABI Prism Dye Terminator Cycle Sequencing
Kit, Perkin-Elmer) with the KanMX-specific
primers K2 (GAAACAACTCTGGCGCATC) and
K4 (ACTGTCAAGGAGGGTATTCTG) and the
40 forward (GTTTTCCCAGTCACGACGTT
GTA) and 50 reverse (TTGTGAGCG GAT
AACAATTTC) primers specific to the vector
(USB); sequences were determined with an ABI
373A (Applied Biosystems). To generate plasmids
bearing the full-length wild-type ORF, the replacement cassettes were liberated from the pYORC
series of plasmids by NotI digestion and the gelpurified fragments ligated to NotI-digested
pRS416 (Sikorski and Hieter, 1989) to create an
intermediate series of plasmids. After transformation of XL-1 Blue or GM2163 and selection on
kanamycin, these plasmids were recovered,
digested with appropriate restriction enzymes (see
Table 4) to yield gap repair substrates, and transformed into FY1679 by the lithium acetate
procedure (Gietz and Woods, 1994). Ura + prototrophs were selected, and the plasmids they
harboured were recovered in XL-1 Blue, as
described by Ausubel et al. (1987), as the pYCG
series of plasmids. Restriction analysis of their
inserts verified that they contained wild-type
ORFs.
Phenotypic characterization of disruptants
Diploids heterozygous for given disruptions
were sporulated and a and á derivatives isolated.
The growth of haploid disruptants and those containing complementing plasmids or pRS416 was
qualitatively assessed in different nutritional and
temperature conditions by spotting ten-fold serial
dilutions of each strain (grown in minimal medium
to saturation) on YPD, YPGal and minimal
media, and incubating at 15C, 30C and 37C.
The efficiency of mating between haploid disruptants was determined as described by Sprague
(1991). Diploids homozygous for disruptions of
YDL057w, YDL012c and YDL010w/YDL009c in
the FY1679 background were selected by complementation of auxotrophic markers (see Table 3).
Homozygous diploid disruptants were obtained in
the W303 background by patching haploids of
opposite mating type on YPD, and after about 5 h
at 30C zygotes were identified under light microscopy and isolated with the use of a micromanipulator (Singer Instruments). In all cases, a 4:0
segregation ratio of G418 resistance to sensitivity
Yeast 15, 1255–1267 (1999)
1260
K. N. SMITH ET AL.
Table 3. Strains created in this study. Strains derived from FY1679 are indicated by the prefix FNOS; those in the
W303 background are indicated by WNOS. The ORFs YDL010w and YDL009c were disrupted as a single unit.
Listed are all strains that were submitted to EUROSCARF in fulfilment of EUROFAN I requirements, and those
that were used in specific experiments described in this paper.
ORF
None
YDL057w
Strain
FY1679-17C
FNOS003
FNOS002
FNOS001
FNOS004
WNOS018
YDL012c
FNOS007
FNOS006
FNOS005
FNOS008
WNOS022
YDL010w/YDL009c
FNOS011
FNOS010
FNOS009
FNOS012
WNOS026
YDL008w
FNOS013
ORT3333
WNOS030
YDL005c
FNOS016
FNOS015
FNOS014
FNOS018
WNOS031
YDL003w
ORT3334-8D
ORT3356-3C
FNOS017
ORT3335
WNOS034
Copyright 1999 John Wiley & Sons, Ltd.
