close

Вход

Забыли?

вход по аккаунту

?

346

код для вставкиСкачать
Cell Motility and the Cytoskeleton 45:1–9 (2000)
Molecular Responses of Human Dermal
Fibroblasts to Dual Cues:
Contact Guidance and Mechanical Load
V.C. Mudera,1* R. Pleass,2 M. Eastwood,3 R. Tarnuzzer,4 G. Schultz,4 P. Khaw,2
D.A. McGrouther,1 and R.A. Brown1
1University
College London, Tissue Repair Unit, Division of Plastic and
Reconstructive Surgery, London, United Kingdom
2University College London, Wound Healing Group, Department of Pathology,
Institute of Ophthalmology, London, United Kingdom
3University of Westminster, Centre for Tissue Engineering Research, Department
of Technology and Design, London, United Kingdom
4University of Florida, Department of Obstretrics and Gynecology,
Gainesville, Florida, USA
Fibroblast contraction in wound healing involves the interaction of several cell
types, cytokines, and extracellular matrix molecules. We have previously developed fibroblast alignment models using precise uniaxial mechanical loads in 3D
culture and using contact guidance on fibronectin strands. Our aim here was to use
contact guidance to place fibroblasts in their potentially most sensitive configuration, i.e., perpendicular to the axis of loading, to present cells with conflicting
guidance cues. Gene expression at the mRNA level of cells recovered from
different zones of the 3D collagen gel (with distinct orientation) was determined by
quantitative RT-PCR for the matrix proteases MMP1, 2, and 3, and inhibitors
TIMP1 and 2.Our results show a 2-, 4-, and 3-fold increase in MMP1, 2, and 3,
respectively, in the non-aligned strain zone, relative to the aligned strain zone.
These results suggest that cells unable to align to applied loads remodel their
matrix far more rapidly than orientated cells. Where fibroblasts were held in an
alignment perpendicular to the applied load by contact guidance, the fall in MMP
mRNA expression was largely abolished, indicating that these cells remained in a
mechano-activated state. The protease inhibitors TIMP1 and 2 were poorly
mechano-responsive, further suggesting that changes in MMP expression result in
functional matrix remodelling. These results indicate how mechanical loading in
tissues may influence matrix remodelling, particularly under conflicting guidance
cues. Cell Motil. Cytoskeleton 45:1–9, 2000. r 2000 Wiley-Liss, Inc.
Key words: quantitative RT-PCR; contact guidance; mechanical load; MMP; TIMP; fibroblasts; collagen gel
INTRODUCTION
Fibroblast populated collagen lattices (FPCLs) have
been widely used as an in vitro model for wound
contraction. Studies have tested the effect of mechanical
loads on fibroblasts in collagen lattices. These have
ranged from the effect of stress on cyclic AMP [He and
Grinnell, 1994] and PDGF receptors [Lin et al., 1998],
Tenascin C [Chiquet-Ehrismann et al., 1994], alpha
smooth muscle actin [Arora et al., 1994], increased cell
proliferation [Butt et al., 1995], and morphological alter-
r 2000 Wiley-Liss, Inc.
This work was carried out jointly at the Tissue Repair Unit and Wound
Healing Group, University College London. Templates for Quantitative RT-PCR were synthesised and purified at the University of Florida.
Contract grant sponsor: Engineering and Physical Sciences Research
Council; Contract grant sponsor: Guide Dogs for the Blind.
*Correspondence to: Dr. Vivek Mudera, University College London,
Tissue Repair Unit, Division of Plastic and Reconstructive Surgery,
67–73 Riding House Street, London W1P,7LD, UK.
E-mail: v.mudera@ucl.ac.uk
Received 17 March 1999; accepted 21 September 1999
2
Mudera et al.
ations as feedback reactions [Chamson et al., 1997].
Previous work from our group examining the effects of
precise uniaxial mechanical loading on FPCLs has demonstrated an ability to predictably align fibroblasts along
lines of principal strain [Eastwood et al., 1998] (see Fig.
5) and mechanical responses of fibroblasts to external
loading, which maintains a tensional homeostasis [Eastwood et al., 1996]. In our FPCL model using the
Tensioning culture force monitor, we have also demonstrated using Finite Element Analysis, whereby in the
regions where mechanical loading was non-directional in
the FPCL, called the ␦ zone (because of the stiffness of
the material used to anchor the FPCLs), the cells did not
become bipolar and elongate but remained stellate in
shape even though they were subjected to the same
mechanical loading (see Fig. 6) [Eastwood et al., 1998].
