close

Вход

Забыли?

вход по аккаунту

?

586

код для вставкиСкачать

Yeast 15, 351–360 (1999)
Basic Phenotypic Analysis of Six Novel Yeast Genes
Reveals Two Essential Genes and One which Affects the
Growth Rate
R. SANJUAN1, M. LEO
u N1, J. ZUECO1 AND R. SENTANDREU1*
1
Sección Departamental de Microbiologı́a, Facultad de Farmacia, Universidad de Valencia, Avda. Vicente Andres
Estelles s/n, 46100 Burjasot (Valencia), Spain
Phenotypic analysis was performed on six mutants of Saccharomyces cerevisiae deleted in one of the following open
reading frames (ORFs), located on chromosome II: YBR254c, YBR255w, YBR257w, YBR258c, YBR259w and
YBR266c. Disruption of the ORFs was carried out in the diploid strain FY1679 using the kanMX4 marker flanked
by short sequences homologous to the target locus. Tetrad analysis following sporulation of the heterozygous
disruptants showed that YBR254c and YBR257w are essential genes. YBR257w was later characterized and
renamed POP4, its gene product being involved in 5.8S rRNA and tRNA processing (Chu et al., 1997). The tetrad
analysis performed for the heterozygous disruptant for YBR266c showed that two of the four viable spores gave
colonies of smaller size, reflecting a slower growth rate. Growth analysis of the disruptant haploids confirmed this
defect at 30C and also at 15C. However, complementation tests failed to confirm that the deletion of YBR266c is
responsible for this growth defect. Growth analysis of the disruptant haploid ybr255wÄ showed a slower growth rate
on YPD and minimal medium at 15C. Finally, no phenotypic effect could be detected associated to the disruption
of ORFs YBR258c and YBR259w. Copyright 1999 John Wiley & Sons, Ltd.
  — EUROFAN; Saccharomyces cerevisiae; kanMX4 marker; gene disruption; preliminary functional
analysis
INTRODUCTION
Once the Saccharomyces cerevisiae genome was
completely sequenced (Goffeau et al., 1996), it
became evident that many genes did not have any
assigned function, confirming previous observations (Bussey et al., 1995; Oliver et al., 1992; Goebl
and Petes, 1986; and Kaback et al., 1984). Primary
analysis of the genome sequence showed that, of
*Correspondence to: R. Sentandreu, Sección Departamental de
Microbiologı́a, Facultad de Farmacia, Universidad de
Valencia, Avda. Vicente Andres Estelles s/n, 46100 Burjasot
(Valencia), Spain. Tel.: 34-96-3864299; fax: 34-96-3864682;
e-mail: rafael.sentandreu@uv.es.
Contract/grant sponsor: European Commission, EUROFAN
programme.
Contract/grant sponsor: Ministry of Education and Science,
Spain, grant number, CICyT PM96-0019.
Contract/grant sponsor: AECI, Spain.
CCC 0749–503X/99/040351–10 $17.50
Copyright 1999 John Wiley & Sons, Ltd.
6000 genes identified, only approximately 30% had
an experimentally characterized function; about
the same percentage had strong or weak homology
to genes with known functions, or had wellcharacterized sequence motifs, whereas the rest,
amounting to almost one-half of the genome,
remained with no clue as to their functions (Dujon,
1996).
To deal with this challenge, the European Functional Analysis Network (EUROFAN) was created (Oliver, 1996). Its objective was the systematic
functional analysis of 1000 novel genes, using
simple and standardized techniques. EUROFAN’s
final aim was to accelerate the progress of biolgical
research by creating an informational and material
resource of utility for both basic science and
industry (EUROFAN Interim Report, 1998). The
Received 1 August 1998
Accepted 25 September 1998
352
yeast research laboratories associated with the
Network carried out the systematic generation of
deletants and plasmid tools, and performed analyses that could be applied on a genome-wide scale.
These tools and the results of the analysis have
since then been passed to specific Functional
Nodes that perform the in-depth study of the
deletants for almost all known cellular functions.
It is hoped that by using this systematic approach
the function of many yeast genes will be ascertained. However, it has to be kept in mind that,
even after the conclusion of the project, the function of an unknown number of these novel genes
will remain a mystery, partly because some genes
could have functions only in environmental conditions not yet reproduced in the laboratory, and
partly because certain other genes, although nonessential, may contribute somewhat to the overall
fitness of the cells under normal growth conditions, contributions that are difficult to detect yet
important for the cell (Thatcher et al., 1998).
