close

Вход

Забыли?

вход по аккаунту

?

39

код для вставкиСкачать
DEVELOPMENTAL DYNAMICS 212:346–351 (1998)
Tooth Eruption Molecules Enhance MCP-1 Gene
Expression in the Dental Follicle of the Rat
BENITO G. QUE AND GARY E. WISE*
Department of Veterinary Anatomy and Cell Biology, School of Veterinary Medicine, Louisiana State University,
Baton Rouge, Louisiana
ABSTRACT
Tooth eruption is a localized developmental event that requires the presence of
the dental follicle, a loose connective tissue sac
that surrounds each tooth. Early postnatally in
the first mandibular molar of the rat there is an
influx into the follicle of mononuclear cells (monocytes) which, in turn, fuse to form osteoclasts that
resorb the bone to form an eruption pathway. The
chemoattractant that may attract the mononuclear cells to the follicle to initiate the cellular
events of eruption is monocyte chemotactic protein-one (MCP-1). MCP-1 is secreted by the dental
follicle cells and its gene is expressed maximally
at an early postnatal age, correlating with the
monocyte influx into the follicle. In this study, we
show that other potential tooth eruption molecules—EGF, IL-1a, TGF-b1 and CSF-1—all enhance the expression of the MCP-1 gene in the
cultured dental follicle cells. In vivo, injections of
IL-1a or EGF also enhance the gene expression of
MCP-1 in the follicle with maximal enhancement
occurring in the early postnatal days. Thus, there
appears to be a redundant function of the different tooth eruption genes to ensure that the MCP-1
gene is expressed. In turn, expression of MCP-1
may be critical for recruiting the monocytes to
the dental follicle to initiate the cellular events of
tooth eruption. Dev. Dyn. 1998;212:346–351.
r 1998 Wiley-Liss, Inc.
Key words: dental follicle; MCP-1; tooth eruption
INTRODUCTION
The initiation of tooth eruption involves an influx of
mononuclear cells (monocytes) into the dental follicle
with a concurrent increase in osteoclasts on the alveolar bone (Marks et al., 1983; Wise and Fan, 1989;
Cielinski et al., 1994). The osteoclasts appear to be
formed from the monocytes (e.g., see Wise et al., 1985)
and their resorption of alveolar bone is required for
eruption to occur (see Marks et al., 1994). Osteopetrotic
mutant rodents are deficient in osteoclasts and, as
such, have formed but unerupted teeth (Cotton and
Gaines, 1974; Iizuka et al., 1992; Grigoriadis et al.,
1994). Bone resorption also can be reduced by injection
of bisphosphonates and this inhibits the rate of tooth
eruption (Grier and Wise, 1998).
r 1998 WILEY-LISS, INC.
Recently, we have shown that two molecules secreted
by rat dental follicle cells, colony-stimulating factor-one
(CSF-1) and monocyte chemotactic protein-one (MCP-1),
are chemotactic for mouse monocytes in vitro (Que and
Wise, 1997). Both genes are maximally expressed in the
rat dental follicle at the time of maximal influx of
monocytes into the follicle (day 3 postnatally) (Wise et
al., 1995a; Que and Wise, 1997). In turn, CSF-1 expression is enhanced by a cascade of molecular signals
(Wise and Lin, 1995). Specifically, interleukin-one alpha (IL-1a) will enhance CSF-1 expression both in vitro
(Wise and Lin, 1994) and in vivo (Wise, 1998). IL-1a
itself is enhanced by either epidermal growth factor
(EGF) or by transforming growth factor-beta one
(TGF-b1) (Wise et al., 1994).
The effect of these putative tooth eruption molecules
on MCP-1 gene expression in the dental follicle is
unknown. Thus, it was the aim of this study to determine the effect of EGF, TGF-b1, IL-1a and CSF-1 on the
expression of MCP-1 in cultured dental follicle cells. In
addition, in vivo studies were conducted to determine
whether injections of EGF or IL-1a would enhance
MCP-1 expression in the dental follicle at different days
postnatally. Because the presence of the dental follicle
is required for eruption to occur (Cahill and Marks,
1980; Marks and Cahill, 1984), elucidation of the
molecular signals that might be required to recruit
monocytes to the follicle is critical for understanding
the relationship between the molecular and cellular
events of tooth eruption.
