close

Вход

Забыли?

вход по аккаунту

?

699

код для вставкиСкачать
1137
Differential Induction of Cell Death in Human Glioma
Cell Lines by Sodium Nitroprusside
Robert V. Blackburn, Ph.D.1
Sandra S. Galoforo, M.S.1
Christine M. Berns, B.S.1
Nalini M. Motwani, Ph.D.2
Peter M. Corry, Ph.D.1
Yong J. Lee, Ph.D.1
BACKGROUND. High grade gliomas represent very aggressive and lethal forms of
human cancer, which often exhibit recurrence after surgical intervention and resistance to conventional chemotherapeutic and radiologic treatment. The clinically
approved antihypertensive agent sodium nitroprusside (SNP) has been shown to
induce cytotoxicity toward a number of carcinoma cell lines in vitro.
METHODS. Three human glioma cell lines were examined for susceptibility to the
1
Department of Radiation Oncology, William
Beaumont Hospital, Royal Oak, Michigan.
2
ApoLife, Inc., Detroit, Michigan.
cytotoxic effects of SNP. The role of the protein kinase C (PKC)a gene in mediating
resistance to SNP-induced killing in U343 cells was investigated using antisense oligonucleotide inhibition. Stable transfection and overexpression of the PKCa gene in the
SNP-susceptible cell line U251 was performed to further implicate PKCa as a mediating factor in SNP cytotoxicity. In addition, the presence of bcl-2 protein in these cells
was examined for possible correlation(s) with resistance to SNP.
RESULTS. Exposure of U251 cells and LN-Z308 cells to 0.5 mM SNP resulted in significant cytotoxicity over a 72-hour period. U343 cells were resistant to SNP killing. U343
cells were shown to exhibit higher basal levels of PKCa and bcl-2 than either U251
or LN-Z308 cells. bcl-2 expression and resistance to SNP toxicity both were decreased
by the introduction of PKCa antisense oligonucleotides into U343 cells. Conversely,
enhanced PKC activity in PKCa-transfected U251 clones was associated with increased
bcl-2 expression and greater resistance to SNP-induced toxicity relative to control
transfected cells.
CONCLUSIONS. SNP can induce cytotoxicity in glioma cells. The susceptibility of
these glioma cells to nitroprusside-induced killing appears to be correlated inversely with bcl-2 and PKC activity. bcl-2 levels in these cells can be altered through
modulation of PKC signaling, specifically, by induction or inhibition of PKCa.
These in vitro results provide an interesting basis for further study into the potential
use of SNP for treatment of human gliomas in patients receiving combination
therapy with conventional chemotherapeutic agents that exhibit PKC inhibitory
activity. Cancer 1998;82:1137–45. q 1998 American Cancer Society.
KEYWORDS: glioma, nitroprusside, toxicity, protein kinase C-a, bcl-2.
Supported through National Institutes of Health
(National Cancer Institute) Grants CA 48000 and
CA 44550, and William Beaumont Hospital
Grants 96-03 and 97-22M.
Address for reprints: Yong J. Lee, Ph.D., Radiation Oncology Research Laboratories, William
Beaumont Hospital, 3601 W. Thirteen Mile
Road, Royal Oak, MI 48073.
Received August 27, 1997; accepted September
26, 1997.
T
he prognosis for individuals with malignant glioma is very poor,
yielding one of the highest mortality rates of all human cancers.
Therefore, development of novel therapies for this form of brain tumor is of extreme importance. Sodium nitroprusside (Na2[Fe(CN)5NO]) (SNP) is a clinically approved compound primarily used for the
treatment of acute hypertension and in vascular surgery.1 It previously
has been demonstrated that exposure to nitric oxide-donating compounds (including SNP) can inhibit mitogenesis and proliferation of
cerebellar glial cells.2 SNP is an iron-containing compound that has
been shown to release at least two physiologically active compounds,
namely cyanide and nitrosonium ion (NO/). Recently, it has been
shown that SNP, as well as other compounds that can release various
q 1998 American Cancer Society
/ 7bba$$1468
02-23-98 13:01:10
cana
W: Cancer
1138
CANCER March 15, 1998 / Volume 82 / Number 6
nitric oxide species, can influence the induction of cytotoxicity and programmed cell death,3–6 and have been
shown to be important factors in the cellular immune
responses that inhibit tumor cell growth.7 Nitric oxides
can react with superoxide to form peroxynitrite,8 an extremely reactive and cytotoxic free radical compound
that has been shown to be a strong inducer of neurotoxicity and apoptosis.9–11 Lin et al.12 have demonstrated
that peroxynitrite-induced cytotoxicity can be selective
for transformed cells, in contrast to endothelial cells
from human umbilical cord and normal human peripheral blood mononuclear cells, which were shown to be
refractory to this cytotoxicity.
Nitrogen oxides have been shown to have many
intracellular targets,13 and can alter the function of
these cellular components through S-nitrosylation. In
addition, nitric oxide can activate guanylyl cyclase and
elevate production of cyclic guanosine monophosphate (cGMP), which subsequently can modulate a
number of intracellular signaling pathways and regulatory proteins.14 Protein kinase C (PKC), key proteins
involved in multiple intracellular signaling pathways,
can be inactivated by S-nitrosylation via nitric oxidedonating compounds (S-nitroso-N-acetyl-penicillamine [SNAP] and SNP).15 Interestingly, it has been
shown that nitric oxide-induced cytotoxicity and
apoptosis can be antagonized by PKC activity.6 Human
glioma express high levels of PKC, and one specific
isoform, PKCa, has been implicated in modulating
proliferation,16 drug resistance,17 and tumorigenicity.18
Therefore, the a isoform of PKC appears to be a key
component of the transformed phenotype of glioma
cells, and may prove to be a potential target for therapeutic intervention in this form of cancer.
