close

Вход

Забыли?

вход по аккаунту

?

180

код для вставкиСкачать
DEVELOPMENTAL DYNAMICS 210:264?273 (1997)
Novel Gene Containing Multiple Epidermal Growth
Factor?Like Motifs Transiently Expressed in the Papillae
of the Ascidian Tadpole Larvae
JEREMY M. ARNOLD,1* RAJARAMAN ERI,1,2 BERNARD M. DEGNAN,3 AND MARTIN F. LAVIN1,2
Cancer Fund Research Unit, Queensland Institute of Medical Research, Brisbane, Australia
2University of Queensland, Department of Surgery, Royal Brisbane Hospital, Brisbane, Australia
3University of Queensland, Department of Zoology, Brisbane, Australia
1Queensland
ABSTRACT
We have investigated molecular
mechanisms of the embryonic development of an
ascidian, a primitive chordate which shares features of both invertebrates and vertebrates, with
a view to identifying genes involved in development and metamorphosis. We isolated 12 partial
cDNA sequences which were expressed in a stagespecific manner using differential display. We
report here the isolation of a full-length cDNA
sequence for one of these genes which was specifically expressed during the tailbud and larval
stages of ascidian development. This cDNA, 1213
bp in length, is predicted to encode a protein of
337 amino acids containing four epidermal growth
factor (EGF)?like repeats and three novel cysteine-rich repeats. Characterization of its spatial
expression pattern by in situ hybridisation in
late tailbud and larval embryos demonstrated
strong expression localised throughout the papillae and anteriormost trunk and weaker expression in the epidermis of the remainder of the
embryo. As recent evidence indicates that the
signal for metamorphosis originates in the anterior trunk region, these results suggest that this
gene may have a role in signalling the initiation
of metamorphosis. Dev. Dyn. 1997;210:264?273.
r 1997 Wiley-Liss, Inc.
Key words: ascidian; EGF-like domain; gene expression; in situ hybridization; metamorphosis
INTRODUCTION
Ascidians are sessile marine invertebrates which
develop rapidly into a motile tadpole larva with a
simple body plan and small number of cells. Ascidian
embryos are an important model for studies of cell
determination. Specification of cell fate occurs early in
development and is achieved mainly by the partitioning
of cytoplasmic maternal factors into specific blastomeres. The cleavage pattern is invariant, and the
complete cell lineage has been characterised up to the
early gastrula stage (Conklin, 1905; Nishida, 1987;
Nicol and Meinertzhagen, 1988). Interest in the ascidian model also stems from the fact that they are
r 1997 WILEY-LISS, INC.
primitive chordates, with a notochord and dorsal nerve
cord evident at the larval stage (Berrill, 1955).
The larva is a non-feeding dispersal phase which
undergoes settlement and metamorphosis after a short
period of swimming. The papillae secrete an adhesive
material which enable the larva to settle, and following
settlement, numerous morphogenetic movements and
physiological changes transform the free-swimming
larva into a fixed, filter-feeding juvenile (Satoh, 1994).
Little is known about the identity of the signal for
ascidian metamorphosis, although evidence suggests
that it originates in the anterior part of the larval trunk
near the papillae and has been suggested to be a
diffusible molecule (Torrence and Cloney, 1983; Degnan
et al., 1997).
In order to investigate genes involved in ascidian
development and metamorphosis, we have studied temporal changes in gene expression during the embryonic
development of the tropical ascidian Herdmania momus (family Pyuridae) by mRNA differential display
and northern blotting (Arnold et al., 1997). This resulted in the isolation of 12 partial cDNA sequences
which were expressed in specific temporal patterns
during development. Further characterisation of one of
these clones resulted in the identification of a novel
serine protease specifically expressed in the epidermis
at the gastrula, neurula, and early tailbud stages
(Arnold et al., 1997). We report here the isolation of the
cDNA sequence for a gene which is specifically expressed during the late tailbud and larval stages of
ascidian development. The predicted protein of 337
amino acids contains four epidermal growth factor
(EGF)?like repeats, a motif of approximately 45 residues including six cysteines with highly conserved
spacing which has been identified in over 70 different
proteins, including many with diverse roles in growth
and development (Davis, 1990; Campbell and Bork,
1993; Carpenter, 1993).
Grant sponsor: Australian Research Council; Grant sponsor: Department of Surgery, University of Queensland.
*Correspondence to: Jeremy M. Arnold, Queensland Cancer Fund
Research Unit, Queensland Institute of Medical Research, Bancroft
Centre, 300 Herston Road, Brisbane, 4029, Australia.
E-mail: jeremya@qimr.edu.au
Received 21 January 1997; Accepted 1 August 1997
GENE SIGNALS ASCIDIAN METAMORPHOSIS
265
Fig. 1. Temporal expression pattern of CB06LL18 as detected by
differential display and northern blot analysis. A: Differential display
pattern showing band CB06LL18. Duplicate PCR reactions are shown for
maternal (M), gastrula (G), neurula (N), tailbud (T), and larval (L) cDNA.
B: Northern blot analysis of CB06LL18. The filter containing 1 礸 of poly
(A)1 RNA was probed against the partial cDNA fragment CB06LL18.