As participants in the EUROFAN network, we
report the results of the deletions of six ORFs
from chromosome II and the standard phenotype
analysis carried out on the resulting mutants.
MATERIALS AND METHODS
Strains, media and plasmids
S. cerevisiae FY1679 (a/á, ura3-52/ura3-52,
leu2Ä1/ + , trp1Ä63/ + , his3Ä200/ + ) and CEN.PK2
(a/á, ura3-52/ura3-52, leu2-3,112/ + , trp1-289/ + ,
his3Ä1/ + ) were the EUROFAN reference strains
used during this study. For maintaining and for
routine culture, S. cerevisiae was grown on YPD
(2% yeast extract, 1% peptone, 2% glucose) at
30C, and for selective growth, it was grown on
YPD containing 200 mg/l of G418 (geneticin,
Gibco BRL). The growth analysis of deletant yeast
cells was carried out on solid YPD, YPG (2% yeast
extract, 1% peptone, 3% glycerol) and SD (0·67%
yeast nitrogen base, 2% glucose), supplemented
with the required amino acids, at 15C, 30C and
37C. Diploid cells were sporulated at 30C on 1%
potassium acetate agar supplemented with 25% of
the nutritional requirements, for 5–7 days.
Escherichia coli strain XL1Blue served as plasmid host for genetic engineering. DNA manipulations such as digestion, ligation, subcloning and
transformation of E. coli were performed according to standard procedures (Sambrook et al.,
1989). For selective growth, the bacteria were
Copyright 1999 John Wiley & Sons, Ltd.
.   .
grown on 2YT (1% yeast extract, 1·4% tryptone,
0·5% NaCl) containing 100 mg/l ampicillin or
50 mg/l kanamycin.
The plasmids used in this study were: pFA6akanMX4 (Wach et al., 1994) as the template for
obtaining the short flanking homology (SFH)
replacement cassettes, pUG7 (Güldener et al.,
1996) to clone the long flanking homology (LFH)
replacement cassettes and pRS416 (Sikorski and
Hieter, 1989) to clone the cognate genes. The
resulting constructions, as well as the deleted heterozygous diploids and haploids for each mating
type, were deposited in the EUROFAN collection,
EUROSCARF.
Construction of SFH replacement cassettes
SFH deletion cassettes were generated by means
of a PCR-targeting strategy (Wach et al., 1994).
PFA6a-kanMX4 was the template for the
kanMX4 amplification, using two chimeric
primers designed to hybridize in the 5 end (35–
45 nt) to the target chromosomal sequence to be
replaced, and in the 3 end (20 nucleotides) to the
adjacent polylinker of kanMX4, as indicated in
Table 1. This amplification results in fragments
containing the kanMX4 marker flanked by short
sequences (35–45 nt) homologous to the target
locus. The dual marker kanMX4 confers G418
resistance in S. cerevisiae and kanamycin resistance in E. coli (Jimenez and Davies, 1980).
The PCR parameters were: 2 min at 94C followed by 20 cycles of 30 s at 94C, 30 s at 55C and
90 s at 72C. Finally the reaction mix was heated at
72C for 2 min. For the amplification, a mix of
Vent DNA (New England Biolabs) and Taq (Pharmacia) polymerases in a proportion of 5 U of the
former per 1 U of the latter was used. Vent DNA
polymerase has 3<5 exonuclease activity that
reduces the incorporation of mismatches into the
PCR products and avoids the overhanging A
nucleotide.
Transformation of yeast cells
Yeast cells were made competent following the
protocol developed by Gietz and Woods (1994)
and then transformed with plasmidic or linear
DNA following the lithium acetate method (Ito
et al., 1983). Both PCR-generated DNA fragments
and DNA released from plasmids by restriction
enzyme digestion were purified in agarose gel prior
to being transformed into the yeast cells (at least
1 ìg of the eluted DNA per transformation).
Yeast 15, 351–360 (1999)
       
353
Table 1. Chimeric oligonucleotides used to generate the SFH deletion cassettes. One pair of these primers was used
for each ORF to be deleted. The number of nucleotides still remaining after the deletion of the ORF is also indicated.