This has led to the hypothesis that the morphological and
motile behavior of fibroblasts tends to ‘‘stress shield’’
them from the perceived mechanical loads wherever they
are able to. (Note: ‘‘percieved load’’ depends on the
applied load and the material properties, i.e., stiffness of
the matrix.) This shielding corresponds to a bipolar,
elongate morphology orientated parallel with the principal strain.
An alternative means to control fibroblast alignment uses topographic guidance, for example micromachined grooves of different dimensions [Oakely et al., 1997;
Curtis and Wilkinson, 1997]. Contact guidance of cellular
migration and orientation has been described on orientated collagen fibrils [Guido and Tranquillo, 1993] and on
fibronectin fibres [Ejim et al., 1993]. Contact guidance to
fibronectin fibres acts at two levels. Firstly, the cells on
the fibres become bipolar and align parallel with the fibre
(i.e., direct cell-fibre interaction). Subsequently, multiple
layers of cells ‘‘dock’’ parallel to this first layer of cells
apparently by cell-cell attachment [Ejim et al., 1993],
representing a second, indirect form of contact alignment.
This ability to control cell orientation experimentally (using contact guidance or tensional models) has
great potential in understanding the basic biological
mechanisms regulating development, growth, and repair.
It is also critical for the development of advanced forms
of tissue repair and cell engineering therapies for example
in peripheral nerve repair, production of tendon and
ligament substitutes in vitro, and control of microvascular
repair. The aim in all cases is to orientate repair cells and
new tissue formation, not least the plane in which the
extracellular matrix is laid down.
Whilst these models provide detailed information
on cellular responses to single cues, cells in vivo are
subjected to complex and interdependent combinations of
mechanical and contact guidance cues. The aim of the
present study was to test the concept that cells subjected
to conflicting orientating cues would behave in a manner
that is a predictable compromise between each cue.
Dermal fibroblasts were in the first stage aligned by
contact guidance on fibronectin strands embedded in an
FPCL. They were then subjected to uniaxial mechanical
loads applied at 90° to the fibronectin fibres. Cell orientation on fibronectin fibres gives a principal orientation
without external tension. The second external loading
cue, perpendicular to the contact guidance cue, would be
predicted to cause some realignment of contact guided
cells. This hypothesis predicts that cell movement (and
eventual matrix deposition) will lead to optimal stress
shielding from external loads, i.e., parallel alignment;
consequently, cells that have been pre-aligned perpendicular to the applied load should be maximally stimulated. To
test this hypothesis we monitored the effects of these
conflicting cues on gene expression of three important
enzymes in matrix remodeling MMP1, 2, and3 and their
natural inhibitors TIMP1 and 2.
MATERIALS AND METHODS
Human dermal fibroblasts were cultured from explants of normal skin taken directly from the operating
theater [Burt and McGrouther, 1992] in Dulbecco’s
Modified Eagle’s Medium (DMEM) supplemented with
10% (v/v) Fetal Calf Serum (FCS, First Link, West
Midlands, UK), with glutamine (2 mM, ICN, Biochemicals Ltd, Thyne, UK), and penicillin/streptomycin (1,000
U/ml/100 µg/ml) (Gibco Life Technologies, Paisley, UK).
Cells were used between passage 3–6 for experiments.
Preparation of Fibronectin Strands
Fibronectin strands were extruded by a modified
method as described by Underwood et al. [1999]. Briefly,
fibronectin-rich plasma solution obtained as a by-product
(Scottish National Blood Transfusion Service, Plasma
Fractionation Laboratory, Edinburg) was used. The protein concentration of the solution was 4.7 mg/ml of which
3.4 mg/ml was fibronectin and 1.3 mg/ml was fibrinogen.
The solution was acidified to precipitate proteins by
addition of 0.1M Citric acid at a v/v ratio of 1 acid:2
protein solution to give a final pH between 4.0 to 4.5. The
acidified solution was gently stirred to facilitate protein
aggregation. Strands of aggregated fibronectin were drawn
up using a fine glass rod and washed repeatedly in
copious amounts of DW followed by isotonic saline and
DMEM to neutralize the acidity.