Genotype
a ura3-52 trp1Ä63
á ura3-52 leu2Ä1 his3Ä200 ÄYDL057w::KanMX
a ura3-52 trp1Ä63 ÄYDL057w::KanMX
a/á ura3-52/ura3-52 +/trp1Ä63 +/leu2Ä1 +/his3Ä200 ÄYDL057w::KanMX/
YDL057w
a/á ura3-52/ura3-52 +/trp1Ä63 +/leu2Ä1 +/his3Ä200 ÄYDL057w::KanMX/
ÄYDL057w::KanMX
a/á ura3-1/ura3-1 trp1Ä2/trp1Ä2 leu2-3,112/leu2-3,112 his3-11/his3-11 ade21/ade2-1 can1-100/can1-100 ÄYDL057w::KanMX/YDL057w
á ura3-52 leu2Ä1 ÄYDL012c::KanMX
a ura3-52 his3Ä200 ÄYDL012c::KanMX
a/á ura3-52/ura3-52 +/trp1Ä63 leu2Ä1 +/his3Ä200 ÄYDL012c::KanMX/
YDL012c
a/á ura3-52/ura3-52
+/leu2Ä1
+/his3Ä200 ÄYDL012c::KanMX/
ÄYDL012c::KanMX
a/á ura3-1/ura3-1 trp1Ä2/trp1Ä2 leu2-3,112/leu2-3,112 his3-11/his3-11 ade21/ade2-1 can1-100/can1-100 ÄYDL012c::KanMX/YDL012c
á ura3-52 trp1Ä63 leu2Ä1 ÄYDL010w,YDL009c::KanMX
a ura3-52 trp1Ä63 his3Ä200 ÄYDL010w, YDL009c::KanMX
a/á ura3-52/ura3-52 +/trp1Ä63 +/leu2Ä1 +/his3Ä200 ÄYDL010W/
YDL009C::KanMX/YDL010w, YDL009c
a/á ura3-52/ura3-52 trp1Ä63/trp1Ä63 +/leu2Ä1 +his3Ä200 ÄYDL010w,
YDL009c::KanMX/ÄYDL010w, YDL009c::KanMX
a/á ura3-1/ura3-1 trp1Ä2/trp1Ä2 leu2-3,112/leu2-3,112 his3-11/his3-11 ade21/ade2-1 can1-100/can1-100 ÄYDL010w, YDL009c::KanMX/YDL010w,
YDL009c
a/á ura3-52/ura3-52 +/trp1Ä63 +/leu2Ä1 +/his3Ä200 ÄYDL008w::KanMX/
YDL008w
FNOS013 pYCG YDL008w
a/á ura3-1/ura3-1 trp1Ä2/trp1Ä2 leu2-3,112/leu2-3,112 his3-11/his3-11 ade21/ade2-1 can1-100/can1-100 ÄYDL008w::KanMX/YDL008w
á ura3-52 trp1Ä63 leu2Ä1 ÄYDL005c::KanMX
a ura3-52 trp1Ä63 his3Ä200 ÄYDL005c::KanMX
a/á ura3-52/ura3-52 +/trp1Ä63 +/leu2Ä1 +/his3Ä200 ÄYDL005c::KanMX/
YDL005c
a/á ura3-52/ura3-52 trp1Ä63/trp1Ä63/ his3Ä200/his3Ä200 +/leu2Ä1
ÄYDL005c::KanMX/ÄYDL005c::KanMX
a/á ura3-1/ura3-1 trp1Ä2/trp1Ä2 leu2-3,112/leu2-3,112 his3-11/his3-11 ade21/ade2-1 can1-100/can1-100 ÄYDL005c::KanMX/YDL005c
á ura3-52 trp1Ä63 his3Ä200 leu2Ä1 ÄYDL005c::KanMX pYCG YDL005c
a ura3-52 trp1Ä63 leu2Ä1 ÄYDL005c::KanMX pRS416
a/á ura3-52/ura3-52 +/trp1Ä63 +/leu2Ä1 +/his3Ä200 ÄYDL003w::KanMX/
YDL003w
FNOS017 pYCG YDL003w
a/á ura3-1/ura3-1 trp1Ä2/trp1Ä2 leu2-3,112/leu2-3,112 his3-11/his3-11 ade21/ade2-1 can1-100/can1-100 ÄYDL003w::KanMX/YDL003w
Yeast 15, 1255–1267 (1999)
1261
SEVEN ORF ON YEAST CHROMOSOME IV
Table 4. Plasmids bearing disruption cassettes or cognate clones. Replacement plasmids
(in pUG7) contain an L1/L4 PCR product amplified from genomic DNA of strains
heterozygous for KanMX disruptions of the indicated ORF. Cognate clones (in pRS416)
were created by gap replacement of an intermediate vector (also in pRS416) linearized at
the sites indicated.