Name
254 S1
254 S2
255 S1
255 S2
257 S1
257 S2
258 S1
258 S2
259 S1
259 S2
266 S1
266 S2
Number of
remaining original
ORF nucleotides
5
3
Sequence*
TGCCTCAGTATTTTGCCATTATTGGTAAGAAGGACAATCCT
CGTACGCTGCAGGTCGAC
GCCCTTGACAATCATGATAAAAAATTTCTGAC—GAGTCCCAG
ATCGATGAATTCGAGCTCG
GCTGAACAAGAACAAAATGGAAGGGGCGATACAACAACAGA
CGTACGCTGCAGGTCGAC
CTATAAATACATAGACCCGCAAATTACCACAGCAATGCCTT
ATCGATGAATTCGAGCTCG
GAAAATAAGCACGATTTGGACTCCCCTATTTGTCAGAATGGA
CGTACGCTGCAGGTCGAC
CTATAAATACATAGACCCGCAAATTACCACAGCAATGCCTT
ATCGATGAATTCGAGCTCG
CAGTATAAGAGAGTAGAGCTTATTTCAAATCCAAAAAATGGC
CGTACGCTGCAGGTCGAC
CTCTGTTTTTAAATATTAATTCTTCATCTTCGTTAACCATT
ATCGATGAATTCGAGCTCG
CAGATCATTCGATCTTCAAAAGGTACCGTTCGTTTCCACCAT
CGTACGCTGCAGGTCGAC
TTGTACAATAAGATTTCATTCCGTTTACTTGTCGGTAAAAC
ATCGATGAATTCGAGCTCG
GACACTTTGGAGTCAAATGTCTCAAATGATATTGGTGGCAA
CGTACGCTGCAGGTCGAC
GCTTCTCATTAGAAGTCAAGAAGAGAGCATATCAGTAAC
ATCGATGAATTCGAGCTCG
42
136
71
18
5
238
5
259
141
168
425
8
*Bold characters in S1 primers are 18 bases homologous to pFA6a–kanMX4 MCS located 5 of kanMX4 module and contain SunI,
PstI and SalI restriction sites. In S2 primers, bold characters are 19 bases located 3 of kanMX4 and containing ClaI, EcoRI and
SacI restriction sites. Standard characters correspond to the sequences complementary to the target gene.
After transformation of the yeast cells with SFH
or LFH deletion cassettes, the transformants were
grown on 3 ml of YPD for 2–3 h, and then concentrated by centrifugation and plated on G418YPD medium. After incubation for 2–3 days,
a few large and many small colonies grew,
only the former being streaked out and regrown
on the second selection YPD-G418 plates,
until single colonies appeared, ensuring the
elimination of abortive transformants and the
growth of heterozygous deletant cells.
Verification of correct ORF replacements
Correct targeting of the kanMX4 module into
the genomic locus was analysed by PCR directly
on the whole yeast cells (Huxley et al., 1990).
G418-resistant transformants were used as source
Copyright 1999 John Wiley & Sons, Ltd.
of DNA template, and oligonucleotides designed
to bind outside of the target locus (A1 and A4),
within the target locus (A2 and A3) and within
the kanMX4 module (K2 and K3) were used as
primers (Table 2).
The conditions for the PCR reaction, using Taq
DNA polymerase, were the following: 94C for
2 min, then 30 cycles consisting of 30 s at 94C,
30 s at 55C and 3 min at 72C.
Cloning of LFH replacement cassettes in pUG7
and ORF replacements in CEN.PK2
LFH cassettes were obtained by PCR, using
approximately 0·1–0·5 ìg of chromosomal DNA
from heterozygous FY1679, disrupted in one of
the six ORFs by the corresponding SFH module,
as templates. The oligonucleotides A1 and A4,
Yeast 15, 351–360 (1999)
.   .
354
Table 2.
Oligonucleotides used to identify clones with correctly targeted kanMX4 marker.