Mechanical Loading Model
Fibroblast Populated Collagen Lattices (FPCL) were
set up as described earlier [Eastwood et al., 1998]. Gels
were prepared by mixing 4 ml of 2.28 mg/ml solution of
native acid soluble Type I rat tail collagen (Advanced
Protein Products, West Midlands, UK) with 0.5 ml of
Molecular Responses to Conflicting Guidance Cues
3
FPCLs were treated for mRNA extraction as described
below.
Assembly of the FPCL for the dual cue model (Fig.
1) involved formation of a two-layered gel. The first layer
was made by casting 2 ml of collagen containing
proportionate fibroblasts, followed by a layer of dermal
fibroblasts and three fibronectin strands perpendicular to
the long edges of the gel followed by another layer of
fibroblasts and a further 2 ml of collagen solution
containing fibroblasts. This was to ensure even distribution of fibroblasts throughout the gel to maintain similarity with the mechanically loaded model. This was then
allowed to gel at 37°C for 5 min, topped up with 15 ml of
culture medium, mounted onto the tensioning-culture
force monitor, and cyclically loaded as described.
Extraction of mRNA
Fig. 1. Overhead and side view schematic of Dual Cue Model showing
fibronectin strands along which cells align, perpendicular to the applied
mechanical load.
10⫻ DMEM and neutralized with 5M NaOH prior to
addition of fibroblasts (106 cells/ml of gel solution)
suspended in 0.5 ml of DMEM. The 5-ml collagen/cell
suspension formed a gel within 5 min at 37°C, at which
stage the cell chamber was topped up with a further 15 ml
of culture medium.
Rectangular FPCLs (75⫻ 25 mm) were restrained
by their opposing short edges to give a high aspect ratio
configuration as described earlier [Eastwood et al., 1998].
The entire apparatus was then transferred and fixed to the
tensioning-Culture Force Monitor (t-CFM) a modification of the Culture Force Monitor described previously
[Eastwood et al., 1998]. FPCLs were loaded with 120
Dyne force in a 1-hr cycle after an 8-hr pre-culture period
without any loading, during which time the cells established a tensional homeostasis [Brown et al., 1998]. The
loading cycle consisted of 15 min of linear loading at a
rate of 480 dynes/hr, followed by a 15-min resting phase
(with no change of load), then unloading for 15-min
reversal of loading, and finally a further 15-min resting
phase. The total cycle time was 1 hr repeated for 16 hr
after which the FPCLs were recovered and the different
zones (described in Fig. 1) were separated using a scalpel
and immersed in modified lysis buffer for mRNA extraction as described below.
Free-floating gels were set up as described above
except that the gels were untethered (i.e., not attached to
the t-CFM). After casting, the FPCL was detached using a
fine bore needle and, after the addition of 15 ml of culture
medium, allowed to float unrestrained. After 24 hr, the
mRNA was extracted from gels using Qiagen kits
with a minor modification. The gels were cut using a
surgical scalpel into different zones of alignment and
these gel pieces were immersed in the lysis buffer
supplied with the kits. An extra 5 µl of ␤-mercaptoethanol/ml of lysis buffer was added to facilitate break up of
disulfide bonds and the lysis buffer with the gel was
frozen overnight at ⫺20°C . Upon thawing, the gel with
the resident cells had lysed completely and the subsequent extraction process was followed according to the
manufacturer’s protocol. Only samples with an OD
260:280 ratio between 1.8–2.0 were used for subsequent
RT-PCR analysis.
Preparation of Competitive MMP Template and
Quantitative(QC)-RT-PCR Protocol
Competitive MMP template was prepared as described by Tarnuzzer et al. [1996] from a synthetic
Super-Template Plasmid Construct. cDNA was synthesized using serial dilutions of the competitive MMP
template from 6.8 ⫻ 102 to 6.8 ⫻ 109 copies/reaction
along with 0.1 µg of extracted RNA in each tube for all
samples along with 2.5 mM oligo(dt)16, 1.5 mM MgCl2,
200 µM dNTP (Promega), 50 U/ml Human Placenta
Ribonuclease Inhibitor, Tris-HCl, pH 8.3, 50 mM KCL
and 200 U/µg RNA Moloney Murine Leukemia Virus
(MMLV)- RT (Life Technologies, Gaithersburg, MD).
