close

Вход

Забыли?

вход по аккаунту

?

613

код для вставкиСкачать
DEVELOPMENTAL DYNAMICS 216:450–458 (1999)
Derivation of Melanocytes From Embryonic
Stem Cells in Culture
TOSHIYUKI YAMANE,1 SHIN-ICHI HAYASHI,1 MASAKO MIZOGUCHI,2
HIDETOSHI YAMAZAKI,1 AND TAKAHIRO KUNISADA1*
1Department of Immunology, School of Life Science, Faculty of Medicine, Tottori University, Yonago, Japan
2Department of Dermatology, St. Marianna University School of Medicine, Kawasaki, Japan
ABSTRACT
We report that embryonic stem
(ES) cells were efficiently induced to differentiate
to melanocytes in vitro. When undifferentiated
ES cells were cocultured with a bone marrow–
derived stromal cell line, a very small but significant number of melanocytes were reproducibly
generated. This process was greatly enhanced by
addition of dexamethasone to the culture and
strictly depended on steel factor, the ligand for
the c-Kit receptor tyrosine kinase. Expression of
c-Kit on the precursor cells was confirmed by
using SCL/tal-1-/- ES cells, which are defective for
producing hematopoietic cells, which were thus
ruled out as possible sources of nonmelanogenic
c-Kit-expressing cells. The morphology, reactivity to growth factors, and expression of melanogenic markers of the cells generated all indicated
unequivocally that these cells were melanocytes.
This culture system may provide a potent tool for
the study of development and function of melanocytes. Dev Dyn 1999;216:450–458.
r 1999 Wiley-Liss, Inc.
Key words: melanocyte; ES cell; stromal cell;
dexamethasone; steel factor; c-Kit; endothelin 3; mouse
INTRODUCTION
Mouse embryonic stem (ES) cells derived from the
inner cell mass of 3.5-day postcoitum (dpc) blastocysts
are totipotent cells (Evans and Kaufman, 1981; Martin,
1981) closely resembling the primitive ectoderm of the
very early postimplantation embryo. As in vitro models
for cell differentiation, ES cells can generate various
cell lineages, such as parietal and visceral endoderm,
cardiac muscle (Doetschman et al., 1985), vascular
endothelial cells (Vittet et al., 1996), hematopoietic
cells (Doetschman et al., 1985), and neuronal cells
(Wobus et al., 1988). Although ES cells can thus be
induced to differentiate into cells of all three germ
layers, until now there has been no solid evidence that
ES cells could also be induced to generate neural crest
lineage in vitro. During the neurulation stage, neural
crest cells migrating away from the closing neural tube
develop into a variety of cell lineages that include bone
and cartilage cells of the head, neurons and glia of the
sensory and autonomic nervous systems, and all melar 1999 WILEY-LISS, INC.
nocytes of the skin, inner ear, and choroid (Le Douarin,
1982; Bronner-Fraser, 1995).
Among the various types of neural crest–derived cell
lineages, we first chose melanocytes for induction attempts from ES cells, because melanocytes are derived
mainly from the neural crest. Migration, survival,
proliferation, and differentiation of the neural crest–
derived melanocytes are dependent on steel factor
(SLF), the ligand for the c-Kit receptor tyrosine kinase
expressed on the surface of melanocytes and their
precursors (Kunisada et al., 1998b). On the other hand,
pigmented epithelial cells of the retina and iris, which
are sometimes called melanocytes, are formed from the
neuroepithelium of the optic vesicle. These cells are
histologically distinguishable from those of neural crest
origin, because they form a simple epithelial layer of
hexagonal cells without dendritic processes (Silvers,
1979). Dopaminergic neurons of the locus ceruleus and
substantia nigra are also known to contain characteristic melanin granules, called neuromelanin (Breathnach,
1988). Importantly, these pigment cells of nonneural
crest origin are not affected by null mutations of the Slf
or c-Kit genes (Motro et al., 1996; Kunisada, unpublished observations) and thus they can be discriminated
from melanocytes of neural crest origin not only by
their morphology but also by their SLF-independent
growth.
To induce melanocytes from ES cells, we took advantage of the ST2 stromal cell line, which was first
developed for the establishment of long-term bone
marrow cultures (Ogawa et al., 1989). Also, co-culture
of ES cells with ST2 cells generated hematopoietic cell
lineages in response to appropriate growth factors or
cytokines (Yamane et al., 1997); therefore, ST2 monolayers are also expected to provide the environment necessary for melanocyte differentiation. In this culture
system, undifferentiated ES cells are inoculated directly onto ST2 monolayers, without forming cell aggregates or embryoid bodies, and thus the whole process of
cell development can easily be monitored. Here, we
report efficient and reproducible induction of the differentiation of ES cells into melanocytes. The melanocytes
*Correspondence to: Takahiro Kunisada, Department of Immunology, School of Life Science, Faculty of Medicine, Tottori University, 86
Nishi-machi, Yonago 683-8503, Japan. E-mail: tkunisad@grape.
med.tottori-u.ac.jp
Received 6 July 1999; Accepted 20 September 1999
INDUCTION OF MELANOCYTES FROM ES CELLS
451
Fig. 1. Genotype of tyrosinase of ST2 cell. A: Restriction maps of
mouse tyrosinase coding region subjected to polymerase chain reaction
(PCR) amplification with primers described in experimental procedures.