Name
254
254
254
254
255
255
255
255
257
257
257
257
258
258
258
258
259
259
259
259
266
266
266
266
K2
K3
A1
A2
A3
A4
A1
A2
A3
A4
A1
A2
A3
A4
A1
A2
A3
A4
A1
A2
A3
A4
A1
A2
A3
A4
Nucleotide
position*
Sequence
CCAATTTCATCTTCTGAGGGT
GTGGATTTTCTGCATTGGTA
ACAGTTAAATGGGAACGGTGG
GACTTGTTGATCCTGACCAGA
GTGGATTTTCTGCATTGGTA
CCAATTTCATCTTCTGAGGGT
GACTGGACATCAAAACTTCTG
GTGCTCTCTTCAGTATTGCCT
AAGAGGAAAAAACATGCAGATTG
GGGCTTTTCAGGGTCCTCC
GTCGTCGTTGTGATGATATGC
GAAATGGTTAACGAAGATGAAG
AGATGCAATGATCTGGGCCAGTT
GTCCCTCCTTCTTATACTTGTC
CTTATGAACAGGAAGCAAATG
GCCTTCAAGGCATTGTGATCT
GTCCCTCCTTCTTATACTTGTC
CTATATCTGGCAACAGCCTCG
GTACAAAAGGGATGGACAGA
CCAGATGACGCTAATGATGTA
TCCCAGTCATCTTCGTTGTCT
GCAAGAAAATGAGGAGAACAA
GTGCAACACGTTCTTTTCAAA
CACATCCACTCTCATTCCCG
CAAGACTGTCAAGGAGGGTATTC
GAAAGTAATATCATGCGTCAATCG
293
+79
+177
+784
272
+100
+1777
+2428
427
+68
+800
+1110
339
+58
+398
+695
283
+32
+2022
+2339
289
+192
+428
+843
+964
309
Size of PCR
fragment (bp)†
A1–A2:
A1–K2:
A3–A4:
K3–A4:
A1–A2:
A1–K2:
A3–A4:
K3–A4:
A1–A2:
A1–K2:
A3–A4:
K3–A4:
A1–A2:
A1–K2:
A3–A4:
K3–A4:
A1–A2:
A1–K2:
A3–A4:
K3–A4:
A1–A2:
A1–K2:
A3–A4:
K3–A4:
371
461
608
500
371
469
652
469
495
558
311
616
396
470
298
633
314
550
318
548
480
840
416
395
*The first base of the start codon of the target ORF (A or the ATG) is designated +1.
†Expected size of the sequences amplified by PCR on heterozygous disruptants.
localized at least 350 nt from the ORF initiation
codon and 250 nt from the terminator codon,
respectively, were used as primers. The PCR conditions were: 94C for 2 min, 10 cycles of 15 s at
94C, 30 s at 50C and 3 min at 68C, followed by
20 cycles of 15 s at 94C, 30 s at 50C and 3 min at
68C increased 20 s for each cycle, the final elongation being 7 min at 72C. A commercial mix of
Pwo and Taq DNA polymerases (Expand High
Fidelity, Boehringer-Mannheim) was used for the
amplification. This mix has 3<5 exonuclease
activity, as Vent DNA polymerase, but it is able to
amplify longer fragments of DNA.
After PCR reaction, the DNA fragments were
resolved by electrophoresis on aragose gel and
cloned into EcoRV-digested pUG7. Recombinant
E. coli were selected for kanamycin resistance and
the resulting plasmid, consisting of pUG7 carrying
the LFH replacement cassette, was termed
pYORC.
Copyright 1999 John Wiley & Sons, Ltd.
To test the efficiency of the LFH replacement
cassettes, they were excised from pYORC, by
restriction enzymes (Table 3) and used to transform S. cerevisiae CEN.PK2 cells. The deletants
were selected by G418 resistance and correct gene
replacement was analysed by PCR using whole
cells and A1 and A4 primers.
Construction of cognate gene clones
The cloning of the six wild-type genes was
carried out by the gap repair technique (Rothstein,
1991). The LFH replacement cassettes were cut
from pYORC using the restriction enzymes as in
Table 3, and subcloned into pRS416. The kanMX4
module was released by SmaI and EcoRI digestion, and 1–5 ìg of the linearized gapped plasmid
product of this digestion was used to transform
FY1679 cells. Ura + transformant colonies were
analysed by PCR using M13 forward and reverse
Yeast 15, 351–360 (1999)
       
Table 3. Restriction enzymes used to excise LFH replacement cassettes from pYORC plasmids
Plasmid
name
pYORC254c
pYORC255w
pYORC257w
pYORC258c
pYORC259w
pYORC266c
Restriction enzyme
Xbal/Kpnl
Xbal/Kpnl
Xbal/Khol
Xbal/Kpnl
Xbal/Khol
Xbal/Khol
primers that bind upstream and downstream of the
pRS416 multiple cloning site. The pRS416 constructions carrying the cognate genes were named
pYCG.
Plasmidic DNA from Ura + cells was obtained
by the method of Hoffman and Winston (1987)
and then used to transform fresh competent E. coli
cells. The rescued plasmids were analysed by
restriction enzymes to verify the presence of the
cognate genes, and the sequences coming from the
LFH cassette and generated by PCR were analysed
by single-strand sequence analysis to check
the absence of PCR-introduced errors. For the
sequencing reaction, pYORCs were used as templates and T3, T7, K2 and K3 oligonucleotides as
primers. Sequencing was performed with Amplitaq
polymerase and a Dye Terminator Kit (Perkin–
Elmer) in an Applied Biosystems 373 automatic
sequencer.
pYCGs were finally used to transform haploid
deletants with a mutant phenotype or heterozygous diploids, in the case of lethal phenotype, in
order to test the complementation ability of the
retrieved genes.