ORF
YDL057w
YDL012c
YDL010w/YDL009c
YDL008w
YDL005c
YDL003w
Replacement plasmid
pYORC_YDL057w
pYORC_YDL012c
pYORC_YDL010w
pYORC_YDL008w
pYORC_YDL005c
pYORC_YDL003w
was observed after sporulation of these diploids,
confirming that they were homozygous for a
specific disruption. Due to the mating defect exhibited by ydl005 haploids, a diploid homozygous
for the disruption was obtained by crossing
FNOS015 with ORT3334-8D (a Ura + segregant
of FNOS014 transformed with pYCG–YDL005c,
Table 4). Ura + candidate diploids were
plated on 1 mg/ml 5-fluoro-orotic acid (Melford
Laboratories) to select for loss of the plasmid, and
the resulting diploid was termed FNOS018 (HO).
Complementation of mutant phenotypes
Strains FNOS013, FNOS014 and FNOS017
were transformed with pYCG–YDL008w,
pYCG–YDL005c and pYCG–YDL003w, respectively, or with the parental vector pRS416 (Soni
et al., 1993). These strains were sporulated, and
their progeny were scored for segregation of the
plasmid-borne URA3 marker and for resistance to
G418.
Sequence analysis
Sequences sharing protein homology with the
products of a given ORF were provided by the
MIPS (http://speedy.mips.biochem.mpg.de) and
YPD (http://www.proteome.com) databases, or
identified with use of the BLAST program (http://
www.ncbi.nlm.nih.gov/BLAST/) (Altschul et al.,
1990). The genome of Caenorhabditis elegans, the
only other eukaryote for which the complete
genomic sequence is available, was also specifically
searched for sequences encoding proteins related
to each of our ORFs (http://genome-www.
stanford.edu/Saccharomyces/worm/). The extent
of amino acid identity between proteins was
Copyright 1999 John Wiley & Sons, Ltd.
5 site
3 site
BglII Eco47III
SnaBI
PacI
NruI
NruI
SnaB1
HpaI
HpaI
HpaI
SnaBI
HpaI
Cognate clone plasmid
pYCG_YDL057w
pYCG_YDL012c
pYCG_YDL010w
pYCG_YDL008w
pYCG_YDL005c
pYCG_YDL003w
determined with the BESTFIT program (Genetics
Computer Group).
RESULTS AND DISCUSSION
Generation of targeted disruptions of seven ORFs
on Chromosome IV
Targeted replacement of seven ORFs with the
KanMX marker was achieved by the use of the
LFH method (Wach, 1996) (see Materials and
Methods). Two ORFs, YDL001w and YDL009c,
which partially overlap and are of opposite orientation, were disrupted and analysed as a single
unit. The replacement of each ORF with KanMX
sequences was verified by Southern analysis.
Genomic DNA prepared from each primary disruptant was digested with two different restriction
enzymes, and in every case the patterns of radiolabelled fragments corresponded to those predicted
for a given disruption (Figure 2). In addition, the
KanMX marker in these disruptants was found by
tetrad analysis to be genetically linked to the TRP1
locus (ORF YDR007w), which is also located near
the chromosome IV centromere. Progeny of diploids heterozygous for disruptions of YDL057w,
YDL012c, YDL010w/YDL009c and YDL005c
exhibited a 2:2 segregation of G418 resistance to
sensitivity, indicating that only one of the two
alleles was replaced in the parental strains. Strains
with a heterozygous disruption of YDL008w or
YDL003w yielded only two viable spores per
tetrad, both of which were G418-sensitive, indicating that both of these ORFs encode essential
functions. Haploid derivatives of each of the
four viable disruptions were assessed for their
ability to grow on minimal media, on glucose or
Yeast 15, 1255–1267 (1999)
1262
K. N. SMITH ET AL.
Figure 2. Verification of replacement of chromosome IV ORFs by the KanMX cassette.
