close

Вход

Забыли?

вход по аккаунту

?

999

код для вставкиСкачать
PROTEINS: Structure, Function, and Genetics 34:383–394 (1999)
Structural and Chemical Complementarity Between
Antibodies and the Crystal Surfaces They Recognize
N. Kessler,1 D. Perl-Treves,1 L. Addadi,1 and M. Eisenstein2*
1Department of Structural Biology, Weizmann Institute of Science, Rehovot, Israel
2Department of Chemical Services, Weizmann Institute of Science, Rehovot, Israel
ABSTRACT
The sequences of the variable regions of three monoclonal antibodies with different
specificities to cholesterol monohydrate and 1,4dinitrobenzene crystals were determined. The structures of their binding sites were then modeled,
based on homology to other antibodies of known
structure. Two of these antibodies were previously
shown to specifically recognize each one welldefined face of one of the crystals, out of a number of
crystal faces of closely related structure. The binding site of the antibody which recognizes the stepped
(301) face of the cholesterol crystal is predicted to
assume the shape of a step with one hydrophobic
and one hydrophilic side, complementary to the
corresponding crystal surface. Within the step, the
hydroxyl groups of five tyrosines are located such
that they can interact with the hydroxyl and water
molecules on the cholesterol crystal face, while
hydrophobic contacts are made between the cholesterol backbone and hydrophobic amino acid sidechains. In contrast, the modeled binding site of the
antibody which recognizes the flat (101) face of
1,4-dinitrobenzene crystals is remarkably flat. It is
lined by aromatic and polar residues, that can make
favorable contacts with the aromatic ring and nitro
groups of the dinitrobenzene molecules, respectively. Proteins 1999;34:383–394.
r 1999 Wiley-Liss, Inc.
Key words: cholesterol; comparative modeling; molecular crystals; molecular recognition;
monoclonal antibody
INTRODUCTION
The knowledge available on the molecular basis of
antibody specificity has greatly increased over the past
decade with the elucidation of the three-dimensional structures of a large number of antibody-antigen complexes,
especially with protein antigens.1 The complexes are stabilized by Van der Waals forces, hydrogen bonds, and
occasional ion-pairs over large (600 to 900 Å2) geometrically and electrostatically complementary surfaces.2,3 Specific antibodies can in principle recognize almost any
exposed surface area on the protein antigen, although
some regions, characterized by higher thermal motion4,5 or
higher accessibility,6 appear to be preferred over others.
The immense variety of known antigens has been recently enlarged to include the surfaces of molecular crysr 1999 WILEY-LISS, INC.
tals.7,8 These are characterized by well-defined structures
and highly ordered, repetitive motifs. The molecular component of the crystal is exposed at the different faces of the
crystal in different orientations, exhibiting different chemical moieties in a known pattern. An antibody interacting
with a crystal surface would recognize an array of molecular moieties in a given arrangement, typically 5–20 depending on the size of the molecule. On each crystal face the
potential recognition sites would thus have well-defined
chemical characteristics which differ from each other and
from that of the individual component molecule.
Specific interactions of proteins with defined crystal
surfaces have been observed in different systems where
crystals are exposed to biological environments, such as in
biomineralization9–11 or in common crystal-associated
pathological conditions.12–15 The structure of proteins binding to the rigid surface of crystals was solved for two types
of anti-freeze proteins, which adsorb to specific planes of
ice crystals. The long linear ␣-helical type I antifreeze
protein exhibits four repeated ice-binding motifs, the
side-chains of which are inherently rigid or restrained by
pair-wise interactions to form a flat binding surface.16 In
type III anti-freeze proteins, the structure reveals a remarkably flat amphipathic binding site, with good matching of
multiple hydrogen bonds. In both cases, the flatness of the
ice-binding site is a crucial feature in the ice-binding
mechanism.17
We have shown that the exposure of an organism to
crystals, such as may occur in various pathological situations, can trigger the amplification of specific antibodies.
The presence of antibodies which recognize crystal surfaces was demonstrated in polyclonal antibody populations using a nucleation assay.18 In humans, the presence
of monosodium urate monohydrate crystals in the synovial
fluid was shown to trigger the production of immunoglobulins that catalyzed the nucleation of the same crystals in
Abbreviations: BSA, Bovine Serum Albumin; CDR, Complementarity Determining Region; DNB, Dinitrobenzene; ELISA, EnzymeLinked-Immuno-Sorbent-Assay; Fab, Fragment Antigen Binding; IgG,
Immunoglobulin G; IgM, Immunoglobulin M; MAb, Monoclonal antibody; PBS, Phosphate Buffer Saline; PCR, Polymerase Chain Reaction; PDB, Protein Data Bank.
Grant sponsor: Minerva foundation; Grant sponsor: Kimmelman
Center for Biomolecular Assembly.
*Correspondence to: Dr. Miriam Eisenstein, Chemical Services,
Weizmann Institute of Science, 76100 Rehovot, Israel. E-mail:
miri@model.weizmann.ac.il
Received 12 June 1998; Accepted 16 October 1998
384
N. KESSLER ET AL.
TABLE I. Specificity of the Selected Antibodies
MAb
122B1
36A1
23C1
Recognized crystal
Crystal face
1,4-DNB
cholesterol
cross-reactive
(101)
(301)
—
vitro.19 Similarly, the exposure of rabbits to three structurally-related crystals (monosodium urate monohydrate,
magnesium urate octahydrate and allopurinol) led to the
development of specific immunoglobulin populations, each
able to catalyze the nucleation of the crystal to which the
animal was exposed.20 We subsequently proposed that
antibodies against specific crystal faces contain within
their binding site a structured imprint of the crystal.
These antibodies then act as stabilizing templates in a new
crystallization event. Using the same type of rationale,
polyclonal ice nucleating IgG’s were detected in the sera of
cold-ocean marine fish, but not in the sera of species which
are not exposed to ice.21
Recently, monoclonal antibodies which recognize crystals of cholesterol monohydrate and of 1,4-dinitrobenzene
were selected, using a conventional fusion protocol coupled
with an adsorption assay, after exposure of mice to either
one of the crystals.7,8 The antibodies generated from
exposure to both crystal types presented a wide range of
recognition levels, from crystal-specific to cross-reactive.
