close

Вход

Забыли?

вход по аккаунту

?

139

код для вставкиСкачать
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????????????
???????
2 0 0 9 ? МИЕ 7 ? ? 3
? ? ? ? ? ? - ? ? ? ? ? ? ? ? ? ? ? ?
? ? ? ? ? ?
????????????? ???????? ???????? ??????????????
г лсоб?б:
?
А?╥снб??босрз╦ к ??рт?срз??лбллсрз╦ гЮС-клыбм?кк р?б?к йбл?кл к ?бзбх
?
гк?шрл?б ?бт?зкз?
?
Юоошлсз?стл?? зб??тк? ?лзб?с?к?шрл?? облкл?кзс?
?
як??лсрзкм? ??з?кзс? кб?рклксалсх ?зкснс?кк
?
Ызксз?стл?? зб??тк? срз??? мк╞б?л?? клыбм?кх
On-line ?б?рк? йш?л?н?
http://www.phdynasty.ru
ISSN 1729-9225
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????????????
???????
? ? ? ? ? ? - ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?
????????????? ???????? ???????? ??????????????
??????? ????????
?.?.??????????
??????????? ???????? ?????????
?.?.??????
??????? ????????
?.?.????????
??????????? ????????
?.?.??????? (????????????? ?????????),
?.?.??????
???????????
?.?.??????
?.?.???????
?.?.??????????
?.?.?????????
?.?.??????
?.?.?????????
?.?.??????????
?.?.??????
?.?.???????
?.?.???????
?.?.????????
?.?.?????????
?.?.???????
?.?.???
?.?.????
???????????? ?????
?.?.?????? (?????????)
?.?.?????? (???????)
???? ?.????????? (????????)
?.?.?????? (?????????)
?.?.?????????? (?????)
?.?.????????? (?????????)
?.?.??????? (????)
?????? ?? ???? (??????)
?.?.????????? (????)
?.?.?????????? (?????-?????????)
?.?.????????? (??????)
?.?.??????? (?????-?????????)
?.?.?????? (??????)
?.?.????????? (??????)
?.?.??????????? (??????)
?.?.???????? (?????-?????????)
?.?.??????? (?????????)
?.?.??????????? (???????????)
?.?.????? (???????)
?.?.????? (??????)
?.?.???????? (??????)
?.?.?????????? (??????)
?????????? ? ????????
╘ ??? ???????????? ╚????????╩
?????? ?????? ? ???????? ??????? ??????? ???????? ? ??????? ???,
? ??????? ?????? ???? ???????????? ???????? ?????????? ??????????? ?? ????????? ?????? ??????? ????????? ? ??????? ????
??????? ?????????????? ??? ??????-???????????? ?????????
???????????? ?????????? ?????????? ? ?????????????
???????? ?????
???????????? ╚????????╩:
119019, ??????, ?-19, ?/? 229
???????: (495) 414-9835,
????: (495) 414-8947
e-mail: red@mm-agency.ru
????? ???????:
???????: (495) 414-9835, 517-7055,
????: (495) 414-8947
E-mail: reklama@mm-agency.ru
?????? ???????????????
??????????? ??????? ?? ???????
?? ??????????? ????????????????
? ????? ???????? ????????????
? ?????? ??????????? ????????.
??????????????? ?????
?? ??? 77-25043
?? 20.07.2006 ?.
?????? ╚???????????? ???????╩
???????? ????????????? ????????.
???????? ?? ????? ???????????????
?? ?????????? ????????? ??????????.
????? 5100 ???. ???? ?????????
????????? ??????? ?? ????????
╚?????????:
??? ??????????? ??? ? 46343
??? ?????????? ??? ? 46342
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????????????
???????
2009 ? ??? 7 ? ?3
C?????????
? ? ? ? ? ? - ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?
????????????? ???????? ???????? ??????????????
???????????? ??????
???????-?????????????????? ?????????????? ? ?????????? ????????
? ??????? ???????????? ????????? ??????????
?.?.???????, ?.?.???????, ?.?.???????? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
?????? ???????? ????????? ? ??????? ??????????? ????????? ?
?.?.??????, ?.?.???????? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8
?????????????? ? ?????????????????? ???-???????? ????? ?????? ? ?????
?.?.??????????? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
???? ?????????????? ?????? ? ????? Nef ? ?????????? ???-1
?.?.????????, ?.?.??????, ?.?.????????, ?.?.????????, ?.?.??????, ?.??????????. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
??????? ????????????????? ??????? ?? ???????? ?????
?.?.????????, ?.?.?????????, ?.?.??????? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25
?????? ?????????? ? ????????????? ??????? ?????????????? ??????????
?.?.??????????, ?.?.??????????, ?.?.???????? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
??????????? ????????? ???????????????? ??????? ???????? ?????????????
?.?.????????-??????? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
?????????? ?????????????? ???????????? ????????????? ? ???????????? ?????????? ???????????-?????
