close

Вход

Забыли?

вход по аккаунту

?

456

код для вставкиСкачать
972
Cranial Desmoid Tumor Associated with Homozygous
Inactivation of the Adenomatous Polyposis Coli Gene
in a 2-Year-Old Girl with Familial Adenomatous
Poly posis
Deepthi C. de Silva, M.R.c.P.(uK)’
Morag F. Wright, B.SC?
David A. J. Stevenson, B.SC.’
Caroline Clark, MSC.’
Elizabeth s. Gray, M.R.C.Path.3
John D. Holmes, M.Chir., F.R.c.s.~
John c. s. Dean, F.R.C.P.(Edin)’
Neva E. Haites, Ph.D.’
Malcolm G. Dunlop, M.D?
’
Department of Medical Genetics, Medical
School, Foresterhill Aberdeen, Scotland.
MRC Human Genetics Unit, Western General
Hospital, Edinburgh, Scotland.
Department of Pathology, Medical School,
Foresterhill, Aberdeen, Scotland.
Department of Plastic Surgery, Royal Aberdeen Children’s Hospital, Aberdeen, Scotland.
BACKGROUND. Familial adenomatous polyposis (FAP) is a dominantly inherited
disorder characterized by the presence of more than 100 adenomatous polyps in
the colon and rectum starting in the second decade of life. FAP is associated with
extra colonic manifestations, including desmoid tumors.
METHODS. A 2-year-old girl presented with a rapidly enlarging tumor of the forehead and a family history of FAP. The tumor was cultured for cytogenetic studies.
A DNA linkage study using flanking and intragenic polymorphisms of the adenomatous polyposis coli (APC) gene was performed to identify allele loss in the tumor.
Germline mutation identification was by single strand conformation polymorphism analysis of exon 15 of the APC gene, with subsequent double stranded
sequencing of fragments with conformational changes. A mutation-induced loss
of a restriction site was used to confirm allele loss in the tumor.
RESULTS. Microscopically, the tumor had desmoid features. Cytogenetic analysis
of the tumor demonstrated loss of chromosome region 5(q21q22). A truncating
adenomatous polyposis coli (APC) gene mutation was identified in the leukocyte
DNA from the child and her affected father. Linked DNA markers suggested that
the tumor had lost the maternal, wild-type allele, A mutation-induced restriction
endonuclease site alteration demonstrated hemizygosity of the mutant sequence
in the tumor DNA.
CONCLUSIONS. These findings are compatible with the presence of a “second hit”
inactivation of the APC gene and implicate this gene in the pathogenesis of desmoid
tumors. Cancer 1996; 77:972-6. 0 1996 American Cancer Society.
KEYWORDS: desmoid tumor, familial adenomatous polyposis (FAP), chromosome
deletion, adenomatous polyposis coli gene (APC gene).
D. de Silva was funded by an ACTR Research
Fellowship from the Aberdeen Royal Hospitals
NHS Trust. APC mutation analysis and allele
dosage studies were funded by Scottish Home
and Health Department (SHHD) grant KIMRSI
50/C1837 to M.G. Dunlop.
Address for reprints: Deepthi C. de Silva, Department of Medical Genetics, Medical School,
Polwarth Building, Foresterhill, Aberdeen, AB9
220 Scotland.
Received August 8, 1995; revision received November 6, 1995; accepted November 6, 1995.
0 1996 American Cancer Society
F
amilial adenomatous polyposis (FAP) is a dominantly inherited disorder
characterized by the presence of over 100 adenomatous polyps in the
rectum and colon developing from the second decade of life, which, if untreated, progress to carcinoma. Extracolonic manifestations include duodenal adenomatous polyps, epidermal and sebaceous cysts, fibromata, osteomata, and desmoid tumors. Congenital hypertrophy of the retinal pigment
epithelium (CHRPE) is present in a characteristic distribution in a high proportion of affected individuals and is a useful indicator of the family members who have inherited the predisposing gene. The association between
adenomatous polyps in the colon and other ectodermal and mesodermal
tumors has been eponymously termed Gardner syndrome. The incidence
of desmoid tumors in FAP is approximately lo%.’ The identification of the
FAP gene locus on chromosome 5q222,3and the subsequent cloningz5of
APC Gene Inactivation in a Cranial Desmoid TumorlDeSilva et al.