The reaction was incubated at 25°C for 10 min, 37°C for
60 min, and 92°C for 5 min.
cDNA amplification was carried out in a 50 µl
reaction volume containing 5 µl of the RT reaction, 200
µM dNTP (Promega USA), 50 pmol of each 38 and 58
PCR primer, 1.5 mM MgCl2, 10 mM Tris-HCL, pH 8.3,
50 mM KCl, and 0.25 µl/reaction Taq DNA polymerase
(Perkin-Elmer). Amplification reactions were carried out
in 40 sequential cycles of 94°C for 1.5 min, 58°C for
2 min, and 72°C for 3 min.
4
Mudera et al.
Fig. 2. Photograph of 2% agarose gel stained with ethidium bromide
showing decreasing band intensity for sample as template concentration increases with primers for MMP2. Template (333 bp) and sample
bands (615 bp) are clearly separated. Marker used is Phi X/ Hae III.
Primer Sequences for MMP Template
MMP1 38: AGGTTAGCTTACTGTCACAC
MMP1 58: TTGTCCTCACTGAGGGAAAC
MMP2 38: GTACTTGCCATCCTTCTCAA
MMP2 58: CCTGTTTGTGCTGAAGGACA
MMP3 38: GTTCTGGAGGGACAGGTTCC
MMP3 58: TCAGAACCTTTCCTGGCATC
TIMP1 38: GACACTGTGCAGGCTTCAGT
TIMP1 58: CAGACCACCTTATACCAGCG
TIMP2 38: GTTGGAGGCCTGCTTATGGG
TIMP2 58: TCTGGAAACGACATTTATGG
Detection and Quantitation of PCR Products
PCR products were separated on 2% agarose gels
containing 25 ng/ml ethidium bromide and photographed.
(Fig. 2). The photographs were scanned and band intensities measured using NIH image. Band intensity values
were normalized based on molecular weight of the
products. The log ratio of band intensities within each
lane was plotted against the log of the copy number of
template added per reaction. Quantity of target messages
was determined where the ratio of template and targetband intensities was equal to 1. As the RNA used in the
RT reaction is constant, the copy numbers per cell were
extrapolated using 26 pg as the universally accepted
standard of RNA per cell [Tarnuzzer et al., 1996].
RESULTS
Baseline responses of cells within a 3D collagen
matrix were determined for fibroblast MMP and TIMP
gene expression after 24 hr in unloaded free floating
collagen lattices. Since the cells themselves generate an
Fig. 3. Bar diagram for unloaded collagen lattice comparing copy
numbers/1,000 cells ⫾ S.D. for MMP1, 2, and 3 and TIMP1 and 2.
endogenous contraction force, some localised tension
between neighbouring cells is inevitable. However, it was
possible to use untethered free-floating gel (i.e., with no
reactive loading) as a control for nil external mechanical
loading. Cells in free-floating gels did not align and were
mostly stellate in shape. Since external loading was
uniformly minimal these gels were analysed in total and
not divided into zones as with subsequent gel models.
Figure 3 shows the copy number/1,000 cells of
MMP1, 2, and 3 and TIMP 1 and 2 for free-floating gels.
The mean copy number among the MMPs was lowest for
MMP3, and TIMP1 mean copy number was 410 ⫾ 34 as
compared to 494 ⫾ 40 for TIMP2.
Figure 4 compares the MMP mean copy number/
1,000 cells from cells within the non-aligned ␦-zone and
cells from the single-cue mechanically aligned zone. In
each case ␦ and single-cue zone cells were analysed from
the same gel. Non-aligned ␦-zone cells (Fig. 5) showed
the highest total MMP expression. Cells that were aligned
parallel to the applied mechanical load (Fig. 6) in the
single-cue zone showed downregulation of total MMP
expression relative to cells in the nonaligned ␦-zone zone.
Molecular Responses to Conflicting Guidance Cues
5
Fig. 5. Picture of cells in the ␦ zone. Note stellate shaped cells with no
orientation. Scale 20⫻.
Fig. 4. Bar diagram for mechanically loaded gel comparing MMP1, 2,
and 3 copy numbers/1,000 cells ⫾ S.D. in non-aligned delta zone and
single cue mechanically aligned zone. Note: Down regulation of
MMPs in single cue aligned zone.
MMP1 mean copy number in the aligned zone was 50%,
MMP2 was 22%, and MMP3 was 37% of that in the
non-aligned ␦-zone within the same gel. This suggests
that cells that have been mechanically loaded but are
unable to align significantly increase their MMP expression. In contrast, cells that were able to align downregulated their MMP expression. MMP2 seemed to be the
most responsive species to mechanical stimulii (over
fourfold reduction in copy numbers).