? ????????????? ? ?????, ??????? ??????? ?????????????? ????????? ??????????
?.?.???????, ?.?.???????, ?.?.?????????, ?.?.??????????. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40
????????????? ??????????? ??????????? ???????? ???????????? ?????????
?.?.?????????, ?.?.?????????????, ?.?.??????, ?.?.???????, ?.?.??????. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48
??????????? ????????????????????? ??????? ? ?????, ??????? ???????????????
?.?.??????????, ?.?.??????????, ?.?.???????, ?.?.?????? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53
????? ??????????
?????? ? ???-????????
?.?.????????, ?.?.?????????, ?.?.??????, ?.?.?????????? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58
? ?????? ?????
??????????? ??????? ?????? ???????? ????????
?.?.??????, ?.?.????????? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62
???????????????? ??????? ????????????? ?????????: ???? ?? ????? ? ??????? ????????????
?.?.??????????, ?.?.???????, ?.?.?????????, ?.?.?????????, ?.?.?????????. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 68
???????? ????????????? ?????????? ? ?????? ?????????????? ???????????????
? ??????? ???????????? ????????????? ??????????
?.?.????????, ?.?.??????????, ?.?.?????????, ?.?.????? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
????? ??????
????????????? ? ???????????? ????????????????? ??????? ? ????????? ????????? ????
?.?.???????, ?.?.???????, ?.?.????????? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80
???????? ?????? ? ?????????????? ????????? ?????? ???????? ???????? ? ?????,
??????????????????? ? ????????? ?. ??????
?.?.????????, ?.?.??????, ?.?.?????????, ?.?.??????? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84
??????? ?????????
??????????????? ???????????? ????????? ?????? ???????? ? ? ??????? ? ?????????? ????????? ?????????????
?.?.???????, ?.?.?????? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
????????? I ?????????? ?????????????? ????????? ?? ???????????? ????????
??????, 30 ????? ? 1 ?????? 2009 ?. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
Infectious
diseases
Scientific and Practical Journal
of National Scientific Society of Infectionists
Editor-in-Chief
V.I.Pokrovsky
Deputy Editor-in-Chief
V.V.Maleev
Associate Editor
S.V.Shabalina
Editorial Staff
A.V.Gorelov (secretary)
D.V.Usenko
Editorial Board
E.I.Belyaev
L.V.Feklisova
S.G.Pak
B.P.Bogomolov
B.S.Kaganov
V.V.Pokrovsky
N.M.Gracheva
Yu.V.Lobzin
A.K.Tokmal?ev
Kh.M.Galimzjanov
V.I.Luchshev
V.F.Uchaikin
V.V.Ivanova
G.G.Onishchenko
N.D.Yushchuk
Editorial Council
N.A.Blagov (Yaroslavl)
B.S.Nagoev (Nalchik)
A.L.Bondarenko (Kirov)
V.A.Petrov (Volgograd)
S.G.Cheshik (Moscow)
L.I.Ratnikova (Chelyabinsk)
V.N.Drozdov (Omsk)
F. de Rose (Italy)
Yu.A.Il?insky (Moscow)
T.V.Sologub (St. Petersburg)
S.G.Gundersen (Norway)
N.V.Skripchenko (St. Petersburg)
E.A.Kashuba (Tyumen)
I.V.Shakhgil?dyan (Moscow)
G.M.Kozhevnikova (Moscow)
V.K.Tatochenko (Moscow)
V.V.Lebedev (Krasnodar)
V.N.Timchenko (St. Petersburg)
I.V.Malov (Irkutsk)
N.P.Tolokonskaya (Novosibirsk)
M.I.Mikhailov (Moscow)
Yu.V.Zolotarev (Orel)
Founder and Publisher
╘ ╚Dynasty╩ Publishing House
Editorial Office:
╚Dynasty╩ Publishing House
p/o box 229,
Moscow, 119019, Russia
Phone: +7 495 414 9835
e-mail: red@mm-agency.ru
Advertising Department:
Phone: +7 495 517 7055
E-mail: reklama@mm-agency.ru
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
Infectious
diseases
2009 ? volume 7 ? No 3
C O N T E N T S
Scientific and Practical Journal
of National Scientific Society of Infectionists
Original Articles
A clinico-epidemiological characteristic and serum values of apoptosis
in patients with chronic viral hepatites
?.R.Ivanova, V.P. Chulanov, R.?.Zsh?muhova . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
A study of immune regulation in patients with chronic hepatitis C
B.S.Nagoev, Zh.B.Ponezheva . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8
HIV-infection morbidity and incidence rate among women and children
V.N.Sadovnikova . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
The role of endothelial cells and Nef protein in replication of HIV-1
M.V.Makarova, S.V.Boychuk, I.G.Mustafin, A.V.Ivankova, A.V.Ivanov, L.Alexander . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
Influence of antiretrovirus therapy on lipid metabolism
V.G.Kanestri, A.V.Kravchenko, M.O.Deulina . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25
The immune status and immunotropic therapy of enterovirus meningitis
N.A.Batskalevich, V.K.Verevshchikov, Yu.G.Lagereva . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
Modern strategies of pathogenetic therapy of tick-borne neuroinfections
A.B.Kon?kova-Reydman . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
Results of a comparative study of the efficacy and safety of interferon-alpha
in suppositories for treatment of acute respiratory viral infections in children
A.V.Gorelov, N.M.Gracheva, L.V.Feklisova, O.O.Pogorelova . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40
Perspectives in diagnosing yersinia arthritis
O.A.Burgasova, E.A.Voskresenskaya, G.Ya.Tseneva, V.B.Musatov, D.A.Suprun . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48
Specific features of the enzyme excretory function in children in salmonellosis
M.S.Grigorovich, I.A.Chastoedova, Yu.G.Votyakov, E.V.Yurlova . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53
Review
Anemia and HIV infection
G.R.Khasanova, E.Yu.Stepanova, V.A.Anokhin, A.A.Abrosimova . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58
Doctor?s Manual
Etiotropic therapy of acute enteric infections
Yu.V.Lobzin, S.M.Zakharenko . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62
Post-infection irritable bowel syndrome: is there place for probiotics in therapy?