DdeI restriction enzyme site is indicated by D. B: DNAs prepared from
ST2 cells or mouse strains indicated on each lane were amplified by PCR
and then cut by DdeI restriction enzyme for restriction fragment length
polymorphism analysis.
produced express markers of the melanocyte lineage,
including c-Kit, and require SLF, suggesting that these
cells correspond to skin melanocytes originated from
neural crest cells. Numbers indicated in A and B are the
length of the DNA fragments (bp).
RESULTS
Generation of Melanocytes From
Undifferentiated ES Cells in Culture
Fig. 2. Effects of various factors on melanocyte differentiation from
embryonic stem (ES) cells. Two thousand D3 ES cells were inoculated
onto ST2 monolayers and incubated in the presence of the indicated
factors. On day 21 of culture, cells were trypsinized, and the number of
melanocytes was counted. The number represented by 100% is 29,700,
the number of melanocytes generated in the presence of Dex only (bar 9).
Each bar represents the average value of triplicate cultures in a representative experiment, and vertical bars indicate standard deviations.
Differentiation of mature melanocytes from their
precursors in vitro requires supporting feeder cells,
such as keratinocytes (Hirobe, 1994). Because monolayers of stromal cells are used for the induction of
hematopoietic cells from ES cells, we first tested whether
the ST2 stromal cell line is capable of supporting
melanocyte development. To confirm the genotype of
tyrosinase of ST2 cell line, a part of tyrosinase coding
region was amplified by polymerase chain reaction
(PCR) and tested for its restriction fragment length
polymorphism (RFLP), according to Shibahara et al.
(Fig. 1A, based on the result of Shibahara et al., 1990).
As shown in Fig. 1B, the amplified fragment from ST2
had two DdeI cutting sites, and this RFLP pattern was
identical with that of BALB/c albino mouse. C57BL/6
mouse was confirmed to have the wild-type tyrosinase
gene containing a single DdeI site. Thus, any pigmented cells observed in the culture are derived from
ES cells. We initially inoculated 2,000 undifferentiated
D3 ES cells onto ST2 monolayers, and then maintained
the cultures for 21 days in medium containing 10% calf
serum. Under these conditions, small numbers of melanocytes were reproducibly generated (110 cells per well
in four independent experiments performed in duplicate), therefore, we performed further improvement of
the culture system.
The effects of basic fibroblast growth factor (bFGF),
cholera toxin (CT), and 12-O-tetradecanoyl phorbol
acetate (TPA), agents known to promote generation of
melanocytes from migrated neural crest cells (Ito et al.,
1993) and of dissociated epidermal skin tissue (Hirobe,
1992; Sviderskaya et al., 1995), were tested. TPA caused
moderate enhancement (6,500 melanocytes per well in
duplicate cultures) when added alone, but no other
factor or combination of factors enhanced the generation of melanocytes (bars 1–8 of Fig. 2). Dexamethasone
452
YAMANE ET AL.
(Dex) very strongly promoted the generation of melanocytes (23,000 cells per well in 3 independent sets of
duplicate cultures). The addition of bFGF, CT, or TPA
slightly increased the number of Dex-induced melanocytes (bars 9–16 of Fig. 2). When added alone, 1a,
25-dihydroxyvitamin D3 (1a, 25-(OH)2D3), which is
known to promote melanin synthesis in mouse melanoma cells (Hosoi et al., 1985), was 40 times less potent
than Dex. Treatment with bFGF, CT, or TPA in addition
to 1a, 25-(OH)2D3 caused significant further enhancement of generation of melanocytes, but only to a level
less than one-tenth of that induced by Dex alone (bars
17–20 of Fig. 2). In the presence of 1a, 25-(OH)2D3, TPA
was inhibitory when combined with CT, or CT and
bFGF (bars 21–24 of Fig. 2). Dex plus 1a, 25-(OH)2D3
was slightly more effective than Dex alone, but the
further addition of the other three factors singly or in
any combination had very little effect (bars 25–32). The
degree of enhancement of induction of melanocytes by
Dex was the same at concentrations of 1028 to 1025
mol/L Dex in the presence of 10% calf serum, 20 pmol/L
bFGF, and 10 pmol/L CT (Fig. 3A). We next tested the
period during which Dex facilitates differentiation of
melanocytes. As shown in Fig. 3B, the addition of Dex
from day 0 to day 6 slightly enhanced the number of
melanocytes, indicating that Dex was effective in the
early phase of melanocyte development from ES cells.
However, the addition of Dex from day 12 until day 21
exerted the same magnitude of effect as when Dex was
added throughout the culture period, from day 0 until
day 21. Thus, although Dex may affect the entire
developmental process of melanocytes from ES cells,
the number of melanocytes that appeared was mostly
affected by Dex at a later stage, apparently from day 12
or later.