Genomic DNA prepared from primary transformants of FY1679 or of ORD2904 (which is a
W303 strain) and from untransformed parental strains was digested with the indicated enzymes,
and fragments containing KanMX sequences were detected by hybridization with a radiolabelled KanMX probe. Since there is a HindIII site within the KanMX cassette, digestion with
this enzyme produces two hybridizing fragments (the two fragments created by digestion of
DNA prepared from YDL010w/YDL009c disruptants are similar in size and are not resolved
on this gel). Not1-digested pFA6aKanMX4 was included as a positive control. B, BamHI;
E, EcoRI; H, HindIII; N, NotI.
glycerol-rich media, and at three temperatures:
15C, 30C and 37C. Disrupted haploids were also
tested for their ability to mate with one another,
and the sporulation efficiency and spore viability
of the resulting homozygous diploids was also
assessed. Notable phenotypes are summarized in
Table 1. During the course of this work, the likely
biological functions of the proteins encoded by
three of the ORFs (YDL008w, YDL005c and
YDL003w) were determined in other laboratories
and these ORFs have since been assigned gene
names: APC11, MED2 and MCD1, respectively.
YDL057w
The YDL057w ORF encodes a hypothetical
protein of 328 amino acids, whose inactivation
Copyright 1999 John Wiley & Sons, Ltd.
confers no detectable phenotype in any of our
tests. This ORF has no obvious homologue elsewhere in the yeast genome, or in other organisms,
including C. elegans, the only other eukaryote for
which the complete genomic sequence is available.
YDL012c and YDL010w/YDL009c
Inactivation of YDL012c and YDL010w/
YDL009c also confers no detectable phenotype
according to our tests. The predicted product of
YDL009c is a small protein of 107 amino acids,
and is not related to any known or predicted
protein. However, the Ydl012c and Ydl010w proteins are homologous to those encoded by two
closely linked ORFs on chromosome II, YBR016w
and YBR014c, respectively. Ydl012c (107 amino
Yeast 15, 1255–1267 (1999)
SEVEN ORF ON YEAST CHROMOSOME IV
acids) and Ybr016w (128 amino acids) are 64%
identical over their entire lengths. To a slightly
lesser extent, they also share homology with
Ydr210w, a hypothetical protein of 75 amino
acids. The predicted Ydl010w (231 amino acids)
and Ybr014c proteins (203 amino acids) are 42%
identical. The case of YDL012c and YDL010w
may illustrate the general observation that a
significant fraction of the yeast genome consists of
tracts that have been duplicated (Goffeau et al.,
1996). The largest pair of repeated tracts is found
in the pericentric regions of chromosomes II
(coordinates 238 164–407 122) and IV (449 752–
569 763), in both cases on the right arm of each of
these chromosomes and near the centromere (Jacq
et al., 1997). Although the chromosome IV ORFs
are just outside the region of shared homology
as defined by these coordinates, the homology
between YDL012c and YBR016w (with 65%
nucleotide identity), and YDL010w and YBR014c,
may be more than fortuitous and might have
resulted from further rearrangements at the
boundaries of the duplicated region after the
ancestral duplication took place. In this respect it
is noteworthy that the chromosome II ORFs are
immediately downstream of an intact Ty element,
whereas the chromosome IV ORFs are similarly
positioned near LTR elements (YDLCdelta1 and
YDLWtau1; Figure 1). However, there is an intervening ORF between YBR014c and YBR016w,
the gene TTP1, which has no counterpart at the
YDL012c/YDL010w locus, suggestive of an
associated deletion event. Also, the YDL012c
sequence contains an intron and YBR016w does
not. To test the idea that the apparent wild-type
phenotype of ydl012c and ydl010w mutants might
be due to functional redundancy in the yeast
genome, we constructed ydl012c ybr016w and
ydl010w ybr014c double mutants. However, we did
not observe any difference between wild-type
haploids and either double mutant with respect
to growth on different media or at different
temperatures (data not shown).
Ydl012c (like its homologues Ybr016w and
Ydr210w) is highly enriched in glutamine, which
constitutes about 25% of the total residues, but
these proteins share no homology with any protein
of known function. On the other hand, searches
of protein databases indicate that Ydl010w (and
Ybr014c) belongs to a large family of known and
predicted glutaredoxins, thioredoxins and thioltransferases, proteins involved in the catalysis
of disulphide oxidation/reduction reactions. These
Copyright 1999 John Wiley & Sons, Ltd.