RESULTS
All of the potential tooth eruption molecules examined (EGF, TGF-b1, IL-1a and CSF-1) enhance the gene
expression of MCP-1 in the cultured dental follicle cells
both time- and dose-dependently. TGF-b1 has a dramatic effect on MCP-1 expression, resulting in peak
expression at 3 hr after incubation with a decline at
later times (Fig. 1). A dose response study indicates that
incubating the cells in TGF-b1 at a concentration of 2
ng/ml medium elicits the maximal increase in gene
expression with a slight decline at higher doses (Fig. 2).
Grant sponsor: National Institute of Dental Research; Grant number: DE08911.
*Correspondence to: Dr. Gary E. Wise, Department of Veterinary
Anatomy and Cell Biology, School of Veterinary Medicine, Louisiana
State University, Baton Rouge, LA 70803-8408.
Received 10 October 1997; Accepted 2 February 1998
MCP-1 EXPRESSION IN THE DENTAL FOLLICLE
Fig. 1. Ethidium bromide-stained gel of RT-PCR product for MCP-1 in
dental follicle cells after incubating the cells in TGF-b1 at a concentration
of 1 ng/ml medium for different times. Note that the maximal enhancement
of MCP-1 gene expression is after 3 hr incubation in TGF-b1 (lane d) with
a subsequent decline at later times (lanes f, g). Lane a, molecular weight
standards. Lane b, control, no TGF-b1. As seen in lower portion of figure,
b-actin mRNA levels are not affected by TGF-b1.
Fig. 2. Gel of RT-PCR product for MCP-1 after follicle cells were
incubated for 3 hr in TGF-b1 at different concentrations. Peak enhancement of MCP-1 expression appears to be at a concentration of 2 ng
TGF-b1/ml medium (lane e). Lane b, control.
Fig. 3. Gel of RT-PCR product for MCP-1 after follicle cells were
incubated in EGF at a concentration of 10 ng/ml for different times.
Maximal expression of MCP-1 gene expression appears to be at 3 hr
incubation in EGF (lane d). Lane b, control.
Regarding EGF, the optimal time of incubation for
maximal expression was 3 hr (Fig. 3) in a time-course
study. In a concentration-dependent study, doses of
EGF at 5–250 ng/ml increased the gene expression of
MCP-1 over the control (Fig. 4) with the maximum
being reached at 25–50 ng/ml (Fig. 4).
IL-1a also enhances MCP-1 transcription time-wise,
with a maximal expression at approximately 3 hr and
then a decline at 24 hr (Fig. 5). In terms of a dose
response, it appears that 25–50 ng/ml is the optimal
amount for increasing MCP-1 expression (Fig. 6).
The effect of CSF-1 on MCP-1 expression is similar to
the other molecules in that a 3-hr incubation is the
optimal time for maximal expression of MCP-1 (Fig. 7).
The optimal dosage of CSF-1 for MCP-1 transcription is
approximately 40 ng/ml (Fig. 8).
347
Fig. 4. Gel of RT-PCR product for MCP-1 after follicle cells were
incubated for 3 hr in EGF at different concentrations. Concentrations of 5
to 250 ng of EGF increased, MCP-1 expression (lanes c–g) with the peak
being reached at 25–50 ng/ml (lanes d, e). Lane b, control, no EGF.
Fig. 5. Gel of RT-PCR product for MCP-1 after follicle cells were
incubated in IL-1a at a concentration of 1 ng/ml for different times.
Maximal expression of MCP-1 is at 3 hr (lane d) with a subsequent
decline at later times (lanes e, f). Lane b, control, no IL-1a.
Fig. 6. Gel of RT-PCR product for MCP-1 after follicle cells were
incubated in IL-1a for 3 hr at different concentrations. Concentrations
of 5 to 250 ng of IL-1a/ml medium increased MCP- 1 expression
(lanes c–g) with the peak being reached at 25–50 ng/ml (lanes d, e).
Lane b, control.
In vivo, the potential tooth eruption molecules also
enhance the gene expression of MCP-1 in the dental
follicle. Injections of EGF at days 1, 3, 5 and 7 increase
the expression of MCP-1 with the greatest increases
occurring at either day 1 or day 3 postnatally (Fig. 9).