Equal loading of RNA in all lanes was confirmed by ethidium bromide
staining of the rRNA bands in the agarose gel and methylene blue staining
of the rRNA bands on the filter after transfer.
Analysis of the spatial expression pattern of this gene
in tailbud and larval stage embryos by in situ hybridisation showed that its expression is localised throughout
the papillae and most anterior end of the trunk. The
similarity of this gene to other genes involved in
signalling various events during development in other
taxa and its highly restricted spatiotemporal expression pattern are discussed in relation to a possible role
for this gene in signalling ascidian metamorphosis.
amino acids. This predicted protein has a calculated
molecular weight of 35.6 kDa and a very high proportion of cysteine (15%) and proline (12%) residues. This
sequence has been deposited in Genbank with accession No. U82540.
RESULTS
Cloning and Characterisation of a Differential
Display cDNA Product
We have studied changes in gene expression during
ascidian development using differential display to compare expression patterns in unfertilised eggs, gastrula,
neurula, tailbud, and larval stages (Arnold et al., 1997).
From this study, 12 partial cDNA sequences were
cloned which were shown to be differentially expressed
during development by northern blot analysis. In this
study, the partial cDNA sequence designated CB06LL18
was selected for further characterisation. Northern blot
analysis for this mRNA detects a single transcript of
about 1.0 kb specifically expressed during the late
tailbud and larval stages, with strongest expression at
the larval stage (Arnold et al., 1997; Fig. 1). Nucleotide
sequencing of the differential display partial cDNA
sequence detected the sequence of the anchored primer
T12MC at one end and the arbitrary 10mer at the other,
suggesting that this clone may be located at the 38 end
of the gene. A polymerase chain reaction (PCR) primer
was designed for amplification of sequences at the
predicted 58 end of this gene by rapid amplification of
cDNA ends (RACE) (Fig. 2). This primer was used in
combination with the adaptor primer (AP1), resulting
in the amplification of a single PCR product of about
1100 bp from larval stage cDNA which was gel purified,
cloned, and sequenced.
PCR cycle sequencing was carried out on five independent clones, resulting in a continuous sequence of 1105
bp, of which 56 nucleotides overlapped with the 164-bp
differential display clone CB06LL18; therefore the total
sequence was 1213 bp (Fig. 2). Analysis of this sequence
revealed a single major open reading frame of 1010
nucleotides from position 64 to 1074 coding for 337
Derived Amino Acid Sequence Analysis
Searches of the EMBL database against the predicted amino acid sequence detected similarity with
numerous other proteins over limited regions. The highest
identity matches were to the human fibrillin 1 and 2
precursors, pig round worm chymotrypsin/elastase isoinhibitors 1 and 2?5, human von Willebrand factor precursor, mouse, rat, and human epidermal growth factor
(EGF) precursors, mouse fibulin 1 and 2, Drosophila
Delta and human TGF-b-binding proteins (Fig. 3).
Analysis of repeat sequences within the ascidian protein in combination with the database searches demonstrated that the ascidian protein contains three types of
repeat sequences. There are four EGF-like domains of
39 or 40 residues (defined by the presence of six
cysteine residues with highly conserved spacing) located at positions 66 to 104, 162 to 200, 225 to 263, and
286 to 325, within which there is strong conservation of
amino acid sequence (Fig. 3A). A second type of repeat
sequence of eight residues follows directly on from
three of these EGF-like repeats at positions 105 to 112,
201 to 208, and 326 to 333 (Fig. 3A). These EGF-like
domains are most similar to non EGF-like sequences
from the chymotrypsin/elastase isoinhibitor (ICE) proteins (1 and 2?5), and human von Willebrand factor
precursor and to EGF-like domains from the mouse,
rat, and human EGF precursors (EGF-like domain 2),
and human fibrillin 1 and 2 (EGF-like domain 42) (Fig.
3A). The similarity with the chymotrypsin/elastase
isoinhibitor proteins continues outside of the EGF-like
domains to include a further six residues at each end.
The third type of conserved region in the ascidian
protein is a repeat of about 48 residues which also has
six conserved cysteines, although the spacing of the
fourth and fifth cysteine residues is divergent from the
normal EGF-like consensus (Fig. 3B). There are two
full repeats of this sequence located at positions 17 to 65
and 112 to 161 and a third fragmented repeat located at
positions 210 to 224 and 261 to 285 (Fig. 3B). These
domains are most similar to EGF-like domains from
266
ARNOLD ET AL.
Fig. 2. Nucleotide and deduced amino acid sequences of gene
CB06LL18: The upper line shows the nucleotide sequence while the lower
line shows the derived amino acid sequence. Coding nucleotides are
given in upper case, while non-coding sequences are given in lower case.
The cDNA fragment corresponding to the differential display clone is given
in bold type. The location of the oligonucleotide primer used for RACE is
shown underlined. This sequence has been deposited in Genbank with
accession number U82540.
human fibrillin 1 and 2, Drosophila Delta, mouse
fibulin 1 and 2, and human TGF-b masking protein;
however, the regions of similarity span two tandemly
repeated EGF-like motifs (Fig. 3B).
We have called this gene HmEGFL-1 (Herdmaina
momus EGF-like protein 1) in recognition of the presence of multiple EGF-like domains.