The mitochondrial membrane-associated protein,
bcl-2, has been reported to inhibit cell death through
antioxidant pathways.19 It also has been demonstrated
to be involved in anticancer drug resistance20 and in
the inhibition of nitric oxide-induced programmed cell
death or apoptosis.21,22 In addition, a correlation has
been shown between the level of PKC activity and the
expression of bcl-2 in glioma cells.23
In these studies, we observed inherent differences
in the relative sensitivities of three glioma cell lines
to SNP exposure. Examination of these cells revealed
differential expression of at least two proteins that
have been implicated previously in the regulation of
drug sensitivity, PKCa and bcl-2. Modulation of SNP
sensitivity and bcl-2 expression was demonstrated by
specific alteration of PKCa levels.
MATERIALS AND METHODS
Reagents
SNP, and potassium ferricyanide (KCN) were purchased from Sigma Chemical Company (St. Louis,
/ 7bba$$1468
02-23-98 13:01:10
cana
MO). Phosphorothioate primers used for antisense
studies were synthesized by Keystone Laboratories
(Menlo Park, CA), and LipofectACETM reagent used for
antisense transfections and geneticin was obtained
from Life Technologies (Grand Island, NY). The plasmids pJ5-hMTIIa and Alpha pJ5-hMTIIa (containing
bovine PKCa), were graciously provided by Dr. Kirk
Ways (East Carolina University School of Medicine,
Greenville, NC).
Cell Lines
Three human glioma cell lines were used for these
studies: U343, U251, and LN-Z308. The cells were cultured in McCoy’s 5a medium (Cellgro, Herndon, VA)
containing 26 mM sodium bicarbonate and 10% ironsupplemented calf serum (HyClone, Logan, UT). T-25/
75 flasks or 35-mm culture dishes containing cells are
kept in a 37 7C humidified incubator with a mixture
of 95% air and 5% carbon dioxide.
Drug Treatment
SNP was used at a concentration of 0.5 mM for time
course experiments, and at various concentrations (0 –
1.0 mM) for dose response experiments. A stock solution of SNP (50 mM) and KCN (50 mM) was prepared
fresh in Hanks balanced salt solution (HBSS) and
placed into equilibrated media (temperature and pH)
at the appropriate dilution, and added to cells to initiate each experiment.
Clonogenic Survival Assay
For survival determination after drug treatment, cells
were trypsinized, counted, and plated in duplicate at
appropriate dilutions. After incubation at 37 7C for 1 –
3 weeks, colonies were stained with crystal violet and
counted. Survival values were normalized for plating
efficiency of control (untreated) cells, and for percentage of detached cells resulting from drug cytotoxicity.
Duplicate flasks of each experimental sample were
plated for survival determination, and two or more
independent experiments were performed for each
survival point.
Polyacrylamide Gel Electrophoresis and Western Blot
Analysis
For one-dimensional polyacrylamide gel electrophoresis (PAGE) and Western blot analysis, cells
were solubilized with lysis buffer (2.4 M glycerol,
0.14 M Tris [pH 6.8], 0.21 M sodium dodecyl sulfate
[SDS], and 0.3 mM bromphenol blue). Samples were
boiled for 5 minutes and protein content was measured using BCATM protein assay reagent (Pierce,
Rockford, IL) standardized for bromphenol blue
content. Equal amounts of protein (30 mg) were ana-
W: Cancer
Differential Nitroprusside Toxicity in Glioma Cells/Blackburn et al.
1139
lyzed on 5% SDS-PAGE for stacking gel and 10 – 18%
linear gradient SDS-PAGE for separating gel. After
electrophoresis, the proteins were transferred onto
a nitrocellulose membrane and processed for immunoblotting with the appropriate dilutions of PKCa
polyclonal (Life Technologies, Gaithersburg, MD),
bcl-2 monoclonal (Dakopatts, Glosstrup, Denmark),
and actin monoclonal (ICN, Irvine, CA) antibodies.
Blots then were incubated with horseradish peroxidase-linked secondary antibody, and processed for
visualization using the ECL Detection System (Amersham, Arlington Heights, IL) and Fuji (Fuji Medical
Systems, Stamford, CT) X-ray film.
PKCa Antisense Treatment of U343 Cells
Phosphorothioate oligonucleotides containing human PKCa antisense sequences were synthesized
based on the primer design of Dean et al.24 An oligo
containing antisense sequences targeting the 3*-untranslated region of the PKCa mRNA (GTTCTCGCTGGTGAGTTTCA, oligo #1), and a random primer of
the same length and approximate melting temperature were introduced into U343 cells by a modification of the protocol of Dean et al.24 Briefly, U343
cells were plated into 35-mm plates to obtain confluency of 80% after 24 hours. The cells were washed
twice in HBSS, and duplicate plates were incubated
in 1-mL serum free medium containing 20 mg/mL
LipofectACETM reagent and 0.5 or 1.0 mM antisense
oligonucleotide, and incubated at 37 7C for 4 hours.
Cells were washed twice with media containing 1%
serum, and incubated in the same medium containing 1 mM SNP for an additional 44 hours prior
to analysis and survival determination.
Transfection and Selection
Exponentially growing U251 cells were plated into
60-mm Petri dishes at 4 1 105 cells per plate 2 days
prior to transfection. The cells were cotransfected
with 10 mg of either Alpha pJ5-hMTIIa, containing
the bovine PKCa gene,25 or parental control plasmid,
pJ5-hMTIIa, and pMAM-neo (Clonetech, Palo Alto,
CA) using standard calcium phosphate transfection
protocols.26 Stable transfectants were selected with
400 mg/mL geneticin for approximately 1 week, followed by continued growth in the presence of 200
mg/mL geneticin to obtain colonies suitable for isolation, and were frozen at low passage numbers.