In the medium containing calf serum and Dex, a
small number of what appeared to be black, dendritic
melanocytes first appeared at around day 14 of culture,
and the number increased thereafter until day 21. In
the presence of bFGF and/or CT, mature melanocytes
were observed 1 or 2 days earlier in the culture. Based
on these results, we set the standard conditions for the
generation of melanocytes from D3 ES cells as: 10% calf
serum, 1027 mol/L Dex, 20 pmol/L bFGF, and 10 pmol/L
CT. The morphology of ES cell–derived melanocytes is
shown in Fig. 4. On day 6, single ES cells had multiplied and formed colonies (Fig. 4A and B); then, on days
12 and 13, dendritic or bipolar pigmented cells that
looked like mature melanocytes had migrated out of the
colonies (Fig. 4C–F, and K). On day 21, most of the
culture dish was covered with these mature melanocytes (Fig. 4G–J, and L). In this later stage of the
culture, dendritic cells observed were fully pigmented.
Electron microscopic analysis revealed typical melanocytes with long dendrites and numerous stage IV
mature melanosomes (Fig. 4M and N). Some melanocytes were actively producing melanosomes, because
they contained stage II and III melanosomes in their
cytoplasm (m2 and m3 in Fig. 4N). Melanosome com-
Fig. 3. The effects of Dex dose and period of Dex treatment in
embryonic stem cell cultures on melanocyte differentiation. Cultures were
prepared and maintained in the standard conditions except that various
doses of Dex (A) were added for 21 days. Similarly, cultures were
supplemented by 1027 mol/L Dex for the indicated periods (B).
plexes made by cells phagocytosing their own dendrites
were occasionally found in the cytoplasm of melanocytes. These ultrastructures confirmed that fully developed active melanocytes were generated from ES cells
in this culture system.
Effect of SLF and Endothelin 3 (ET3) on
Induction of Melanocytes From ES Cells
The factors thus far genetically proven to be indispensable for melanocyte development are SLF (Kunisada et
al., 1998a; Kunisada et al., 1998b and references therein)
and ET3 (Baynash et al., 1994). We therefore tested the
INDUCTION OF MELANOCYTES FROM ES CELLS
Fig. 4. Morphology of the cells differentiated from embryonic stem
(ES) cells. D3 ES cells were cultured under the standard conditions (with
Dex, basic fibroblast growth factor and cholera toxin). A, B: Photomicrographs from day 6 of the culture. Cell colonies, relatively small (A) and
large (B), were observed. (C–F) On day 12, pigmented melanocytes were
not yet detected in most of the colonies. G–J: On day 21, many
melanocytes were observed inside and outside of the colonies. K: On day
13, pigmented melanocytes, indicated by arrows, started to appear at the
edge of each colony. L: On day 21, melanocytes were highly pigmented
453
and dendritic in shape. M and N: To further define the structure of these
melanocytes, cells from day 21 of culture were examined by electron
microscopy, as previously described (Okura et al., 1995). D, F, H, and J:
Bright-field images matching the phase-contrast images in (C), (E), (G),
and (I), respectively. Scale bars: A and B 5 400 µm; C–J 5 200 µm; K and
L 5 100 µm; M 5 5 µm; N 5 1 µm. Abbreviations in (M) and (N): d,
dendrite; m2, m3, and m4: stage II, stage III, and stage IV melanosomes,
respectively. Asterisk indicates a cell that may be a melanoblast without
melanosomes.
454
YAMANE ET AL.
Expression of c-Kit in ES Cell Culture
Fig. 5. Effects of steel factor (SLF) and ET3 on generation of
melanocytes from D3 ES cells. SLF and/or ET3 were added to culture
medium containing Dex or Dex, basic fibroblast growth factor (bFGF), and
cholera toxin. In the experiment represented by the bottommost bar,
30 µg/ml of ACK 2 monoclonal antibody (Nishikawa et al., 1991) was
added throughout the culture period. Each bar represents the average
value of triplicate cultures in a representative experiment, and vertical
lines indicate standard deviations.
effects of these factors in this culture system. Addition
of SLF had no significant effect on the induction of
melanocytes from ES cells cultured in medium containing Dex (bars 1 and 2 of Fig. 5). In the presence of ET3,
five times more melanocytes were generated (bars 1
and 3 of Fig. 5) and this enhancement did not change by
the further addition of SLF (bar 4 of Fig. 5). This
ET3-induced enhancement was also observed in the
standard culture containing Dex, bFGF, and CT (bars 5
and 7 of Fig. 5). Again, SLF did not induced any
enhancement of melanocyte induction (bars 6 and 8 of
Fig. 5). ET3-mediated promotion of proliferation and
differentiation of melanocytes from embryonic neural
crest has been reported (Reid et al., 1996; Lahav et al.,
1996; Opdecamp et al., 1997). On the other hand,
addition of SLF did not have any effect on melanocyte
development. This is not surprising because ST2 cells
are known to produce SLF (Ogawa et al., 1991), and
differentiated heterogeneous cell populations other than
melanocytes may also produce SLF.