Sporulation and tetrad analysis
Heterozygous deletants and wild-type cells were
grown on YPD plates overnight and then a large
amount of cellular mass was placed on sporulation
medium. The formation of the tetrads was checked
under a light microscope, and after 5–7 days at
30C, they were dissected. At least 10 tetrads per
ORF were analysed and the resulting spores were
incubated on YPD at 30C for 3 days. The mating
type of the germinated spores was analysed by
crossing them with S. cerevisiae DC14 (a, his1) and
S. cerevisiae DC17 (á, his1), and the auxotrophies
Copyright 1999 John Wiley & Sons, Ltd.
355
by growing the spores in SD medium containing
different amino acids. The resistance to G418 was
also checked.
The sporulation efficiency of deletant cells was
determined by observation of tetrad formation
under the microscope and comparison with that of
the wild-type cells.
To obtain homozygous disruptants for each
ORF, G418 resistant haploid cells were crossed
and the deletant diploids selected on SD plates
containing the required amino acids.
Growth analysis
Haploid wild-type and deletant strains were
analysed for their growth on YPD, YPG and SD
media at 15C, 30C and 37C. To verify the
possible phenotypes, homozygous deletants were
analysed in parallel. The strains were grown overnight in YPD, and the optical density at 600 nm
measured and adjusted to 1. Serial dilutions of the
cultures from 10 1 to 10 6 were then made and
2 ìl of each dilution was spotted on the three
different media. The plates were incubated for 3–5
days at different temperatures and the growth of
the cells followed day after day.
Morphological changes of disruptant haploid
cells were tested by observation under a contrast
phase microscope, and the modification of colony
morphology by looking at them directly on the
agar medium plates or through the 10 lens in
the microscope.
RESULTS AND DISCUSSION
Basic phenotype analysis of the ORFs YBR254c,
YBR255w, YBR257w, YBR258c, YBR259w and
YBR266c from chromosome II was undertaken as
part of the EUROFAN project. The first step of
this analysis consisted in the deletion of these six
ORFs using SFH (short flanking homology)
replacement cassettes. These cassettes, obtained
by PCR, consist of the heterologous dominant
marker kanMX4 flanked by two short sequences
of 35–45 nt which are homologous to the target locus. This short homology is sufficient to direct
the integration of the cassette in the right
place—helped by the fact that the kanMX4 does
not have any homology to the yeast genome,
although the efficiency of the process is rather low,
around 5–25 transformants per ìg of transforming
DNA. As a general rule, the SFH cassettes were
designed in such a way that 65–95% of the ORFs
Yeast 15, 351–360 (1999)
.   .
356
Figure 1. Verification of gene disruption by PCR. Lane 1, PCR product obtained from
diploid wild-type cells (FY1679); lane 2, PCR product from heterozygous disruptants);
lane ë, ë DNA digested by EcoRI and HindIII. For ybr254cÄ/ + , ybr255wÄ/ + and
ybr266cÄ/ + , lane a shows the PCR amplification with the corresponding A1 and A2
oligonucleotides; lane b, with A2 and K2; lane c, with A3 and A4; and lane d, with K3
and A4. For ybr257wÄ/ + , ybr258cÄ/ + and ybr259wÄ/ + , lane a represents the PCR
product amplified with the corresponding A1, A2 and K2 oligonucleotides; and lane b
with A3, K3 and A4. The expected size of PCR fragments is shown in Table 2.
were replaced by the kanMX4 marker, except for
YBR266c that was only 36%, to prevent inactivation of the adjacent ORF. To avoid changes of
expression of contiguous ORFs, the end point for
the disruption was at least 350 nt upstream of the
start codon and 250 nt downstream of the stop
codon of the adjacent ORFs. The integration of
Copyright 1999 John Wiley & Sons, Ltd.
the cassettes in the respective loci was verified by
PCR at the novel joints, as shown in Figure 1.