Injections of IL-1a and examination of MCP-1 mRNA at
days 3, 7 and 10 show that MCP-1 gene expression is
enhanced at each age after IL-1a injection, with the
greatest increase seen at day 3 (Fig. 10).
DISCUSSION
A fundamental tenet of tooth eruption is that alveolar
bone resorption must occur to form an eruption pathway (e.g., see Marks et al., 1994; Grier and Wise, 1998).
To achieve this, there is an influx of mononuclear cells
(monocytes) into the dental follicle to increase the
348
QUE AND WISE
Fig. 7. Gel of RT-PCR product for MCP-1 after follicle cells were
incubated in CSF-1 at a concentration of 10 ng/ml for different times.
Maximal expression of MCP-1 is seen at 3 hr (lane d) with a slight decline
at later times (lanes e–g). Lane b, control, no CSF-1.
Fig. 8. Gel of RT-PCR product for MCP-1 after follicle cells were
incubated in CSF-1 for 3 hr at different concentrations. Peak expression of MCP-1 is seen at a concentration of 40 ng CSF-1/ml (lane d)
with a decline at higher concentrations (lanes e, f). Lane b, control.
Fig. 9. In vivo analysis of MCP-1 expression in the dental follicle at
different days postnatally. Animals were either injected with EGF (1) or
not (-). As can be seen in ethidium bromide stained gel, RT-PCR product
for MCP-1 is enhanced by EGF injection with the greatest increases
occurring at day 1 and day 3.
number of osteoclasts needed to erode the alveolar bone
for eruption (Marks et al., 1983; Wise et al., 1985). In
the rat, the maximal number of monocytes and osteoclasts in the first mandibular molar is reached at day 3
postnatally (Wise and Fan, 1989; Cielinski et al., 1994).
For the above cellular events to occur requires the
recruitment of the monocytes into the follicle. Recently,
we have shown that MCP-1 is expressed in the dental
follicle with its peak expression at day 3 postnatally
(Que and Wise, 1997). Moreover, the medium taken
from cultured follicle cells is chemotactic for monocytes,
as is added MCP-1 only, and treating the medium with
an antibody to MCP-1 reduces this chemotaxis (Que
and Wise, 1997). Thus, it is probable that MCP-1
secreted by the dental follicle acts as a chemoattractant
to recruit monocytes into the follicle for eruption.
Another candidate chemotactic molecule, CSF-1, also is
secreted by the follicle (Grier et al., 1998) and is
chemotactic for monocytes, although MCP-1 is a more
Fig. 10. In vivo analysis of MCP-1 expression in the dental follicle at
different days postnatally. Animals were either injected with IL-1a (1) or
not (-). As can be seen on the gel, the RT-PCR product for MCP-1 is
enhanced by IL-1a injection with the maximal increase seen at day 3
(lane c).
potent chemoattractant than is CSF-1 (Que and Wise,
1997).
As seen in this study, the gene expression of MCP-1 in
the cultured dental follicle cells is enhanced by each of
the four putative tooth eruption molecules examined.
This is confirmed in vivo in that injections of either
EGF or IL-1a will enhance MCP-1 expression (Figs. 1
and 10). All of the four molecules are transcribed and
translated either in the dental follicle or the adjacent
stellate reticulum—EGF (Wise et al., 1992; Lin et al.,
1996), TGF-b1 (Wise and Fan, 1991; Lin and Wise,
1993), IL-1a (Wise et al., 1994, 1995b) and CSF-1 (Wise
and Lin, 1994; Wise et al., 1995b). All also achieve their
peak transcription and translation early postnatally.
Thus, the follicle is receptive to a multitude of signals to
enhance MCP-1 transcription for the ultimate production of MCP-1 for monocyte recruitment.
The optimal concentrations of the mediators of MCP-1
expression are physiological meaningful, at least when
compared with their concentrations in other tissues
and serum. Their concentration in the dental follicle
and stellate reticulum is unknown except for the observation that their maximal gene expression and immunostaining occur early postnatally (see review by Wise
and Lin, 1995). Regarding TGF-b1, the 2-ng/ml concentration for maximal MCP-1 expression would be less
than the 8-ng TGF-b1/mg protein in rat bone extracts
(Carrington et al., 1988) or the 430-ng TGF-b1/g (wet
weight) found in platelets (Assoian et al., 1983). The
optimal concentration of CSF-1 used (40 ng/ml) is the
same concentration present in fetal mouse serum (Roth
and Stanley, 1996). For a tissue, CSF-1 is present in the
mouse kidney at a concentration of 70 ng/mg protein
(Roth and Stanley, 1996).