SLF-dependent melanocyte development of the present culture system was shown by the fact that the
addition of ACK2 antibody, which prevents binding of
SLF to its receptor, c-Kit (Nishikawa et al., 1991),
abolished melanocytes from ES cell culture (bar 9 of
Fig. 5). Elimination of melanocyte precursors by ACK2
treatment was observed in cultures of isolated neural
tubes (Reid et al., 1995) or in developing embryos
(Yoshida et al., 1993). The effect of ACK2 is specific to
melanocyte lineage, because osteoclasts appeared normally in the presence of ACK2 (Yamane et al., 1997).
The fact that induction of melanocytes from ES cells
is SLF-dependent leads us to expect that precursors
expressing the SLF receptor, c-Kit, might transiently
appear in the culture. Because of the totipotency of ES
cells, the present culture system generates multiple cell
lineages in addition to melanocytes. In fact, SLFdependent, c-Kit1 precursors of hematopoietic cells are
generated in the ES cultures on ST2 monolayers (Yamane, unpublished observation). To prevent the emergence of c-Kit1 hematopoietic cells in the present ES
cell cultures, we took advantage of SCL/tal-1-/- ES cells,
from which no hematopoietic cells are induced in vivo
(Porcher et al., 1996) or in vitro (Porcher et al., 1996).
SCL/tal-1-/- ES cells generated mature melanocytes
morphologically indistinguishable (Fig. 6A) from those
generated from normal ES cells (Fig. 6B). Thus, c-Kit1
cells detected on day 9 of the culture are highly likely to
be melanocyte precursors or melanoblasts (Fig. 6C, D).
The appearance of these c-Kit1 cells was prevented in
the SCL/tal-1-/- ES cell culture by ACK2 treatment
(Fig. 6E, F).
Expression of Melanocyte Lineage Markers
To follow the expression of some critical melanogenic
markers, we used reverse transcriptase polymerase
chain reaction (RT-PCR) to analyze expression of Trp-1
(Jimenez et al., 1991), Trp-2 (Tsukamoto et al., 1992),
and tyrosinase (Jimenez et al., 1989), at various times
in the cultures. Trp-2 and tyrosinase mRNAs were first
detected on day 6 of culture, and the less-abundant
Trp-1 mRNA was also detected on day 6. The expression
of these markers reached a maximum on day 12
(Fig. 7A). Expression of MITF, a basic-helix-loop-helixzipper transcription factor whose mutations are associated with loss of neural crest–derived melanocytes, was
monitored using anti-MITF antibody (Opdecamp et al.,
1997). Cells stained by the anti-MITF antibody were
detected on day 6 of the culture (Fig. 7B, C). Thus,
melanogenic markers need at least 6 days to become
detectable in this culture system.
Functional Analysis of Melanocyte Precursors
Generated From ES Cells
Expression of c-Kit protein in vitro was detected as
early as 2 days after explanation of the 9 dpc neural
tube (Reid et al., 1995), corresponding to 11 dpc in vivo,
when C-kit mRNA expression was found in the embryo
along melanocyte migration pathways (Manova and
Bachvarova, 1991; Duttlinger et al., 1993). SLF dependence of neural crest cells in vitro begins 2 days after
explanation and lasts about 4 days (Morrison-Graham
and Weston, 1993). Blocking of any endogenous SLF
activity by ACK2 treatment of neural tube cultures
resulted in the loss of c-Kit-expressing melanocyte
precursors, indicating that these precursor cells are
SLF dependent (Reid et al., 1995). Generation of melanocytes from ES cells is also SLF dependent, as shown
INDUCTION OF MELANOCYTES FROM ES CELLS
in the previous sections. We tried to determine the
timing of the differentiation of ES cells into SLFdependent precursor cells. For this purpose, ACK2 was
added from the initiation of the ES cultures for various
periods, as indicated in Fig. 8. For the first 3–6 days of
culture, ACK2 showed no significant effect on the
induction of melanocytes. When ACK2 was added for
the first 9 days of the culture, the number of melanocytes on day 21 was decreased to 32% of control, and
when ACK2 was added for 12 days or longer, virtually
no melanocytes were generated. These results indicate
that SLF-dependent melanocyte precursors did not
emerge until around day 6, then emerged within the
next 3 days, and increased their number to the maximum level by day 12.
DISCUSSION
In this study, we have recapitulated the whole developmental process of melanocyte cell lineage, starting
from a totipotent ES cell line. Individual ES cells first
proliferate in a tightly associated form, as shown in Fig.
4A and B, and then melanocytes emerge inside (Fig. 4I
and J) or outside (Fig. 4G and H) of these colony-like
structures. Apparently, cells other than melanocytes,
such as endothelial cells, macrophages, and neuronlike cells (data not shown) exist in these colony-like
structures, suggesting that interaction between cells
derived from ES cells is important.