At the highest level of specificity, one of the monoclonal
antibodies generated against cholesterol monohydrate crystals and one of the monoclonal antibodies generated
against 1,4-dinitrobenzene crystals were shown to preferentially interact each with one crystal face of well defined
character.22
Here we report on the sequences and predicted threedimensional structures of three selected monoclonal antibodies (MAbs), raised against crystals of cholesterol monohydrate and 1,4-dinitrobenzene. The models of the two
MAbs, each of which recognizes one specific face of cholesterol monohydrate crystals and of 1,4-dinitrobenzene crystals respectively, exhibit a clear-cut geometrical match
between the interacting surfaces. It is suggested that
binding is stabilized by multiple chemical interactions
between the residues exposed on the antibody-binding site
and the molecular moieties exposed on the crystal surface.
RESULTS
Monoclonal antibodies (MAbs) were produced after repeated injections of crystals of 1,4-dinitrobenzene (1,4DNB) and cholesterol monohydrate in mice. The binding of
each monoclonal antibody from both mice hybridoma
populations was assayed in parallel on crystals of 1,4-DNB
and cholesterol monohydrate.7,8 Three of these MAbs
(Table I) were selected here for further characterization:
one interacts with 1,4-DNB crystals (but not cholesterol
monohydrate crystals), one interacts only with cholesterol
crystals, and one is cross-reactive (reactive to all crystal
surfaces tested). All the selected MAbs belong to the IgM
type and use the kappa class of light chains.
Sequences of the Selected Antibodies
The sequences of the selected antibodies were determined by cloning the cDNA’s of the heavy and light chain
variable domains (VH and VK) by the polymerase chain
reaction (PCR) and further sequencing those fragments.
The genetic elements comprising the VL and VH region
were determined, based on sequence homology to known
germline sequences of mouse antibodies (see Materials
and Methods, Table II). On the basis of the existent library,
none of them is germline. As not all the mouse Ig germlines
were sequenced and included in the library, the degree of
somatic mutation cannot however be established with
certainty.
The sequences of the Complementarity Determining
Regions (CDRs) of the three selected MAbs are reported in
Figure 1.
Modeling of the Antibody Structure
Models for the variable domains of MAbs 36A1, 23C1,
and 122B1 were generated by the comparative modeling
procedure described in detail below. The modeling procedure was exclusively based on the 3D structure of antibodies with high sequence identity, determined by X-ray
diffraction, and did not include any type of information on
the antigen structure.
A detailed description of the predicted structures and of
their putative complex with the appropriate crystal faces
(when applicable), follows.
MAb 36A1: Proposed structure and interactions
with cholesterol crystals
Three candidate templates for the Fv light chain of 36A1
were identified in the PDB23,24, entries 1bbd,25 1hil,26 and
1mcp.27 Superposition of the C␣ atoms of their light
chains, including CDR regions, showed that they are very
similar, i.e. the RMSD (root mean square deviations) did
not exceed 0.65 Å. For the heavy chain we found one
candidate, entry 1vfa.28 Superposition of the light chain of
1vfa, except L1, onto the group of the selected light chain
templates (RMSD ⬍ 0.7 Å) showed that 1mcp and 1vfa
have the closest relative disposition of light and heavy
chains. The RMSD for C␣ atoms in the framework of both
light and heavy chains of 1mcp and 1vfa was 1.6 Å. The
superposition is particularly good for the inner ␤-sheets of
both chains (RMSD 0.9 Å). Thus, 1mcp and 1vfa were
selected as modeling templates.
Five of the CDR’s of 36A1 (L1, L2, L3, H1, H2) were
modeled together with the framework, using the same
templates. H3 is one residue longer in 36A1, relative to
1vfa. Next, several structures in the PDB were compared,
with an appropriate stem for H3 and an apex loop of the
same length as in 36A1: 1jhl,29 7fab,30 2fbj,31 1jel,32 and
1mfb.33 The conformations of the loops were found to be
different in each structure, although, being very short,
they occupy the same region in space. The sequences of the
H3 apexes also differ from H3 in 36A1. We therefore
generated several plausible structures for this loop by
Homology and checked them manually. We chose the loop
385
ANTIBODIES RECOGNIZING CRYSTAL SURFACES
TABLE II. Genetic Elements of the Variable Regions of the Selected Antibodies and Their Homology to Germline
VK gene
family
36A1 (cholesterol)
23C1 (cross reactive)
122B1 (1,4-DNB)
Homology to
germline
VK8,a [GLVK50]c
92%
VK8, [GLVK50]
96.3%
(V)
67%
Number
of CDR
mutations
JK
11
J4
4
J4
27
J2
VH gene
family
VH2, (IB),b
[Vm13]
VH2, (IB),
[Vm13]
VH1, (IIB),
[clone 28]
Homology to
germline
Number
of CDR
mutations
JH
D
100%
0
J4
FL16.2
96%
1
J4
SP2.2
98%
0
J2
SP2.5
VH , VK ⫽ Variable region of heavy (H) and light (K) chain gene.
aV and V -gene family as defined by Kofler et al.57
K
H
bV and V protein subgroup as defined by Kofler et al.57 is given in round brackets.
K
H
cPrototype member for each family is given in square brackets. The data were taken from the genebank library (University of Wisconsin Genetic
Computer Group soft-ware package).
JK , JH ⫽ Junction region of light (K) and heavy (H) chain gene, according to Max58 (K chain) and Sakano59 (H chain).
D ⫽ Diversity region of heavy chain gene according to Kurosawa.60
Fig. 1. Amino acid sequence of the CDRs of antibodies 36A1, 23C1, and 122B1. The symbol (-)
denotes sequence identity to MAb 36A1. Amino acid numbering is according to Kabat et al.55 and
CDR position is according to Chotia et al.48,56
that did not clash with the rest of the structure and
occupied the same spatial region as H3 in the structures
listed above.
The combining site of 36A1 assumes a peculiar shape of
a step with an angle close to 90°, which is roughly 12 Å
high and 24 Å wide (Fig 2A, insert). The long L1 loop forms
one ‘‘wall’’ of the step, while the short H2 and H3 loops
form the ‘‘floor’’ of the step. The step wall is highly
hydrophilic, exposing the hydroxyls of 5 tyrosines and 3
serines, the amide group of 1 asparagine and the charged
end of 1 lysine. The step floor, in contrast, is composed of
three aromatic residues with their rings parallel to the
step (2 Tyr, 1 Trp), 2 hydrophobic (Ala, Val), and 1 polar
(Ser) residues (Fig 2A).
