close

Вход

Забыли?

вход по аккаунту

?

255

код для вставкиСкачать
PROTEINS: Structure, Function, and Genetics 30:381–387 (1998)
A Fusion Protein Between Serum Amyloid A
and Staphylococcal Nuclease—Synthesis,
Purification, and Structural Studies
Alan K. Meeker1 and George H. Sack, Jr.1,2*
of Biological Chemistry, The Johns Hopkins University School of Medicine, Baltimore, Maryland
2Department of Medicine, The Johns Hopkins University School of Medicine, Baltimore, Maryland
1Department
ABSTRACT
We developed a recombinant
DNA system to overexpress a fusion protein
between the small, minimally soluble acute
phase serum protein, serum amyloid A (SAA),
and the bacterial enzyme staphylococcal nuclease (SN). This fusion protein is very soluble
and is immunoreactive to polyclonal anti-SAA
antibodies. Tryptophan fluorescence shows
smooth denaturation curves for the fusion protein in guanidinium HCl or potassium thiocyanate. Fluorescence also indicates that only a
single tryptophan residue (of the four present)
is accessible to iodide quenching and, presumably, is exposed on the surface of the fusion
protein. Circular dichroism (CD) shows a significant signal indicating a-helix, which can be
attributed to the SAA portion of the molecule;
these are the first CD spectral data available
for SAA. pH titration shows persistence of
helix domains for the fusion protein at pH 3.0,
in contrast to the denaturation of SN under the
same conditions. (The entire fusion protein
shows a random coil pattern below pH 3.0.) By
exploiting the structural and solubility properties of SN, this fusion protein has provided the
first structural data about SAA—the precursor
of the amyloid deposits in secondary amyloidosis. This fusion protein should be useful for
further physical and physiologic studies of SAA.
Proteins 30:381–387, 1998. r 1998 Wiley-Liss, Inc.
Key words: serum amyloid A; fluorescence; circular dichroism; acute phase; denaturation; nuclease; amyloidosis
INTRODUCTION
Serum amyloid A (SAA) is the most prominent
protein of the acute phase response in humans and
many other animals.1 Human SAA comprises 104
amino acids and the protein has been highly conserved in mammalian evolution. Proteolytic cleavage of the native monomer yields an N-terminal
fragment of , 64 aa which forms the highly ordered,
protease-resistant polymeric fibrils of ‘‘secondary’’ or
‘‘reactive’’ amyloidosis.2,3 SAA-derived amyloid fibrils
are prototypes for understanding the biology of
r 1998 WILEY-LISS, INC.
amyloid disease, which is an important, generally
lethal complication of neoplastic, genetic, and chronic
inflammatory disorders throughout the world.
Because of the widespread pathologic involvement
of SAA proteins we isolated and characterized members of the human SAA gene family,4,5 a cluster of
similar loci on chromosome 11.6 At least one member of
this gene/protein family may function as an autocrine
stimulator of collagenase secretion.7,8 This protein has
multiple N-terminal aa differences from the precursor of
amyloid fibrils, but they are otherwise quite similar.9
Despite the important information available regarding the SAA genes, the basic problem in understanding amyloid disease is related to the structure
and biology of the proteins themselves. Thus, we
sought to investigate the structure of SAA proteins
in order to develop models for them and the fibrils to
which they contribute.
Unfortunately, the low solubility of SAA (in most
reports a maximum of about 50 µg/ml) has prevented
detailed structural studies in the past. Visual inspection of the SAA aa sequence does not indicate why it
should be so insoluble, especially since 40% of its
residues are charged. Because of this, we hypothesized that much of the insolubility may be related to
the folded structure of SAA monomers. Isolating
SAA from serum is complicated by its low concentration and limited solubility. Thus, we sought to use
recombinant systems to produce SAA proteins suitable for structural and physiologic studies.
Producing native SAA monomers is complicated by
their apparent toxicity in bacterial systems (unpublished observations) and their intrinsic insolubility,
even if such systems were successful. Thus, we
studied fusions between staphylococcal nuclease
(SN)—an extremely soluble and well-characterized
bacterial enzyme10,11—and SAA. We showed earlier
Abbreviations: SAA: serum amyloid A; SN: staphylococcal
nuclease; CD: circular dichroism; Gdn-HCl: guanidinium chloride; KSCN: potassium thiocyanate; PCR: polymerase chain
reaction; PIPES: piperazine-N,N’-bis(2-ethanesulfonic acid);
IPTG: isopropyl β-D-thiogalactoside.