Transfected cell lines with passage numbers between 4 and 10 were used for the experiments described herein.
Measurement of PKC Activity
Activity of PKC in glioma cell lysates was assayed
using the MESACUPt Protein Kinase Assay System
/ 7bba$$1468
02-23-98 13:01:10
cana
FIGURE 1. Effects of sodium nitroprusside (SNP) and potassium ferricyanide (KCN) on cell survival. Glioma cell lines U251, LN-Z308, and U343
were exposed to KCN or SNP for 48 hours prior to plating for survival
determination. The legend for the cell lines is shown at the top of graph.
Bars represent the average relative survival of two separate experiments,
and standard error bars are shown.
(Upstate Biotechnology, Lake Placid, NY) as per
manufacturer’s protocol. Briefly, cells were harvested into assay buffer (50 mM Tris-HCl [pH 7.4],
1% NP-40, 150 mM NaCl, 1 mM ethylene diamnetetraacetic acid, 1 mM phenylmethyl sulfonyl fluoride,
aprotinin/leupeptin/pepstatin (1 mg/mL each), 1
mM Na3VO4 , and 1 mM NaF ), sonicated, and clarified by centrifugation. Lysates were incubated sequentially in microtiter wells coated with a biotinylated monoclonal antibody (2B9) that binds to the
activated (phosphorylated) form of PKC, streptavidin/peroxidase conjugate, and peroxidase substrate.
Final reactions were measured photometrically at
490 nanometers.
RESULTS
Cytotoxic Effects of SNP on Glioma Cell Lines
Because SNP can release both nitric oxide and cyanide, the toxicity of SNP exposure was compared
with treatment with the cyanide compound KCN in
U343, U251, and LN-Z308 glioma cells. The cells
were exposed to SNP (0.5 mM) or KCN (0.5 mM) for
48 hours, and assayed for clonogenic survival. Figure
1 shows the relative survival of the three glioma cell
lines. KCN induced little cytotoxicity in these cell
lines at 0.5 mM. U251 and LN-Z308 cells exposed to
the same concentration of SNP exhibited marked
decrease in survival rates (approximately 81% and
64% decreased survival, respectively). U343 cells
were not affected significantly by SNP exposure.
W: Cancer
1140
CANCER March 15, 1998 / Volume 82 / Number 6
FIGURE 2.
Dose response of glioma cells
to sodium nitroprusside (SNP) exposure. Glioma cell lines were incubated in the presence
of various concentration of SNP (0.1–1.0
mM) for 48 hours prior to trypsinization and
plating for survival determination. Survival of
each cell line was standardized for plating efficiency and detached cells.
FIGURE 3.
Time course of sodium nitroprusside (SNP) toxicity. Glioma cell lines were
incubated at 37 7C in media containing 0.5
mM SNP for the various time periods indicated, prior to harvesting and plating for survival determination. Cell line markers are designated in the inset legend.
Dose Response of SNP Cytotoxicity in Glioma Cell Lines
With the purpose of examining nitric oxide-donating
compounds for possible anti-cancer activity, we chose
to further examine the cytotoxic activity of the clinically approved agent, SNP. The three glioma cell lines
were exposed to various concentrations of SNP (0, 0.1,
0.25, 0.5, 0.75, and 1.0 mM) for 48 hours prior to plating
in duplicate for survival determination. Survival relative to untreated cells is shown for each cell line in
Figure 2. Markers indicate the average of duplicate
survival flasks and graph lines were generated from
the average survival values of two separate experiments. U343 cell remained relatively resistant to SNP
killing over the entire range of drug concentrations.
The U251 and LN-Z308 cells exhibited increased cytotoxicity and decreased survival in a dose dependent
pattern, with similar survival levels at various drug
concentrations. In addition, U251 and LN-Z308 cells
exhibited morphologic changes characteristic of
apoptosis on exposure to SNP concentrations of ¢0.5
mM, including nuclear condensation and fragmentation (apoptotic bodies), as well as cytoplasmic retraction and blebbing (data not shown).
Time Course of SNP-Induced Cytotoxicity
From the dose response data in Figure 2, an intermediate
concentration of SNP was chosen to examine the time
course of cytotoxicity. The glioma cell lines were exposed
to 0.5 mM SNP for various time periods (0, 24, 32, 48,
56, and 72 hours) followed by plating for survival assay
as described in Figure 2. Survival relative to untreated
control cells is shown in Figure 3. U343 cells were resistant to SNP toxicity over the duration of the exposure.
/ 7bba$$1468
02-23-98 13:01:10
cana
U251 cells exhibited the greatest reduction in viability
at all time points, whereas LN-Z308 cells demonstrated
intermediate cytotoxicity. Differences in LN-Z308 survival levels at the 48-hour (0.5 mM SNP) points displayed
in dose response versus time course assays may be due
to a difference in passage number of cells used these
experiments, although PKCa levels were similar in Western blot analysis (not shown).
Differential Protein Expression in U343, U251, and LNZ308 Cells
Because a differential response to SNP exposure was
observed between the three glioma cell lines, 10 – 18%
SDS-PAGE and immunoblotting was performed to detect factors that could mediate SNP susceptibility.