After the disruption of the ORFs in FY1679, the
chromosomal DNA of the disruptant strains was
used in PCR reactions to obtain the LFH (long
flanking homology) replacement cassettes, that
contain the kanMX4 marker, but in this case
Yeast 15, 351–360 (1999)
       
357
Figure 2. Tetrad analysis of the heterozygous disruptants. (A) Example
of tetrad dissection and spore germination of diploid FY1679 cells deleted
for essential genes YBR254c or YBR257w. Only two spores per tetrad are
viable and kans. (B) Tetrad dissection and spore germination of diploid
FY1679 deleted for YBR266c. Spores kanr grow more slowly than kans
spores. (C) Example of tetrad dissection and spore germination of diploid
1679 deleted for non-essential genes, YBR255w, YBR258c and YBR259w.
All kans and kanr spores are viable and grow at the same rate.
flanked by at least 350 nt of the promoter and
250 nt of the terminator regions of the respective
ORFs. These LFH cassettes were cloned in pUG7
to generate pYORC plasmids, from which the
LFH cassettes could easily be excised and used for
the efficient inactivation of the ORFs in different
strain backgrounds. To test the efficiency of these
LFH cassettes, the six ORFs were again deleted,
this time, however, in CEN.PK2 strain. The
number of transformants obtained was higher,
compared to the number obtained with the SFH
cassette in the same strain, and PCR performed
using oligonucleotides A1 and A4 confirmed the
correct targeting of the cassette.
The LFH cassettes were also cloned in pRS416
and, after excising the kanMX4, the resulting linear constructs were used to recover the six cognate
genes by the gap repair technique. The efficiency of
the gap repair was very low, especially the transformation step in E. coli with the pYCGs obtained
from transformed yeast cells.
To try to ascertain the possible function of the
six ORFs studied, heterozygous FY1679 and wildtype cells were induced to sporulate, and formation of tetrads was followed by observation under
the microscope for 5–7 days. No difference in the
efficiency of sporulation between heterozygous
Copyright 1999 John Wiley & Sons, Ltd.
deletants and wild-type cells was noticeable. Tetrad analysis showed that, when YBR254c and
YBR257w were inactivated, only two viable spores
were isolated from each tetrad, and all of the
haploid cells derived from the viable spores were
geneticin-sensitive (Figure 2). This result shows
that YBR254c and YBR257w are essential genes
for growth. Little information is available about
YBR254c, apart from the fact that it probably
codes for a membrane protein (Feldman et al.,
1994). YBR257w has been recently characterized
by Chu et al. (1997), who renamed this ORF
POP4. It codes for a protein that is associated with
both RNase MRP and RNase P and that is
necessary both for normal 5·85 rRNA processing
and for processing of tRNA. Disruption of the
other four ORFs did not affect the viability of the
spores, since all four spores were able to germinate
and grow from each tetrad (Figure 2). However, in
the case of YBR266c, the two spores from each
tetrad that were geneticin-resistant showed a
slower growth rate, indicating that the ybr266
mutation could affect the rate of growth of the
cells.
To carry out the different phenotypic analyses,
two deletant spores of opposite sexual type were
selected for each ORF and grown in different
Yeast 15, 351–360 (1999)
.   .
358
YPD
37°C
SD
YPG
YPD
28°C
SD
YPG
YPD
15°C
SD
YPG
ybr255w (1)
wild type (1)
ybr255w (2)
wild type (2)
ybr255w/ybr255w (3)
wild type (3)
ybr255w (1)
wild type (1)
ybr255w (2)
wild type (2)
ybr255w/ybr255w (3)
wild type (3)
ybr255w (1)
wild type (1)
ybr255w (2)
wild type (2)
ybr255w/ybr255w (3)
wild type (3)
Figure 3.
media (YPD, YPG and SD) at three different
temperatures (15, 30 and 37C), using homozygous
disruptants and wild-type spores, with auxotrophies the same as the deletant ones, as controls. It
was necessary to compare deletant and wild-type
spores with the same auxotrophies because
deletant spores with different nutritional requirements showed differences in growth (data not
shown); a similar observation was reported by
Thatcher et al. (1998). Ybr255wÄ cells and the
corresponding homozygous strain exhibited slower
growth at 15C in any medium (Figure 3), indicating that this gene could play a role in the development of the cells at low temperatures. Ybr266wÄ
cells showed a slower rate of growth at 15C and
30C in all the three media used, confirming the
result observed during the germination of the
Copyright 1999 John Wiley & Sons, Ltd.
(A).
geneticin-resistant spores at 30C. Finally, no appreciable change in the phenotype was observed
for the ybr258cÄ and ybr259wÄ mutant cells under
the conditions of growth used, and no morphological change in the cells or the colonies of any of
the four viable disruptant haploids, ybr255wÄ,
ybr258cÄ, ybr259wÄ and ybr266wÄ, was detected.