EGF and IL-1a were injected at a concentration of 1
µg/g body weight and in vitro were optimal mediators at
25–50 ng/ml. As detailed by Carpenter and Wahl (1991),
EGF has a wide range of concentration in body fluids
that includes a low of 1.14 ng/ml serum to such highs as
101 ng/ml of seminal fluid, 140 ng/ml milk and 272
ng/ml prostate fluid. IL-1a concentration reports are
scarce but extraction of IL-1a from brown adipocytes or
spleen shows a high concentration, e.g., 260–460 ng/mg
protein in the nuclear fraction alone (Burysek and
MCP-1 EXPRESSION IN THE DENTAL FOLLICLE
Houstek, 1996). It also should be noted that studies
using articular cartilage slices used a concentration of
50 ng IL-1a/ml medium for 4 weeks (Xu et al., 1996).
These molecules that enhance MCP-1 gene expression probably have other roles in tooth eruption, as
shown by their ability to enhance gene expression in a
manner such that a cascade of molecular signals
(EGF=TGF-b1=IL-1a=CSF-1) might initiate eruption (Wise and Lin, 1995). Although CSF-1 might be the
critical molecule needed to enhance MCP-1 gene expression, the fact that the other putative eruption molecules
also can increase MCP-1 expression reflects the theme
that more than one molecule can exert the same
developmental effect. This redundancy of gene function
is demonstrated by the example that either transforming growth factor-alpha (TGF-a) or epidermal growth
factor (EGF) can accelerate incisor eruption (Tam,
1985; Cohen, 1962). Mice with a null mutation of the
TGF-a gene still have a normal eruption of the incisors
(Mann et al., 1993), suggesting that EGF substitutes
for the missing TGF-a.
MCP-1 itself is a CC chemokine, so named because of
two conserved cysteine residues that are adjacent to
each other near the N-terminal end of the chemotactic
protein (see review by Rollins, 1997). Human monocyte
chemotactic protein 1 and its murine counterpart (JE)
have a 62% amino acid homology over the first 68
positions of the protein (Rollins et al., 1989) and both
are equally chemoattractive for monocytes (Ernst et al.,
1994). In view of their structural and functional similarities, it is probable that the role MCP-1 could play in
molar eruption in the rat is paralleled in the human.
Tooth eruption is somewhat analogous to chronic
inflammation in that both processes involve the attraction of monocytes to a specific site by a chemotactic
substance. For example, expression of MCP-1 is noted
in osseous inflammation (Rahimi et al., 1995), inflammation of gingiva (Yu and Graves, 1995), atherosclerosis
(Nelken et al., 1991; Yla-Herttuala et al., 1991; Yu et al.,
1992), synovial inflammation (Villiger et al., 1992) and
glomerulonephritis (Rovin et al., 1994). As would be
expected, MCP-1 expression is often enhanced by proinflammatory cytokines such as IL-1 (Brieland et al.,
1995; Goppelt-Struebe and Stroebel, 1995; Rovin et
al., 1992; Takeshita et al., 1993), TGF-b1 (Hanazawa et
al., 1991; Takeshita et al., 1995) and CSF-1 (Shyy et al.,
1993). The probability that many of these proinflammatory cytokines may be involved in tooth eruption suggests that a developmental process, tooth eruption, may
have evolved as a modification of the chronic inflammation process. In fact, MCP-1 itself stimulates histamine
release from basophils (Alam et al., 1992; Bischoff et al.,
1992; Kuna et al., 1992), again relating tooth eruption
to an inflammation heritage.
EXPERIMENTAL PROCEDURES
Cell Cultures
Harlan Sprague-Dawley rats were housed in Association for Accreditation and Assessment of Laboratory
349
Animal Care (AAALAC)-approved facilities and provided with water and food ad libitum. Cultures of dental
follicle cells were established from the first and second
mandibular molars obtained from 6–7-day-old postnatal rats (Wise et al., 1992). The cells were maintained in
Eagle’s modified minimal essential medium (MEM)
(ICN Biochemicals, Costa Mesa, CA) containing 15%
fetal bovine serum (Gibco-BRL, Grand Island, NY) in
the presence of streptomycin and penicillin. For the
experiments in which cells were cultured with different
cytokines or growth factors, the fourth passage or later
of the dental follicle cells was used to insure the
homogeneity of the cell population (Wise et al., 1992).