After transfer of the proteins to nitrocellulose, proteins
were detected with specific antibodies to PKCa, bcl-2,
and actin, shown in Figure 4. U251 cells exhibited the
lowest relative basal level of PKCa. U343 and LN-Z308
cells contained 3-fold and 1.2-fold greater levels of
PKCa, respectively, than U251 cells. Detection of the
antiapoptotic protein bcl-2 demonstrated that U343
contained a greatly elevated basal level of this protein
than U251 cells (approximately 9.5-fold), and a much
greater level than detected in LN-Z308 cells (approximately 3.5-fold). Actin bands were monitored on the
same blot to verify consistency of protein loading and
standardization of densitometric scan values.
Effects of PKCa-Antisense Oligonucleotide on U343 Cells
Because the distinctly higher level of basal PKCa detected in U343 cells correlated with greater resistance
to SNP, we examined the effects of modulating PKCa
W: Cancer
Differential Nitroprusside Toxicity in Glioma Cells/Blackburn et al.
1141
FIGURE 4. Immunoblot detection of protein kinase Ca (PKCa) and bcl2 in glioma cell lysates. Protein (50 mg) from exponentially growing U251,
U343, and LN-A308 cells was resolved by 10–18% gradient sodium dodecyl sulfate-polyacrylamide gel electrophoresis and processed for immunobloting with specific antibodies to PKCa, bcl-2, and actin.
levels using an antisense oligonucleotide. U343 cells
were treated with a solution of liposomes/PKCa-antisense oligonucleotide, followed by exposure to 1 mM
SNP for 48 hours, and plating for survival determination. Figure 5 shows the survival of U343 cells that
were treated with a control oligonucleotide (1 mM)
alone, PKCa-antisense oligo (1 mM) alone, or SNP and
antisense oligonucleotide in combination. All values
are represented as the viable percentage of SNP/liposome treated controls. Markers represent values derived from duplicate survival assays, and bars indicate
average survival of both assays. The PKCa-antisense
oligonucleotide alone decreased cell viability by 40%.
The combination of SNP and antisense oligonucleotide lowered U343 cell survival by approximately 63%
of the control cells. The high background of cell killing
by the PKCa-antisense oligonucleotide was not decreased by reduction of the concentration to 0.5 mM
(data not shown). However, these data indicate that
the basal PKCa level present in U343 cells may influence the susceptibility to SNP killing, and pretreatment with 1 mM PKCa-antisense oligonucleotide appears to increase the sensitivity of U343 cells to SNP
cytotoxicity. Immunoblot detection of PKCa protein
(inset in graph of Figure 5) shows that the levels of
PKCa and bcl-2 were comparable in both untreated
(Lane 1) and control oligonucleotide-treated cells
(Lane 2), whereas the level of both PKCa and bcl-2
were decreased in cells treated with 1 mM oligo #1
(Lane 3) by approximately 49% and 41%, respectively,
as detected by densitometric scan.
Overexpression of PKCa and Altered Drug Sensitivity
U251 Cell Transfectants
To examine whether the putative involvement of PKCa
in mediating SNP cytotoxicity is a generalized or cell
/ 7bba$$1468
02-23-98 13:01:10
cana
FIGURE 5.
Effects of sodium nitroprusside (SNP) and protein kinase
Ca (PKCa) antisense oligonucleotide (oligo) treatment on U343 cell survival. U343 cells were exposed to a PKCa antisense oligonucleotide in the
presence of LipofectACETM (Life Technologies, Grand Island, NY) for 4
hours prior to incubation in 1 mM SNP for 48 hours at 37 7C. The cells
were harvested by trypsinization and plated in duplicate for survival determination. The bars in this graph represent the average percent survival
(compared with LipofectACETM/SNP treated controls) of cells treated with
SNP or antisense oligonucleotide alone or in combination for two separate
assays. Inset immunoblot stain shows detection of PKCa from untreated
(Lane 1), control oligonucleotide treated (Lane 2), and antisense oligonucleotide treated (Lane 3) U343 cells. Actin bands were detected in the
same gel lanes to monitor standardization of sample loading.
line specific phenomenon, U251 cells were transfected
stably with the vector pJ5-hMTIIa containing the bovine PKCa gene. Proteins from transfected clones were
harvested and resolved on 10 – 18% gradient SDSPAGE gels. The proteins were transferred to nitrocellulose and immunoblotted with specific antibodies for
PKCa, bcl-2, and actin. The inset of Figure 6A shows
the relative PKCa and bcl-2 protein expression from
the control plasmid transfected cells (U2/pSV#2 and
#3) and from PKCa transfected clones (U2/PKC#1-8).
PKCa clones 3 and 4 expressed the highest levels of
both PKCa and bcl-2 of the clones examined. Densitometric scan of the PKCa bands indicates that clones
3 and 4 expressed approximately 6.4-fold and 5-fold
higher than the levels of control clone pSV#2, respectively. It should be noted that the PKCa level detected
in control clone pSV#3 was twice the amount detected
in clone pSV#2; however, subsequent immunoblots of
additional control clones revealed relative PKCa levels
similar to that of pSV#2. Actin bands also were detected in each sample for standardization of protein
loading. PKC activity also was measured for each of
the transfected clones, as well as for parental U251,
U343, and LN-308 cells. Bars in the graph portion of
Figure 6A represent the mean PKC activity (as fold
increase over basal U251 levels). The assays were per-
W: Cancer
1142
CANCER March 15, 1998 / Volume 82 / Number 6
formed in triplicate and error bars represent standard
deviation between assays. U251/PKCa-transfected
clones 3 and 4 exhibited approximately 14.7-fold and
2.5-fold greater PKC activity than parental U251 cell
levels. It should be noted that this assay detects total
activated PKC and is not specific for PKCa. It is interesting to note that, elevated PKC activity in other
PKCa-transfected clones that expressed relatively high
levels of PKCa protein (e.g., clone 6) was not detected.
Basal levels of PKC activity in U343 cells was approximately threefold greater than in U251 cells.