In the present culture system, the most critical
requirement for the induction of melanocytes was Dex,
which is not usually used for the culture of melanocytes. Instead, other reagents known to be important
for the induction of melanocytes from the neural tube,
or epidermal skin, such as bFGF, CT, and TPA, were not
as effective as Dex. Although the effect of Dex is
prominent during the later stages of the ES cell culture,
a small but significant effect was observed even when
Dex was added only during the first 6 days of the
culture. The effect of Dex on melanocyte development
needs to be further investigated.
Because melanocytes are mainly derived from neural
crest cells, we assume that induction of the neural crest
might have occurred in the culture. The possibilities
that pigmented cells induced in this culture are derived
from epithelial cells or neurons of nonneural crest
origin appear not to be the case for two reasons. First,
the pigmented cells induced are highly dendritic in
shape and very different from the cells of pigment
epithelium or neurons, as shown in Fig. 4L and M.
Second, pigmented cells induced in the present system
were dependent on c-Kit signaling, as is also true of the
cells of neural crest origin. On the other hand, the
pigment epithelium of retina and iris are totally independent of c-Kit signaling (Nishikawa et al., 1991). No
developmental defects are reported in neuromelanincontaining neurons of the locus ceruleus and substantia
nigra in c-kit-deficient W mutant mice (Motro et al.,
1996). However, although very unlikely, it is also possible that melanocytes in the present ES cell culture are
455
directly derived from ES cells without any relevance to
the normal differentiation pathway of melanocytes
from trunk neural crest.
In cultures started from 9.5 dpc neural tubes, early
melanocyte lineage markers, such as MITF and TRP-2,
appear as early as day 1 of culture and, in vivo,
MITF-positive cells are observed at around 10.5–11 dpc
(Opdecamp et al., 1997). In our culture system, melanocyte lineage markers first appeared as early as day 6 of
the culture (Fig. 7). We think that this difference
between the lag times before the onset of expression of
melanocyte lineage markers in ES cell cultures and
neural crest cell cultures is likely because ES cells
closely resemble the inner cell mass of 3.5 dpc, and need
the 6 days in culture to differentiate into the melanocyte lineage. In accordance with expression of melanocyte-specific markers on day 6 of the culture, the
generation of SLF-dependent precursors was detected
during days 6–9 of the culture (Fig. 8). Regardless of the
developmental process by which they were derived, the
melanocytes generated were strictly dependent on SLF,
as are those developed in vivo (Nishikawa et al., 1991)
or maintained in vitro (Murphy et al., 1992). Because
c-Kit1 cells were generated from SCL/tal-1-/- ES cells,
which are defective for hematopoiesis, precursors of
melanocytes generated in the present ES culture are
most likely to express c-Kit, as expected from the fact
that induction of melanocytes in the culture is SLF
dependent. ET3 is also indispensable for the proper
differentiation of melanocytes, and the addition of ET3
to the cultures increased the number of melanocytes.
These results show that the melanocytes generated are
normal, as judged by their growth factor dependency.
In this report, we have shown the induction of
melanocyte lineage cells from ES cells. By introducing
or removing genes necessary for the development and
function of melanocyte lineage, the present ES cell
cultures may contribute to elucidate more precise
mechanisms for melanocyte differentiation. Furthermore, in combination with strategic insertional mutagenesis study of ES cells, previously unknown genes
could possibly identified.
EXPERIMENTAL PROCEDURES
Genotype of Tyrosinase of ST2 Cell Line
Genomic DNAs purified from ST2 cells, kidney of
C57BL/6 and BALB/c mice were amplified by PCR.
Primers used were 58CTTCAAAGGGGTGGATGACC38
and 58GAACTTATTCTTTTCGGAGACACTC38. PCR
cycle was 94°C for 5 min, then 36 cycles of 94°C for 45
sec, 58°C for 1 min, and 72°C for 1 min. The amplified
fragments were cut by DdeI restriction enzyme and
separated by 3% of Agarose X (Nippon Gene, Japan) gel.
ES Cell Culture
D3 ES cells, SCL/tal-1-/- ES cells (established from
the J1 ES cell line) and J1 ES cells were maintained on
mouse embryonic fibroblasts in the presence of leukemia inhibitory factor as previously described (Yamane
456
YAMANE ET AL.
Fig. 7. Expression of melanocyte lineage markers. A: Embryonic
stem (ES) cell culture was carried out under the standard conditions, and
on the days indicated, cells were harvested for the purification of total
RNA, and then reverse transcriptase polymerase chain reaction was
performed to detect expression of melanogenic marker genes. The lane
labeled ‘‘ES’’ shows RNA that was prepared from undifferentiated ES cells
(HPRT, hypoxanthine phosphoribosyl transferase). B and C: Immunocytochemical detection of MITF was carried out by the method described
previously (Kunisada et al., 1996). The antisera were used at 150-fold
dilutions. On day 6, MITF became detectable in the nucleus (B). The
phase-contrast image shows that these MITF1 cells were growing tightly
attached to ST2 cells (C). Scale bar: B, C 5 25 µm.