973
forehead lesion, the proband presented with a history of
recurrent left limb paralysis lasting about 4 hours. There
were no symptoms preceding the episode and five further
episodes, occurring approximately fortnightly, were reported. On examination, the arm was flaccid, with weak
biceps and absent triceps and supinator reflexes. Routine
investigations, including full blood count, biochemistry,
coagulation, immunoglobulins, and autoantibody and virology screens were all normal. X-ray examination of the
skull and cervical spine revealed no abnormalities. Magnetic resonance imaging similarly revealed no evidence
of a desmoid affecting the brain, thorax, or brachial
plexus. Her recent symptoms remain unexplained, although a recurrence of the desmoid remains a possibility,
despite the normal scans.
Her father, who has FAP and had undergone regular
colonoscopic screening, was initially noted to have polyps
in the distal colon at age 26 years. He had a colectomy
and ileorectal anastomosis performed when he was 28
years old. He has CHRPE but has not developed desmoid
tumors. Gastric fundal polyps have been noted in the
father, but his duodenum and periampullary region are
normal. He also suffers from insulin-dependent diabetes.
The proband’s paternal grandmother had died at the age
of 29 years from a rectal carcinoma associated with multiple colonic polyps. There is no record of this woman
having extracolonic tumors or abnormal fundoscopic
findings.
FIGURE 1. Proband, age 2 years. Desmoid tumor of left forehead.
this gene (termed APC) have confirmed that these two conditions a.re allelic and that identical APC gene germline mutations can result in FAP or Gardner syndrome.
CASE REPORT
The proband was born at term following an uncomplicated pregnancy and a vaginal delivery. She has reached
normal developmental milestones and was a healthy
child prior to the present illness. When she was 2 years
and 1 month old, her parents reported a rapidly enlarging
mass on1 the left side of her forehead. At the surgical clinic
10 weeks later, it measured 7 cm x 6 cm x 2.5 cm (Fig.
1).The inass was nontender and nonpulsatile, had a firm
texture, and was fixed to the deeper tissue. Results of her
general examination were otherwise normal. Fundoscopy
confirmed the presence of congenital hypertrophy of the
retinal pigment epithelium (CHRPE). No rectal polyps
were noted on sigmoidoscopy. Jaw X-rays were not performed.
The tumor was resected with excellent cosmetic results, and 18 months following surgery no recurrence has
been noted. One year after the initial resection of the
MATERIALS AND METHODS
The cytogenetic study was performed by culturing the
resected cranial tumor using standard tissue culture techniques, and G banding of chromosomes was performed
before analysis. DNA was purified to standard protocols
from blood leukocytes and fresh tumor. The DNA linkage
study was performed using the flanking, polymorphic microsatellite markers DP1,6YN 5.64,7and intragenic polymorphisms at nucleotide 1458 (exon 11)8and 5037 (exon
15)*and 37A/B (3’ untranslated region). Initial APC mutation screening was by single stranded conformation
polymorphism (SSCP) analysis of leukocyte DNA from
the affected father of the proband. SSCP screening was
confined to exon 15, fragments A to M, by polymerase
chain reaction (PCR) amplification using primer sequences described by Groden et aL5 PCR products were
heat denatured and run on 6% polyacrylamide gels with
5% or 10% glycerol at room temperature under nondenaturing condition^.""^'^ Gels were dried and autoradiography was performed for 6-24 hours. PCR fragments showing any evidence of conformational changes were then
reamplified by PCR from leukocyte DNA, electrophoresed
on ultrapure low-melting-point agarose, and lightly
ethidium stained. Each PCR fragment was cut from the
gel with a fresh scalpel and gene cleaned (Stratech Scien-
974
CANCER March 1,1996 / Volume 77 / Number 5
FIGURE 3. Partial karyotype of tumor demonstrating interstitial deletion
of chromosome 5jq21q22).