Control-transfected clones (pSV#2 and #3) and
PKCa-transfected clones (U251/PKCa#1-8) were exposed to 0.5 mM SNP for 48 hours and plated for
clonogenic survival determination. Only PKCa clones
3 and 4 displayed significantly greater survival than
control transformed clones (data not shown). To examine the relative dose response of these partially resistant clones, control-transfectant U2/pSV#2 and
PKCa-transfectant clones U2/PKC#3 and U2/PKC#4
were exposed to various concentrations of SNP and
incubated for 48 hours. Figure 6B shows the relative
survival values for these cells. The U2/PKC#3 clone,
which exhibited the highest detected levels of PKC activity, PKCa, and bcl-2 protein of the clones examined
(Fig. 6A), showed the greatest increase in resistance
to SNP exposure at all concentrations compared with
control cells. Clone U2/PKC#4 also demonstrated increased resistance to SNP over the control cells; however, it was less resistant than U2/PKC#3 at all concentrations of SNP examined.
DISCUSSION
FIGURE 6. (A) Protein kinase Ca (PKCa) and bcl-2 protein expression
and PKC activity in U251 transfected cells. Expression of PKCa and bcl2 protein was detected in cellular lysates of control plasmid transfected
clones pSV#2 (N2) and pSV#3 (N3) and PKCa transfected clones (U251/
PKCa#1-8), as shown in the inset. Immunoblotting of actin also was
performed to monitor relative protein loading. PKC activity was measured
for the transfected U251 cells, and for untransfected glioma cell lines
U343 (U3) and LN-Z308 (LN). Bars represent the average fold increase
in PKC activity compared with untransfected U251 cells. Error bars show
standard deviation between assays. (B) Assay for resistance to sodium
nitroprusside (SNP) killing in transfected cells. Control clone U2/pSV#2
and PKCa transfected clones U2/PKCa#3 and U2/PKCa#4 were treated
with various concentrations of SNP (0–1.0 mM, as shown) for 48 hours,
and plated for survival determination. Cell line markers are designated in
the inset legend. Each point represents the average of two assays; error
bars indicate standard error.
/ 7bba$$1468
02-23-98 13:01:10
cana
The vasodilatory (antihypertensive) effects of SNP
have been well documented and utilized clinically for
many years. Relatively recent information has been
reported regarding the cytotoxic activity of SNP and
other nitric oxide-donating compounds on transformed cells.27,28 We have investigated the cytotoxic
effects of SNP on three glioma lines. This toxicity appears to be the predominant result of nitrosonium ion
(NO/) rather than the cyanide moiety release by SNP,
because exposure to equimolar amounts of KCN were
relatively nontoxic to all three cell lines (Fig. 1). It is
interesting to note that the two glioma cell lines that
were sensitive to SNP-induced toxicity also were deficient in expression of the tumor suppressor gene, p53.
U251 cells, which express mutant p53, and LN-Z308
cells, which do not express significant levels of any
form of p53 protein,29 exhibited extensive SNP-induced cytotoxicity. U343 cells, which express low levels of normal p53,30 were resistant to SNP-induced cytotoxicity in concentrations of 1 mM (Fig. 2) and possibly greater (data not shown). Fan et al.31 recently
W: Cancer
Differential Nitroprusside Toxicity in Glioma Cells/Blackburn et al.
showed that alteration of normal p53 function can
sensitize the breast carcinoma cell line MCF-7 to cisplatin. Like cisplatin, nitric oxide also can induce DNA
damage,32 – 34 which may accumulate in cells lacking
normal p53 activity. Because it recently was demonstrated that normal p53 (not mutant p53) directly can
affect DNA repair activity,35 it is reasonable to question
the possible role of p53 in establishing resistance to
SNP in U343 cells. However, we observed extensive
cytotoxicity/apoptosis in MCF-7 cells, which express
normal p53, on exposure to 0.5 mM SNP (unpublished
data). Because MCF-7 cells have been shown to be
relatively resistant to induction of apoptosis after DNA
damage,36 the major cytotoxic effects of SNP in these
cells may initiated through p53 and/or DNA damage
independent pathway(s), and may prove to be cell type
specific. Ongoing investigations include the use of specific antisense oligonucleotides to examine the possible role of normal p53 in the resistance of U343 cells
to SNP.
Our data suggest an inverse correlation between
the relative levels of basal PKCa and bcl-2 expression
(Fig. 4) and the amount of cytotoxicity induced in the
glioma cells examined (Figs. 1, 2, and 3). U343 cells,
which express the greatest basal level of both PKCa
and bcl-2, exhibit the highest relative resistant to SNP
cytotoxicity, and specific down-regulation of PKCa in
these cells with antisense oligonucleotides decreases
bcl-2 expression and resistance to SNP (Fig. 5). These
data are consistent with previous findings that demonstrated that induction of PKCa can inhibit nitric oxideinduced apoptosis in RAW 264.7 macrophage cells.6
The histologic studies of Benzil et al.37 indicated that
PKCa expression levels may be indicative of astrocytoma grade classification, with well differentiated tumors expressing the highest PKCa levels, and low or
nondetectable levels expressed in aggressive glioblastomas. Of the three cell lines examined in our studies,
the U343 cell line exhibits the most highly differentiated phenotype, in contrast to U251 cells, which demonstrate higher proliferation rates, random growth
patterns, and greater metastatic activity (reference 38
and unpublished data) than U343. Because our data
revealed that SNP toxicity was greatest in the U251
cells, we can speculate that SNP cytotoxicity may be
most pronounced in undifferentiated and more aggressive tumor cells. However, additional in vitro and
in vivo studies will be required to confirm this hypothesis.