*Correspondence to: George H. Sack, Jr., Blalock 1008, The
Johns Hopkins Hospital, Baltimore, MD 21287.
Received 1 July 1997; Accepted 2 September 1997
382
A.K. MEEKER AND G.H. SACK, JR.
that a fusion protein between a truncated form of SN
and SAA was recognized by anti-SAA antibodies but
still had limited solubility.12 Thus, we investigated
the properties of a fusion protein combining fulllength SN and SAA that displays excellent solubility.
We present spectral data indicating that this very
soluble fusion protein has significant, stable structure making it an appropriate reagent for subsequent analysis.
METHODS
Preparation of Recombinant
Expression Vector
Plasmid pGS112 (containing the complete cDNA
sequence for human SAA1 and derived from pA113)
was linearized by BamH1 digestion and pFOG506
(containing the complete SN coding region14) was
linearized by AlwN1 digestion (Fig. 1A). 25 ng of
each linearized DNA was mixed with 1.3 µg primer 1
(5’ GCAACTAGTACTAAAAAATTACATAAAGAACCT 3’), 1.3 µg primer 2 (5’ CGGAGGATCCTTAGTATTTCTCAGACAGGCC 3’), 5 ng primer 3 (5’
TGGAGCGAAGACAACCGAAGCTTCTTTTCGTTCCTTGGC 3’), and 5 ng primer 4 (5’ GCCAAGGAACGAAAAGAAGCTTCGGTTGTCTTCGCTCCA 3’) in
10 mM KCl, 20 mM Tris-HCl, pH 8.8, 10 mM (NH4)2SO4,
2 mM MgSO4, 0.1% Triton X-100, 0.2 mM deoxynucleoside triphosphates, and 0.5 µl VenttPolymerase (New
England Biolabs, Beverly, MA) in 100 µl. The mix was
overlaid with oil and run for 30 cycles of (1 min @ 95°, 1
min @ 55°, 1 min @ 72°). Following the polymerase chain
reaction (PCR), 8 U of Klenow DNA polymerase was
added and incubation continued for 20 min at 37°.
The reaction then was precipitated in ethanol and
the product was resuspended at 50 ng/µl in 2.5 mM
Tris, pH 8.0, 0.25 mM EDTA. The fragment was
digested with BamH1 and SpeI and ligated into the
pET12A vector (Novagen, Madison, WI) with matching ends. The product was used to transform Mg-T7
Escherichia coli; ampicillin-resistant colonies were
selected. Ampicillin-resistant colonies were screened
for expression of a protein of appropriate size (visualized by Coomassie-staining of SDS-PAGE gels) following induction by isopropyl β-D-thiogalactoside
(IPTG).
Induction and Purification of Fusion Protein
The culture was inoculated from a single transformed colony and grown for 16 hr at 31°C in
medium containing 10 gm tryptone, 5 gm yeast
extract, 5 gm NaCl, and 200 mg ampicillin per liter;
1.5 ml was then used to inoculate 200 ml cultures of
the same medium. Cultures were grown 4 hr at 36°C,
IPTG was then added to 1.0 mM and growth continued for 2.5 hr. Cells were harvested by centrifugation
at 3.5 K rpm, resuspended in 1/10th volume 6M
urea, 25 mM Tris-HCl, pH 8.1, 5 mM EDTA at 4°C
and placed on ice for 20 min. The suspension was
centrifuged at 8K rpm for 15 min in a GSA rotor and
Fig. 1. (A) Protocol for assembling DNA construct used to
produce the fusion protein. Numbered oligonucleotides correspond to sequences in Methods. Complete pET 12A vector not
shown. (B) (Left) SDS-polyacrylamide gel electrophoresis of
purified fusion protein stained with Coomassie blue. Left lane 5
nuclease, right lane 5 fusion protein. (Right) Reactivity of a
Western blot of the same electrophoresis gel with polyclonal
anti-SAA antibodies. (C) Sequence of the fusion protein (253
amino acids). Underlined amino acids correspond to SN; those in
bold represent SAA.