Fig. 6. Melanocyte differentiation from SCL/tal-1-/- embryonic stem
(ES) cells. SCL/tal-1-/- ES cells (A) and J1 ES cells, from which SCL/tal-1-/cells were derived (B), were cultured on ST2 cells for 21 days under the
standard conditions. To identify c-Kit1 precursor cells, cultures of SCL/tal1-/- ES cells were fixed on day 9 and stained with anti-c-Kit monoclonal
antibody ACK4 (C, bright-field image; D, phase-contrast image). The
appearance of these c-Kit1 cells was prevented by the addition of
ACK2-blocking antibody during days 0–9 of culture (E, bright-field image;
F, phase-contrast image). Note that ACK4 and ACK2 have different
antigen recognition sites and do not interfere with the binding to each
other’s determinants. Scale bars: A, B 5 25 µm; C, F 5 50 µm.
et al., 1997). Two thousand undifferentiated ES cells
were harvested by trypsinization and inoculated into
six-well plates previously seeded with ST2 cells, and
differentiated in a-minimum essential medium (MEM)
supplemented with 10% calf serum (Hyclone) in 5%
CO2 at 37°C. For the experiments shown in Fig. 2, the
following factors: 1027 mol/L Dex (Sigma), 1028 mol/L
1a, 25-(OH)2D3 (Biomol Research Laboratories), 20
pmol/L bFGF, 50 nmol/L TPA (Sigma), or 10 pmol/L CT
(Sigma), were added in some experiments as indicated.
The medium was changed twice a week. For the experiments shown in Fig. 5, 100 ng/ml of recombinant mouse
SLF (Yasunaga et al., 1995), 100 ng/ml of ET3 (Peptide
Institute Inc.), and 30 µg/ml of ACK2 monoclonal
antibody (Nishikawa et al., 1991) were added as indicated.
Immunohistochemistry
Cells grown on ST2 monolayers in six-well plates
were fixed with 4% paraformaldehyde, washed twice
with phosphate-buffered saline (PBS) and incubated
with 0.3% H2O2 in methanol to inactivate endogenous
peroxidase, and then incubated with blocking medium
(10% normal goat serum in PBS). Next, 0.8 ml of
INDUCTION OF MELANOCYTES FROM ES CELLS
457
PCR conditions for tyrosinase were: 94°C, 5 min;
58°C, 2 min; 72°C, 3 min for the primary cycle, followed
by 36 cycles of 94°C, 0.75 min; 58°C, 2 min; 72°C, 1.5
min; and then extension at 72°C for 6 min. For other
primers, a 94°C, 3-min denaturation step was followed
by 36 cycles of 94°C, 0.75 min; 58°C, 1 min; 72°C, 1.5
min; and then extension at 72°C for 3 min.
ACKNOWLEDGMENTS
Fig. 8. Emergence of steel factor–dependent melanocyte precursors
in the embryonic stem (ES) cell culture. ACK2 blocking antibody (10 µg/ml)
was added for the indicated periods in the ES cultures prepared in six-well
plates under the standard condition. The numbers of melanocytes were
counted on day 21.
We thank T. Baba for technical assistance for electron
microscopy; S.H. Orkin for SCL/tal-1-/- ES cells; T.
Nakano for providing D3 ES cells; E. Nakajima for
reading the manuscript; and T. Shinohara for secretarial assistance. This work was supported by grants
from the Special Coordination Funds for Promoting
Science and Technology from the Science and Technology Agency of Japan, the Ministry of Education, Science, Sports and Culture of Japan, Cellular Technology
Institute, Otsuka Pharmaceutical Co. Ltd, and the
Uehara Memorial Foundation. T.Y. is a JSPS Research
Fellow.
REFERENCES
primary antibody solution diluted with blocking medium (1:400 for rabbit anti-mouse TRP-2; 1: 150 for
rabbit anti-mouse MITF; 10 µg/ml for rat anti-mouse
c-Kit monoclonal antibody, ACK4, Ogawa et al., 1991)
was added and incubated at room temperature for 12
hr. Cells were washed in PBS and then incubated for 30
min in 0.8 ml of second antibody solution (1 µg/ml of
horseradish peroxidase [HRP]-conjugated goat antirabbit IgG or HRP-conjugated goat anti-rat IgG, both
were purchased from Vector). Cells were again washed
in PBS, and 0.8 ml of diaminobenzidine (DAB) solution
was added to develop the peroxidase reaction. After 10
min, cells were washed several times with PBS to stop
the reaction. Anti-TRP2 antibody and anti-MITF antibody were gifts from Drs. V. Hearing (Tsukamoto et al.,
1992) and H. Arnheiter (Opdecamp et al., 1997), respectively.
RT-PCR Analysis
Total RNA was purified from cultures at various
times using Isogen (Nippon Gene). After treatment
with DNase I (Pharmacia), first-strand cDNA synthesis
was carried out using Super Script reverse transcriptase (Gibco-BRL) primed with random hexamer in a
20-µl reaction mixture containing 1 µg of total RNA.