FIGURE 2. Desmoid tumor of the scalp. Sweeping bundles of slender,
elongated cells in a rather mucoid matrix (H and E; x120).
tific). Gel purification was then subjected to double
stranded sequencing as previously described.","
DESMOID TUMOR ALLELE DOSAGE ANALYSIS
After identification of the causative germline mutation, a
search was made for a suitable mutation-induced restriction site alteration. The mutation was found to generate
an Msel site. However, the Msel site in the wild-type
sequence being in close proximity to the mutation site
confounded the use of this alteration. Hence, a primer
was made that removed this wild-type sequence Msel
site by base substitution in the primer sequence itself.
The new forward primer (GTTCTAATCATGGAATCTAATCA) was paired with primer E-reverse.5 PCR amplification with primer pair ElMse/E-reverse produced a 165
bp fragment with no Msel site for the wild-type sequence,
but the mutation-induced Msel site generated 138 bp
and 27 bp fragments after digestion. PCR amplification
was then performed using desmoid and leukocyte DNA
from the proband, leukocyte DNA from her affected father, and control DNA from a healthy individual, each
incorporating 0.25 p.Ci of 3'P-CTP. The radiolabelled PCR
fragments were digested to completion with Msel overnight at 37 "C in the manufacture's buffer and electrophoresed on 6% nondenaturing acrylamide gels. This analysis
was repeated three times to ensure reproducibility. Gels
were dried and analyzed on a phosphor imager using
ImageQuant software. The relative allele dosages of mutant and wild-type bands were compared using peak pixel
counts.
FIGURE 4. Allele loss at DP1 locus in the desrnoid tumor DNA demonstrated by a reduction in intensity of the maternal band (marked by arrow)
in the tumor DNA compared with the leukocyte DNA from the proband.
Lane a, leukocyte DNA from affected father; lane b, desmoid tumor DNA;
lane c, leukocyte DNA from proband; lane d, leukocyte DNA from unaffected mother.
longer fascicles, more uniform fibroblasts, and evenly
spaced small round vessels was more compatible with
the diagnosis of a desmoid (Fig. 2). Cytogenetic studies
showed an interstitial deletion of chromosome 5,
de1(5)(q21q22),in three of five cells examined (Fig. 3), the
normal karyotype in two of five cells presumably being
due to contaminating normal tissue or leukocytes.
There was a reduction in intensity of the maternal
marker demonstrated for DP1 (Fig. 4) compatible with
loss of the wild-type allele in the tumor. The loss is incomplete, possibly owing to contamination with normal tissue. The intragenic markers were uninformative in this
family. No allele loss was apparent with markers YN 5.64.
RESULTS
Microscopic examination of the tumor revealed some features of cranial fasciitis, including myxoid change and
occasional extravasated erythrocytes, but the presence of
Identification of the Germline APC Mutation
In leukocyte DNA from the father of the proband, an SSCP
variant was identified in segment E of exon 15, and the
APC Gene Inactivation in a Cranial Desmoid Tumor/DeSilva et al.
975
DISCUSSION
FIGURE 5. Msel-digested and undigested radiolabelled PCR products
(EliMse lorward and E-reverse) from blood and desmoid tumor DNA from
proband (patient 956). with leukocyte DNA from her father (patient 603)
and from a control healthy individual electrophoresed on 6% acrylaniide.
Lanes A and B. undigested and Msel -digested products, respectively.
Allele dosage and naked-eye assessment show that blood DNA from the
proband and her father both show a mutant sequence band (138 bp),
which is of approximately 50% the intensity of the wild-type band (165
bp) owing to the relative size and proportion of cytosine bases of each of
the fragments. However, this pattern is clearly reversed in the desrnoid
tumor. with 70% underrepresentation of the wild-type sequence on allele
dose analysis.
relevant product was reaniplified, gene cleaned, and sequenced as described. A frame shift mutation due to an
insertion of thyrnidine a t nucleotide 3372 (codon 1124),
resulting in a downstream premature stop codon, was
identified (data not shown). APC sequencing was then
repeated for leukocyte DNA from the proband, which
confinned that she was also a carrier of the mutation.
Sequencing of desmoid tumor DNA strongly suggested
that the mutant sequence was overrepresented compared
with the wild type, and quantification of the relative contribution of the mutant and wild-type alleles was performed using allele dosage analysis.