the supernatant was diluted 1:8 in the original
buffer, applied to a fast flow sulfonyl Sepharoset
(Pharmacia, Piscataway, NJ) column and washed
with 5 bed volumes of 6 M urea, 2.5 mM EDTA, 20
mM glycine, pH 9.5. The fusion protein was eluted
with the same buffer containing an additional 100
383
SAA/NUCLEASE FUSION PROTEIN
mM NaCl. The eluate was dialyzed against 5 mM
NaCl, 5 mM PIPES, pH 6.5 at 4°C and a fine
precipitate formed which was discarded; the remaining soluble protein was concentrated for further
study.
Electrophoresis and Antigenicity
The protein migrated as a single band of the
predicted molecular weight using Coomassie staining on 15% SDS-polyacrylamide gel electrophoresis
and appeared .95% pure (Fig. 1B). It reacted with
commercial polyclonal anti-SAA antibodies (Calbiochem, La Jolla, CA, #566705) on Western blots; no
reaction with native SN was observed in control
lanes.
Spectroscopic Studies
For denaturation studies, fluorescence was recorded on a SPEX Fluorolog II (SPEX Industries,
Edison, NJ) at 20°C. The 2 ml cuvette contained
protein at 50 µg/ml in 0.1 M NaCl, 25 mM NaPO4, pH
7.0. 6 M guanidinium HCl (Gdn-HCl) in the same
buffer was titrated into the mix with excitation at
295 nm and emission monitored at 325 nm.15 Stability (DG) of the fusion protein was calculated from
fluorescence denaturation curves as previously described.15 Fluorescence quenching was measured at
20°C on a Perkin-Elmer LS50B Luminescence spectrometer in a 1 ml cuvette containing 20 µg/ml
protein in the same buffer. 5 M NaI in the same
buffer was titrated into the mix with excitation at
295 nm. Emission was monitored from 310 to 420 nm
and calculations were based on peak heights measured above the background. Studies were performed in triplicate. Circular dichroism (CD) spectra
were collected on an Aviv CD-60 spectropolarimeter.
Standard spectra were obtained using 0.5 mg/ml
protein in 5 mM Tris-HCl, 5 mM NaCl, pH 8.0, with a
Suprasil quartz cuvette with 0.2 mm path length at
19.6°C. pH studies used 5 mM NaPO4, 5mM NaCl.
Below pH 4.0, 5 mM glycine, 5 mM NaCl was used
with a protein concentration of 0.8 mg/ml. Spectra
represent the average of 5 scans made at 0.5 nm
intervals with 1 sec signal integration time and 1.5
nm bandwidth. They were corrected relative to a
background scan (buffer alone) and smoothed using
a third-order polynomial with 62-point averaging
algorithm. Concentrations were determined for each
sample by measuring absorbance at 280 nm and
using extinction coefficients of 0.93 for SN16 and 1.14
for the fusion protein (calculated on the basis of the
sequence shown in Fig. 1C); these values were used
to calculate protein concentrations used to calculate
mean residue weight ellipticity. Estimates of helix
content were made using the deconvolution program
PROSEC17. For measurements of ellipticity at 220
nm as a function of Gdn-HCl concentration, a 1 cm X
1 cm pathlength suprasil quartz cuvette with a small
magnetic stir bar in the bottom was used.
RESULTS
Figure 1B shows the single stained band on SDSpolyacrylamide gel electrophoresis of the purified
fusion protein following chromatography and dialysis. This band reacts strongly and uniquely with
anti-SAA antibodies on Western blots (Fig. 1B). The
primary aa sequence of the fusion protein is shown
in Figure 1C. The calculated molecular weight is
32,899 daltons. This fusion protein exhibits high (a
minimum of 10 mg/ml), prolonged solubility at 4°C for at
least 8 months in several buffers of low ionic strength.
We investigated structural aspects of the fusion
protein using fluorescence and CD spectroscopy.
Figure 2A shows individual fluorescence spectra for
the fusion protein and SN as well as the difference
spectrum. The SN spectrum primarily originates
from a single Trp residue buried within the hydrophobic core of the protein. By contrast, the fusion
contains three additional Trps and therefore has
greater fluorescence intensity. Note also the significant shift of the fusion and the difference spectra to
longer wavelengths (red shift), indicating possible
exposure of one or more Trps in the fusion protein to
the solvent.