One and one-half microliter of the first-strand cDNA
mixture was used for PCR with Taq polymerase (Toyobo)
performed in a 25-µl volume. Ten microliter of each
PCR product was electrophoresed on an agarose gel and
stained with ethidium bromide. Primers used for PCR
were as follows: TRP-1: 58GCCCCAACTCTGTCTTTTCTCAAT38/58GATCGGCGTTATACCTCCTTAGC38;
TRP-2: 58GGACCGGCCCCGACTGTAATC38/58GTAGGGCAACGCAAAGGACTCAT38; tyrosinase: 58GGGCCCAAATTGTACAGAGAAGC38/58CTGCCAGGAGGAGAAGAAGAAGGATG38; hypoxanthine phosphoribosyl
transferase (HPRT): 58GTAATGATCAGTCAACGGGGGC
Baynash AG, Hosoda K, Giaid A, Richardson JA, Emoto N, Hammer
RE, Yanagisawa M. 1994. Interaction of endothelin-3 with endothelin-B receptor is essential for development of epidermal melanocytes
and enteric neurons. Cell 79:1277–1285.
Breathnach AS. 1988. Extra-cutaneous melanin. Pigment Cell Res
1:234–237.
Bronner-Fraser M. 1995. Origins and developmental potential of the
neural crest. Exp Cell Res 218:405–417.
Doetschman TC, Eistetter H, Katz M, Schmidt W, Kemler R. 1985. The
in vitro development of the blastocyst-derived embryonic stem cell
lines: formation of visceral yolk sac, blood islands and myocardium.
J Embryol Exp Morphol 87:27–45.
Duttlinger R, Manova K, Chu TY, Gyssler C, Zelenetz AD, Bachvarova
RF, Besmer P. 1993. W-sash affects positive and negative elements
controlling c-kit expression: ectopic c-kit expression at sites of
kit-ligand expression affects melanogenesis. Development 118:705–
717.
Evans MJ, Kaufman MH. 1981. Establishment in culture of pluripotent cells from mouse embryos. Nature 292:154–156.
Hirobe T. 1992. Basic fibroblast growth factor stimulates the sustained
proliferation of mouse epidermal melanoblasts in a serum-free
medium in the presence of dibutyryl cyclic AMP and keratinocytes.
Development 114:435–445.
Hirobe T. 1994. Keratinocytes are involved in regulating the developmental changes in the proliferative activity of mouse epidermal
melanoblasts in serum-free culture. Dev Biol 161:59–69.
Hosoi J, Abe E, Suda T, Kuroki T. 1985. Regulation of melanin
synthesis of B16 mouse melanoma cells by 1 a, 25-dihydroxyvitamin
D3 and retinoic acid. Cancer Res 45:1474–1478.
Ito K, Morita T, Sieber-Blum M. 1993. In vitro clonal analysis of mouse
neural crest development. Dev Biol 157:517–525.
Jimenez M, Maloy WL, Hearing VJ. 1989. Specific identification of an
authentic clone for mammalian tyrosinase. J Biol Chem 264:3397–
3403.
Jimenez M, Tsukamoto K, Hearing VJ. 1991. Tyrosinase from two
different loci are expressed by normal and by transformed melanocytes. J Biol Chem 266:1147–1156.
Kunisada T, Yoshida H, Ogawa M, Shultz LD, Nishikawa S-I. 1996.
Characterization and isolation of melanocyte progenitors from
mouse embryos. Dev Growth Differ 38:87–97.
Kunisada T, Lu SZ, Yoshida H, Nishikawa S, Nishikawa SI, Mizoguchi
M, Hayashi SI, Tyrrell L, Williams DA, Longley BJ. 1998a. Murine
cutaneous mastcytosis and epidermal melanocytosis induced by
keratinocyte expression of transgenic stem cell factor. J Exp Med
187:1565–1573.
458
YAMANE ET AL.
Kunisada T, Yoshida H, Yamazaki H, Miyamoto A, Hemmi H, Nishimura E, Shultz LD, Nishikawa SI, Hayashi SI. 1998b. Transgene
expression of steel factor in the basal layer of epidermis promotes
survival, proliferation, differentiation and migration of melanocyte
precursors. Development 125:2915–2923.
Lahav R, Ziller C, Dupin E, Le Douarin NM. 1996. Endothelin 3
promotes neural crest cell proliferation and mediates a vast increase
in melanocyte number in culture. Proc Natl Acad Sci USA 93:3892–
3897.
Le Douarin NM. 1982. The neural crest. Cambridge: Cambridge
University Press.
Manova K, Bachvarova RF. 1991. Expression of c-kit encoded at the W
locus of mice in developing embryonic germ cells and presumptive
melanoblasts. Dev Biol 146:312–324.
Martin GR. 1981. Isolation of a pluripotent cell line from early mouse
embryos cultured in medium conditioned by teratocarcinoma stem
cells. Proc Natl Acad Sci USA 78:7634–7638.