Incubation and Injection Experiments
Dental follicle cells were incubated separately with
TGF-b1 (R & D Systems, Minneapolis, MN), EGF
(Upstate Biotechnology, Lake Placid, NY), IL-1a (gift
from NCI Biological Resources Branch, Frederick, MD),
and murine CSF-1 (R & D Systems) to determine both
concentration and time-dependent effects of these agents
on MCP-1 gene expression. In terms of concentration
effects, dosages of TGF-b1 ranged from 0 (control) to 4
ng/ml medium; EGF from 0 to 250 ng/ml; IL-1a from 0
to 250 ng/ml; and CSF-1 from 0 to 100 ng/ml. For all the
dosage studies, the cells were incubated for 3 hr for any
given concentration. For the time-course studies, incubation times of TGF-b1 ranged from 0 (control) to 24 hr;
EGF ranged from 0 to 24 hr; IL-1a from 0 to 30 hr; and
CSF-1 from 0 to 24 hr. For all the above experiments,
the dental follicle cells first were cultured in MEM/15%
fetal bovine serum until near confluency at 37°C and
5% CO2 in air. Next, the cells were washed with
serum-free MEM, incubated for 3 hr and then treated
for the times or dosages listed above in the presence of
serum-free MEM.
For the IL-1a injection experiments, rats were injected with IL-1a at a concentration of 1 µg IL-1a/g
body weight on days 2, 6 or 9. Controls were injected
with an equal volume of saline. Fifteen hours after
injections (days 3, 7 or 10), the animals were sacrificed
and the dental follicles removed from the first mandibular molars. The total RNA was isolated from the
experimentals and controls according to the TRI
REAGENT protocol (Molecular Research Center, Cincinnati, OH). These experiments were repeated three
times and for each age (days 2, 6 or 9) six rats were
injected— three experimentals and three controls.
For the EGF injection experiments, 12 rats were
injected daily (starting at day 0 postnatally) with EGF
at a concentration of 1.0 µg/g body weight. For controls,
another 12 rats of the same age were injected daily with
the same volume of saline. At days 1, 3, 5 and 7, at 2–3
hr after the injection on that given day, three experimentals and three controls were sacrificed. The total RNA
was then isolated from the dental follicles for reverse
transcription-polymerase chain reaction (RT-PCR)
analysis. These injection experiments were repeated
twice in their entirety.
350
QUE AND WISE
Reverse Transcription-Polymerase
Chain Reaction
After isolation of the total RNA, it was quantitated at
an optical reading of 260 nm and the ratio OD 260/280
was greater than 1.6. The total RNA was reverse transcribed as previously described (Que and Wise, 1997).
The specific primers for the PCR were chosen based
on the nucleotide sequence of MCP-1 cDNA of the rat
(Yoshimura et al., 1991). The 58 primer sequence was
ATGCAGGTCTCTGTCACGCTTCTG and the 38 primer
sequence was TCCCATTCATCTCTATACAT. Details of
the PCR technique used have been published (Que and
Wise, 1997). In general, 2 µL of the reverse transcription product was mixed with the primers, Taq polymerase, nucleotides and PCR buffer to make a total volume
of 25 µL. For controls, primers for the b-actin gene
(Clontech) were used in parallel amplification with the
target gene (MCP-1). The reaction was conducted using
a Perkin Elmer Thermal Cycler programmed at 95°C
for 1 min (denaturation), 60°C for 1 min (annealing)
and 72°C for 2 min (extension) for 30 cycles. Following
PCR, 5 µL of the entire reaction volume was electrophoresed on a 1.1% agarose gel. Each gel was then stained
with ethidium bromide and photographed.
The RT-PCR methods of detection used were within
the linear range for detection of RNA. Reverse transcription of total RNA ranging from 1 to 5 µg demonstrated a
linear increase in the PCR product (data not shown).