Figure 7 shows the comparable expression of TIMP
1 and 2 from cells within the non-aligned ␦-zone and cells
from the single-cue mechanically aligned zone. In this
case, aligned cells showed 53% TIMP1 and 63 % TIMP2
of mean copy number/1,000 cells when compared with
non-aligned mechanically loaded cells within the same
gel. There was no significant increase in TIMP expression
by non-aligned loaded cells (␦ zone) relative to freefloating gels (Fig. 3) despite the upregulation of MMPs.
However, TIMP expression in single cue mechanically
loaded and aligned cells was down regulated when
compared to cells from the ␦ zone. Although differential
Fig. 6. Picture of cells aligning along lines of principal strain. Note the
elongate and bipolar morphology. Scale 20⫻.
responses were seen between MMP and TIMP in the ␦
zone, both species of TIMP responded in parallel throughout the experimental series.
Figure 8 compares MMP expression of cells in
non-aligned ␦ zone with that in the dual cue zone. MMP1
6
Mudera et al.
Fig. 7. Bar diagram for mechanically loaded gel comparing TIMP1
and 2 copy numbers/1,000 cells ⫾ S.D. in non-aligned delta zone and
single cue mechanically aligned zone. Note: Down regulation of
TIMPs in single cue aligned zone is less than MMPs.
copy number in the dual cue zone was 86% of that in the
non-aligned zone, whilst MMP2 was 72% and MMP3
was 78%. These reductions in expression were modest
and contrast dramatically with the fourfold down regulation of copy number in cells from the single cue aligned
zone. This absence of down regulation of copy numbers
occurred despite the fact that by the end of the 16 loading
cycles, most of the cells had realigned to become parallel
to the applied mechanical load, which was now predominant.(Fig. 9a,b). Indeed, 80% of cells were estimated to
have realigned to become parallel to the applied mechanical load whilst 20% of cells were adherent to the fibronectin fibres and remained aligned along them, perpendicular to the applied load. The absense of predicted down
regulation, despite 80% cell realignment, suggests that
the cells that were still adherent and perpendicular to the
loading contributed a disproportionately large proportion
of the total signal, effectively obscuring the expected
down regulation as seen in Figure 3.
Figure 10 shows that TIMP1 and 2 show 83% and
86% of copy numbers in the dual cue zone when
Fig. 8. Bar diagram comparing copy numbers/1,000 cells ⫾ S.D. of
MMP1, 2, and 3 from non-aligned delta zone and dual cue zone. Note:
Down regulation of MMPs is not as much as in single cue aligned zone.
compared to the non-aligned zone. These figures again
reflect a much lower down regulation in copy number
than expected when compared to the down regulation by
single cue mechanically aligned cells (Fig. 7).
DISCUSSION
Previous studies on topographic cues have shown
that many cell types like fibroblasts, nuerites, oesteoblasts, and macrophage-like cells will take on alignment
parallel to that of ridges or fibres of appropriate dimension in their substrate [Curtis and Wilkinson, 1997; Gray
et al., 1996; Matsuzawa et al., 1994]. A specific form of
contact guidance using aligned fibronectin fibres has been
developed as a model here [Ejim et al., 1992; Underwood
et al., 1999]. In this model, cells are aligned to discreet
artificial fibres of fibronectin and migrate along those
tracks in vitro [Wojciak-Stothard et al., 1997]. Another
major organizing cue is known to be mechanical loading
across the substrate. Mechanical loading in vitro using a
Fig. 9. a: Photograph of cells in dual cue zone after 16 cycles of mechanical loading. Note: A layer of cells
still aligned along fibronectin strand while the rest have realigned parallel to the direction of mechanical
loading. Scale 20⫻. b: Higher magnification of cells in dual cue zone after 16 cycles of mechanical
loading. Scale 40⫻.
8
Mudera et al.