The overall structure of the protein consists of three
copies of a unit of about 96 residues consisting of one 48
residue repeat, followed by an EGF-like domain and an
eight-residue repeat, although the third copy of this
unit is interrupted by an additional EGF-like domain
(EGF-like #3), as shown in Figure 4A. Analysis of the
relative hydrophobicity of the ascidian protein using
the Kyte-Doolittle scale (Kyte and Doolittle, 1982) with
a window size of 7 (Fig. 4B) shows a highly hydrophobic
region formed by approximately the first 20 residues,
which is likely to represent a signal peptide. Analysis of
this region for potential signal sequence cleavage sites
using the von Hiejne method (von Hiejne, 1986) indicates that the most likely site for cleavage of a signal
peptide is between Ala18 and Ile19.
267
Fig. 3.
(Legend on page 268.)
GENE SIGNALS ASCIDIAN METAMORPHOSIS
268
ARNOLD ET AL.
Fig. 4. Domain structure of HmEGFL-1. A: The relative positions and approximate sizes of the predicted
signal peptide, the 48-residue conserved sequence, the EGF-like domain, and the eight-residue sequence are
shown. B: Hydrophilicity plot of HmEGFL-1 by the Kyte-Doolittle scale (Kyte and Doolittle, 1982).
Since all homologies which were detected existed
only in short regions within HmEGFL-1, we constructed a phylogenetic relationship based on the similarity of the EGF-like domains to sequences from 12
other proteins which were determined to have the
greatest identity from database searches (Fig. 5). This
analysis demonstrates that the ascidian EGF-like domains
are not closely related to any of these sequences, but
instead form a separate grouping. EGF-like repeat 3 is the
most divergent of the four EGF-like domains and is grouped
with the ICE proteins, although the assignment is tenuous
due to the short branch length defining this group.
the ascidian genome (Fig. 6). A major and a minor band
were detected in both the BamHI (lane 1, 8 kb and 13
kb, respectively) and PstI (lane 4, 8 kb and 12 kb,
respectively) digests. There were two bands of about
equal intensity detected in the NcoI digest (lane 3, 12
kb and 16 kb) while a single band was detected in the
HindIII digest (lane 2, 7 kb). This result suggests that
HmEGFL-1 is present as a single copy per haploid
genome in H. momus. The presence of a second, less
intense band in the BamHI and PstI digests indicates
that there is another related sequence in the genome.
Determination of Gene Copy Number
by Southern Blotting
Temporal Expression of HmEGFL-1 During
Development by Reverse Transcription
(RT)-PCR Analysis
Genomic Southern blotting was carried out to determine the number of copies of the HmEGFL-1 gene in
To confirm the northern blot analysis of the temporal
expression of HmEGFL-1 and extend it to include
Fig. 3. Amino acid repeat elements within HmEGFL-1. A: Homology
comparison between the 4 EGF-like domains and strongest matching
regions from other proteins. The top four lines show the four EGF-like
domains from the ascidian protein. The numbering on the left indicates
their position within the protein. The six conserved cysteine residues are
numbered. The bottom eight lines show the strongest matching sequences from a number of other proteins based on BLITZ searches
against all four EGF-like domains from the ascidian protein. Gaps
introduced for alignment of sequences are shown as spaces. The percent
identity of all regions to the first EGF-like domain from the ascidian protein
is given on the right. The proteins and the regions shown are chymotrypsin/
elastase isoinhibitor 1 (ICE 1), positions 17?61 (Babin et al., 1984);
chymotrypsin/elastase isoinhibitors 2?5 (ICE 2), positions 16?60 (Babin
et al., 1984); human fibrillin 1 (FBN 1), positions 2444?2484 (Pereira et
al., 1993); human fibrillin 2 (FBN 2), positions 2494?2530 (Zhang et al.,
1994); mouse epidermal growth factor precursor (EGF), positions 362?
402 (Scott et al., 1983; Gray et al., 1983); human EGF precursor,
positions 356?396 (Bell et al., 1986); rat EGF precursor, positions
357?397 (Price et al., 1992); human von Willebrand factor precursor
(VWF), positions 1153?1191 (Mancuso et al., 1989). B: Homology
comparison of the three 48-residue conserved regions with the strongest
matching regions from a number of other proteins based on BLITZ
searches against the two complete motifs from the ascidian protein. The
top four lines show the two complete 48-residue sequences from the
ascidian protein and the two partial repeats. The six conserved cysteine
residues are numbered. The next three lines show the alignment with
human fibrillin 1 and 2 and Drosophila Delta. The last three lines show the
alignment with mouse fibulin 1 and 2 and the human TGF-b?binding
protein. The positions of the cysteine residues within the EGF-like
domains are indicated. The proteins and the regions shown are human
fibrillin 1 (FBN 1), positions 98?147 (Pereira et al., 1993); human fibrillin 2
(FBN 2), positions 128?166 (Zhang et al., 1994); Drosophila Delta
(DELTA), positions 402?452 (Vaessin et al., 1987); mouse fibulin 1 (FBL
1), positions 283?329 (Pan et al., 1993a); mouse fibulin 2 (FBL 2),
positions 820?866 (Pan et al., 1993b); human TGF-b?binding protein
(TGFb BP), positions 685?728 (Kanzaki et al., 1990).
GENE SIGNALS ASCIDIAN METAMORPHOSIS
Fig. 5. Molecular phylogeny of the EGF-like domains from HmEGFL-1.