Several mechanisms have been implicated in the
induction of cytotoxicity by nitric oxide-donating
compounds. SNP may initiate cytotoxicity through release of nitric oxide and reaction with superoxide to
form peroxynitrite, which subsequently can inhibit
/ 7bba$$1468
02-23-98 13:01:10
cana
1143
mitochondrial respiration.39 Nitric oxides can induce
cellular damage both directly and also by elevating
intracellular levels of cGMP, which subsequently can
regulate cGMP-dependent phosphodiesterases, ion
channels, and protein kinases.14 Devi et al.40 have
shown that exposure of cultured glia to the nitric oxide-donating agent SNAP (S-nitroso-N-acetylpenacillamin) can down-regulate peptide biosynthetic enzymes, which may contribute to the cytostatic and/or
cytotoxic effects of nitric oxide on glial cells. Another
mechanism through which nitric oxide may induce
toxicity and apoptosis is by inactivating glutathione
peroxidase, allowing accumulation of peroxides.41 Mitrovic et al.42 reported differential effects of nitric oxide
on primary rat glial cells, associated with partial loss
of activity in the mitochondrial enzyme succinate dehydrogenase. Nitric oxide-induced apoptosis also has
been shown to involve cleavage of poly(ADP-ribose)
polymerase (or PARP), and this cleavage can be inhibited by expression of bcl-2.43 Our findings demonstrating a correlation between bcl-2 level and resistance
to SNP-related toxicity would be consistent with this
mechanistic pathway. However, the exact mechanism
of cell toxicity observed in our studies remains to be
determined.
Drug resistance can develop in both normal and
cancerous cells through various mechanisms. As Matsumoto et al.17 and others have demonstrated, high
levels of immunoreactive PKCa levels (and activity)
have been shown to activate the drug efflux function
of the p-glycoprotein through increased phosphorylation. However, to our knowledge, expression of multidrug resistant gene(s) and p-glycoprotein products
have not been demonstrated for the U343 cell line.
However, drug resistance also can be affected by elevated levels of other intracellular proteins. The antiapoptotic protein bcl-2 also has been implicated in the
establishment of drug resistance.20 Increased expression and activation of PKC has been correlated with
increased bcl-2 expression44 and activation via phosphorylation.45 Conversely, inhibition of PKC activity
can decrease expression and phosphorylation of bcl2 in glioma cells.23 Our data also demonstrate a correlation between the relative resistance of three glioma
cell lines and the basal levels of bcl-2 expression (Fig.
4), possibly implicating bcl-2 as an inhibitor of nitric
oxide-mediated cleavage of PARP, as described earlier.22,43 In addition, bcl-2 protein levels appear to be
altered through specific modulation of PKCa in U343
cells (Fig. 5) and U251 cells (Fig. 6A). We observed that
significantly increased resistance of PKCa-transfected
U251 cells to SNP occurred only in U251/PKCa clones
3 and 4 (Fig. 6B) (data not shown). These clones also
expressed the greatest basal PKC activity, as well as
W: Cancer
1144
CANCER March 15, 1998 / Volume 82 / Number 6
greatest levels of both PKCa and bcl-2. It is interesting
to note that expression levels of PKCa protein in transfected cells did not directly correlate with increased
generalized phosphorylation (activation) of PKC (see
Fig. 6A, U251/PKCa clone #6). One possible factor contributing to this phenomenon may be differences in
individual transfected clones to the PKC-inactivating
properties of nitric oxide.15 In addition, several clones
that expressed higher levels of bcl-2 than control transfected cells were not resistant to SNP levels of 0.5 mM
used to screen these clones (e.g., U251/PKCa, clone
#1). However, this level of bcl-2 expression may provide resistance to lower concentrations of SNP. Ongoing investigations will examine further the quantitative
relationship between bcl-2 expression and SNP resistance. bcl-2 may be involved directly in the scavenging
of free radical species19 and also has been implicated
in the inhibition of nitric oxide-induced apoptosis.46
Our data suggest that the level of bcl-2 in the glioma
cell lines examined may determine the relative resistance to SNP toxicity, and this resistance can be modulated by altering the expression and/or activation of
the a isoform of PKC.
The possible use of SNP as an adjuvant chemotherapeutic agent is intriguing for several reasons.
First, SNP is a clinically approved agent with known
therapeutic and toxicity levels through its use as an
antihypertensive agent. And although levels of SNP
such as those examined in the current study could
not be achieved safely clinically, much lower systemic
levels of SNP may be useful as an adjuvant chemotherapy, particularly in combination with agents that have
been demonstrated to suppress PKC expression, such
as staurosporine and tamoxifen.47 In addition, our laboratory recently has observed supraadditive cytotoxicity in breast carcinoma cells exposed to a combination
of paclitaxel and SNP (unpublished data). Investigations of alternative nitric oxide-donating compounds
that do not exhibit cyanide toxicity may increase the
potential use of this type of adjuvant therapy. Second,
SNP is effective in the induction of cytotoxicity (including apoptosis) in a variety of carcinoma cells in
vitro, and may exhibit selectivity for transformed cells
over normal cells through a peroxynitrite-mediated
pathway.11 Because SNP-induced cell death can be initiated in the absence of functional p53, the mutational
status of p53 would not appear to be a limiting factor
for the efficacy of this drug. In addition to its direct
cytotoxic effects, SNP also may prove to be an effective
chemotherapeutic agent for treatment tumor cells in
vivo by: 1) increasing circulation and delivery of other
chemotherapeutic agents (e.g., PKC inhibitory compounds) through the commonly inadequate microvasculature of a tumor and 2) by contributing to increased
/ 7bba$$1468
02-23-98 13:01:10
cana
permeability of the blood-brain barrier,48 thus increasing accessibility of malignant brain tumors to systemically delivered chemotherapeutic agents. Therefore,
further investigations into the use of SNP and other
nitric oxide-donating compounds may provide a
unique means of potentiating the effects of cytotoxic
drugs in the treatment of glioma and other forms of
cancer.