Fig. 10. Bar diagram comparing copy numbers/1,000 cells ⫾ S.D. of
TIMP1 and 2 from non-aligned delta zone and dual cue zone.
flex cell device [Butt et al., 1996] has been reported,
though the complex nature of predominant mechanical
forces in this model makes reliable correlation with cell
behavior difficult. In fibroblasts, response to mechanical
loading has been shown to result in an elongate bipolar
morphology parallel with the axis of a uniaxial repetitive
mechanical strain [Eastwood et al., 1998]. Using this
same uniaxial strain model for mechanical loading fibroblasts, it has also proved possible to identify responsive
species of matrix metalloproteases. In a previous study,
gross changes in protein expression were monitored over
prolonged experimental periods and total protease activity was measured by zymography [Prajapati, 1998]. This
demonstrated that uniaxialy loaded fibroblasts appear to
dramatically alter their rates of matrix remodeling and
also that some species of MMPs are differentially modulated by loading, representing potentially good markers
of cell activation.
Having established that cells can be organized and
aligned in a predictable manner in vitro by single cues,
i.e., either contact guidance or mechanical load, the aim
here has been to determine the cellular response to
multiple conflicting cues. In effect, the interplay between
cues has been tested in this model in an attempt to
determine which form of cue is dominant in any given
circumstance. Analysis of the cellular responses in this
model was adapted to make use of QT-RT-PCR for the
measurement of mRNA expression since direct measurement of protein measurement for this low number of cells
is not presently feasible. In effect, this analysis of gene
expression provides a short measure of cell activity at the
time of the end of mechanical loading.
The initial finding of this study was that uniaxial
mechanical loading was able to reorganize cells that were
not directly attached to the fibronectin fibre cues. Eighty
percent of cells guided by these were aligned by cell-cell
contact as opposed to direct cell-fibre contact (Fig. 9a,b).
These cells in this conflicting, dual cue zone appeared to
be under weaker guidance, since at the end of the
experiment they were realigned parallel to the applied
load.
Analysis of MMP expression in the three zones—
namely, non-aligned mechanical loaded, single cue uniaxial aligned load, and dual cue guided zones—indicated
that the ability to align to the mechanical loading in the
single cue zone led to a dramatic down regulation of
message. Cells under the same mechanical load but
without any predominant alignment (hence unable to
become aligned) express far higher levels of MMP
message than even cells in the unloaded collagen lattice,
which also have no alignment. This is consistent with the
idea that non-aligned, mechanically loaded cells are
stimulated to move and remodel their matrix whilst the
ability to align (and to minimise the perceived strain)
reverses this process, potentially leading to matrix accumalation. The most differentially reactive species of the
three tested was the gelatinase, MMP2. MMP2 has been
implicated in other systems in the process of cell motility
[Gianelli et al., 1997]. The additional differential response in the down regulation of MMPs (MMP2) is likely
to be accentuated in effect since down regulation of
TIMP1 and 2 was far less in the single cue zone,
potentially increasing the TIMP:MMP ratio.
The importance of cell alignment to applied load
was supported by the minimal down regulation of MMP
and TIMP in the dual cue zone. This was the zone where
cells were predicted to be most sensitive to mechanical
loading because of their orientation across the loading
axis. Though less than 20% of the cells retained the
perpendicular alignment, down regulation of signal was
reduced by three- to fourfold, indicating that these cells
produced disproportionately higher MMP and TIMP
message, obscuring the down regulation of message of
the remaining 80% of cells that did become aligned.
Findings from the model provide a new insight into the
Molecular Responses to Conflicting Guidance Cues
differential response of cells to realistic cues, likely to
occur in natural tissues or in vitro, in engineered tissues.
In this instance, mechanical loading appeared to dominate over cell-cell contact guidance on previously aligned
cells. However, cells directly in contact with the guiding
substrate could not be realigned, and appeared to be
maximally stimulated by the mechanical strain. It seems
likely that cell movement and remodeling associated with
this stress shielding may be mediated through expression
of MMP activity. Further studies are in progress to
characterize MMP responses as potential markers of
mechanical activation. Practical application of guidance
cues, for example, in tissue engineering, are likely to
require multiple control cues, since contact guidance is
effective in guiding and accelerating cell recruitment. At
the same time, mechanical cues will inevitably be present
as fibroblasts remodel and contract, collagenous matrices
leading to complex and conflicting cues.
ACKNOWLEDGMENTS
We are grateful to Dr. Ann Lee and Ms. Kirsty
Smith for photography.
REFERENCES
Arora PD, Bibby KJ, McCullogh CA. 1994. Slow oscillations of free
intracellular calcium ion concentration in human fibroblasts
responding to mechanical stretch. J Cell Physiol 161:187–200.
Brown RA, Prajapati R, McGrouther DA, Yannas IV, Eastwood M.