Morrison-Graham K, Weston JA. 1993. Transient steel factor dependence by neural crest-derived melanocyte precursors. Dev Biol
159:346–352.
Motro B, Wojtowicz JM, Bernstein A, Van Der Kooy D. 1996. Steel
mutant mice are deficient in hippocampal learning but not longterm potentiation. Proc Natl Acad Sci USA 93:1808–1813.
Murphy M, Reid K, Williams DE, Lyman SD, Bartlett PF. 1992. Steel
factor is required for maintenance, but not differentiation, of
melanocyte precursors in the neural crest. Dev Biol 153:396–401.
Nishikawa S, Kusakabe M, Yoshinaga K, Ogawa M, Hayashi SI,
Kunisada T, Era T, Sakakura T, Nishikawa SI. 1991. In utero
manipulation of coat color formation by a monoclonal anti-c-kit
antibody: two distinct waves of c-kit-dependency during melanocyte
development. EMBO J 10:2111–2118.
Ogawa M, Nishikawa S, Ikuta K, Yamamura F, Naito M, Takahashi K,
Nishikawa S, Nishikawa SI. 1989. B cell ontogeny in murine embryo
studied by a culture system with the monolayer of a stromal cell
clone, ST2: B cell progenitor develops first in the embryonal body
rather than in the yolk sac. EMBO J 7:1337–1343.
Ogawa M, Matsuzaki Y, Nishikawa S, Hayashi SI, Kunisada T, Sudo T,
Kina T, Nakauchi H, Nishikawa SI. 1991. Expression and function
of c-kit in hematopoietic progenitor cells. J Exp Med 174:63–71.
Okura M, Maeda H, Nishikawa SI, Mizoguchi M. 1995. Effects of
monoclonal anti-c-kit antibody (ACK2) on melanocytes in newborn
mice. J Invest Dermatol 105:322–328.
Opdecamp K, Nakayama A, Nguyen M-TT, Hodgkinson CA, Pavan
WJ, Arnheiter H. 1997. Melanocyte development in vivo and in
neural crest cell cultures: crucial dependence on the Mitf basic-helixloop-helix-zipper transcription factor. Development 124:2377–2386.
Porcher C, Swat W, Rockwell K, Fujiwara Y, Alt FW, Orkin SH. 1996.
The T cell leukemia oncoprotein SCL/tal-1 is essential for development of all hematopoietic lineages. Cell 86:47–57.
Reid K, Nishikawa S-I, Bartlett PF, Murphy M. 1995. Steel factor
directs melanocyte development in vitro through selective regulation of the number of c-kit1 progenitors. Dev Biol 169:568–579.
Reid K, Turnley AM, Maxwell GD, Kurihara Y, Kurihara H, Bartlett
PF, Murphy M. 1996. Multiple roles for endothelin in melanocyte
development: regulation of progenitor number and stimulation of
differentiation. Development 122:3911–3919.
Shibahara S, Okinaga S, Tomita Y, Takeda A, Yamamoto H, Sato M,
Takeuchi T. 1990. A point mutation in the tyrosinase gene of BALB/c
albino mouse causing the cysteine–serine substitution at position
85. Eur J Biochem 189:455–461.
Silvers WK. 1979. The coat colors of mice. New York: Springer Verlag.
Sviderskaya EV, Wakeling WF, Bennett DC. 1995. A cloned, immortal
line of murine melanoblasts inducible to differentiate to melanocytes. Development 121:1547–1557.
Tsukamoto K, Jackson IJ, Urabe K, Montague PM, Hearing VJ. 1992.
A second tyrosinase-related protein, TRP-2, is a melanogenic enzyme termed DOPAchrome tautomerase. EMBO J 11:519–526.
Vittet D, Prandini MH, Berthier R, Schweitzer A, Martin-Sisteron H,
Uzan G, Dejana E. 1996. Embryonic stem cells differentiate in vitro
to endothelial cells through successive maturation steps. Blood
88:3424–3431.
Wobus AM, Grosse R, Schoneich J. 1988. Specific effects of nerve
growth factor on the differentiation pattern of mouse embryonic
stem cells in vitro. Biomed Biochim Acta 47:965–973.
Yamane T, Kunisada T, Yamazaki H, Era T, Nakano T, Hayashi SI.
1997. Development of osteoclasts from embryonic stem cells through
a pathway that is c-fms but not c-kit dependent. Blood 90:3516–
3523.
Yasunaga M, Wang FH, Kunisada T, Nishikawa S, Nishikawa SI.
1995. Cell cycle control of c-kit1IL-7R1 B precursor cells by two
distinct signals derived from IL-7 receptor and c-kit in a fully
defined medium. J Exp Med 182:315–323.
Yoshida H, Nishikawa SI, Okamura H, Sakakura T, Kusakabe M.
1993. The role of c-kit proto-oncogene during melanocyte development in mouse. Dev Growth Differ 35:209–220.
Документ
Категория
Без категории
Просмотров
2
Размер файла
803 Кб
Теги
613
1/--страниц
Пожаловаться на содержимое документа