The proteins and regions shown are as for Figure 3. Additional sequences
are chick agrin, positions 1490?1522 (Tsim et al., 1992), bovine metallothionein III, positions 26?65 (Poutney et al., 1994), Plasmodium ookinete
surface antigen precursor, positions 157?193 (Lal, 1990), and mouse
thrombomodulin, positions 369?404 (Dittman and Majerus, 1989). The
scale represents the number of differences between the proteins along
the branches.
post-larval stages, semi-quantitative RT-PCR analysis
of neurula, mid-tailbud, larval, 48-hr post-metamorphosis, and adult gene expression was carried out (Fig. 7).
This demonstrates that the strongest expression was at
the larval stage. Weak expression was also detectable
at the mid-tailbud stage, but only at longer exposures
than shown in Figure 7. No expression was detected at
the neurula stage, at 48 hr post-metamorphosis or in
adults (Fig. 7).
269
Fig. 6. Genomic Southern blot analysis of the HmEGFL-1 gene.
Genomic DNA (5 礸) was digested separately with BamHI (lane 1), HindIII
(lane 2), NcoI (lane 3), and PstI (lane 4). The membrane was hybridised
with random primed [32P]labelled probe and washed under high-stringency
conditions. The numbers on the right show approximate size (kb).
Analysis of the Spatial Expression Pattern
of HmEGFL-1
To analyse the tissue specificity of expression of this
gene at the tailbud and larval stages, whole-mount in
situ hybridisation was carried out using sense and
antisense digoxigenin-labelled riboprobes, whereby
mRNA expression is detectable as purple staining (Fig.
8). The antisense riboprobe revealed staining restricted
to the adhesive papillae and the most anterior part of
the trunk in both late tailbud and larvae immediately
after hatching (Fig. 8A,B). Staining was also detected
in the larval tunic (tail fin) at the posterior end of the
late tailbud and larval embryos; however, the same
pattern was also detected with the sense control ribo-
Fig. 7. RT-PCR analysis of the expression of HmEGFL-1. An autoradiograph of RT-PCR analysis of (A) HmEGFL-1 and (B) ubiquitin. The
lanes shown are neurula (N), tailbud (T), larval (L), 48-hr postmetamorphosis (M), and adult (A) stages, respectively.
probe (Fig. 8C), so this is attributed to non-specific
trapping. No staining was detected in the papillae or
270
ARNOLD ET AL.
Fig. 8. Spatial restriction of HmEGFL-1 expression by whole-mount in
situ hybridisation. Expression of HmEGFL-1 is indicated by purple
staining. Embryos were hybridised against antisense (A,B,D) and sense
(C) riboprobes. A: A lateral view of a late tailbud embryo. Expression of
HmEGFL-1 is observed at the anterior tip of the trunk. The posterior end of
the tail is out of focus. B: A larval embryo immediately after hatching.
Expression of HmEGFL-1 is observed in the papillae (pp) and anteriormost part of the trunk. The two dark spots are the ocellus (oc) and otolith
(ot). C: A larval embryo hybridised with the sense riboprobe. No staining is
detected in the papillae or anteriormost part of the trunk. The staining in
the larval tunic at the posterior end of the tail is nonspecific. D: A saggital
section of a larva after whole-mount in situ hybridisation. Strong expression is observed throughout the papillae (pp) and anteriormost part of the
trunk. Weak expression is observed in the epidermis (ep). The larval tunic
(tu) is nonspecifically stained. Anterior is to the right for all embryos. The
Scale bar 5 100 祄 in A?C and 50 祄 in D.
anterior part of the trunk with the sense probe (Fig.
8C). Expression above background was not detected in
embryos before the late tailbud stage or in larvae 3 hr
post-hatching.
To analyse the cellular localisation of expression in
more detail, some of the whole-mount antisense stained
larvae were sectioned (Fig. 8D). This demonstrates that
HmEGFL-1 is expressed strongly throughout all cells of
the papillae and the most anterior part of the larval
trunk. Less intense expression is also evident in the
single layer of epidermal cells covering the entire trunk
(Fig. 8D) of the larvae.
DISCUSSION
We have reported here the isolation and characterisation of the cDNA for a gene known to be specifically
expressed during the tailbud and larval stages of
ascidian development. The derived protein contains
three types of repeat sequences, including four EGFlike repeats. The novel domain structure and lack of
strong sequence homologies indicate that it represents
a new gene which we have designated HmEGFL-1.
The EGF-like domains had highest similarity to
regions from the chymotrypsin/elastase isoinhibitor
proteins (1 and 2?5), human fibrillin 1 and 2, the
mouse, human, and rat epidermal growth factor (EGF)
precursor, and human von Willebrand factor precursor.
The similarity of the ascidian protein to the chymotrypsin/elastase isoinhibitor proteins extends a further six
residues outside each end of the EGF-like domain. All
eight cysteine residues in this region are conserved,
although the spacing varies slightly. The chymotrypsin/
elastase isoinhibitor reactive site sequence of Leu, Met,
Cys, and Arg (Babin et al., 1984) corresponds to a
sequence of Leu, Ile, Cys, and Glu in HmEGFL-1,
representing conservative changes to this sequence.