Linearity also was shown for the PCR cycles in the
range of 20–40 cycles.
ACKNOWLEDGMENTS
This work was supported by National Institute of
Dental Research grant DE08911 to G.E. Wise. The
authors thank Ms. Cindy Daigle for the typing of this
manuscript and for assistance in preparing the figures.
We also are indebted to Mr. Charles Adams and Ms.
Angela Layfield for their technical assistance.
REFERENCES
Alam R, Lett-Brown MA, Forsythe PA, Anderson-Walters DJ, Kenamore C, Kormos C, Grant JA. Monocyte chemotactic and activating
factor is a potent histamine-releasing factor for basophils. J. Clin.
Invest. 1992;89:723–728.
Assoian RK, Komoriya A, Meyers CA, Miller DM, Sporn MB. Transforming growth factor-b in human platelets. J. Biol. Chem. 1983;258:
7155–7160.
Bischoff SC, Krieger M, Brunner T, Dahinden CA. Monocyte chemotactic protein 1 is a potent activator of human basophils. J. Exp. Med.
1992;175:1271–1275.
Brieland JK, Flory CM, Jones ML, Miller GR, Remick DG, Warren JS,
Fantone JC. Regulation of monocyte chemoattractant protein-1
gene expression and secretion in rat pulmonary alveolar macrophages by lipopolysaccharide, tumor necrosis factor-a, and interleukin-1b. Am. J. Respir. Cell Mol. Biol. 1995;12:104–109.
Burysek L, Houstek J Multifactorial induction of gene expression and
nuclear localization of mouse interleukin 1 alpha. Cytokine 1996;8:
460–467.
Cahill DR, Marks SC Jr. Tooth eruption: Evidence for the central role
of the dental follicle. J. Oral Pathol. Med. 1980;9:189–200.
Carpenter G, Wahl MI. The epidermal growth factor family. In: Sporn
MB, Roberts AB, eds. Peptide Growth Factors and Their Receptors.
New York: Springer-Verlag, 1991:69–133.
Carrington JL, Roberts AB, Flanders KC, Roche NS, Reddi AH.
Accumulation, localization, and compartmentation of transforming
growth factor b during endochondral bone development. J. Cell Biol.
1988;107:1969–1975.
Cielinski MJ, Jolie M, Wise GE, Ando DG, Marks SC Jr. Colonystimulating factor-1 (CSF-1) is a potent stimulator of tooth eruption
in the rat. In: Davidovitch Z, ed. The Biological Mechanisms of Tooth
Eruption, Resorption and Replacement by Implants. Birmingham,
AL: EBSCO Media, 1994;429–436.
Cohen S. Isolation of a mouse submaxillary gland protein accelerating
incisor eruption and eyelid opening in the newborn animal. J. Biol.
Chem. 1962;237:1555–1562.
Cotton WR, Gaines JF. Unerupted dentition secondary to congenital
osteopetrosis in the Osborne-Mendel rat. Proc. Soc. Exp. Biol. Med.
1974;146:554–561.
Ernst CA, Zhang YJ, Hancock PR, Rutledge BJ, Corless CL, Rollins
BJ. Biochemical and biologic characterization of murine monocyte
chemoattractant protein-1: Identification of two functional domains.
J. Immunol. 1994;152:3541–3549.
Goppelt-Struebe M, Stroebel M. Synergistic induction of monocyte
chemoattractant protein-1 (MCP-1) by platelet-derived growth factor and interleukin-1. FEBS Lett. 1995;374:375–378.
Grier RL IV, Wise GE. Inhibition of tooth eruption in the rat by a
bisphosphonate J. Dent. Res. 1998;77:8–15.
Grier RL, Zhao L, Adams CE, Wise GE. Secretion of CSF-1 and its
inhibition in rat dental follicle cells: implications for tooth eruption.
Eur. J. Oral Sci. 1998; in press.
Grigoriadis AE, Wang ZQ, Cecchini MG, Hofstetter W, Felix R, Fleisch
HA, Wagner EF. c-Fos: A key regulator of osteoclast-macrophage
lineage determination and bone remodeling. Science 1994;266:
443–448.
Hanazawa SA, Takeshita A, Tsukamoto Y, Kawata Y, Takara KO,
Kitano S. Transforming growth factor-b-induced gene expression of
monocyte chemoattractant JE in mouse osteoblastic cells, MC3T3E1. Biochem. Biophys. Res. Commun. 1991;180:1130–1136.