It is important, at this point, to discuss the reliability of
our model and of its most pronounced feature, the stepshaped combining site. The high percentage of sequence
identity between the light chain of 36A1 and the candidate
template structures, together with the pronounced structural similarity among the light chains of these templates,
suggest that the structure of the modeled light chain is
highly reliable. The model of the heavy chain is also based
on a template with high sequence identity and the structure is reliable except for H3. However, this is a very short
loop in 36A1, with a limited range of conformations all
occupying a preferred region in space (based on our
comparison of several structures with loops of the same
length). Hence, variations in the structure of this loop are
not expected to affect the overall shape of the step. Another
important consideration is the relative positioning of the
light and heavy chains, which were modeled using different templates. The RMSD between the framework C␣
atoms in the ␤-sheets at the light-heavy interface of 1mcp
and 1vfa is only 0.9 Å. An error of this magnitude might
slightly affect the shape of the combining site, retaining
however the overall shape of the step. In summary, the
model structure for 36A1, including the features of the
combining site, appears to be highly reliable.
The binding of 36A1 to the different cholesterol crystal
faces has been characterized by immunolabeling techniques.8 Specific recognition was detected for the (301)
face. By far lower binding was observed on the other
commonly developed side faces of the crystal, (100), (101),
(201), (010), and (011), and practically no binding on the
large plate faces, (001). The recognized (301) face is
characterized by the presence of molecular steps, exposing
the 3␤ hydroxyl groups of the cholesterol molecule and
lattice water molecules on the walls of the steps, which
separate between long ‘‘floors’’ where only the hydrophobic
cholesterol backbones are exposed (Fig. 3). This geometry
is highly suggestive of a possible interaction with the
hydrophilic and hydrophobic regions of the antibodybinding site, respectively.
Manual docking of MAb 36A1 on the step of the (301)
face shows an excellent geometrical and chemical match
between the two surfaces (Fig 2B). During the docking
procedure, only the ␹1 torsion angle of a single tyrosine
residue was changed, in the allowed range, to better fit the
386
N. KESSLER ET AL.
Fig. 2. (A) Model structure of MAb 36A1 (cyan), with the antigen
binding site residues highlighted: red:Tyr-L31, Tyr-L32, Tyr-L92, Tyr-H97,
and Tyr-H99 ; yellow:Tyr-L91, Tyr-L94, Trp-H52, Ala-H53, Val-H95 and
Ser-H56. A stick representation of the antibody-binding site is shown. The
balls mark the hydroxyl oxygens of the tyrosines on the vertical hydrophilic
‘‘wall’’ of the step, while the hydrophobic residues on the ‘‘floor’’ of the step
(yellow) are viewed edge-on. The insert highlights the step-like solvent
accessible surface of the antibody variable region. The position of the
binding site is indicated by an arrow. Here and hereafter, in this view, the
light chain is shown on the left and the heavy chain on the right. (B)
Docking model of MAb 36A1 (in line representation) onto the (301) face of
the cholesterol crystal (in space-filling representation).Yellow: cholesterol
backbone, antibody side chains of Tyr-L91, Tyr-L94, Trp-H52, Ala-H53,
Val-H95, and Ser-H56; cyan: antibody backbone; red: hydroxyl oxygen
atoms of the cholesterol molecule, antibody tyrosines L31, L32, L92, H97
and H99; blue: water molecules. The stepped (301) face with the docked
antibody Fv region is presented in a nearly edge-on view.
ANTIBODIES RECOGNIZING CRYSTAL SURFACES
387
Fig. 3. Cholesterol crystal packing arrangement on the (101), (010), (100), (001), and (301)
faces. The (011) and (021) faces are similar to (010), except that only the cholesterol backbone is
exposed as in (100). The relevant surface is represented at the top of each figure, as marked (white
dashed lines). Yellow: cholesterol backbone; red: hydroxyl oxygen atoms; blue: water molecules.
hydroxyl surface of the cholesterol step. No backbone
conformational modifications were allowed, however. Automatic docking was attempted using a modified version
(unpublished) of the program Molfit.34,35 Several structures for the crystal-antibody complex were obtained. In
all of them the step-shaped combining site matched the
step on the crystal surface, but several equivalent positions along the step were obtained, translated at intervals
corresponding to the displacement of the cholesterol molecules along the b axis of the crystal.
The step in the antibody-binding site is 12 Å high, as is
the dimension of one unit cell of cholesterol monohydrate
along the a axis, comprising two molecules. The width of
the antibody-binding site is 24 Å, which fits four molecules
of cholesterol along the b axis, whereas the length of the
bottom of the step in the antibody-binding site fits the size
of one molecule of cholesterol along the c axis (⬃ 17 Å). In
addition to the geometrical match (Fig 2B), the model
indicates the possibility of good chemical interactions,
with hydrogen bonds being formed between the hydroxyl
and water groups on the cholesterol (301) face and the
polar residues constituting the antibody-binding site. Notably, the five tyrosines (L31, L32, L92, H97, and H99) on
the hydrophilic side of the antibody-binding site (Fig 2A)
are spaced such that they can be juxtaposed each to one of
five cholesterol hydroxyl groups (not shown). The hydrophobic cholesterol backbones are suggested to interact with
the hydrophobic residues (Ala-H53, Val-H95, Tyr-L91,
Tyr-L94, Trp-H52) lining the floor of the step in the
antibody-binding site.
Five structures, representative of the crystal faces commonly developed in cholesterol crystals, are shown in
Figure 3.
The lower binding of MAb 36A1 to some of these is easily
understandable, based on the geometric and electrostatic
mismatch between the surfaces. The (100), (011), and (021)
faces all expose the hydrophobic cholesterol backbone
exclusively. On the (001) face, only the 3␤ hydroxyls and
the lattice water are exposed. However, low binding was
also observed for the (101) and (010) faces, which exhibit a
stepped structure identical or similar to that of the (301)
face respectively, but with (on average) one unit cell
interval between the steps rather than three. We suspect
that the lower binding is related to the shorter distance
between the steps on these faces, where the bulky IgM
molecule may not be able to bind cooperatively.