The disulfide bonding structure of the chymotrypsin/
elastase isoinhibitor proteins is different from that of
the EGF-like domains, and, as the degree of sequence
similarity is not sufficient to determine which conformation is most likely for the ascidian protein, structural
studies will be necessary.
The homologous regions from human fibrillin 1 and 2
and the mouse, human, and rat epidermal growth
factor (EGF) precursor are Ca21-binding EGF-like domains. These Ca21-binding EGF-like domains have, in
addition to the six cysteine residues with conserved
spacing, a secondary consensus of Asp/Asn, Asp/Asn,
Asp/Asn, Tyr/Phe (positions 1, 3, 19, and 24 in Fig. 3A)
(Rees et al., 1988; Davis, 1990). Studies have suggested
that the role of Ca21 binding is to stabilise the conformation of the tandem EGF-like repeats which occur in
these proteins (Rao et al., 1995; Knott et al., 1996). The
ascidian protein does not contain this Ca21-binding
consensus sequence which may reflect the fact that the
EGF-like repeats in HmEGFL-1 are not in tandem, but
are separated by other conserved regions.
The 48-residue six-cysteine repeat does not have the
conserved spacing of the fourth and fifth cysteines
(CxC) found in EGF-like domains, although it may
represent a divergent type of EGF-like domain as
variations in the spacing of the fourth and fifth cysteine
residues of up to four positions have been reported for
fibulin-1 and fibulin-2 (Argraves et al., 1990; Pan et al.,
1993b). The similarities of these 48 residue six-cysteine
repeats were also against EGF-like domains, although
in this case, the similarity spanned two tandemly
repeated EGF-like domains. Structural studies of this
motif will again be required to distinguish between the
possibility of its being an EGF-like motif or another
type of domain.
The lack of overall sequence similarity to any known
protein demonstrates that HmEGFL-1 represents a
novel protein. The possibility of predicting function by
sequence similarity is further complicated by the fact
that EGF-like repeats are found in many proteins with
GENE SIGNALS ASCIDIAN METAMORPHOSIS
diverse roles in development such as cell growth and
proliferation, specification of cell fate, and neuronal
guidance (reviewed in Davis, 1990; Carpenter, 1993).
The restricted spatiotemporal expression pattern of
HmEGFL-1 indicates a role associated with the papillae and anterior part of the trunk at the larval stage of
development. The papillae is a structure of packed
cuboidal cells and some neuronal cells arranged in a
triangular shape and covered with a single layer of
flattened epidermal cells (Torrence and Cloney, 1983;
Satoh, 1994). The papillae secrete adhesives which
enable the larvae to attach to substrates, with attachment initiating the subsequent events of metamorphosis. Little is known about the identity of the signal for
ascidian metamorphosis or how the various events are
initiated or coordinated.
A study of the role of the papillae in the metamorphosis of H. momus larvae has recently been reported
(Degnan et al., 1997). In this study, the larvae were
severed at various points along the anterior-posterior
axis and the severed fragments were maintained in a
common test. Anterior fragments could be induced to
undergo metamorphosis; however, posterior fragments
only underwent metamorphosis when fused with papillae-containing fragments (Degnan et al., 1997). These
results suggest that an anterior signalling centre associated with the papillae releases a diffusible factor
required for metamorphosis.
The restriction of the spatial expression of HmEGFL-1
to the papillae and anteriormost trunk correlates with
this demonstration of an anterior signalling centre of
the larvae required for initiation of metamorphosis in
H. momus (Degnan et al., 1997). Further, the predicted
signal peptide in HmEGFL-1 and the lack of any other
major hydrophobic regions which could form transmembrane domains suggests that HmEGFL-1 is likely to be
an extracellular, secreted protein. This correlates with
the demonstration that an intact nervous system is not
required for induction of metamorphosis and that the
signal can move posteriorly when cells are in direct or
close contact (Degnan et al., 1997). Therefore,
HmEGFL-1 may be involved in signalling the initiation
of metamorphosis in H. momus.
Molecular markers are now available for almost all
cell types in the ascidian embryo. For the epidermis, six
regions have been defined by restricted patterns of
spatial gene expression (Ishida et al., 1996). HmEGFL-1
represents the first molecular marker described for the
papillae and anteriormost trunk (region 3), and thus
may be valuable for further studies of the differentiation of the papillae.
EXPERIMENTAL PROCEDURES
Ascidian Collection and Embryo Culture
Adult specimens of H. momus forma curvata were
collected from the slope and flats of Heron Reef (23�8
S; 151�8 E) and maintained in flow-though aquaria
under constant illumination at The University of
Queensland Heron Island Research Station. Embryos
271
were cultured into Millipore-filtered (0.2 祄 pore size)
seawater (FSW) as described in Degnan et al. (1996).
Metamorphosis was induced in larvae about 4 hr after
hatching by adding KCl to 40 mM in the FSW (Degnan
et al., 1997).