1263
include the yeast hypothetical protein Ypl156c
(284 amino acids) and the yeast Ttr1 protein, a
thioltransferase, as well as bacterial, plant and
animal (including C. elegans) glutaredoxins. The
compelling homologies shared by Ydl010w and
these other proteins indicates that it very likely has
a biological function. The lack of phenotype of
ydl010w ybr014c double mutants could be due,
then, to additional functional redundancy in the
yeast genome. Alternatively, any phenotypes
exhibited by YDL010w disruptants might be conditional, in that the ORF might be required only
under certain physiological or environmental
circumstances, such as oxidizing conditions.
YDL008w
Disruption of this ORF is lethal in both FY1679
and in the W303 background. Spores lacking the
gene form microcolonies of roughly eight to 16
cells, which suggests that a small amount of the
wild-type gene product is partitioned from the
parental heterozygote into the meiotic products,
sufficient to allow only a few divisions after germination. That disruption of YDL008w is responsible
for the observed lethality was confirmed by transformation of a diploid heterozygous for the disruption with the wild-type gene carried on a replicative
plasmid (pYCG–YDL008w). Tetrad analysis
showed that the G418-resistant progeny of this
strain all contained the plasmid, indicating that it
rescued the lethality caused by the disruption.
The predicted product of YDL008w, a 165
amino acid protein, has been identified recently as
a component of the anaphase-promoting complex
(APC), or cyclosome, and the gene has been
termed APC11 (Zachariae et al., 1998). The APC
controls the transition from metaphase to anaphase during mitosis, by targeting mitotic cyclins
and other cell cycle regulators for destruction by
ubiquitin-mediated proteolysis. Biochemical purification of the yeast APC, followed by the analysis
of constituent peptides by mass spectrometry,
indicated that Apc11 is one of at least 12 subunits
(Zachariae et al., 1998). This study also demonstrated that APC11 is an essential gene and that
the Apc11 protein shares similarity with members
of a family of RING-finger (a motif which may
mediate protein–protein interactions) proteins
found in other species, including C. elegans and
humans. A genome-wide analysis using DNA
microarrays to assay the activity of nearly every
yeast gene during sporulation showed that APC11
Yeast 15, 1255–1267 (1999)
1264
Figure 3. Growth defects of ydl005c haploids and complementation by pYCG–YDL005c. Ten-fold serial dilutions
yielding from 105 (top) to ten (bottom) colonies were plated on
minimal medium and incubated at 30C. From left to right on
each panel are shown the wild-type haploid FY1679-17C,
the ydl005c haploid FNOS015, a ydl005c haploid containing
pYCG–YDL005c (ORT3334-8C), and a ydl005c haploid
containing the vector pRS416 (ORT3356-3C). The two latter
haploids are derived from FNOS014 transformed with the
given plasmid.
is also specifically induced at an intermediate
stage, along with several other genes encoding
APC components, suggesting that the APC oversees the transition through one or both meiotic
divisions (Chu et al., 1998).
YDL005c
Disruption of YDL005c results in haploid
strains that grow somewhat slowly on rich medium
at all temperatures tested but have severe growth
defects on minimal medium, which is exacerbated at 15C and 37C (Figure 3). They are also
incapable of growth on glycerol. We also observed
that ydl005c haploids and homozygous diploids
exhibit an aberrant cellular morphology (Figure
4), in that budded cells often fail to separate
normally from the mother cell, producing grapelike clusters of cells which are sometimes elongated
and misshapen. Single cells sometimes appear
more ‘blocky’ in shape than do wild-type cells. In
addition, although ydl005c haploids readily outcross with wild-type strains, a and á disruptants
are unable to mate with one another, even when
Copyright 1999 John Wiley & Sons, Ltd.