V.I.Simanenkov, A.N.Suvorov, S.M.Zakharenko, A.N. Bochkareva, Z.R.Sundukova . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 68
Laser Doppler flowmetry in assessing peripheral microcirculations of ?strakhan fever rickettsiay patients
L.N.Niculina, Kh.M.Galimzyanov, N.I.Rasskazov, T.E.Archba . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
Clinical and Laboratory Observations
Efficacy and safety of antiretrovirus therapy in patients in the Perm region
N.G.Shmagel, K.V.Shmagel, N.N.Vorob?eva. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80
Viral diarrheas in the etiological structure of acute enteric infections in children admitted to a Moscow hospital
E.A.Doroshina, G.A.Kozina, A.T.Podkolzin, A.V.Gorelov . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84
Brief Communication
The distribution of variants genotypes of HCV among patients with different ways of transmission
A.V.Baranov, V.V.Maleev . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87
Materials of the 1st Annual Russian Congress on Infectious Diseases
(Moscow, March, 30 ? April, 1, 2009) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????????? ??????
???????-?????????????????? ??????????????
? ?????????? ???????? ? ??????? ????????????
????????? ??????????
?.?.???????1, ?.?.???????2, ?.?.????????1
?????????-?????????? ??????????????? ??????????? ??. ?.?.?????????, ???????;
??????????? ??? ????????????? ????????????????, ??????
1
2
? ??????????? ???????????? ????????, ??? ?? ?????????? ?????????-?????????? ?????????? ???????? ???????????????? ????????? ?????? ???????? ? ???????? 3?, ????? ? ????????? ??????? 1b ? 2. ??? ?????? ???????? ? ?????????????? ?????????? ???? D (61%) ? ? (39%). ??????????? ???????????? ???-?, ???????????? Fas-?????????
(sFas) ? TRAIL ? ????????? ? ???????????? ????????? ?????????? ?, ? ? ?????????? ?????????? ????????? ?+?. ??????????, ??? ? ???? ????????? ? ????????? ?????????? ?????????? ???????? ???????? ???-? ? sFas ? ?????????
?????. ? ?????? ??????? ? ??????????? ??????????? ???????? ???????????? TRAIL. ??????? ????????? ???-? ??????????? ? ??????????? ????????? ???????? ? ???????? ??????????? ????????????? ??????????. ??????? ??????????
sFas ? ????????? ????? ?? ???? ??????? ?????????, ????????, ???????? ????? ?? ?????? ???????? ?????????? ???????? ?????-?????????????? ??????, ? ???????? ?????? TRAIL ??????????????? ?? ?????????? ????????, ???????? ?????????? ? ??????? ??????????? ???????? ????????? ?.
???????? ?????: ???????, ???-?, sFas, TRAIL, ???????? ????????
A clinico-epidemiological characteristic and serum values
of apoptosis in patients with chronic viral hepatites
M.R.Ivanova1, V.P.Chulanov2, R.Kh.Zhemukhova1
Kh.M.Berbekov Kabardino-Balkar State University, Nalchik;
Central Research Institute of Epidemiology, Federal Supervision Service for Consumer Rights Protection
and People?s Welfare, Moscow
1
2
The study has found that on the territory of the Kabardino-Balkar Republic the most common genotype of virus C hepatitis is
3?, then follow 1b and 2, in the descending order. For virus B, the prevalent genotypes were D (61%) and A (39%). The authors
studied the concentration of TNF-?, soluble Fas-receptor (sFas) and TRAIL in patients with chronic viral hepatitis ? and ?, and
hepatitis with combined etiology ?+?. As has been found, in all patients with viral hepatitis TNF-? and sFas values in blood
serum were reliably elevated. On the other hand, TRAIL concentrations were reliably decreasing. The degree of TNF-? elevation correlates with the activity of viral process and is indicative of the intensiveness of inflammation. High values of sFas in
blood serum in all groups of patients might be one of the causes of a decreased activity of apoptosis of virus-infected cells, and
decreased levels of TRAIL indicate excess apoptosis, which is especially marked in patients with chronic viral hepatitis C.