RNA Isolation
RNA for northern blots was isolated from large-scale
cultures of stage-specific embryos (.5,000 embryos)
obtained by the removal of unfertilised eggs from the
mixed culture by centrifugation though Ficoll-Paque
(Pharmacia) at 1,000g for 10 min; normal developing
embryos were collected from the seawater?Ficoll interface. These embryos were of approximately 95% purity
for the selected stage. RNA extraction was performed
immediately by homogenising in 4 volumes of NETS
buffer (50 mM Tris, pH 7.6, 200 mM NaCl, 50 mM
EDTA, and 2% SDS), extracting with phenol/chloroform, and precipitating in ethanol. RNA was further
purified by LiCl precipitation, and the concentration
was determined by spectrophotometry. The extraction
of poly(A)1 RNA was performed using an Oligotex
mRNA kit (Qiagen) following the manufacturers instructions.
Northern and Southern Blot Analysis
Poly(A)1 RNA was resolved using formaldehydeagarose gel electrophoresis and transferred by capillary
blotting to a Hybond-N membrane (Amersham) and
fixed by UV irradiation (Sambrook et al., 1989). Membranes were prehybridised for at least 1 h at 42癈 in
50% formamide, 53 saline sodium citrate (SSC), 53
Denhardt?s solution, 50 mM sodium phosphate buffer
(pH 6.8), 1% sodium dodecyl sulfate (SDS), 250 礸/ml
salmon sperm DNA, and 100 礸/ml yeast tRNA and
hybridised for 16 hr in 50% formamide, 53 SSC, 13
Denhardt?s solution, 20 mM sodium phosphate buffer
(pH 6.8), 1% SDS, 10% dextran sulfate, 100 礸/ml
salmon sperm DNA, 100 礸/ml yeast tRNA, and approximately 100 ng of [32P]labelled DNA probe. Membranes
were washed twice in 23 SSC/0.1% SDS at room
temperature for 15 min and then once in 0.13 SSC/
0.1% SDS at 65癈 for 15 min and exposed to film.
Genomic DNA was extracted by lysing sperm in the
NETS buffer containing 200 礸/ml proteinase K, followed by phenol/chloroform extraction and ethanol
precipitation. This DNA was digested separately with
BamHI, HindIII, NcoI, and PstI (5 礸 per digest),
resolved on an agarose gel, and transferred to a nylon
membrane by capillary blotting. The membrane was
then hybridised with a [32P]labelled cDNA probe spanning positions 850 to 1105 of the HmEGFL-1 cDNA for
16 hr in a solution containing 53 SSC, 53 Denhardts
solution, 5% dextran sulfate, 0.5% SDS, and 100 礸/ml
salmon sperm DNA. Washing was carried out as above.
RACE Cloning of cDNA
The Clontech Marathony cDNA Amplification Kit
was used according to the manufacturer?s instructions
272
ARNOLD ET AL.
for the rapid amplification of cDNA ends (RACE) corresponding to clone CB06LL18. A PCR primer was
designed to amplify the predicted 58 region of unknown sequence (58 GCTGCTTTTGAAGTCCCAACGC).
Double-stranded cDNA was synthesised from 1 礸 of
poly(A)1 RNA primed with an oligo-dT containing
primer and ligated to the Marathon adaptor. PCR
amplification was performed with the gene-specific
primer and a primer that anneals to the adaptor: AP1
(58 CCATCCTAATACGACTCACTATAGGGC). The PCR
product was gel purified before cloning into pGEM-5zf
(Promega) and sequencing using the ABI Prismy Dye
Terminator cycle sequencing kit.
RT-PCR Analysis
cDNA was synthesised from 1 礸 of stage-specific
total RNA (DNase treated) using superscript reverse
transcriptase (Gibco-BRL) and an oligo-dT primer in a
20 祃 reaction volume. PCR amplification was performed simultaneously for both HmEGFL-1 and ubiquitin using 1 and 2 祃 of a 1:100 dilution of this cDNA in a
25-祃 volume. Reaction conditions were 24 cycles of
94癈 for 40 sec, 58癈 for 40 sec, and 72癈 for 2 min. The
primers used were EGF-1 (58 GATGGATCCGTCGGTGGAGCGATAGCC), EGF-2 (58 CAGGAATTCACTCGAATTCATCTGGGG), HmUBQ-1 (58 GAYAARGARGGNATHCCNCCNGAYCARCAG) and HmUBQ-2 (58
YTGDATYTTNGCYTTNACRTTYTCDAT). A control reaction without reverse transcription was included for
each cDNA.
The PCR products were resolved on duplicate agarose gels and transferred to nylon membranes by
capillary blotting. These filters were then hybridized
overnight to radioactive probes, one to HmEGFL-1 and
the other to ubiquitin, washed, and exposed to film. To
ensure consistency of results, the cDNA synthesis was
carried out twice for each stage-specific RNA, and the
PCR reactions were performed twice for each cDNA.
The intensity of the bands was found to reflect the
amount of input cDNA, and hence the amplification
was quantitative and within the linear range of PCR
amplification.
Nucleotide and Amino Acid Sequence Analysis
Nucleotide sequence analysis was performed using
MacVector software. Database searches for derived
amino acid sequence similarities were conducted at the
National Centre for Biotechnology Information (NCBI)
using the BLAST, BLITZ, and FASTA programs.
For the construction of phylogenetic relationships,
the Molecular Evolutionary Genetics Analysis (MEGA)
software was used (Kumar et al., 1993). This software
was used to construct a neighbour-joining tree (Satou
and Nei, 1987) by the complete deletion method.