MAb 23C1: Proposed structure
MAb 23C1 is a cross reactive antibody, that binds mainly
to imperfections on the crystal faces.8 The sequence identity between 23C1 and 36A1 is very high, 91% for the light
chains and 85% for the heavy chains, which differ mostly
in the H3 region. Therefore the same templates were used
to build the model for 23C1 as for 36A1. We found 4
structures in the PDB with H3 of the same length as in
23C1: 8fab,30 1igm,36 1iai,37 and 6fab.38 Superposition of
388
N. KESSLER ET AL.
the heavy chains of these structures revealed two conformations for their H3. Thus, the H3 loops in 6fab and 1iai were
similar and those in 1igm and 8fab were similar to one
another but different from the first pair. We built two
models, with different H3’s, according to 6fab and 1igm.
Energy minimization strongly preferred one model, in
which H3 was based on 6fab, over the other.
Although 23C1 has a high sequence identity and CDR
loop similarity (L1, L2, L3, H1 and H2) with 36A1, the
structure of their combining sites is markedly different.
Due to the longer H3 in 23C1, the step that was observed
in the combining site of 36A1 is flatter (not shown).
Moreover, MAb 23C1 has 3 charged residues (Arg-H3,
Asp-H58, and AspL91) located in a central position, while
MAb 36A1 has none. The model structure of 23C1 is less
reliable than the model for 36A1, due to the longer H3 loop
and its two apparent conformations. Yet, our conclusion
regarding the characteristics of the site are sound because
the exposed charged residues in the combining site come
from the L1 and H2 loops.
MAb 122B1: Proposed structure and interactions
with 1,4-DNB crystals
Three candidate templates were found for the light
chain of 122B1: 1ivl,39 1mlb,40and 3hfm.41 The RMSD
between all C␣ atoms in these chains were less than 0.7 Å.
The candidate templates for the heavy chains were 1fpt,42
1for,43 and 1jhl.29 Superposition of their C␣ atoms, excluding H3, gave RMSD less than 0.9 Å. According to its
sequence, the H3 loop of 122B1 is expected to form a
non-bulged stem structure.44 The fragment -CAN-, which
indicates a non-bulged stem, occurs in 1mrf,45 where
indeed the non-bulged H3 stem conformation is found. In
1mrf the buried D101 of the heavy chain forms hydrogen
bonds to Trp 103(H) and Tyr 36(L). Notably, in 122B1 these
residues are conserved suggesting that similar hydrogen
bonds are formed. The relative position of the light and
heavy chains is likely to be affected by the conformation of
the stem of H3, which is found at the light-heavy interface.
The structure of 1mrf was thus selected as a template for
the relative positioning of the light and heavy chains. The
light chain of 1mlb was superimposed on the light chain of
1mrf (97 atoms excluding L1; RMSD ⫽ 0.63 Å) and the
heavy chain of 1jhl was superimposed on the heavy chain
of 1mrf (101 atoms excluding H3 and missing atoms in the
framework of 1mrf, RMSD ⫽ 0.78 Å). Thus, 1mlb was used
as a template for constructing the light chain of 122B1,
1jhl was used as a template for the heavy chain, 1mrf
provided a template for the stem of the H3 loop of 122B1,
whereas the apex of this loop (4 residues) was generated by
Homology and a conformer acceptable with regard to
intramolecular clashes was selected.
The combining site of 122B1 is flat, with exposed aromatic (Phe, Tyr, Trp, and His), polar (Asn, Gln, and Ser)
and hydrophobic (Leu) residues (Fig. 4A). Notably, the
overall percentage of the aromatic residues in the CDRs of
122B1 is not exceptionally high, but they appear to be all
exposed to the solvent.
The model structure for the light chain of this antibody
is deemed reliable due to the high sequence identity with
the template. Similarly reliable is the model for the heavy
chain, H3 excluded. The relative position of the light and
heavy chains is determined by the conformation of the
stem of H3 and by the interactions of the buried D101(H);
1mrf provided a good template for these interactions and
for the relative L/H positioning. The model for the nonbulged stem of H3 is also reliable, whereas the apex of H3
is less reliable, as in all antibody models.
MAb 122B1 preferentially recognizes the (101 ) face of
the 1,4-DNB crystals.22 Substantially lower reactivity was
observed for the (101), (110), and (100) faces. The (101) face
is planar and is characterized by aromatic rings organized
in a herring-bone structure, with the dinitro-benzene
molecule emerging side-on, almost perpendicular to the
face. One oxygen atom of each nitro group and the benzene
ring profiles are thus exposed at the surface (Fig. 5).
The flat surface of MAb 122B1 well matches the (101 )
face of the 1,4-DNB crystal, both geometrically and chemically (Fig. 4). The antibody-binding site is characterized by
the presence of aromatic residues, which may interact
with the aromatic rings exposed at the (101 ) crystal face,
and of polar (Asn, Gln, and Ser) residues which can form
hydrogen bonds with the nitro groups. Manual docking of
MAb 122B1 on the (101 ) face of the 1,4-DNB crystal shows
a striking correspondence between 5 of the antibody
tyrosines (50 of the light chain and 32, 97, 98, 100 of the
heavy chain) and one tryptophan (94 of the light chain)
and the structure of the dinitrobenzene molecules in the
crystal (Fig 4B). These side chains appear to be positioned
such that they match the crystal lattice, forming a continuation of the herring-bone motif of the crystal into the
antibody.
The lower binding of MAb 122B1 to the other faces of the
1,4-DNB crystal is easily rationalized by their different
structures (Fig. 5). The (101) and (110) faces are rough
faces, and expose mainly the nitro groups in a ridge-andchannel motif. The (100) face is not as rough, exposing
mainly the nitro moieties and less the aromatic rings. In
contrast to the (101 ) face, however, the aromatic rings are
oriented towards the (100) face such that their ring plane
is exposed. Hence, their packing motif cannot be matched
by the antibody aromatic moieties, as for the (101 ) face.
The model thus suggests a plausible explanation for the
observed binding preference of 122B1. We note, however,
that the conformation of the aromatic side chains cannot
be accurately modeled, in particular those of Tyr-97 and
Tyr-98 in the apex of the H3 loop.
DISCUSSION
In this study we determined the amino acid sequences
and modeled the 3D structures of antibodies which recognize specific crystal surfaces of cholesterol monohydrate
and 1,4-dinitrobenzene. In two cases the models were
subsequently matched to the recognized crystal surfaces.
The binding preference may be explained first in terms of
the geometrical fit between the two interacting surfaces. In
ANTIBODIES RECOGNIZING CRYSTAL SURFACES
addition, a striking correspondence was found between the
antibody residues exposed at the binding site and the molecular moieties exposed at the appropriate crystal surface.