In order to investigate the extent of solvent exposure for Trp residues, the effect of NaI quenching on
fluorescence intensity was measured. Figure 2B
shows reduced fluorescence intensity with increasing NaI concentration, with no further changes
beyond 0.2 M NaI. Figure 2C shows a modified
Stern-Volmer plot18 for these data, indicating that a
single Trp fluorophore is susceptible to iodide quenching under these nondenaturing conditions and, therefore, is likely to be on the surface of the parent
protein. A blue shift of the fluorescence peak occurs
during the titration from 343 nm (top curve, no NaI)
to 339 nm (bottom curve, 200 mM NaI), supporting
the notion that the Trp being quenched is associated
with SAA.
Figure 3A presents the denaturation profiles of the
fusion protein and SN by monitoring Trp fluorescence as a function of Gdn-HCl concentration. The
fusion protein shows a single transition (midpoint 5
0.72 M Gdn-HCl) which is less steep than that of SN
(midpoint 5 0.82 M Gdn-HCl). The calculated free
energy values indicate that the fusion protein is 2
kcal/mole less stable (5.6 kcal/mole vs. 3.6 kcal/mole)
than that of the wild-type SN. The residual Trp
fluorescence of the fusion protein persisted through
3.4 M Gdn-HCl (data not shown). Similar measurements were made using potassium thiocyanate
(KSCN) as the denaturant (Fig. 3B). All denaturation profiles were fully reversible. Under both sets
of conditions, the residual fluorescence levels were
consistent with the total number of Trp residues, all
in a fully denatured environment.
Denaturation also was assessed by CD based on
the prominent signal at 220 nm for the fusion
384
A.K. MEEKER AND G.H. SACK, JR.
Fig. 3. (A) Fluorescence measurement during Gdn-HCl denaturation of fusion protein (open squares), and SN alone (closed
squares). Note single transition for fusion protein. (B) Fluorescence measurement during KSCN denaturation of fusion protein
(open squares) and SN alone (closed squares). The fusion protein
also shows a single transition in this system. (C) CD denaturation
measurements at u5220 nm during Gdn-HCl addition. Three sets
of symbols correspond to three repeats of the same experiment
and are superposable.
Fig. 2. (A) Fluorescence spectra of fusion protein (a), SN (b),
and the difference between them (c 5 a-b). (B) Quenching of
fluorescence in fusion protein by NaI. NaI concentrations (top to
bottom) are: 0, 20, 50, 70, 120, 200 mM. There is minimal
fluorescence change at concentrations above 200 mM. (C) Modified Stern-Volmer plot based on peak height data from Figure 2B.
The intercept corresponds to having one exposed Trp residue on
the fusion protein.
protein, presumably representing a-helical domains
(see below). As shown in Figure 3C, mean specific
ellipticity/residue showed a single transition during
Gdn-HCl titration with a midpoint similar to that
seen in Figure 3A. Thus, two complementary techniques—Trp fluorescence and molar ellipticity at 220
nm—show a single transition during denaturation
at the same level of Gdn-HCl. There is no evidence
for any persistent structure to the fusion protein
under these denaturing conditions.
CD spectra were obtained for both the fusion and
SN. Figure 4A shows the CD spectra at pH 8.0. The
difference spectrum (Fig. 4B) is compatible with
a-helical domains in the SAA portion of the molecule.
However, shallow negative signals at 208 and 222
nm are seen in the difference spectrum, possibly
reflecting cancellations due to increases in aromatic
components in the far UV region.19 The helix content
of the difference spectrum at pH 8.0 was estimated at
33% (PROSEC).
CD spectra also were obtained for both SN and the
fusion protein at different pH values. The spectra for
both proteins show relatively few changes from pH 8
through pH 4. Figure 4C shows the spectra for pH
SAA/NUCLEASE FUSION PROTEIN
385
Fig. 4. (A) CD spectra for fusion protein and SN at pH 8.0
showing values at consecutive nm wavelengths. Closed squares 5
fusion protein; open squares 5 SN. (B) Difference CD spectrum at
pH 8.0. (C) CD spectra for fusion protein and SN at pH 3.0. Note
prominent changes in SN spectrum. Closed squares 5 fusion
protein; open squares 5 SN. (D) Difference CD spectrum at pH
3.0. Note similarities to curve in 3B and considerable differences
from SN, which is denatured under these conditions.