K. N. SMITH ET AL.
subjected to strong selection for diploids (data not
shown). To rule out the possibility that this apparent mating defect might be due instead to diploid
inviability, we crossed a ydl005c a haploid to a
ydl005c á haploid carrying the wild-type YDL005c
ORF on a plasmid, and selected diploids by the
complementation of auxotrophic markers (see
Materials and Methods). In addition to rescuing
the mating deficiency, this plasmid also complements the growth defects and aberrant cellular
morphology of ydl005c haploids (Figure 3, and
data not shown). Selection for plasmid loss
allowed diploids homozygous for the ydl005c disruption to be isolated. These strains behave as
non-maters and exhibit phenotypes similar to
those of ydl005c haploids. Since they do not grow
in SPS in our standard sporulation protocol, we
attempted to induce sporulation by direct transfer
of cells from YPD to 1% potassium acetate. Under
these conditions, wild-type FY1679 sporulates
almost as efficiently as when transferred from SPS,
but ydl005c diploids do not. Cells in sporulation
medium adopt an elongated shape but do not
suffer apparent mortality. The inability of diploids
to sporulate may be due to respiratory defects, as
suggested by the failure of ydl005c mutants to
grow in medium containing such non-fermentable
carbon sources as glycerol or acetate.
YDL005c encodes a component of Mediator, a
multiprotein complex which binds the carboxyterminal domain of RNA polymerase II and which
confers responsiveness to various activators of
transcription (Myers et al., 1998). The C-terminus
of the Ydl005c protein, now termed Med2, is
highly enriched in asparagine residues (21% of
total residues), which may function in transcriptional activation or in protein–protein interactions.
The pleiotropic phenotype exhibited by ydl005c
haploids and diploids that we observe is highly
consistent with the participation of Med2 in general transcription. Many of these phenotypes have
been described for mutants defective in other components of Mediator, including Hrs1 (Pgd1),
Gal11, Sin4 and Rgr1 (Piruat et al., 1997; Chen
et al., 1993). For example, HRS1, identified as a
suppressor of the hyper-recombination phenotype
of hpr1 mutants, is required for transcriptional
activation or repression of the regulated promoters
GAL1, PHO5 and HSP26, but not for constitutively expressed promoters such as ADH1 (Piruat
et al., 1997). Mutants lacking HRS1 are also
impaired in mating factor expression, which may
be relevant to the ydl005c mating defect. Strains
Yeast 15, 1255–1267 (1999)
1265
SEVEN ORF ON YEAST CHROMOSOME IV
Figure 4. Cellular morphology of ydl005c haploids during exponential growth. Cells were lightly sonicated before microscopy. Top
panel, wild-type haploids (FY1679-17A); bottom panel, the ydl005c
haploid FNOS015. At left is shown a typical cluster, with daughter
cells remaining attached to mother cells. At right is shown the
‘blocky’ shape adopted by some ydl005c cells.
with sin4 and rgr1 mutations, like ydl005c mutants,
also exhibit a clumpy phenotype (Chen et al., 1993;
Sakai et al., 1990).
YDL003w
Only two viable spores are recovered from tetrads produced by FY1679 and ORD2904 diploids
heterozygous for disruption of YDL003w, and
both develop into G418-sensitive colonies, indicating that the wild-type ORF is essential. Microexamination of spores produced by heterozygotes
shows that the disrupted spore divides at most
once or twice. The cloned cognate ORF carried on
a replicative plasmid can rescue the lethality of the
ydl003w mutation, as indicated by the appearance
of G418-resistant progeny in tetrads derived from
heterozygous diploids, all of which contain the
plasmid (data not shown).
Mutations in YDL003w were isolated recently
in several screens for genes relevant to chromosomal structure, particularly those required for
sister chromatid cohesion prior to mitosis (Guacci
et al., 1997; Michaelis et al., 1997); the gene is now
known as MCD1 (for Mitotic Chromosome Determinant; Guacci et al., 1997) or SCC1 (for Sister
Chromatid Cohesion; Michaelis et al., 1997). In
strains with mcd1/scc1 conditional mutations,
sister chromatids prematurely dissociate at restrictive temperatures, resulting in the improper
Copyright 1999 John Wiley & Sons, Ltd.
segregation and eventual loss of chromosomes
(Michaelis et al., 1997; Guacci et al., 1997). The
Mcd1 protein fluctuates in abundance over the
course of the cell cycle. It is absent in early G1 but
accumulates during S phase, at which time it
associates with replicating chromosomes, and it
disappears during anaphase (Michaelis et al.,
1997). The association of Mcd1 with chromosomes
requires the presence of Smc1, a protein required
for the structural maintenance of chromosomes
and for chromosome condensation during mitosis
(Michaelis et al., 1997); Mcd1 and Smc1 physically
interact (Guacci et al., 1997). The degradation
of Mcd1 at anaphase, interestingly enough with
respect to ORF YDL008c, above, requires the
action of the cyclosome (Michaelis et al., 1997).