The antibodies considered here were selected based on
their affinity for crystal surfaces. None of these has any
appreciable binding to the individual molecule comprising
the crystal.7,8 This may be explained when considering
that the exposed area of a single molecule on any crystal
surface (approximately 50 Å2), is one order of magnitude
smaller than the interface area of an antibody-binding site
(600–900 Å2). Moreover, an analysis of binding site topographies showed that the combining sites of antibodies that
bind small haptens are usually concave,46 in sharp contrast with the step-like and planar binding sites of the
crystal-binding antibodies considered here. The interaction of one single molecule with the flat surface of the
antibody-binding sites is thus too weak, and binding
occurs rather to a number of specifically ordered molecules, held together by the crystal lattice forces.
One of the antibodies examined here, 36A1, selectively
interact with cholesterol monohydrate. One, 122B1, with
1,4-DNB crystals. Both show specific interaction with one
crystal face, out of several expressed faces of either cholesterol monohydrate or 1,4-DNB. The available information
on the binding patterns of these antibodies offers thus the
rare advantage of a systematic approach to binding of
antibodies to a series of organized surfaces comprising the
same component molecule.
Although the accuracy in the modeling of protein structures is still limited in general, the reliability of modeling
of antibody structures is increased by three essential
advantages: the number of high quality crystal structures
of antibody fragments available, which provides a substantial base for model building, the conservation of the
antibody structure in the framework regions,47 and the
small repertoire of main chain conformations for five of the
six hypervariable regions48 and the stem fragment of
the sixth.44 Comparisons of models with subsequently
obtained X-ray data of the same variable regions showed
that the accuracy levels in the position of most of the
predicted CDR loops were better than 1.0 Å for backbone
atoms.39,49,50 The positions of the side chains do occasionally differ, varying from one of the allowed conformations
to the other. This is frequently observed to occur however
between independent crystal structures of the same antibody, as well as between the structures of free and
complexed antibodies. Thus, reasonably accurate models
can be generated, which enable identification of at least
the prominent structural features of the binding sites.
As noted, immunolabeling indicates a clear recognition
of MAb 36A1 for the (301) face of the cholesterol crystals.
The step of ⬃90° in the binding site of 36A1 is due to the
very short H3 and long L1 loops. It fits very well the step
on the (301) face of the cholesterol crystal, both geometrically and chemically, allowing the establishment of a net of
hydrogen bonds and hydrophobic interactions with the
crystal surface. In particular, the array of five tyrosines on
the hydrophilic wall of the step appears to be optimally
389
located to form hydrogen bonds with the hydroxyls of a
corresponding array of cholesterol molecules on the crystal
surface. In addition, the structural water molecules of the
cholesterol monohydrate crystals, exposed on the step on
the (301) face, form an ordered array. They might be
conserved in part within the antibody-antigen complex,
and participate in additional hydrogen bonds to the serines
and tyrosines of the antibody-binding site. This type of
hydrogen bond between polar amino acid residues and
structured water arrays are well represented in the complex between antifreeze proteins and ice crystals.16,17 The
area of the binding site of MAb 36A1 involved at the
interface with the crystal is ⬃800 Å2, in good agreement
with typical values of buried surfaces in antibody complexes with proteins.
The model structure of MAb 122B1 is very different from
MAb 36A1, both in shape and in chemistry. The antibodybinding site is extremely flat, due to both H3 and L1 loops
being short. Only one serine residue emerges slightly from
this flat surface, and this is within the error limit of the
model. Five aromatic residues are positioned such that
they can interact with the aromatic rings organized in a
herring-bone structure at the surface of the flat (101) face
of 1,4-DNB, and with polar (Asn and Gln) residues which
are suitable for interacting with the nitro groups. It is
impossible to establish the conformation of the exposed
aromatic side chains with certainty. The possibility to
arrange six aromatic rings such that they appear to
continue the crystal lattice, is however highly suggestive of
the possible optimization of aromatic interactions in this
antibody-antigen complex. The area of the antibodybinding site buried in the complex is ⬃1000 Å2.
Docking of both 36A1 and 122B1 was performed onto the
appropriate crystal surfaces, considered as locally perfect.
Although crystal surface layers are known to be often
composed of islands and terraces and decorated by imperfections and dislocations, there is plenty of evidence indicating that in molecular crystals the average structure of
the face is strikingly similar to that obtained by cutting the
bulk structure along the relevant plane.51 Besides, islands
have probably to be larger than 1,000 Å2 in order to be
stable. The presence of steps and imperfections on the
surface is in fact the factor that may explain why some
antibody reactivity is observed on crystal faces of average
structure different from that specifically recognized.
Determining the specific binding properties of an antibody with no specific recognition is, by definition, impossible. In this study, however, two cross-reactive antibodies
were selected, one of which, 23C1, by coincidence has a
high sequence homology with 36A1. Comparison between
the two antibodies may be useful in this case, for understanding their very different binding behavior. Very evident is the presence of four charged moieties in the binding
site of 23C1, that are absent in 36A1. 23C1 was observed to
bind to imperfections in the crystal. We suspect that the
presence of charged residues in the antibody-binding site
may be connected to its lack of selectivity, and to its nonspecific binding to imperfections.
390
N. KESSLER ET AL.
Fig. 4. (A) Solvent-accessible surface representation of MAb 122B1
(white). The exposed residues of the antibody-binding site are highlighted.
Yellow: aromatic (Phe, Tyr, and Trp); orange: Asn, Gln and Ser; green:
aliphatic residues (Leu, Ile, Val, Ala, Met and Cys). (B) Model of the
complex of MAb 122B1 and the (10°) face of the 1,4-DNB crystal (in
space-filling representation). MAb 122B1 is shown in stick representation,
except for the aromatic rings of Tyr-H32, Tyr-H97, Tyr- H98 and Trp-L94
which are shown in space-filling representation to highlight their location
at lattice sites that appear to continue the crystal stacking motif. Two other
residues, Tyr-L50 and Tyr-H100b which are found behind Tyr-H97 and
Tyr-H32 respectively, are also located at positions matching crystal lattice
sites.
ANTIBODIES RECOGNIZING CRYSTAL SURFACES
391
Fig. 5. Crystal packing arrangement on the (101), (110), (101), and (100) faces of 1, 4-DNB. Yellow: carbon
atoms; green: nitrogen atoms; red: oxygen atoms. The relevant surface is represented at the top of each figure,
as marked (white lines).