Allele Dosage Analysis
Phosphor imager analysis of the dried gels show that the
wild-type sequence, after digestion with Mse1, is more
intense than the smaller mutant due to the relative size
and proportion of the cytosine bases of each of the fragments (Fig. 5). However, this pattern is dramatically reversed in the desmoid tumor even o n naked-eye assessment. ImageQuant software dosimetry on a number of
separate analyses of peak pixel count of each band indicated a mean ratio of 2.06 for wild-typemutant alleles.
Ilowever, this ratio was only 0.62 in the desnioid tumor
DNA, indicating that thc wild-type sequence was only
30% of that expected if the mutation was heterozygous.
The 2-year-old patient described herein was shown to
have inherited the germline mutation of the APC from
her affected father, although she has not yet manifested
signs of colonic polyps. I ler presentation with a desmoid
tumor is unusual for two reasons: her age and the site of
the lesion. 1)esmoid tumors are commonly intraabdominal or on the abdominal wall. McAdam and Goligher’:’
reviewing 89 cases of desmoid tumors associated with
FAP, reported that 44 were localized to the abdominal
wall and 26 were intraabdominal, and in 19 the desmoids
were present in both. Jarvinen14 in his review of 19 of
168 FAP patients with desmoids in the Finnish polyposis
register reported three patients with extraabdominal desmoids, including one with a desmoid on the buttock and
two with thoracic lesions. No cases of a cranial desmoid
associated with a family history of FAP have been reported. In Jarvinen’s’”report, the average age at diagnosis
of the desnioid tumor was 28.5 years (range 8-41 years).
In McAdam and Goligher’s’‘’series, the average age of the
affected females was 28 years and that of males 38 years.
Childhood onset of desmoids is rare in association with
FAP. Jarvinen” has reported an 8-month-old infant with
an intraabdominal desmoid, and Kratzer et al“ have reported a family with FAP in which a 1-year-old infant
who died of a hepatoma was also noted to have a desmoid
near the umbilicus at post mortem.
Cytogenetically visible abnormalities of chromosome
5q21 have been demonstrated in two desmoid tumors of
patients with Gardner syndrome.16 These were an interstitial deletion of 5q14-21 and a random telomeric fusion
of 5q. Non-Gardner syndrome patients with desmoids
were also noted to have abnormalities of chromosome
5q21. Another study” of 10 desnioid tumors analyzed
after short term culture and in situ hybridization demonstrated trisomy 8 in 4 of 10 tumors, and the authors refer
to the fact that this trisomy was identified using conventional karyotype analysis in only one case of the series,
indicating the need for more detailed cytogenetic studies
in these tumors.
We have attempted to identitji the parental origin of
the deleted chromosome. The loss of the maternal 5q21
region was demonstrable at DP1, estimated to bc 1% distal to the A N : gene, but this does not extend to the proximal marker 5.64. The intragenic polymorphisnis were uninformative in this family. 1,oss of both APC gene copies
has previously been reported for desnioid tuniors affecting the abdominal wall and mesentery. In a study of eight
desmoids and corresponding normal tissue from seven
patients with FAP using PCR, SSCP, and direct sequencing, Miyaki et all” demonstrated that all eight tumors had
APC gene mutations. Seven of eight were exon 15 mutations leading to the formation of a stop codon and one
of eight had loss of the normal allele. In one of the tumors,
976
CANCER March 1,1996 / Volume 77 I Number 5
loss of the wild-type allele was demonstrated by linkage
studies in addition to the sequencing evidence. In the
remainder, the presence of a germline mutation was assumed if this was present in both the normal surrounding
tissue and the tumor. Our studies were complicated by
the presence of normal tissue in the resected tumor specimen, and this normal tissue included infiltrating lymphocytes and normal stroma. The contamination with normal
tissue was noted in both pathological and molecular investigations. The dosage protocol was specially designed
to demonstrate dosage difference between the wild-type
(maternal) and mutant (paternal) alleles in the tumor.