Iizuka T, Cielinski MJ, Aukerman SL, Marks SC Jr. The effects of
colony-stimulating factor-1 (CSF-1) on tooth eruption in the toothless (osteopetrotic) rat in relation to the critical periods for bone
resorption during tooth eruption. Arch. Oral Biol. 1992;37:629–636.
Kuna P, Reddigari SR, Rucinski D, Oppenheim JJ, Kaplan AP.
Monocyte chemotactic and activating factor is a potent histaminereleasing factor for human basophils. J. Exp. Med. 1992;175:489–493.
Lin F, Wise GE. Effect of epidermal growth factor on expression of
transforming growth factor-b1 mRNA in stellate reticulum cells of
rat mandibular molars. Dev. Dyn. 1993;198:22–27.
Lin F, Zhao L, Wise GE. In vivo and in vitro effects of epidermal growth
factor on its receptor gene expression in rat dental follicle cells.
Arch. Oral Biol. 1996;41:485–491.
Mann GB, Fowler KJ, Gabriel A, Nice EC, Williams RL, Dunn AR.
Mice with a null mutation of the TGFa gene have abnormal skin
architecture, wavy hair, and curly whiskers and often develop
corneal inflammation. Cell 1993;73:249–261.
Marks SC Jr, Cahill DR. Experimental study in the dog of the
non-active role of the tooth in the eruptive process. Arch. Oral Biol.
1984;29:311–322.
Marks SC Jr, Cahill DR, Wise GE. The cytology of the dental follicle
and adjacent alveolar bone during tooth eruption in the dog. Am. J.
Anat. 1983;168:277–289.
Marks SC Jr, Cielinski MJ, Sundquist K, Wise GE, Gorski JP. The role
of bone resorption in tooth eruption. In: Davidovitch Z, ed. The
Biological Mechanisms of Tooth Eruption, Resorption and Replacement by Implants. Birmingham, AL: EBSCO Media, 1994;483–488.
Nelken NA, Coughlin SR, Gordon D, Wilcox JN. Monocyte chemoattractant protein 1 in human atheromatous plaques. J. Clin. Invest.
1991;88:1121–1127.
Que BG, Wise GE. Colony-stimulating factor-1 and monocyte chemotactic protein-1 chemotaxis for monocytes in the rat dental follicle.
Arch. Oral Biol. 1997;42:855–860.
Rahimi P, Wang CY, Stashenko P, Lee SK, Lorenzo JA, Graves DT.
Monocyte chemoattractant protein-1 expression and monocyte recruitment in osseous inflammation in the mouse. Endocrinology
1995;136:2752–2759.
MCP-1 EXPRESSION IN THE DENTAL FOLLICLE
Rollins BJ. Chemokines. Blood 1997;90:909–928.
Rollins BJ, Stier P, Ernst T, Wong GG. The human homolog of the JE
gene encodes a monocyte secretory protein. Mol. Cell Biol. 1989;9:
4687–4695.
Roth P, Stanley ER. Colony stimulating factor-1 expression is developmentally regulated in the mouse. J. Leukocyte Biol. 1996;59:
817–823.
Rovin BH, Yoshiumura T, Tan L. Cytokine induced production of
monocyte chemoattractant protein-1 by cultured human mesangial
cells. J. Immunol. 1992;148:2148–2153.
Rovin BH, Rumancik M, Tan L, Dickerson J. Glomerular expression of
monocyte chemoattractant protein-1 in experimental and human
glomerulonephritis. Lab. Invest. 1994;71:536–542.
Shyy YJ, Wickham LL, Hagan JP, Hsieh HJ, Hu YL, Telian SH,
Valente AJ, Sung KLP, Chien S. Human monocyte colony-stimulating factor stimulates the gene expression of monocyte chemotactic
protein-1 and increases the adhesion of monocytes to endothelial
monolayers. J. Clin. Invest. 1993;92:1745–1751.
Takeshita A, Hanazawa S, Amano S, Matumoto T, Kitano S. IL-1
induces expression of monocyte chemoattractant JE in clonal mouse
osteoblastic cell line MC3T3-E18. J. Immunol. 1993;150:1554–1562.