3.0. The SN spectrum displays a ‘‘random coil’’
pattern resulting from the loss of secondary structure following denaturation,20 but the fusion protein
spectrum shows persistent structure, compatible
with significant a-helical content.
Figure 4D shows the difference spectrum (fusion 2
SN) at pH 3.0. Comparing the difference-derived
SAA spectra at pH 8.0 and pH 3.0 shows shifting of
the maximum and minima to shorter wavelengths at
lower pH. The positive peak is shifted to a slightly
longer wavelength in the acidic environment. The
helix content at pH 3.0 was estimated at 44%. Below
pH 3.0 there was little evidence for any structure of
the SAA portion of the molecule and the SN remained denatured (data not shown).
Trp in SN. Equilibrium denaturation experiments
using either Gdn-HCl or KSCN show that Trp residues in the fusion protein undergo significant quenching with a single inflection compatible with global
denaturation of the protein with increasing denaturant concentrations in both environments. This conclusion is supported by monitoring Gdn-HCl denaturation behavior with CD measurements.
The shape of the difference CD spectrum at pH 8.0,
including a prominent positive peak at 191 nm,
suggests helical domains in the SAA region of the
fusion protein. A similar peak persists in the difference spectrum obtained at pH 3.0 (see Fig. 4). SN
exhibits near random coil CD spectra at pH #3.0 due
to extensive denaturation20 supporting, but not proving, the notion that the residual secondary structure
resides within SAA domain(s). The helix content of
the fusion protein has been estimated at 33–44% for
these conditions based on PROSEC deconvolutions
but falls quickly below pH 3.0.
These observations are important for several reasons. First, few structural data have been available
for SAA because of its poor solubility. Second, the
antigenic reactivity of the fusion protein with polyclonal anti-SAA antibodies indicates that at least
some SAA epitopes are intact in the fusion protein.
Third, the earlier proposal of Turnell et al.,21 used
predictive algorithms to suggest that SAA likely
contained two a-helices; this is compatible with our
DISCUSSION
We purified and characterized a soluble recombinant derivative of the human acute phase protein
SAA expressed in E. coli. Our protein combines the
full lengths of both SN and SAA, can be readily
overproduced and purified, and is stably soluble to at
least 10 mg/ml. It retains SAA-antigenicity as measured with polyclonal anti-SAA antiserum.
Structural information was obtained by spectroscopic techniques. The fusion protein has four Trp
residues, three derived from SAA. Quenching of the
fluorescence with iodide indicates that at least one
Trp is exposed to solvent, unlike the single, buried
386
A.K. MEEKER AND G.H. SACK, JR.
CD data consistent with increased helical content for
the fusion protein. Fourth, the evidence for helical
domains in the SAA monomer contrasts with earlier
proposals that SAA-derived amyloid fibrils are largely
comprised of β-sheets.22 However, it is also possible
that important structural transition(s) of the monomers may accompany their polymerization into
fibrils.
The CD spectra indicating substantial a-helical
content in SAA through pH 3.0 are consistent with
the existence of relatively stable and, possibly, independent structure for the region of this fusion protein derived from SAA. The persistence of SAA
structure at pH 3.0 strengthens this notion because
it is in contrast to the known denaturation of SN at
low pH, which we also have reproduced in these data
(Fig. 4). By contrast, fluorescence studies show
smooth denaturation curves in response to increasing concentrations of either Gdn-HCl or KSCN with
single inflection points, indicating that the relative
independence of SN and SAA domains as suggested
by the CD data at lower pH values is not maintained
for all denaturants. Nevertheless, our data show
that we have achieved our goal of maintaining
SAA-specific epitopes in the fusion protein as measured by antigenicity.