Key words: apoptosis, TNF-?, sFas, TRAIL, viral hepatites
?
???? ?? ?????????? ??????? ??????????? ????????
???????? ???????? ????????? ?????? ????????? ?????????. ???????? ??????? ? (???) ???????? ???? ?? ???????
???? ? ????????? ???????????? ????????? ? ??????, ?????????????? ??????? ?????????? ?? 18 ?? 42 ?? 100 000 ?????????. ? ????? ????????? ???????? ????????? ?? ???? ???????? ? ?????????? 10?30% [1, 2]. ? ????????? ????? ? ???? ????????????? ????? 170 ??? ?????????????? ??????? ???????? ?, ??? ?????????? ????? 3% ????????? ????? [3, 4].
??? ???????????????:
??????? ?????? ??????????, ?????? ??????????? ????,
????????? ??????? ???????????? ???????? ???????????? ??????????
?????????-??????????? ???????????????? ????????????
?????: 360004, ???, ???????, ??. ?????????????, 175
???????: (8662) 40-7447
E-mail: marina19692003@list.ru
?????? ????????? 23.06.2009 ?., ??????? ? ?????? 15.09.2009 ?.
? ???????????? ? ???????????? ???????????????, ? ?????????? ??????????? ???????? ????????? ????? ????? ???????, ??????? ????????? ??????? ???? ? ???????????? ???????? ???????? ? ???????? ???????????? ????????? ??????.
??? ???????, ???????, ? ????? ???????, ? ???????? ???????? ???????, ? ? ?????? ? ? ????????????? ????????????? ??????. ?? ????????? ??????? ????????? ???????????? ??????????????????? ?????? ??? ???????????????? 8 ?????????
(A?H), ?? ?????? ???????? ? ? D ?????? ?????????????? ?
?????????????????? ?????????, ??? ??? ??????????? ????? ?
90% ???? ?????????????? [5, 6]. ? ?????????? ??????? ??????? 6 ????????? ?????? ???????? ? (???), ?????? ?? ??????? ?????????????? ?? ????????? ????????. ? ???? ???????????? ???? ???????? ?????????????? ???????? ? ??????????????? ????????? ??? ? ????????? ??????????? ???????????? ??????? [7, 8]. ? ?????????? ????????? ????????
?????????????? ???????? 1b ? 3a; ???????? 2 ? 1? ???????-
5
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.??????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 5?7
???? ??????????? ????, ? ???????? 4, 5 ? 6 ??????????????
?????? ??? ???????? ??????. ????? ?? ????? ?????? ???????????? ???? ???????????? ?????????????????? ????????????? ????????? ??????? ???????? ? ? ? ?? ?????????? ?????????-?????????? ??????????.
??????????????? ????????? ??????, ??? ???????, ???????? ????????? ?????????? ???????? ????????? ????????? ? ?????????????? ?????????. ???????? ?????? ??????? ?????????????????? ???????, ?????????? ?????? ?
???????? ? ?????????? ?????????????? ?????? ?? ????????? ??????? ??????? ??????? (???) ?? ?????????????? ??????????? [2, 4]. ????? ?????????????? ???? ?????? ??????
???????? ??????? Fas/Fas-L. Fas-L ???????? ????????? ??
???-?????????, ??????????????? ?? ??????????? ?????????
??????, ? ??? ????? ?? ?????????????? ?-?????????? ? ??????????? ???????? [9]. ????????? ?????????? ╚Fas-??????????? ???????????????╩ ??? ???????? ??????????? ????????? ???????? ?????????? ?????????? ???????????? Fas26????????? (sFas), ???????? ??????????????? ??????????
m??? FasR ? ????????????????? ?????????? ???????????????? FasR. ???-? ? ???? ?? ???????? ?????????, ?????????
????????? ?????? ???????????? ???????? ?? ??????-?????? ? ?????????? ??????, ?????????????? ???????; ????????
??????????? ? ? ?? ?? ????? ??????????? ?????????? ??????? ? ????????? ?????????????? ??????? [9]. ??? ?????
???????? ?????????? ???????? ? ?????????????? ???????????, ?? ????????? ????????????? Fas [2]. TRAIL ? ???-????????? ?????, ???????????? ???????. ???????? ?????????