REFERENCES
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Abrams MJ, Murrer BA. Metal compounds in therapy and
diagnosis. Science 1993;261:725–30.
Garg UC, Devi L, Turndorf H, Goldfrank LR, Bansinath M.
Effect of nitric oxide on mitogenesis and proliferation of
cerebellar glial cells. Brain Res 1992;592:208–12.
Albina JE, Cui S, Mateo RB, Reichner JS. Nitric oxide-mediated apoptosis in murine peritoneal macrophages. J Immunol 1993;150:5080–5.
Blanco FJ, Ochs RL, Schwarz H, Lotz M. Chondrocyte
apoptosis induced by nitric oxide. Am J Pathol 1995;146:75–
85.
Fehsel K, Kroncke KD, Meyer KL, Huber H, Wahn V, KolbBachofen V. Nitric oxide induces apoptosis in mouse thymocytes. J Immunol 1995;155:2858–65.
Messmer UK, Lapetina EG, Brune B. Nitric oxide-induced
apoptosis in RAW 264.7 macrophages is antagonized by protein kinase C- and protein kinase A-activating compounds.
Mol Pharmacol 1995;47:757–65.
Stuehr DJ, Nathan CF. Nitric oxide. A macrophage product
responsible for cytostasis and respiratory inhibition in tumor target cells. J Exp Med 1989;169:1543–55.
Stamler JS, Singel DJ, Loscalzo J. Biochemistry of nitric oxide
and its redox-activated forms. Science 1992;258:1898–902.
Salgo MG, Squadrito GL, Pryor WA. Peroxynitrite causes
apoptosis in rat thymocytes. Biochem Biophys Res Commun
1995;215:1111–8.
Estevez AG, Radi R, Barbeito L, Shin JT, Thompson JA, Beckman JS. Peroxynitrite-induced cytotoxicity in PC12 cells: evidence for an apoptotic mechanism differentially modulated
by neurotrophic factors. J Neurochem 1995;65:1543–50.
Bonfoco E, Krainc D, Ankarcrona M, Nicotera P, Lipton SA.
Apoptosis and necrosis: two distinct events induced, respectively, by mild and intense insults with -methyl-D-aspartate
or nitric oxide/superoxide in cortical cell cultures. Proc Natl
Acad Sci USA 1995;92:7162–6.
Lin KT, Xue JY, Nomen M, Spur B, Wong PY. Peroxynitriteinduced apoptosis in HL-60 cells. J Biol Chem 1995;
270:16487–90.
Stamler JS. Redox signaling: nitrosylation and related target
interactions of nitric oxide. Cell 1994;78:931–6.
Schmidt HHHW, Walter U. NO at work. Cell 1994;78:
919–25.
Gopalakrishna R, Chen ZH, Gundimeda U. Nitric oxide and
nitric oxide-generating agents induce a reversible inactivation of protein kinase C activity and phorbol ester binding.
J Biol Chem 1993;268:27180–5.
Baltuch GH, Dooley NP, Rostworowski KM, Villemure JG,
Yong VW. Protein kinase C isoform alpha overexpression in
C6 glioma cells and its role in cell proliferation. J Neurooncol
1995;24:241–50.
Matsumoto T, Tani D, Yamaura I, Miyaji K, Kaba K. Effects
of protein kinase C modulators on multidrug resistance in
human glioma cells. Neurosurgery 1995;36:565–71.
W: Cancer
Differential Nitroprusside Toxicity in Glioma Cells/Blackburn et al.
18. Ahmad S, Mineta T, Martuza RL, Glazer RI. Antisense expression of protein kinase C alpha inhibits the growth and tumorigenicity of human glioblastoma cells. Neurosurgery
1994;35:904–8.
19. Hockenbery DM, Oltvai ZN, Yin XM, Milliman CL, Korsmeyer SJ. Bcl-2 functions in an antioxidant pathway to prevent apoptosis. Cell 1993;75:241–51.
20. Desoize B. Anticancer drug resistance and inhibition of
apoptosis. Anticancer Res 1994;14:2291–4.
21. Messmer UK, Reed UK, Brune B. Bcl-2 protects macrophages from nitric oxide-induced apoptosis. J Biol Chem
1996;271:20192–7.
22. Melkova Z, Lee SB, Rodriguez D, Esteban M. Bcl-2 prevents
nitric oxide-mediated apoptosis and poly(ADP-ribose) polymerase cleavage. FEBS Lett 1997;403:273–8.
23. Ikemoto H, Tani E, Matsumoto T, Nakano A, Furuyama J.
Apoptosis of human glioma cells in response to calphostin
C, a specific protein kinase C inhibitor. J Neurosurg
1995;83:1008–16.
24. Dean NM, McKay R, Condon TP, Bennett F. Inhibition of
protein kinase C-a expression in human A549 cells by antisense oligonucleotides inhibits induction of intercellular adhesion molecule 1 (ICAM-1) mRNA by phorbol esters. J Biol
Chem 1994;269:16416–24.
25. Ways DK, Kukoly CA, deVente J, Hooker JL, Bryant WO,
Posekany KJ, et al. MCF-7 breast cancer cells transfected
with protein kinase C-a exhibit altered expression of other
protein kinase C isoforms and display a more aggressive
neoplastic phenotype. J Clin Invest 1995;95:1906–15.