Our fusion protein was designed intentionally to
minimize the distance between the SN and SAA
domains in order to improve its likelihood of forming
crystals in future studies. We did not plan to be able
to separate the SN and SAA domains because this
would regenerate insoluble SAA monomers that
would have the recognized insolubility problems. We
thus presume that the SAA component of the fusion
protein has a structure similar to that of SAA alone,
although the only direct evidence of this is the
reactivity of the fusion molecule with polyclonal
anti-SAA antibodies (Fig. 1B). The fusion protein
also reacts with selected anti-SAA epitope-specific
monoclonal antibodies (preliminary observations).
The impressive solubility (a minimum of 10 mg/
ml) and ease of preparation of this fusion protein
make it an ideal reagent for further structural and
physiologic studies, most of which have been prevented by past problems of limited availability and
poor solubility of SAA. Further structural studies
should permit testing of the SAA monomer model
proposed by Turnell et al.21,23 They also will improve
interpretation of data about SAA fibril structure
because polymerization of SAA into fibrils requires
removing the C-terminal third of the protein. Understanding fibril formation is basic to the design of
rational pharmacologic intervention for secondary
(i.e., SAA-derived) amyloid disease and also will be
essential in clarifying the role of other amyloid fibrils
in conditions, including Alzheimer’s disease and
diabetes, where fibrils are also prominent.24,25 Amyloid fibrils form by the aggregation of monomers in
an apparently unassisted fashion, as shown by the
early observation that dissociated monomers can
reform fibrils in solution.22 Clearly, the structures of
the monomer precursors are the basic determinants
of this reaction. The studies reported here establish
this fusion protein as an important reagent for
investigating the basis of reactive amyloid fibril
formation.
SAA has amphipathic character26 and is generally
isolated from the high-density lipoprotein fraction of
serum. It has been proposed that SAA is an authentic apolipoprotein27,28 but this has not been established unequivocally. More recently, SAA mRNA
expression has been found in atherosclerotic vascular lesions.29 Whatever its actual function in serum
is, however, the lipophilicity of SAA has been established. Our fusion protein presents an opportunity to
obtain structural information about such a lipophilic
molecule in a novel and rigorous manner.
Our observations with this derivative of SAA show
that fusing a small, relatively insoluble protein to
SN is a useful approach to obtaining important
structural data about a protein which is otherwise
difficult to study. This general approach should be
useful in analyzing other small proteins which have
hitherto resisted detailed analysis because of insolubility, instability, or scarcity. SN has ideal features as
a fusion partner for protein structure studies because of its small size, remarkable solubility, ease of
crystallization, complete crystal structure availability, and extensive study for its folding properties.10,11,30–32 The effects of deletions and mutations
on SN also have been studied in detail.33–36 Multiple
genetic constructs with excellent expression levels
are available for SN and recombinant DNA methods
can rapidly modify the basic SN sequence and/or the
structure of the appended protein, permitting a
remarkable range of study possibilities. In addition
to its useful physical features, the enzymatic function of SN also has been useful in fusion proteins. For
example, a fusion protein between SN and a retroviral Gag protein reduced infectious viral titers 20- to
60-fold.37,38 Thus, this small bacterial enzyme has
been useful in different types of recombinant systems.
This fusion protein should be the basis for further
study of the structure of the SAA monomer. Such
information is essential for understanding amyloid
fibril formation. Recent studies have shown the
growth of microcrystals of our fusion protein in the
presence of polyethylene glycol, indicating that this
recombinant may provide the substrate for crystal
studies of SAA.
ACKNOWLEDGMENTS
We are particularly grateful to Dr. David Shortle
for continuous advice and discussion, to Dr. Joel
Gillespie for assistance with CD measurements and
thoughtful comments, to Dr. Peter Pedersen for the
use of his spectrometer, to Dr. Wesley Stites for
SAA/NUCLEASE FUSION PROTEIN
corroborative fluorescence measurements, to Ronald
Yap for help with protein purification, to Tina Saxowsky for denaturation CD measurements, and to
Mrs. Mary A. Mix for secretarial assistance. Plasmid
pA1 was the kind gift of Dr. Jean Sipe. The work was
supported by generous gifts from Mr. and Mrs.
William M. Griffin and Mr. Daniel M. Kelly.
REFERENCES
1. Kushner, I. The phenomenon of the acute phase response.
Ann. N.Y. Acad. Sci. 111:39–48, 1982.