????????????? ?????? ????? ???????? ? ???????? ????????
??????? ?????? [10]. ????????????? ??????? ???????????
??????????? ???????? ????? ????? ????????? ????????? ?????? ?????? ? ??????????? ?????????? ????????. ? ????? ?
????, ????? ???????????? ???? ??????????? ??????????
????????????? ???-?, sFas ? TRAIL ? ????? ?????????,
??????? ????????? ??????????.
???????? ? ??????
??? ????? ??????????? ?????????? 155 ??????? ???????????? ????????? ?????????? ? ???????? ?? 18 ?? 76 ???, ??????? ????????? ???????????? ??????? ? ?????? ?? ???????????? ? ?????? ?? ???? ? ????????????? ????????????? ???????????? ??????????????? ? ??????????? ???????? ?????????-?????????? ??????????. ??????????? ???? ????????
???? (88%). ?? ??? ? 76 ??????? ? ??????????? ????????? ?
(???), 37 ????????? ? ??????????? ????????? ? (???) ? 38 ?
? ??????????? ???????? ????????? ?????????? ?????????
?+?. ??? ??? ???????????? ??????????? ? ??????? ??????????? ?????????? 7,8 ????, ??? ??? ? 11,2 ???? ? ??? ??????????? ???????? ???????? ?????????? ????????? ? 5,6 ????. ??
????? ???? ????????????? 48% ????????? ???? ??????????????? ????????????? ??????????. ? 75% ????????? ????????????? ???????? ?? ???????????? ?????? ??????? ? ????????.
??? ???????? ?????????????? ?? ?????? ???????-????????????? ??????????: 32 ??????? ? ??????????? ???????????
(?????????????????????? (???) ????????? ??????? ??????? ????? ????? ??? ? 2 ????), 77 ? ? ????????? ???????? ?????????? (??? ????????? ??????? ??????? ????? ? 2?4 ????)
? 46 ? ? ??????? ???????? ?????????? (??? ????????? ????-
6
??? ??????? ????? ????? ??? ? 4 ????). ??????? ????????
???????????????? ??????? ??? ????????? ???????????????
??????????. ??????? ??? ????????? ?? ????????? ????????????????????????? ?????? ? ??????????? ???????????? ????????????. ???? ????????? ??????????? ??????????? ???????? ???????? ????????? ??????? ??? (????-??????? ╚??????-????╩, ??????), ??? ???, ??? ???, ??? ????????? ???????? ??????, ? ????? ??????????? ???????? ??? ??????? ???????????? ?????? ??????? ? ?????????????? ????-??????
╚?????????╩ (???? ╚????? ????????????????╩, ??????),
??????????????? ??? ??????????? ??????? ??????? ?????????????? S-???? ? ??????????? ???????????????? ????????.
?????? ?????????? ? ????????? sFas ????????? ???????
????????????? ????????????????? ??????? (???) ? ?????????????? ??????????? ????-??????? ╚human sAPO-1/Fas
ELISA BMS245╩ (Bender MedSystems). ??????????? ??????
TRAIL ? ????????? ????? ????? ????????? ??????? ????????????? ??? ? ?????????????? ??????????? ????-???????
╚human TRAIL ELISA╩ (Biosource). ???????????? ??????
???-? ? ????????? ????? ????????? ????????? ? ???????
????-??????? ╚??????????? ??????╩ (?????-?????????, ??????). ?????????? ?????????? ?????????? ? ???????????? ??????????? ??????, ????????? ?? 15 ??????????? ???????? ??????? ??????????????? ??????? ??????????? ????? ?. ????????. ?????????? ??????????? ???????????? ?????????? ???
????????????? ???????????? ???????? Microsoft Ex?el ?
Statistica ? ??????????? ??????? ???????????? ??????????,
????????????? ? ??????????????? ????????.
?????????? ???????????? ? ?? ??????????
??? ??????????? ???????? ?????? ? 42 ????????? ? ???,
??????? ? ???????? ?????????? ????????? ?+?, ???? ???????? ????????? ???????????: 16 ??????? (38%) ????? ???????
1b, 21 (50%) ? 3? ? 5 (12%) ? ??????? 2 (???????). ??? ??????????????? ?????????? ??????, ?? ?????????? ??????????????????? ?????????? ??????????? 3? ???????, ? ????????? ??????? ??????????? ???????? 1b ? 2. ??????? 1b ?????
?????? ????????????? ?? ?????????? ??? [11]. ??? ??????????????? 67 ??????? ? ???, ??????? ???????? ??????????
????????? ?+?, ?????????, ??? ? 61% ????????????? ??????????? ????????? D ? ? 39% ??????? ? ????????? ?.
??? ???????????? ????????? ????? ? ??????? ??????????
???????????? ????????? ???????????? ???????????? ???-?
12%
38%
??????? 1b
??????? 3?