26. Kingston RE. Transfection of DNA into eukaryotic cells. Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG,
Smith JA, et al., editors. Short protocols in molecular biology.
New York: John Wiley and Sons, 1992:[9–3]-[9–5].
27. Jenkins DC, Charles IG, Thomsen LL, Moss DW, Holmes LS,
Baylis SA, et al. Roles of nitric oxide in tumor growth. Proc
Natl Acad Sci USA 1995;92:4392–6.
28. Farias-Eisner R, Chaudhuri G, Aeberhard E, Fukuto JM. The
chemistry and tumoricidal activity of nitric oxide/hydrogen
peroxide and the implications to cell resistance/susceptibility. J Biol Hematol 1996;271:6144–51.
29. Van Emir EG, Kikuchi T, Tada M, Li H, Diserens AC, Wojcik
BE, et al. Analysis of the p53 gene and its expression in
human glioblastoma cells. Cancer Res 1994;54:649–52.
30. Asai A, Miyagi Y, Sugiyama A, Gamanuma M, Hong SH, Takamoto S, et al. Negative effects of wild-type p53 and sMyc on cellular growth and tumorigenicity of glioma cells.
Implication of the tumor suppressor genes for gene therapy.
J Neurooncol 1994;19:259–68.
31. Fan S, Smith ML, Rivet DJ, Duba D, Zhan Q, Kohn KW, et
al. Disruption of p53 function sensitizes breast cancer MCF7 cells to cisplatin and pentoxifylline. Cancer Res 1995;
55:1649–54.
32. Inoue S, Kawanishi S. Oxidative DNA damage induced by
simultaneous generation of nitric oxide and superoxide.
FEBS Lett 1995;371:86–8.
33. Nguyen T, Brunson D, Crespi CL, Penman BW, Wishnok JS,
Tannenbaum SR. DNA damage and mutation in human cells
/ 7bba$$1468
02-23-98 13:01:10
cana
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
1145
exposed to nitric oxide in vitro. Proc Natl Acad Sci USA
1992;89:3030–4.
Wink DA, Kasprzak KS, Maragos CM, Elespuru RK, Misra M,
Dunams TM, et al. DNA deaminating ability and genotoxicity
of nitric oxide and its progenitors. Science 1991;254:1001–3.
Mummenbrauer T, Janus F, Muller B, Wiesmuller L, Deppert
W, Grosse F. p53 Protein exhibits 3*-to-5* exonuclease activity. Cell 1996;85:1089–99.
Zhan Q, Fan S, Bae I, Guillouf C, Liebermann DA, O’Connor
PM, et al. Induction of bax by genotoxic stress in human cells
correlates with normal p53 status and apoptosis. Oncogene
1994;9:3743–51.
Benzil DL, Finkelstein SD, Epstein MH, Finch PW. Expression pattern of alpha-protein kinase C in human astrocytomas indicates a role in malignant progression. Cancer Res
1992;52:2951–6.
Abe T, Mori T, Kohno K, Seiki M, Hayakawa T, Welgus HG,
et al. Expression of 72 kDa type IV collagenase and invasion
activity of human glioma cells. Clin Exp Metastasis
1994;12:296–304.
Szabo C, Salzman AL. Endogenous peroxynitrite is involved
in the inhibition of mitochondrial respiration in immunostimulated J774.2 macrophages. Biochem Biophys Res Commun 1995;209:739–43.
Devi L, Petanceska S, Liu R, Arbabha B, Bansinath M, Garg
U. Regulation of neuropeptide-processing enzymes by nitric
oxide in cultured astrocytes. J Neurochem 1994;62:2387–93.
Asahi M, Fujii J, Suzuki K, Seo HG, Kuzuya T, Hori M, et
al. Inactivation of glutathione peroxidase by nitric oxide.
Implication for cytotoxicity. J Biol Chem 1995;270:21035–9.
Mitrovic B, Ignarr LJ, Montestruque S, Smoll A, Merrill JE.
Nitric oxide as a potential pathological mechanism in demyelination: its differential effects on primary glial cells in vitro.
Neuroscience 1994;61:575–85.
Messmer UK, Reimer DM, Reed JC, Brune B. Nitric oxide
induced poly(ADP-ribose) polymerase cleavage in RAW
264.7 macrophage apoptosis is blocked by Bcl-2. FEBS Lett
1996;384:162–6.
Genestier L, Bonnefoy-Berard N, Rouault JP, Flacher M, Revillard JP. Tumor necrosis factor-alpha up-regulates Bcl-2
expression and decreases calcium-dependent apoptosis in
human B cell lines. Int Immunol 1995;7:533–40.
May WS, Tyler PG, Ito T, Armstrong DK, Qatsha KA, Davidson NE. Interleukin-3 and bryostatin-1 mediate hyperphosphorylation of BCL2 alpha in association with suppression
of apoptosis. J Biol Chem 1994;269:26865–70.
Ho YS, Lee HM, Mou TC, Wang YJ, Lin JK. Suppression of
nitric oxide-induced apoptosis by N-acetyl-L-cysteine
through modulation of glutathione, bcl-2, and bax protein
levels. Mol Carcinog 1997;19:101–13.
Couldwell WT, Antel JP, Apuzzo ML, Yong VW. Inhibition of
growth of established human glioma cell lines by modulators
of the protein kinase-C system. J Neurosurg 1990;73:594–600.
Buster BL, Weintrob AC, Townsend GC, Scheld WM. Potential role of nitric oxide in the pathophysiology of experimental bacterial meningitis in rats. Infect Immun 1995;63:
3835–9.
W: Cancer
Документ
Категория
Без категории
Просмотров
3
Размер файла
164 Кб
Теги
699
1/--страниц
Пожаловаться на содержимое документа