2. Benditt, E.P., Eriksen, M., Hermodsen, M.A., Ericsson,
L.H. The major proteins of human and monkey smyloid
substance: Common properties including unusual
N-terminal amino acid sequences. FEBS Lett. 19:169–173,
1981.
3. Parmelee, D.C., Titani, K., Ericsson, L.H., Eriksen, N.,
Benditt, E.P., Walsh, K.A. Amino acid sequence of amyloidrelated apoprotein (apoSAA1) form human high-density
lipoprotein. Biochemistry 21:3298–3303, 1982.
4. Sack, G.H. Jr. Molecular cloning of human genes for serum
amyloid A. Gene 21:19–24, 1983.
5. Sack, G.H. Jr., Talbot, C.C. Jr. The human serum amyloid A
gene SAA4 is a pseudogene. Biochem. Biophys. Res. Commun. 183:362–366, 1992.
6. Sack, G.H. Jr., Talbot, C.C. Jr, Seuanez, H., O’Brien, S.J.
Molecular analysis of the human serum amyloid A (SAA)
gene family. Scand. J. Immunol. 29:113–119, 1989.
7. Brinckerhoff, C.E., Mitchell, T.I., Karmilowicz, M.J., KluveBeckerman, B., Benson, M.D. Autocrine induction of collagenase by serum amyloid A-like and β2-microglobulin-like
proteins. Science 243:655–657, 1989.
8. Sack, G.H. Jr., Zink, M.C. Serum amyloid A (SAA) gene
expression in synovial cells in retroviral arthritis. Am. J.
Pathol. 141:525–529, 1992.
9. Sack, G.H. Jr., Talbot, C.C. Jr. The human serum amyloid A
(SAA)-encoding gene GSAA1: Nucleotide sequence and
possible autocrine-collagenase-inducer function. 84:509–
515, 1989.
10. Tucker, P.W., Hazen, E.E. Jr., Cotton, F.A. Staphylococcal
nuclease reviewed: A prototypic study in contemporary
enzymology. I. Isolation, physical and enzymatic properties. Mol. Cell. Biochem. 22:66–77, 1978.
11. Loll, P.J., Lattman, E.E. The crystal structure of the
ternary complex of staphylococcal nuclease, Ca21, and the
inhibitor pdTp, refined at 1.65 angstroms. Proteins 5:183–
201, 1989.
12. Sack, G.H. Jr., Aquilina, P., Shortle, D., Meeker, A. A
recombinant system for serum amyloid A (SAA) gene and
protein expression. In: ‘‘Amyloid and Amyloidosis.’’ Kisilevsky, R. et al. (eds.). New York: Parthenon Press, 1994:
146–148.
13. Sipe, J.D., Colten, H.R., Goldberger, G., Edge, M.D., Tack,
B.F., Cohen, A.S., Whitehead, A.S. Human serum amyloid
A (SAA): Biosynthesis and postsynthetic processing of
preSAA and structural variants defined by complementary
DNA. Biochemistry 24:2931–2936, 1985.
14. Shortle, D. A genetic system for analysis of staphylococcal
nuclease. Gene 22:181–189, 1983.
15. Shortle, D. Guanidine hydrochloride denaturation studies
of mutant forms of staphylococcal nuclease. J. Cell. Biochem. 30:281–289, 1986.
16. Fuchs, S., Cuatrecasas, P., Anfinsen, C.B. An improved
method for the purification of staphylococcal nuclease J.
Biol. Chem. 242:4768–4770, 1967.
17. Chang, C.T., Wu, C.-S.C., Yang, Y.T. Circular dichroism
analysis of protein conformation: Inclusion of the β turns.
Anal. Biochem. 91:13–31, 1978.
387
18. Lakowicz, J.R. ‘‘Principles of Fluorescence Spectroscopy’’
New York: Plenum Press, 1983:260–273.
19. Johnson, W.C. Jr. Secondary structure of proteins through
circular dichroism spectroscopy. Ann. Rev. Biophys. Biophys. Chem. 17:145–166, 1988.
20. Schechter, A.N., Chen, R.F., Anfinsen, C.B. Kinetics of
folding of staphylococcal nuclease. Science 167:886–887,
1970.