We suggest in conclusion that there may be antibodies
which have an intrinsic capability to bind to all kinds of
surfaces, such as those of molecular crystal addressed
here, in a wide range of degrees of recognition. It appears
that, as in protein-protein complexes, the recognition is
modulated by sterical and chemical interactions. These
may be analyzed systematically in depth, because the
antigen has a repetitive homogeneous structure, known at
the atomic level. The level of reliability of the antibody
models built here is obviously not sufficient to allow
Ångstrom-scale resolution of fine structural features. It
would be thus preposterous, for example, to claim definition of the structure down to the conformation of the amino
acid side-chains. However, in contrast to other instances
where these very features assume a mechanistical importance, such as in catalytic antibodies, in the present
system such fine tuning is not essential, inasmuch as it
would not modify the general shape and character of the
antibody-binding site.
We are presently testing the degree of recognition of the
selected antibodies for defined molecular arrays, using
progressively more relaxed structures, such as monolayers
of cholesterol at the air-water interface. This type of
studies should further our understanding of the molecular
and structural requirements of antibody-antigen surfaceto-surface interactions.
MATERIALS AND METHODS
Preparations Of Monoclonal Antibodies
The production, purification and partial characterization of the monoclonal antibodies was previously described.7,8
cDNA Cloning and Sequencing
The mRNA was purified from mouse hybridoma cells
using the Guanidine Isothiocyanate (GIT) technique for
preparation of total RNA.52 cDNA was prepared using
Reverse Transcription kit (Promega), and amplified by the
polymerase chain reaction (PCR). The following consensus
oligonucleotide primers for the J region and the amino
terminus of the variable region were used.53
58 terminus:
58 VK - CCCAAGCTTGACATTGTGGTGACCCAGTCTCCA
58 VH - GCGAATTCGTCGACSAGGTSMARCTGCAGSAGTCWGG
38 terminus:
58 JK - CCCGAATTCTTAGATCTCCAGCTTGGTCCC
58 kappa constant - GCGCCGTCTAGAATTAACACTCATTCCTGTTGAA
58 JH - TGARGAGACGGTGACCAGGGTBCC
58 IgM constant - GCACTAGTGCACATGTGGAGGACACG
392
N. KESSLER ET AL.
TABLE III. Parent Structures Used as Templates for Modeling of the Framework Regions (VK, VH) and CDRs (L1, L2, L3,
H1, H2, H3) of the Various Antibodies
La (% identity)
36A1 (cholesterol)
23C1 (cross reactive)
122B1 (1,4-DNB)
aVariable
bVariable
1mcp, (84%)
1mcp, (91%)
1mlb, (77%)
L1
L2
L3
1mcp
1mcp
1mlb
1mcp
1mcp
1mlb
1mcp
1mcp
1mlb
Hb (% identity)
H1
H2
H3
1vfa, (84%)
1vfa, (85%)
1jhl, (88%)
1vfa
1vfa
1jhl
1vfa
1vfa
1jhl
Stem: 1vfa apex: designed
6fab
Stem: 1mrf apex: designed
light domain excluding the J region.
heavy domain excluding the D and J regions.
Amplification was performed with VentR DNA Polymerase Recombinant (New England Biolabs) in an automated
thermal cycle: 1 cycle of 3 min at 94°C. 5 cycles of 3 min
denaturation, at 94°C, 30 sec annealing at 45°C and 1 min
extension at 72°C. 25 cycles of 30 sec denaturation, at
94°C, 30 sec annealing at 60°C and 1 min extension at
72°C. The PCR fragments were purified by Isolation
kit-DNA (Biological industries Co., Beit Haemek, Israel) or
by centricon-100 (Amicon). PCR fragments were sequenced using the same primers as for PCR amplification
and Ampli Taq DNA Polymerase, FS cycle sequencing was
performed on an ABI PRISM 377 DNA Sequencer.
Characterization of the MAb Sequences
Sequences were analyzed using the University of Wisconsin Genetic Computer Group software package. Stringsearch was applied on the genebank library in order to
generate a library of the selected patterns: ‘‘immunoglobulin,’’ ‘‘germline.’’ and ‘‘mouse.’’ Homology comparison
(FASTA) with the sequences of the selected library was
performed and germline sequences with the best sequence
identity were determined for each MAb.
Computer-Aided Molecular Modeling
Models of the Fv regions of the antibodies were constructed on the basis of experimental structures from the
Protein Data bank (PDB).23,24 Initial lists of possible
templates were prepared for the light and heavy chains
separately, including all the structures with high percentage of sequence identity (⬎ 75%) for the framework and
CDRs L1, L2, L3, H1, and H2. The relative position of the
heavy and the light chains was also considered. Thus,
templates with high sequence identity both for the light
and the heavy chains of the modeled sequence were
preferred. Where this was not possible, the structures of
the candidates for the light and heavy chains were superimposed to find a pair of templates with similar relative
positioning at the interface. The template structures selected for each of the antibody framework regions and
CDRs are listed in Table III.
For CDR loops L1, L2, L3, H1 and H2 we selected
templates according to the canonical forms described by
Chothia et al.48 In most cases, the same templates were
used for these loops and for the framework. Otherwise, we
looked for examples in the PDB for the given loop and
superimposed them on the template chosen for the framework. The stem fragments of the H3 loop (defined as in
Reference 44) were modeled together with the framework
except for 122B1 (see Results). Templates for the apex of
H3 were selected, for 23C1, based on the length of the loop,
whereas for 36A1 and 122B1, where H3 is short, loops
were generated using the Homology module of MSI/
Biosym (MSI/Biosym Inc, San Diego, California). Initial
coordinates for each model structure were generated using
the Homology module of MSI/Biosym. The new side chains
inherited equivalent torsion angles from the side chains of
the template structures, where possible. The models were
manually checked for correct van der Waals distances, and
severe clashes were fixed by changing the rotamers of
amino acid side chains too close to one another. Finally, the
initial models were energy minimized using program
ENCAD.54 The positions of the C␣ atoms were constrained
in the minimization to their initial values such that the
final structure was very similar to the initial one and the
overall fold of the protein was not disrupted.
The same scaffold was used for the framework regions
and for some of the CDRs of MAbs 36A1 and 23C1, because
of the high sequence similarity in their VH (excluding H3),
and VL regions.
The suggested docking models were generated by manually juxtaposing the antibody model structures and the
corresponding crystals surface structures, using MSI/
Biosym.