Budding yeast Mcd1/Scc1 has been implicated in
DNA repair. A mutant bearing a temperaturesensitive allele of mcd1 is sensitive to both UV and
gamma radiation, and in addition undergoes aberrant chromosome segregation (Heo et al., 1998).
We have independently confirmed that the
temperature-sensitive allele described by Michaelis
et al. (1997) also confers UV and ionizing radiation sensitivity (provided by K. Nasmyth, data
not shown). MCD1/SCC1 exhibits homology to
rad21 of Schizosaccharomyces pombe, an essential
gene which has a role in the repair of DNA
double-strand breaks (Birkenbihl and Subramani,
Yeast 15, 1255–1267 (1999)
1266
1992) and in proper chromosome segregation
(Tatebayashi et al., 1998). The Mcd1/Scc1 and
rad21 proteins, and very likely their functions,
have been conserved over evolution. Homologues
have been identified in C. elegans, mouse and
human and, as shown for yeast MCD1, expression
of the human rad21 (hHR21) is cell-cycle regulated
in HeLa cells (McKay et al., 1996).
ACKNOWLEDGEMENTS
This work was supported by the EUROFAN
program of the European Commission and by a
Chateaubriand Fellowship to K.N.S.
REFERENCES
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. and
Lipman, D. J. (1990). Basic local alignment search
tool. J. Mol. Biol. 215, 403–410.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore,
D. D., Seidman, J. G., Smith, J. A. and Struhl, K.
(eds) (1987). Current Protocols in Molecular Biology.
Wiley, New York.
Birkenbihl, R. P. and Subramani, S. (1992). Cloning and
characterization of rad21, an essential gene of
Schizosaccharomyces pombe involved in DNA doublestrand-break repair. Nucleic Acids Res. 20, 6605–6611.
Chen, S., West, R. W. J., Johnson, S. L., Gans, H.,
Kruger, B. and Ma, J. (1993). TSF3, a global regulatory protein that silences transcription of yeast GAL
genes, also mediates repression by alpha 2 repressor
and is identical to SIN4. Mol. Cell. Biol. 13, 831–840.
Chu, S., DeRisi, J., Eisen, M., Mulholland, J., Botstein,
D., Brown, P. O. and Herskowitz, I. (1998). The
transcriptional program of sporulation in budding
yeast. Science 282, 699–705.
Church, G. M. and Gilbert, W. (1984). Genomic
sequencing. Proc. Natl Acad. Sci. U S A 81, 1991–
1995.
Dujon, B. (1998). European Functional Analysis Network (EUROFAN) and the functional analysis of the
Saccharomyces cerevisiae genome. Electrophoresis 19,
617–624.
Gietz, R. D. and Woods, R. A. (1994). High efficiency
transformation with lithium acetate. In Johnson, J. R.
(Ed.), Molecular Genetics of Yeast: A Practical
Approach. IRL Press, Oxford, pp. 121–131.
Goffeau, A., Barrell, B. G., Bussey, H., Davis, R. W.,
Dujon, B., Feldmann, H., Galibert, F., Hoheisel,
J. D., Jacq, C., Johnston, M., Louis, E. J., Mewes,
H. W., Murakami, Y., Philippsen, P., Tettelin, H. and
Oliver, S. G. (1996). Life with 6000 genes. Science 274,
546, 563–567.
Guacci, V., Koshland, D. and Strunnikov, A. (1997). A
direct link between sister chromatid cohesion and
Copyright 1999 John Wiley & Sons, Ltd.
K. N. SMITH ET AL.
chromosome condensation revealed through the
analysis of MCD1 in S. cerevisiae. Cell 91, 47–57.
Heo, S. J., Tatebayashi, K., Kato, J. and Ikeda, H.
(1998). The RHC21 gene of budding yeast, a homologue of the fission yeast rad21 + gene, is essential
for chromosome segregation. Mol. Gen. Genet. 257,
149–156.