21. Turnell, W., Sarra, R., Glover, I.D., Baum, J.O., Caspi, D.,
Baltz, M.L., Pepys, M.B. Secondary structure prediction of
human SAA1: Presumptive identification of calcium and
lipid binding sites. Mol. Biol. Med. 3:387–407, 1986.
22. Glenner, G.G., Ein, D., Eanes, E.D., Bladen, H.A., Terry, W.
Page, D. Creation of ‘‘amyloid’’ fibrils from Bence Jones
proteins in vitro. Science 174:712–714, 1971.
23. Turnell, W., Sarra, R., Baum, J.O., Caspi, D., Baltz, M.L.,
Pepys, M.B. X-ray scattering and diffraction by wet gels of
AA amyloid proteins. Mol. Biol. Med. 3:409–424, 1986.
24. Selkoe, D. Aging, amyloid, and Alzheimer’s disease. New
Engl. J. Med. 320:1484–1487, 1989.
25. Lorenzo, A., Razzaboni, B., Weir, G.C., Yanker, B.A. Pancreatic islet cell toxicity of amylin associated with type 2
diabetes mellitus. Nature 368:756–760, 1994.
26. Segrist, J.P., Pownall, H.J., Jackson, R.L., Glenner, G.G.,
Pollock, P.S. Amyloid A: Amphipathic helices and lipid
binding. Biochemistry 15:3187–3191, 1976.
27. Skogen, B., Borresen, A.L., Natvig, J.B., Berg, K., Michaelsen, T.E. High-density lipoprotein as a carrier for
amyloid-related protein SAA in rabbit serum. Scand. J.
Immunol. 10:39–45, 1979.
28. Benditt, E.P., Eriksen, N., Hansen, R.H. Amyloid protein
SAA is an apoprotein of mouse plasma high density
lipoprotein. Proc. Natl. Acad. Sci. USA 76:4092–4096,
1979.
29. Meek, R.L., Urieli-Shoval, S., Benditt, E.P. Expression of
apolipoprotein serum amyloid A mRNA in human atherosclerotic lesions and cultured vascular cells: Implications
for serum amyloid A function. Proc. Natl. Acad. Sci. USA
91:3186–3190, 1994.
30. Tucker, P.W., Hazen, E.E. Jr., Cotton, F.A. Staphylococcal
nuclease reviewed. II. Solution studies of the nucleotide
binding site and the effects of nucleotide binding. Mol. Cell.
Biochem. 23:3–16, 1979.
31. Tucker, P.W., Hazen, E.E. Jr., Cotton, F.A. Staphylococcal
nuclease reviewed. III. Correlation of the three-dimensional structure with the mechanisms of enzyme action.
Mol. Cell. Biochem. 23:67–86, 1979.
32. Tucker, P.W., Hazen, E.E. Jr., Cotton, F.A. Staphylococcal
nuclease reviewed. IV. The nuclease as a model for protein
folding. Mol. Cell. Biochem. 23:131–142, 1979.
33. Shortle, D., Meeker, A.K. Mutant forms of staphylococcal
nuclease with altered patterns of guanidine hydrochloride
and urea denaturation. Proteins 1:81–89, 1986.
34. Shortle, D., Meeker, A.K. Residual structure in large
fragments of staphylococcal nuclease: Effects of amino acid
substitutions. Biochemistry 28:936–944, 1989.
35. Shortle, D., Stites, W.E., Meeker, A.K. Contributions of the
large hydrophobic amino acids to the stability of staphylococcal nuclease. Biochemistry 29:8033–8041, 1990.
36. Green, S.M., Meeker, A.K., Shortle, D. Contributions of the
polar, uncharged amino acids to stability of staphyloccal
nuclease: Evidence for mutational effects on the free energy of the denatured state. Biochemistry 31:5717–5728,
1992.
37. Natsoulis, G., Boeke, J.D. New antiviral strategy using
capsid-nuclease fusion proteins. Nature 352:632–635, 1991.
38. Schumann, G., Qin, L., Rein, A., Natsoulis, G., Boeke, J.D.
Therapeutic effect of Gag-nuclease transport on retrovirusinfected cell cultures. J. Virol. 70:4329–4337, 1996.
Документ
Категория
Без категории
Просмотров
2
Размер файла
122 Кб
Теги
255
1/--страниц
Пожаловаться на содержимое документа