ACKNOWLEDGMENTS
We are grateful to S. Cabilly for providing us with
primers and helping us with the cloning of the antibodies,
and to D. Schindler for useful advice.
L.A. is the incumbent of the Dorothy and Patrick
Gorman professorial chair and N.K. is the recipient of the
Jeaninne Klueger scholarship. This project was supported
by a research grant from the Minerva foundation and by
the Kimmelman Center for Biomolecular Assembly.
REFERENCES
1. Wilson IA, Stanfield RL. Antibody-antigen interactions: New
structures and new conformational changes. Curr Opin Struct
Biol 1994;4:857–867.
2. Davies DR, Padlan EA, Sheriff S. Antibody-antigen complexes.
Annu Rev Biochem 1990;59:439–473.
ANTIBODIES RECOGNIZING CRYSTAL SURFACES
3. Wilson IA, Stanfield RL. Antibody-antigen interactions. Curr
Opin Struct Biol 1993;3:113–118.
4. Westhof E, Altschuh D, Moras D, Bloomer AC, Mondragon A, Klug
A, Van Regenmortel MHV. Correlation between segmental mobility and the location of antigenic determinants in proteins. Nature
1984;311:123–126.
5. Tainer JA, Getzoff ED, Alexander H, et al. The reactivity of
anti-peptide antibodies is a function of the atomic mobility of sites
in a protein. Nature 1984;312:127–134.
6. Davies DR, Sheriff S, Padlan EA. Antibody-antigen complexes. J
Biol Chem 1988;263:10541–10544.
7. Kessler N, Perl-Treves D, Addadi L. Monoclonal antibodies that
specifically recognize crystals of dinitrobenzene. FASEB J 1996;10:
1435–1442.
8. Perl-Treves D, Kessler N, Izhaky D, Addadi L. Monoclonal antibody recognition of cholesterol monohydrate crystal faces. Chem
Biol 1996;3:567–577.
9. Addadi L, Weiner S. Interactions between acidic proteins and
crystals: Stereochemical requirements in biomineralization. Proc
Natl Acad Sci USA 1985;82:4110–4114.
10. Albeck S, Weiner S, Addadi L. Polysaccharides of intercrystalline
glycoproteins modulate calcite growth in vitro. Chem Eur J
1996;2:278–284.
11. Hunter GK. Interfacial aspects of biomineralization. Curr Opin
Solid State Mater Sci 1996;1:430–435.
12. Kozin F, McCarty DJ. Molecular orientation of immunoglobulin G
adsorbed to microcrystalline monosodium urate monohydrate. J
Lab Clin Med 1980;95:49–58.
13. Cherian PV, Schumacher HR. Immunochemical and ultrastructural characterization of serum proteins associated with monosodium urate crystals (MSU) in synovial fluid cells from patients
with gout. Ultrastruct Pathol 1986;10:209–219.
14. Shiraga H, Min W, VanDusen WJ, et al. Inhibition of calcium
oxalate crystal growth in vitro by uropontin: Another member of
the aspartic acid-rich protein superfamily. Proc Natl Acad Sci USA
1992;89:426–430.
15. Bertrand JA, Pignol D, Bernard JP, Verdier JM, Dagorn JC,
Fontecilla-Camps JC. Crystal structure of human lithostathine,
the pancreatic inhibitor of stone formation. EMBO J. 1996;15:
2678–2684.
16. Sicheri F, Yang DS. Ice-binding structure and mechanism of an
antifreeze protein from winter flounder. Nature 1995;375:427–
431.
17. Jia Z, DeLuca CI, Chao H, Davies PL. Structural basis for the
binding of a globular antifreeze protein to ice. Nature 1996;384:
285–288.
18. Perl-Treves D, Kam M, Addadi L. Interactions between antibodies
and crystal surfaces. Mol Cryst Liq Cryst 1996;278:1–15.
19. Kam M, Perl-Treves D, Caspi D, Addadi L. Antibodies against
crystals. FASEB J 1992;6:2608–2613.
20. Kam M, Perl-Treves D, Sfez R, Addadi L. Specificity in the
recognition of crystals by antibodies. J Mol Recognit 1994;7:257–
264.
21. Verdier JM, Ewart KV, Griffith M, Hew CL. An immune response
to ice crystals in north atlantic fishes. Eur J Biochem 1996;241:740–
743.
22. Bromberg R, Kessler N, Addadi L. Antibody recognition of specific
crystal faces of 1–4 dinitrobenzene. J Cryst Growth 1998;193:656–
664.
23. Bernstein FC, Koetzle TF, Williams GJ, et al. The protein data
bank: A computer-based archive file for macromolecular structures. J Mol Biol 1977;112:535–542.
24. Abola EE, Bernstein FC, Bryant SH, Koetzle TF, Weng J. Protein
data bank. In: Allen FH, Bergerhoff G, Sievers R, editors. Crystallographic databases-information content, software systems, scientific applications. Bonn/Cambridge/Chester: Data Commission of
the International Union of Crystallography; 1987. p 107–132.
25. Tormo J, Stadler E, Skern T, et al. Three-dimensional structure of
the Fab fragment of a neutralizing antibody to human rhinovirus
serotype 2. Protein Sci 1992;1:1154–61.
26. Rini JM, Schulze-Gahmen U, Wilson IA. Structural evidence for
induced fit as a mechanism for antibody-antigen recognition.
Science 1992;255:959–965.
393
27. Satow Y, Cohen GH, Padlan EA, Davies DR. Phosphocholine
binding immunoglobulin Fab McPC603. An X-ray diffraction
study at 2.7 Å. J Mol Biol 1986;190:593–604.
28. Bhat TN, Bentley GA, Boulot G, et al. Bound water molecules and
conformational stabilization help mediate an antigen-antibody
association. Proc Natl Acad Sci USA 1994;91:1089–1093.
29. Chitarra V, Alzari PM, Bentley GA, et al. Three-dimensional
structure of a heteroclitic antigen-antibody cross-reaction complex. Proc Natl Acad Sci USA 1993;90:7711–7715.
30. Saul FA, Poljak RJ. Crystal structure of human immunoglobulin
fragment Fab New refined at 2.0 Å resolution. Proteins 1992;14:
363–371.
31. Suh SW, Bhat TN, Navia MA, et al. The galactan-binding immunoglobulin Fab J539: An X-ray diffraction study at 2.6-Å resolution.
Proteins 1986;1:74–80.