To verify whether the inactivation of the respective ORFs was responsible for the phenotypes
observed, ybr255wÄ, ybr266cÄ and their corresponding homozygous disruptant strains were
transformed with the constructions containing the
cognate genes rescued by gap-repair (pYCGYBR255w and pYCG-YBR266c). pYCGYBR255w was able to restore the wild-type
phenotype, but this was not the case with pYCGYBR266c. This unexpected result shows that the
Yeast 15, 351–360 (1999)
       
359
YPD
37°C
SD
YPG
YPD
28°C
SD
YPG
YPD
15°C
SD
YPG
ybr266c (1)
wild type (1)
ybr266c (2)
wild type (2)
ybr266c/ybr266c (3)
wild type (3)
ybr266c (1)
wild type (1)
ybr266c (2)
wild type (2)
ybr266c/ybr266c (3)
wild type (3)
ybr266c (1)
wild type (1)
ybr266c (2)
wild type (2)
ybr266c/ybr266c (3)
wild type (3)
Figure 3. (B).
Figure 3. Phenotypic analysis of deleted haploids and homozygous disruptants for (A) YBR255w and (B) YBR266c. A1; deleted
haploid ybr255wÄ and wild-type cells with the following genotype: a, ura3–52, leu2Ä1, trp1Ä63; A2, deleted haploid ybr255wÄ and
wild-type-cells with the following genotype: á, ura3-52, his3Ä200; A3, homozygous disruptant for YBR255w in strain FY1679 (a/á,
ura3–52/ura3–52, leu2Ä1/ + , trp1Ä63/ + , his3Ä200/ + ) and wild-type FY1679 (a/á, ura3–52/ura3–52, leu2Ä1/ + , trp1Ä63/ + , his3Ä200/
+
); B1, deleted haploid ybr266cÄ and wild-type cells with the genotype á, ura3–52, his3Ä200; B2, deleted haploid ybr266cÄ and
wild-type cells with the genotype a, ura3–52, trp1Ä63; B3, homozygous disruptant for YBR266c in strain FY1679 (a/á,
ura3–52/ura3–52, leu2Ä1/ + , trp1Ä63/ + , his3Ä200/ + ) and wild-type FY1679 (a/á, ura3–52/ura3–52, leu2Ä1/ + , trp1Ä63/ + , his3Ä200/
+
). Ybr255wÄ cells and the corresponding homozygous disruptant grow more slowly at 15C compared to the wild-type cells. These
deletants do not show any phenotype when growing at 37C or 28C. Mutant cells for YBR266c grow more slowly than wild-type
cells at 28C. This phenotype is even more clear when the cells are incubated at 15C.
slower growth rate at 15C and 30C of the
ybr266cÄ disruptant is not, at least entirely, due to
the inactivation of YBR266c. YBR266c is overlapped with YBR267w (Feldmann et al., 1994) and
thus it is probable that the deletion of YBR266c
may affect the regulation of the adjacent ORF.
Finally, in the case of the two essential ORFs,
YBR254c and YBR257w, the corresponding
heterozygous deletants were transformed with
Copyright 1999 John Wiley & Sons, Ltd.
pYCG-YBR254c and pYCG-YBR257w. Tetrad
analysis following sporulation of these transformants showed that this time, not only kanamycinsensitive spores were growing, but also resistant
ones, and all the latter contained the pYCG plasmids, indicating that the lethality of the disruptant
haploids was complemented by the cognate genes.
The conclusion of this study is that two of
the six ORFs analysed (33%) are essential for
Yeast 15, 351–360 (1999)
360
vegetative growth, and only one (16%) shows a
conditional phenotype. These percentages closely
resemble those that have so far been published as
part of the EUROFAN project. Huang et al.
(1997) reported that of the six ORFs allocated to
them, three were essential (50%) and only one
(16%) had a conditional phenotype. Maftahi et al.
(1998) concluded that three out of the eight ORFs
they studied were essential (37·7%) and none
exhibited a conditional phenotype. These results,
together with the results available through EUROFAN, confirm the validity of the basic phenotype
analysis to uncover essential ORFs and conspicuous conditional phenotypes, and further, the
need for more specific functional analysis to be
performed by the respective nodes within the
EUROFAN network.