Whole-Mount In Situ Hybridisation
Whole-mount in situ hybridisation was performed
using sense and antisense digoxigenin-labelled RNA
probes as described (Arnold et al., 1997) based on a
method originally described by Tautz and Pfeifle (1989).
Briefly, embryos were fixed in 4% paraformaldehyde,
washed in methanol, incubated in 90% methanol containing 50 mM EGTA, washed with 100% ethanol, and
stored at 220癈 in 100% ethanol. After rehydration, the
embryos were manually dechorionated in PBT (0.1%
Tween 20 in PBS), treated with 50 礸/ml proteinase K
for 15 min, and refixed in 4% paraformaldehyde in PBS.
Prehybridisation was carried out in 50% formamide,
53 SSC, 0.1% Tween 20, 50 礸/ml heparin, and 100
礸/ml herring sperm DNA (HS) for 1 hr at 45癈 and
hybridisation for 16 hr at 45癈 in a volume of 100 祃
containing 100 ng of digoxigenin (DIG)-labelled riboprobe. Riboprobes were constructed by the incorporation of digoxigenin (DIG)-UTP in an in vitro transcription reaction from the partial cDNA fragment CB06LL18
using either SP6 or T7 RNA polymerase to generate
sense and antisense probes (Boehringer Mannheim
DIG RNA labelling kit).
Following hybridisation, the embryos were washed in
4:1, 3:2, 2:3, and 1:4 HS:PBT mixtures, then in PBT for
20 min each. The embryos were then treated with
RNase A and RNase T1 and washed twice more with
PBT. The anti-DIG antibody conjugate was preabsorbed against fixed embryos in PBT for 2 hr, and the
embryos were incubated in PBT containing a 1:2,000
dilution of the antibody for 2 hr. Non-specifically bound
antibody was removed by washing several times in
PBT. The embryos were then washed twice in 100 mM
Tris, pH 9.5, 100 mM NaCl, 50 mM MgCl2, and 0.1%
Tween 20 and then incubated in the same buffer
containing 4.5 祃 NBT/ml and 3.5 祃 BCIP/ml. Colour
development was monitored visually, and the reaction
was stopped by transferring the embryos into PBT.
For the sectioning of whole-mount stained larvae, the
embryos were fixed in 4% paraformaldehyde in PBS,
washed for 5 min in methanol and 10 min in isopropanol, and embedded in paraffin wax. Serial sections were
taken at 10 礛.
ACKNOWLEDGMENTS
We thank Dr. T. Yamada for comments on this
manuscript, Dr. M. Hargrave for assistance with the
sectioning, Dr. R. Slade for assistance with the phylogenetic analysis, and the staff of The University of
Queensland Heron Island Research Station for the use
of boating, aquaria, and laboratory facilities. This work
was conducted under permit numbers G95/024 and
G95/579 from the Great Barrier Reef Marine Park
Authority.
REFERENCES
Argraves WS, Tran H, Burgess WH, Dickerson K. Fibulin is an
extracellular matrix and plasma glycoprotein with repeated domain
structure. J Cell Biol 1990;111:3155?3164.
Arnold JM, Kennett C, Lavin MF. Transient expression of a novel
serine protease in the ectoderm of the ascidian Herdmania momus
during development. Dev Genes Evol 1997;206:455?463.
Babin DR, Peansky RJ, Goos SM. The inhibitors of chymotrypsin/
elastase from Ascaris lumbricoides: the primary structure. Arch
Biochem Biophys 1984;232:143?161.
GENE SIGNALS ASCIDIAN METAMORPHOSIS
Bell GI, Fong NM, Stempien MM, Wormsted MA, Caput D, Ku L,
Urdea MS, Rall LB, Sanchez-Pescador R. Human epidermal growth
factor precursor: cDNA sequence, expression in vitro and gene
organization. Nucleic Acids Res 1986;14:8427?8446.
Berrill NJ. The Origin of Vertebrates. Oxford: Oxford University
Press, 1955.
Campbell ID, Bork P. Epidermal growth factor-like modules. Curr
Opin Struct Biol 1993;3:385?392.
Carpenter G. EGF: new tricks for an old growth factor. Curr Opin Cell
Biol 1993;5:261?264.
Conklin EG. Mosaic development in ascidian eggs. J Exp Zool 1905;2:
146?223.
Davis CG. The many faces of epidermal growth factor. New Biologist
1990;2:410?419.
Degnan BM, Rohde PR, Lavin MF. Normal development and embryonic gene activity of the ascidian Herdmania momus. Aust J Mar
Freshwater Res 1996;47:543?551.
Degnan BM, Souter D, Degnan SM, Long SC. Induction of metamorphosis with potassium ions requires development of competence and
an anterior signalling centre in the ascidian Herdmania momus.
Dev Genes Evol 1997;206:370?376.
Dittmen WA, Majerus PW. Sequence of a cDNA for mouse thrombomodulin and comparison of the predicted mouse and human amino
acid sequences. Nucleic Acids Res 1989;17:802.
Gray A, Dull TJ, Ullrich A. Nucleotide sequence of epidermal growth
factor cDNA predicts a 128,000 molecular weight protein precursor.
Nature 1983;303:722?725.
Ishida K, Ueki T, Satoh N. Spatio-temporal expression patterns of
eight epidermis-specific genes in the ascidian embryo. Zool Sci
1996;13:699?709.