32. Prasad L, Sharma S, Vandonselaar M, et al. Evaluation of
mutagenesis for epitope mapping. Structure of an antibodyprotein antigen complex. J Biol Chem 1993;268:10705–10708.
33. Zdanov A, Li Y, Bundle DR, et al. Structure of a single-chain
antibody variable domain (Fv) fragment complexed with a carbohydrate antigen at 1.7-Å; resolution. Proc Natl Acad Sci USA
1994;91:6423–6427.
34. Katchalski-Katzir E, Shariv I, Eisenstein M, Friesem AA, Aflalo
C, Vakser IA. Molecular surface recognition: Determination of
geometric fit between proteins and their ligands by correlation
techniques. Proc Natl Acad Sci USA 1992;89:2195–2199.
35. Eisenstein M, Shariv I, Koren G, Friesem AA, Katchalski Katzir
E. Modeling supra-molecular helices: Extension of the molecular
surface recognition algorithm and application to the protein coat
of the tobacco mosaic virus. J Mol Biol 1997;266:135–143.
36. Fan ZC, Shan L, Guddat LW, et al. Three-dimensional structure of
an Fv from a human IgM immunoglobulin. J Mol Biol 1992;228:
188–207.
37. Ban N, Escobar C, Garcia R, et al. Crystal structure of an
idiotype-anti-idiotype Fab complex. Proc Natl Acad Sci USA
1994;91:1604–1608.
38. Strong RK, Campbell R, Rose DR, Petsko GA, Sharon J, Margolies
MN. Three-dimensional structure of murine anti-p-azophenylarsonate Fab 36–71. 1. X-ray crystallography, site-directed mutagenesis, and modeling of the complex with hapten. Biochemistry
1991;30:3739–3748.
39. Essen LO, Skerra A. The de novo design of an antibody combining
site. Crystallographic analysis of the VL domain confirms the
structural model. J Mol Biol 1994;238:226–244.
40. Braden BC, Souchon H, Eisele JL, et al. Three-dimensional
structures of the free and the antigen-complexed Fab from
monoclonal anti-lysozyme antibody D44.1. J Mol Biol 1994;243:
767–781.
41. Padlan EA, Silverton EW, Sheriff S, Cohen GH, Smith-Gill SJ,
Davies DR. Structure of an antibody-antigen complex: crystal
structure of the HyHEL-10 Fab-lysozyme complex. Proc Natl Acad
Sci USA 1989;86:5938–5942.
42. Wien MW, Filman DJ, Stura EA, et al. Structure of the complex
between the Fab fragment of a neutralizing antibody for type 1
poliovirus and its viral epitope. Nat Struct Biol 1995;2:232–243.
43. Liu H, Smith TJ, Lee WM, et al. Structure determination of an
Fab fragment that neutralizes human rhinovirus 14 and analysis
of the Fab-virus complex. J Mol Biol 1994;240:127–137.
44. Morea V, Tramontano A, Rustici M, Chothia C, Lesk AM. Conformations of the third hypervariable region in the VH domain of
immunoglobulins. J Mol Biol 1998;275:269–294.
45. Pokkuluri PR, Bouthillier F, Li Y, Kuderova A, Lee J, Cygler M.
Preparation, characterization and crystallization of an antibody
Fab fragment that recognizes RNA. Crystal structures of native
Fab and three Fab-mononucleotide complexes. J Mol Biol 1994;243:
283–297.
46. MacCallum RM, Martin ACR, Thornton JM. Antibody-antigen
interactions: Contact analysis and binding site topography. J Mol
Biol 1996;262:732–745.
47. Kabat EA, Wu TT, Bilofsky H. Unusual distribution of amino acids
in complementarity-determining (hypervariable) segments of
heavy and light chains of immunoglobulins and their possible
roles in specificity of antibody-combining sites. J Biol Chem
1977;252:6609–6616.
394
N. KESSLER ET AL.
48. Chothia C, Lesk AM, Tramontano A, et al. Conformations of
immunoglobulin hypervariable regions. Nature 1989;342:877–
883.
49. Bajorath J, Sheriff S. Comparison of an antibody model with an
X-Ray structure: The variable fragment of BR96. Proteins 1996;24:
152–157.
50. Eigenbrot C, Randal M, Presta L, Carter P, Kossiakoff AA. X-ray
structures of the antigen-binding domains from three variants of
humanized anti-p185HER2 antibody 4D5 and comparison with
molecular modeling. J Mol Biol 1993;229:969–995.
51. Weissbuch I, Addadi L, Lahav M, Leiserowitz L. Molecular
recognition at crystal interfaces. Science 1991;253:637–645.
52. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ. Isolation
of biologically active ribonucleic acid from sources enriched in
ribonuclease. Biochemistry 1979;18:5294–5299.
53. Orlandi R, Gussow DH, Jones PT, Winter G. Cloning of immunoglobulin variable domains for expression by the polymerase chain
reaction. Proc Natl Acad Sci USA 1989;86:3833–3837.
54. Levitt M. Molecular dynamics of native protein,I: Computer
simulation of trajectories. J Mol Biol 1983;168:595–617.
55. Kabat EA, Wu TT, Perry HM, Gottesman KS, Foeller C. Sequences of proteins of immunological interest. Fifth edition.
Washington D.C.: U.S. Department of Health and Human Services, National Institutes of Health Publication:91–3242. 1991.
56. Chothia C, Lesk AM. Canonical structures for the hypervariable
regions of immunoglobulins. J Mol Biol 1987;196:901–917.
57. Kofler R, Geley S, Kofler H, Helmberg A. Mouse variable-region
gene families: Complexity, polymorphism and use in nonautoimmune responses. Immunol Rev 1992;128:5–21.
58. Max EE, Seidman JG, Leder P. Sequences of five potential
recombination sites encoded close to an immunoglobulin k constant region gene. Proc Natl Acad Sci USA 1979;76:3450–3454.
59. Sakano H, Maki R, Kurosawa Y, Roeder W, Tonegawa S. Two types
of somatic recombination are necessary for the generation of
complete immunoglobulin heavy-chain genes. Nature 1980;286:
676–683.
60. Kurosawa Y, Tonegawa S. Organization, structure and assembly
of immunoglobulin heavy chain diversity DNA segments. J Exp
Med 1982;155:201–218.
Документ
Категория
Без категории
Просмотров
3
Размер файла
2 060 Кб
Теги
999
1/--страниц
Пожаловаться на содержимое документа