ACKNOWLEDGEMENTS
We would like to thank Drs Pascual Sanz and
Enrique Herrero for their helpful discussions. This
work was supported by the EUROFAN programme of the European Commission and by
grants CICyT PM96-0019 and PM97-0103 from
the Spanish Ministry of Education and Science.
Maela León was supported by a grant from the
AECI.
REFERENCES
Bussey, H. et al. (1995). The nucleotide sequence of
chromosome I from Saccharomyces cerevisiae. Proc.
Natl Acad. Sci. USA 92, 3809–3813.
Chu, S., Zengel, J. M. and Lindahl, L. (1997). A novel
protein shared by RNase MRP and RNase P. RNA 3,
382–391.
Dujon, B. (1996). The yeast genome project: what did we
learn? Trends Genet. 12, 263–270.
Feldmann, H. et al. (1994). Complete DNA sequence of
yeast chromosome II. EMBO J. 13, 5795–5809.
Gietz, R. D. and Woods, R. A. (1994). High efficiency
transformation with lithium acetate. In Johnston,
(Ed.), Molecular Genetics of Yeast, A Practical
Approach. IRL Press, Oxford, pp. 121–134.
Goebl, M. G. and Petes, T. D. (1986). Most of the yeast
genomic sequences are not essential for cell growth
and division. Cell 46, 983–992.
Goffeau, A., Barrell, B. G., Bussey, H. et al. (1996). Life
with 6000 genes. Science 274, 546–567.
Copyright 1999 John Wiley & Sons, Ltd.
.   .
Goldener, U., Heck, S., Fielder, T., Beinhauer, J. and
Hegemann, J. H. (1996). A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic
Acids Res. 24, 2519–2524.
Hoffman, C. S. and Winston, F. (1987). A ten-minute
DNA preparation from yeast efficiently releases
autonomous plasmids for transformation of E. coli.
Gene 57, 267–272.
Huang, M. E., Cadieu, E., Souciet, J. L. and Galibert, F.
(1997). Disruption of six novel yeast genes reveals
three genes essential for vegetative growth and one
required for growth at low temperature. Yeast 13,
1181–1194.
Huxley, C., Green, E. D. and Dunham, Y. (1990). Rapid
assessment of Saccharomyces cerevisiae mating type
by PCR. Trends Genet. 6, 236.
Ito, B., Fukuda, Y., Murata, M. and Kimura, A. (1983).
Transformation of intact yeast cells with alkali
cations. J. Bacteriol. 153, 163–168.
Jimenez, A. and Davies, J. (1980). Expression of transposable antibiotic resistance elements in Saccharomyces. Nature 287, 869–871.
Kaback, D. B., Oeller, P. W., de Steensma, H.,
Hirschman, J., Ruezinsky, D., Coleman, K. G. and
Pringle, J. R. (1984). Temperature sensitive lethal
mutations on yeast chromosome I appear to define
only a small number of genes. Genetics 108, 67–90.
Maftahi, M., Gaillardin, C. and Nicaud, J. M. (1998).
Generation of Saccharomyces cerevisiae deletants and
basic phenotypic analysis of eight novel genes from
left arm of chromosome XIV. Yeast 14, 271–280.
Oliver, S. G. et al. (1992). The complete DNA sequence
of yeast chromosome III. Nature 357, 38–46.
Oliver, S. G. (1996). A network approach to the systematic analysis of yeast gene function. Trends Genet. 12,
241–242.
Rothstein, R. (1991). Targeting, disruption, replacement, and allele rescue: integrative transformation in
yeast. Methods Enzymol. 194, 281–301.
Sambrook, J., Fritsch, E. and Maniatis, T. (Eds) (1989).
Molecular Cloning. A Laboratory Manual. Cold
Spring Harbor Laboratory Press, New York..
Sikorski, R. S. and Hieter, P. (1989). A system of shuttle
vectors and yeast host strains designed for efficient
manipulation of DNA in Saccharomyces cerevisiae.
Genetics 122, 19–27.
Thatcher, J. W., Shaw, J. M. and Dickinson, W. J.
(1998). Marginal fitness contributions of non-essential
genes in yeast. Proc. Natl Acad. Sci. USA 9, 253–257.
Wach, A., Brachat, A., Pöhlmann, R. and Philippsen,
P. (1994). New heterologous modules for classical
or PCR-based gene disruptions in Saccharomyces
cerevisiae. Yeast 10, 1793–1808.
Yeast 15, 351–360 (1999)
Документ
Категория
Без категории
Просмотров
2
Размер файла
382 Кб
Теги
586
1/--страниц
Пожаловаться на содержимое документа