50%
??????? 2
???????. ????????????? ????????? ?????? ???????? ? ? ??????????? ???????.
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????-?????????????????? ?????????????? ? ?????????? ???????? ? ??????? ???????????? ????????? ??????????
?, sFas ? TRAIL ? ???????????. ?????????? ?????????? ???-?
????? ????? ? ??????? ???????????? ????????? ??????????
(??/??)
?????? ?????????
??????????
??? ??????????? ????? 30 ?????
? ?????????
???????? ????????
???
???-? (n = 30; 17)
55,0 ╠ 1,61,3
64,0 ╠ 2,11,2,3
sFas (n = 46; 22) 1739,0 ╠ 64,71,3
1652,0 ╠ 123,51,3
TRAIL (n = 29; 18)
119 ╠ 13,01,3
107 ╠ 16,21
???
???-? (n = 20; 14)
41,0 ╠ 3,31
35,0 ╠ 1,21
sFas (n = 20; 15) 2366,0 ╠ 85,71
2317 ╠ 74,61
TRAIL (n = 15; 11)
55 ╠ 19,61
78 ╠ 22,41
???????????
???-? (n = 27; 19)
48 ╠ 1,91
49 ╠ 3,61,3
???????
sFas (n = 25; 17)
2177 ╠ 73,31
1488 ╠ 154,41,2,3
?+?
TRAIL (n = 15; 12)
112 ╠ 21,71
105 ╠ 24,31
???????? ??????
???-?
18,0 ╠ 2,01
?
(n = 15)
sFas
1250,5 ╠ 135,51
?
TRAIL
199 ╠ 5,3
?
1
????????????? ???????? ?? ????????? ? ??????????? ???????, ? < 0,001;
2
????????????? ???????? ?? ????????? ? ??????????? ??????????? ???????, ? < 0,001;
3
????????????? ???????? ? ??????????? ? ??????? ???, ? < 0,001.
?????????? ??????? ????? ?????????????????? ????????
???-?, ??????? ??? ? ?????? ????????????? ???????, ??? ?
????? ???????? ??????? ?? ?????????? ????????? ??????????? ????????, ????????????? ??????? ?????????? ????????????????? ????????? ?, ??????????, ???????? ????? ?? ???????? ???????????????? ???????? ? ???????????????? ???????????? ??????? ????????. ? ?????? ??????? ??????? ???????????? ???????????? sFas ????? ??????????????? ????????
??????????? ? ????????? ?????????, ??? ???????? ? ????????? ?????????? ??????, ??????? ???????? ?????, ??? ??????? ??????????? ??? ?????????? ???????????? ????????.
???????? ???????????? TRAIL ? ????????? ????? ?????????
?? ???????????? ?????????????? ?????????, ?? ???????? ?????????? ??????? ????????? ? ??????????????? ? ???? ??????????? (? ??? ????? ? ?? ???????????) ? ?????????? ???????????????? ?????????????? ????????? ? ????? ??????.
??? ??????????? ??????? ? ?????????, ?????? ?????????? ????? ?????????? ? ??????? ? ???, ?? ????????? ? ????????
??? ? ??????????? ???????? ????????? ?????????? ????????? ?+?. ??????, ? ????? ??? ?????????? ?? ????????? ? ????????? ??????? ? ????? ???????? ?? ?????????? (???????).
???????????????? ????????? ???????????? ? ??? ????????
sFas ? ????????? ?????. ?????????? ?????????? ????? ??????? ???????? ?????????? ?????????? ?? ???? ???????????
??????? ?? ????????? ?? ?????????? ???????. ??? ??, ??? ?
??? ???????? ???????????? ???-?, ?? ? ????? ?? ??????????? ????? ?????????? sFas ?? ?????? ? ????? ????? ???????? ??????? ?? ?????????? ??? ????????????? ??????????, ??
???????????? ?? ??????????? ???????? (???????). ?????????? ????? ??????? ???????? ???-? ? ????????????? ???????
???????? ? ? ??????? ??? ???? ????? ???????? ??????? ??
?????????? ??? ???????????? ???????-????????????? ?????????? ? ???? ?????? ??????? ????????? ?? ??????????????
???????????? ???????, ?????????? ???, ??? ???????? ?????????? ??? ????? ??????? ?????????? ????????? [12]. ???????? ???????? ???? ???????? ??? ??????????? ????????????
TRAIL ? ????????? ????? ???????. ??????????? ???????????
???????? ???????????? ???????????? ?????????? ? ???? ???????. ???????? ?????? ???????? ???????????? ? ??????? ???,
??? ??? ??? ???????????? ??????? ???? ???????? ? ?????????? ?????? ????????? [13].
1. ????? ?.-?. ??????? ? ??????????? ????????. ?.,1999; 423.
2. ????? ?.?. ?????????? ???????? ???????????. ???.: ???????????, 2004; 47.