These findings are intriguing insofar as the loss of the
wild type-allele with resultant hemizygosity for the paternal APC mutation occurred at a very early age. Hence, it
is clear that APC gene alterations are a key milestone in
the pathogenesis of desmoid tumors. We have no way of
knowing why a second somatic event involving an interstitial deletion of chromosome 5 should have occurred at
such an early age. This deletion could have arisen purely
by chance, or there could be an underlying predisposition
to chromosomal breakage or other environmental influence.
REFERENCES
1.
2.
3.
4.
5.
Hodgson SV, Maher ER. A practical guide to human cancer
genetics. Cambridge: Cambridge University Press, 1993:1206.
Bodmer W, Bailey C, Bodmer J , Bussey H, Ellis A, Gorman
P, et al. Localisation of the gene for familial polyposis on
chromosome 5. Nature 1987;328:614-6.
Leppert M, Dobbs M, Scrambler P, O’Connell P, Nakamura
Y, Stauffer D. The gene for familial polyposis maps to the
long arm of chromosome 5. Science 1987;238:1411-3.
Kinzler K, Nilbert MC, Su LK, Vogelstein B, Bryan T, Levy
D, et al. Identification of FAP locus genes on chromosome
5q21. Science 1991;253:661-4.
Groden J, Thlivens A, Samowitz W, Carlson M, Gelbert L,
Albertson H, et al. Identification and characterisation of the
familial adenomatous coli gene. Cell 1991;66:589-600.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
Spirio L, Nelson L, Ward K, Burt R, White R, Leppert M. A CA
repeat polymorphism close to the adenomatous polyposis
(APC) gene offers improved diagnostic testing for familial
APC. A m J H u m Genet 1993;52:286-96.
Breukel C, Tops C, Van Leeuwen C, Van der Klift H, Fodde
R, Khan M. CA repeat polymorphism at the D5S82 locus,
proximal to adenomatous polyposis coli (APC).Nucleic Acids
Res 1992; 19:5804.
Kraus C, Ballhausen W. Two intragenic polymorphisms of
the APC gene detected by PCR and enzymatic digestion.
H u m Genet 1992;88:705-6.
Heighway J, Hoban P, Wyllie A. Sspl polymorphism in sequence encoding 3’ untranslated region of the APC gene.
Nucleic Acids Res 1991;195966.
Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T, et
al. Detection of polymorphism of human DNA by gel electrophoresis as single strand conformation polymorphism. Proc
Nut1 Acud Sci USA 1989;86:2766-70.
Prosser J, Condie A, Wright M, Horn J, Fantaes J, Wyllie A,
et al. APC mutation analysis by chemical cleavage of mismatch and a protein truncation assay in familial adenomatous polyposis. B r J Cancer 1994;70:841-6.
Winship P. An improved method for direct sequencing PCR
amplified material using dimethyl sulphoxide. Nucleic Acids
Res 1989; 171266.
McAdam WAF, Goligher JC. The occurrence of desmoids in
patients with familial adenomatous polyposis coli. Br J Surg
1970;57:618-31.
Jarvinen HJ. Desmoid disease as a part of familial adenomatous polyposis coli. Acta Chir Scand 1987;153:379-83.
Kratzer G, Kasumi A, Krush AJ. Gardner syndrome: study
and follow up of a family. A m J h4ed Genet 1991;41:393-7.
Bridge JA, Sreekantaiah C, Mouron B, Neff J, Sandberg A,
Wolman S. Clonal chromosomal abnormalities in desmoid
tumours. Implications for histopathogenesis. Cancer
1992;69:430-6.
Dal Cin P, Sciot R, Aly MS, Delabie J , Stas M, De Wever I,
et al. Some desmoid tumours are characterised by trisomy
8. Genes Ckrom Cancer 1994;10:131-5.
h‘iiyaki M, Konishi M, Kikuchi-Yanoshita R, Enomoto M, Tanaka K, Takahashi H, et al. Coexistence of somatic and germline mutations of APC gene iii desmoid tumours from patients with familial adenomatous polyposis. Cancer Res
1993;535079-89.
Документ
Категория
Без категории
Просмотров
3
Размер файла
502 Кб
Теги
456
1/--страниц
Пожаловаться на содержимое документа