Jacq, C., Alt-Morbe, J., Andre, B., Arnold, W., Bahr,
A., Ballesta, J. P., Bargues, M., Baron, L., Becker, A.,
Biteau, N., Blocker, H., Blugeon, C., Boskovic, J.,
Brandt, P., Bruckner, M., Buitrago, M. J., Coster, F.,
Delaveau, T., del Rey, F., Dujon, B., Eide, L. G.,
Garcia-Cantalejo, J. M., Goffeau, A., Gomez-Peris,
A., Zaccaria, P. et al. (1997). The nucleotide sequence
of Saccharomyces cerevisiae chromosome IV. Nature
387, 75–78.
McKay, M. J., Troelstra, C., van der Spek, P., Kanaar,
R., Smit, B., Hagemeijer, A., Bootsma, D. and
Hoeijmakers, J. H. (1996). Sequence conservation of
the rad21 Schizosaccharomyces pombe DNA doublestrand break repair gene in human and mouse.
Genomics 36, 305–315.
Michaelis, C., Ciosk, R. and Nasmyth, K. (1997).
Cohesins: chromosomal proteins that prevent
premature separation of sister chromatids. Cell 91,
35–45.
Myers, L. C., Gustafsson, C. M., Bushnell, D. A., Lui,
M., Erdjument-Bromage, H., Tempst, P. and
Kornberg, R. D. (1998). The Med proteins of
yeast and their function through the RNA
polymerase II carboxy-terminal domain. Genes Dev.
12, 45–54.
Piruat, J. I., Chavez, S. and Aguilera, A. (1997). The
yeast HRS1 gene is involved in positive and negative
regulation of transcription and shows genetic characteristics similar to SIN4 and GAL11. Genetics 147,
1585–1594.
Sakai, A., Shimizu, Y., Kondou, S., Chibazakura, T.
and Hishinuma, F. (1990). Structure and molecular
analysis of RGR1, a gene required for glucose repression of Saccharomyces cerevisiae. Mol. Cell. Biol. 10,
4130–4138.
Sikorski, R. S. and Hieter, P. (1989). A system of shuttle
vectors and yeast host strains designed for efficient
manipulation of DNA in Saccharomyces cerevisiae.
Genetics 122, 19–27.
Soni, R., Carmichael, J. P. and Murray, J. A. (1993).
Parameters affecting lithium acetate-mediated transformation of Saccharomyces cerevisiae and development of a rapid and simplified procedure. Curr. Genet.
24, 455–459.
Sprague, G. F. (1991). Assay of yeast mating reaction.
In Guthrie, C. and Fink, G. R. (Eds), Guide to Yeast
Genetics and Molecular Biology. Academic Press, New
York, pp. 77–93.
Tatebayashi, K., Kato, J. and Ikeda, H. (1998). Isolation of a Schizosaccharomyces pombe rad21ts
mutant that is aberrant in chromosome segregation,
Yeast 15, 1255–1267 (1999)
SEVEN ORF ON YEAST CHROMOSOME IV
microtubule function, DNA repair and sensitive to
hydroxyurea: possible involvement of Rad21 in
ubiquitin-mediated proteolysis. Genetics 148, 49–57.
Wach, A. (1996). PCR-synthesis of marker cassettes
with long flanking homology regions for gene disruptions in S. cerevisiae. Yeast 12, 259–265.
Wach, A., Brachat, A., Pöhlmann, R. and Philippsen, P.
(1994). New heterologous modules for classical or
PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10, 1793–1808.
Copyright 1999 John Wiley & Sons, Ltd.
1267
Winston, F., Dollard, C. and Ricupero-Hovasse, S. L.
(1995). Construction of a set of convenient Saccharomyces cerevisiae strains that are isogenic to S288C.
Yeast 11, 53–55.
Zachariae, W., Shevchenko, A., Andrews, P. D., Ciosk,
R., Galova, M., Stark, M. J., Mann, M. and
Nasmyth, K. (1998). Mass spectrometric analysis of
the anaphase-promoting complex from yeast: identification of a subunit related to cullins. Science 279,
1216–1219.
Yeast 15, 1255–1267 (1999)
Документ
Категория
Без категории
Просмотров
4
Размер файла
294 Кб
Теги
472
1/--страниц
Пожаловаться на содержимое документа