Takeshita A, Chen Y, Watanabe A, Kitano S, Hanazawa S. TGF-b
induces expression of monocyte chemoattractant JE/monocyte chemoattractant protein 1 via transcriptional factor AP-1 induced by
protein kinase in osteoblastic cells. J. Immunol. 1995;155:419–426.
Tam PJ. Physiological effects of transforming growth factor in the
newborn mouse. Science 1985;229:673–675.
Villiger PM, Terkeltaub R, Lotz M. Production of monocyte chemoattractant protein-1 by inflamed synovial tissue and cultured synoviocytes. J. Immunol. 1992;149:722–727.
Wise GE. In vivo effect of IL-1a on CSF-1 gene expression in the dental
follicle of the rat molar Arch. Oral Biol. 1998; 43:163–165.
Wise GE, Fan W. Changes in the tartrate-resistant acid phosphatase
cell population in dental follicles and bony crypts of rat molars
during tooth eruption. J. Dent. Res. 1989;68:150–156.
Wise GE, Fan W. Immunolocalization of transforming growth factor
beta in rat molars. J. Oral Pathol. Med. 1991;20:74–80.
Wise GE, Lin F. Regulation and localization of colony-stimulating
factor-1 mRNA in cultured rat dental follicle cells. Arch. Oral Biol.
1994;39:621–627.
351
Wise GE, Lin F. The molecular biology of initiation of tooth eruption. J.
Dent. Res. 1995;74:303–306.
Wise GE, Marks SC Jr, Cahill DR. Ultrastructural features of the
dental follicle associated with formation of the tooth eruption
pathway in the dog. J. Oral Pathol. Med. 1985;14:15–26.
Wise GE, Lin F, Fan W. Localization of epidermal growth factor and its
receptor in mandibular molars of the rat prior to and during
prefunctional tooth eruption. Dev. Dyn. 1992;195:121–126.
Wise GE, Lin F, Marks SC Jr, Gorski JP. The molecular basis of tooth
eruption. In: Davidovitch Z, ed. The Biological Mechanisms of Tooth
Eruption, Resorption and Replacement by Implants. Birmingham,
AL: EBSCO Media, 1994;383–389.
Wise GE, Lin F, Zhao L. Transcription and translation of CSF-1 in the
dental follicle. J. Dent. Res. 1995a;74:1551–1557.
Wise GE, Lin F, Zhao L. Immunolocalization of interleukin-1a in rat
mandibular molars and its enhancement after in vivo injection of
epidermal growth factor. Cell Tissue Res. 1995b;280:21–26.
Xu C, Oyajobi BO, Frazer A, Kozaci LD, Russell RGG, Hollander AP.
Effects of growth factors and interleukin-1a on proteoglycan and
type II collagen turnover in bovine nasal and articular chondrocyte
pellet cultures. Endocrinology 1996;137:3557–3565.
Yla-Herttuala S, Lipton BA, Rosenfeld ME, Sarkioja T, Yoshumura T,
Leonard EJ, Witztum JL, Steinberg D. Expression of monocyte
chemoattractant protein 1 in macrophage-rich areas of human and
rabbit atherosclerotic lesions. Proc. Natl. Acad. Sci. U.S.A. 1991;88:
5252–5256.
Yoshimura T, Takeya M, Takahashi K. Molecular cloning of rat
monocyte chemoattractant protein-1 (MCP-1) and its expression in
rat spleen cells and tumor cell lines. Biochem. Biophys. Res.
Commun. 1991;174:504–509.
Yu X, Graves DT. Fibroblasts, mononuclear phagocytes, and endothelial cells express monocyte chemoattractant protein-1 (MCP-1) in
inflamed human gingiva. J. Periodontol. 1995;66:80–88.
Yu X, Dluz S, Graves DT, Zhang L, Antoniades HN, Hollander W,
Prusty S, Valente AJ, Schwartz CJ, Sonenshein GE. Elevated
expression of monocyte chemoattractant protein 1 by vascular
smooth muscle cells in hypercholesterolemic primates. Proc. Natl.
Acad. Sci. U.S.A. 1992;89:6953–6957.
Документ
Категория
Без категории
Просмотров
3
Размер файла
120 Кб
Теги
1/--страниц
Пожаловаться на содержимое документа