1998. Tensional Homeostasis in dermal fibroblasts: Mechanical
responses to mechanical loading in three-dimensional substrates. J Cellular Physiol 175:323–332.
Burt AM, McGrouther DA. 1992. Production and use of skin cell
cultures in theraputic situation. In: SpierRE, Griffiths JB,
editors. Animal cell biotechnology. New York: Academic Press.
p 150–168.
Butt RP, Laurent GJ, Bishop JE. 1995. Mechanical load and polypeptide growth factors stimulate cardiac fibroblast activity. Ann NY
Acad Sci 752:387–393.
Chamson A, Sudre F, Le-Guen C, Le J, Rattner A, Frey J. 1997.
Morphological alteration of fibroblasts mechanically stressed in
collagen lattice. Arch Dermatol Res 289:596–599.
Chiquet-Ehrismann R, Tannheimer M, Koch M, Brunner A, Spring J,
Martin D. 1994. Tenasin C expression by fibroblasts is elevated
in stressed collagen gels. J Cell Biol 127:2093–2101.
9
Curtis A, Wilkinson C. 1997. Topographical control of cells. Biomaterials 18:1573–1583.
Eastwood M, Porter R, Khan U, McGrouther DA, Brown RA. 1996.
Quantitative analysis of collagen gel contractile forces generated by dermal fibroblasts and the relationship to cell morphology. J Cell Physiol 166:33–42.
Eastwood M, Mudera VC, McGrouther DA, Brown RA. 1998. Effect
of precise mechanical loading on fibroblast populated collagen
lattices: morphological changes. Cell Motil Cytoskeleton 40:
13–21.
Ejim OS, Blunn GW, Brown RA. 1993. Production of artificially
orientated mats and strands from plasma fibronectin: a morphological study. Biomaterials 14:743–748.
Gianelli G, Falk-Marzillier J, Schiraldi O, Stetler-Stevenson WG,
Quaranta V. 1997. Induction of cell migration by matrix
metalloprotease-2 cleavage of laminin-5. Science 277:225–228.
Gray C, Boyde A, Jones SJ. 1996. Topographically induced bone
formation in vitro: implications for bone implants and bone
grafts. Bone 18:115–123.
Guido S, Tranquillo RT. 1993. A methodology for the systematic and
quantitative study of cell contact guidance in oriented collagen
gels. Correlation of fibroblast orientation and gel birefringence.
J Cell Sci 105:317–331.
He Y, Grinnell F. 1994. Stress relaxation of fibroblast activates a cyclic
AMP signaling pathway. J Cell Biol 126:457–464.
Lin YC, Ho CH, Grinnell F. 1998. Decreased PDGF receptor kinase
activity in fibroblasts contracting stressed collagen matrices.
Exp Cell Res 240:377–387.
Matsuzawa M, Potember RS, Krauthamer V. 1994. Use of chemically
patterened substrate to study directional effect of damaging
electrical stimulation on cultured neuroblastoma cells. Brain
Res 667:47–53.
Oakley C, Jaeger NA, Brunette DM. 1997. Sensitivity of fibroblasts
and their cytoskeletons to substratum topographies: topographic
guidance and topographic compensation by micromachined
grooves of different dimensions. Exp Cell Res 234:413–424.
Prajapati R. 1998. The regulation of proteases and mechanical loading
during fibroblast populated collagen lattice contraction. Ph.D.
thesis. University of London.
Tarnuzzer RW, Macauley SP, Farmerie WG, Caballero S, Ghassemifar
MR, Anderson JT, Robinson CP, Grant MB, Humphreys-Beher
MG, Franzen L, Peck AB, Schultz GS. 1996. Competitive RNA
templates for detection and quantitation of growth factors,
cytokines, extracellular matrix components and matrix metalloproteinases by RT-PCR. Biotechniques 20:670–674.
Underwood S, Afoke A, Brown RA, MacLeod AJ, Dunnill P. 1999. The
physical properties of a fibrillar fibronectin-fibrinogen material
with potential use in tissue engineering. Bioprocess Engineering
20:239–248.
Wojciak-Stothard B, Denyer M, Mishra M, Brown RA. 1997. A study
of the adhesion, orientation and movement of cells cultured on
ultrathin fibronectin fibres. In Vitro Cell Dev Biol 33:110–117.
Документ
Категория
Без категории
Просмотров
2
Размер файла
427 Кб
Теги
346
1/--страниц
Пожаловаться на содержимое документа