3. ???? ?.?., ???????? ?.?. ?????? ?? ???????????? ????????. ?., 1999.
4. Bamberger A.M., Schulte H.M., Thuneke I. Expression of the apoptosis-inducing
Fas ligand (FasL) in human first and third trimester placenta and choriocarcinoma
cells. J Clin Endocrinol Metab. 1997; 82(9): 3173?75.
5. Lindh M., Andersson A.S., Gusdal A. J Infect. Dis.1997; 175: 1285?93.
6. Norder H., Courouce A.M., Magnius L.O. Virology 1994; 198: 489?503.
7. Berkes J., Cotler S.J. Global epidemiology of HCV infection. Curr. Hep. Rep. 2005;
4(4):125?9.
8. HwangS.I., Lee S.D., Lu R.H., et al. Relationship between genotypes of hepatitis C
virus and hystopathiological manifestasion in chronic hepatitis C patients.
J Gastroenterol. Hepatol. 2000; 12(3): 299?304.
9. Simmons H.U. Neutrophils apoptosis pathways and their modification in inflammation. Immunol. Rev. 2003; 193: 101?10.
10. Ki M. Kim et al. Pretreatment of acetylsalicylic acid promotes tumor nekrosis factor-related apoptosis-inducing ligand-induced apoptosis by down-regulating BCL2 gene expression. J of Biological Chemistry. 2005; 3: 2123?30.
11. ???????? ?.?. ???????? ???????? 2-? ???. ???.: ????, 1998.
12. ?????? ?.?., ??????????? ?.?., ????????? ?.?. ? ??. ?????? ? ??????? ??????????? ? ?????? ????????? ????????????? ?????????? ????? ? ???????
? ???????????? ???????? ??????????? ??????. ???. ?????? ?????????????????, ??????????? ? ??????????????? 2007; 6(27): 32?7.
13. ???????? ?.?., ?????? ?.?. ??????????? ??????? ???????? ???????? ??? ??????????? ???????? ?????????. ???. ?????? ???????????., ???????. ? ???????????. 2006; 2: 4?10.
14. ????? ?.?., ????? ?.?., ??????? ?.?. ?????????????????? ????????? ??????
???????? B ????? ???, ?????????? ?????????????? ??????? ???????? B ?
?. ?????? ? ?????????? ???????. ????????? ?????????? ??????-???????????? ??????????? ╚??????????????? ???????????? ????????╩ 25?27 ??????? 2005 ?., ╚????????╩, ????????????? ???. 2005; 56?8.
??????????
?? ?????????? ?????????-?????????? ?????????? ???????? ????? ??????????? ???????? ??? 3a (50%) ? 1b (38%), ?????? ???????????? ???????? 3? ???????? ?????? ?????? ??
?????? ???????? ??????, ? ???????, ??? ???????, ???????????
??????? 1b. ???????? ???????????? ??????? ? ?????????? ??????? ???, ?????????? ?????????? 1b ? 3a, ?????? ??????????? ????????????? ????????? ?????????? ????????? ???
???????????? ???????????? ???????? ???????. ????? ????????????? ????????? ??? ???????????? ??????? D (61%), ?????? ???????? ??? ???????? ? (39%) ? ?????????-??????????
?????????? ??????????? ????, ??? ? ??????????? ????? ?????? [14], ??? ??????? ??????????? ????????.
??????????
?????????? ? ?????????:
??????? ???????? ????????, ???????? ??????????? ????,
?????????? ??????-??????????????? ???????-??????????????? ???????
???????????? ??? ????????????? ????????????????
?????: 111123, ??????, ??. ??????????????, 3?
???????: (495) 974-9646
???????? ????? ??????????, ???????? ??????? ???????????? ????????
???????????? ?????????? ?????????-??????????? ????????????????
????????????
?????: 360004, ???, ???????, ??. ?????????????, 175
???????: (8662) 40-7447
7
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????????? ??????
?????? ???????? ????????? ? ???????
??????????? ????????? ?
?.?.??????, ?.?.????????
?????????-?????????? ??????????????? ??????????? ??. ?.?.?????????, ???????
?????? ??????????? ?????? ??? ??????????? ???????? ? ? ??????????? ?? ?????????? ??????????????? ????????.
?????????? ???????????? ???????? ?????????, ?????????? ??????????? ???- ? ????????????????????? ?????????: ?1 ? ??????????? ??????? ??-2/??-10, ?2 ? ???-?/??-10 ? ?3 ? ???-?/??-4. ?????????? ??????????? ? ???????? ???????? ?3 ? ???? ???????, ?????????? ?? ?????? ???????????. ?????????? ?1 ? ?2 ? ??????? ??? ??????????? ? ????????????? ?????????? ??????????????? ????????, ?1 ????? ?????????? ??????? ??????? ? ?????????????
???????????, ? ??????? ?3 ? ??????-???????????? ????????.