Kanzaki T, Olofsson A, Moren A, Wernstedt C, Hellman U, Miyazono
K, Claesson-Welsh L, Helden CH. TGF-beta 1 binding protein: a
component of the large latent complex of TGF-beta 1 with multiple
repeat sequences. Cell 1990;61:1051?1061.
Knott V, Downing AK, Cardy CM, Handford P. Calcium binding
properties of an epidermal growth factor-like domain pair from
human fibrillin-1. J Mol Biol 1996;255:22?27.
Kumar S, Tamura K, Nei M. MEGA: Molecular Evolutionary Genetics
Analysis, version 1.0. University Park, PA: Pennsylvania State
University, 1993.
Kyte J, Doolittle RF. A simple method for displaying the hydropathic
character of a protein. J Mol Biol 1982;157:105?132.
Lal AA. Primary structure of the 25-kilodalton ookinete antigen from
Plasmidium reichenowi. Mol Biochem Parasitol 1990;43:143?145.
Mancuso DJ, Tuiley EA, Westfield LA, Worrall NK, Shelton-Inloes BB,
Sorace JM, Alevy YG, Sadler JE. Structure of the gene for human
von Willebrand factor. J Biol Chem 1989;264:19514?19527.
Nicol D, Meinertzhagen IA. Development of the central nervous
system of the larvae of the ascidian, Ciona intestinalis L. II. Neural
plate morphogenesis and cell lineages during neurulation. Dev Biol
1988;130:737?766.
Nishida H. Cell lineage analysis in ascidian embryos by intracellular
injection of a tracer enzyme. III up to the tissue restricted stage. Dev
Biol 1987;121:526?541.
273
Pan TC, Kluge M, Zhang RZ, Mayer U, Timpl R, Chu ML. Sequence of
extracellular matrix protein BM-90/fibulin and its calcium dependent binding to other basement membrane ligands. Eur J Biochem
1993a;215:733?740.
Pan T, Sasaki T, Zhang R, Fassler R, Timpl R, Chu M. Structure and
expression of fibulin-2, a novel extracellular matrix protein with
multiple EGF-like repeats and consensus motifs for calcium binding. J Cell Biol 1993b;123:1269?1277.
Pereira LV, D?Alessio M, Ramirez F, Lynch JR, Sykes B, Pangilinan T,
Bonadio J. Genomic organization of the sequence coding for fibrillin,
the defective gene product in Marfan syndrome. Hum Mol Genet
1993;2:961?968.
Poutney DL. Isolation, primary structures and metal binding properties of neuronal growth inhibitory factor (GIF) from bovine and
equine brain. FEBS Lett 1994;345:193?197.
Price PM, Saggi SJ, Safirstein R. Cloning and expression of the rat
preproepidermal growth factor cDNA: comparison with mouse and
human sequences. DNA Cell Biol 1992;11:481?487.
Rao Z, Handford PA, Mayhew M, Knott V, Brownlee GG, Stuart D. The
structure of the Ca21-binding epidermal growth factor-like domain:
its role in protein-protein interactions. Cell 1995;82:131?141.
Rees DJG, Jones IM, Handford PA, Walter SJ, Esnouf MP, Smith KJ,
Brownlee GG. The role of b-hydroxyaspartate and adjacent carboxylate residues in the first EGF domain of human factor IX. EMBO J
1988;7:2053?2061.
Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory
Manual, 2nd Edition. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory Press, 1989.
Satoh N. Developmental Biology of Ascidians. Cambridge: Cambridge
University Press, 1994.
Satou N, Nei M. The neighbour-joining method: a new method for
reconstructing phylogenetic trees. Mol Biol Evol 1987;4:406?425.
Scott J, Urdea M, Quiroga M, Sanchez-Pescador R, Fong NM, Selby M,
Rutter WJ, Bell GI. Structure of a mouse submaxillary messenger
RNA encoding epidermal growth factor and seven related proteins.
Science 1983;221:236?240.
Tautz D, Pfeifle C. A non-radioactive in situ hybridization method for
the localisation of specific RNAs in Drosophila embryos reveals
translational control of the segmentation gene hunchback. Chromosoma (Berl) 1989;98:81?85.
Torrence SA, Cloney RA. Ascidian larval nervous system: primary
sensory neurons in adhesive papillae. Zoomorphology 1983;102:111?
123.
Tsim KWK. cDNA that encodes active agrin. Neuron 1992;8:677?689.
Vaessin H, Bremmer KA, Knust E, Campos-Ortega JA. The neurogenic gene Delta of Drosophila melanogaster is expressed in neurogenic territories and encodes a putative transmembrane protein
with EGF-like repeats. EMBO J 1987;6:3431?3440.
von Heijne G. A new method for predicting signal sequence cleavage
sites. Nucleic Acids Res 1986;14:4683?4690.
Zhang H, Apfelroth SD, Hu W, Davis EC, Sanguineti C, Bonadio J,
Mecham RP, Ramirez F. Structure and expression of fibrillin-2, a
novel microfibrillar component preferentially located in elastic
matrices. J Cell Biol 1994;124:855?863.
Документ
Категория
Без категории
Просмотров
3
Размер файла
268 Кб
Теги
180
1/--страниц
Пожаловаться на содержимое документа