???????? ?????: ??????????? ???????? ???????, ????????
A study of immune regulation in patients
with chronic hepatitis C
B.S.Nagoev, Zh.B.Ponezheva
Kh.M.Berbekov Kabardino-Balkar State University, Nalchik
The authors studied the cytokine status in chronic hepatitis C, depending on the activity of the pathological process. Coefficients
of immune regulation reflecting the ratio of pro- and anti-inflammatory cytokines: C1 ? ratio of IL-2/IL-10 levels, C2 ? TNF-?/IL-10
and C3 ? IFN-?/IL-4 were calculated. A reliable and significant decrease of C3 in all the patients was found, irrespective of the
stage of disease. The values of C1 and C2 in patients with CHC correlated with the degree of activity of the pathological
process, C1 had a high correlation with biochemical activity, and the C3 levels ? with the immunoregulatory index.
Key words: chronic viral hepatitis, cytokines
?
?????????? ??????? ? (???) ???????? ????? ?? ?????????? ??????? ??????????????? ? ????? ? ??? ???????????????????, ????????? ????????????? ??????????,
??????? ???????? ???????????? ??????? ?????? ? ????????????????? ????????? [1]. ????? ??????????? ???????
??? ??????????? ?????????? ????????? ?????? ?? ???????? ????????, ????????? ??????? ???????? ? (HCV).
?????? ?????????????? ? ??????? ╚????????????╩ ???
??????????? ???????? ???????? (???) ?????? ????????
???? ? ??????????? ??????? ? ???????????? ?????? ???????????. ? ????????? ????? ????????? ?????????????, ???
??????? ??????? ???????????? ??????????? ???? HCV-???????? ??????????? ╚????????????╩ ?????? ?? ?????????
??????? ? ????????????? ??????????????? ?????????? ?
?????????? ????? [2, 3].
? ?????????, ?????????? ??????????????, ??? ??????????? ????????? ?????????????? ? ?????????????? ????????? ?????????? ???????????? ? ???? ??????????? ??? ?
?????????? ? ????????? ???????????, ?? ????????? ?????? ???????????????:
?????? ?????? ???????????, ?????? ??????????? ????, ?????????,
?????????? ???????? ???????????? ???????? ???????????? ??????????
?????????-??????????? ???????????????? ????????????
?????: 360004, ???????, ??. ?????????????, 175
???????: (8662) 40-7447
?????? ????????? 16.03.2009 ?., ??????? ? ?????? 15.09.2009 ?.
8
???? ????????? ??????? ????? ??? ? ????? ?????????. ? ??
?? ????? ??????? ????????? ??????????????? ???????,
????? ???????? ????????, ?????, ??? ?????????, ????????
????????????? ? ????????????? ????????? ?????? ?????????? ????? ?????????????? ??????? ?????????????? [1, 4].
? ????? ? ??? ???????????? ???????? ?????????? ????????? ╚???????????╩ ??? ??? ? ?????????? ???????????? ????????? ??????????? ????????????? ?????????? ??????? ?
?????? ????????? ????????????? ??????? ??????? ??????????? ???????? ?????????.
????? ???????????? ??????? ???????? ?????????????
???????? ????????? ??? ??? ? ??????????? ?? ??????????
??????????????? ????????.
???????? ? ??????
? ???????????? ???? ???????? 56 ????????? (34 ??????? ? 22 ???????) ? ???????? ?? 21 ?? 54 ???, ??????????
???, ? ????????????? (+) ????????, ?????????? ???????
???????????? ?????? ??????? (???). ?? ?????? ????? ????????? 32 (57,1%) ??????????????? ??????? ????? ?? ???????????, 14 (25%) ??????? ?? ???????? ?? ?????????????? ???? ??????????????? ??????? ??????????? ???????????? (?? 3 ??? ?? ????????????? 3 ???? ? ??? ? ???????
12?24 ???), 4 ???????? (7,1%) ?? ???????? ?? ?????????????? ???? ??????????????? ??????? ??????????? ???????-
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?????? ???????? ????????? ? ??????? ??????????? ????????? ?
????-????? (3 ??? ?? ????????????? 3 ???? ? ??? ? ??????? 12?24 ???) + ??????? 800?1000 ?? ? 6 (12,9%) ???????
????? ??????????? ??????? ????? ??????? ??????????? ????????????-????? (???-?) ????? 3?12 ???. ? ???????
????????? ???-??????? ?? ????????? ? ????????? ???????????? ?????? ?? 6 ?? 12 ???.
?????????? ?? ?????????? ????????? ? ???????? ????????????????? ????????? ? ??????????? ??????? ??????
????????????, ??????????? ??? ????????????????? ????????? ? ??????????? ?????? ???????? ?????????, ??????????????? ???????????? ? ???????????? ???????? ????????????? HCV: ????-HCV, ????-HCV IgM, ????-HCV IgG ???????????????? ??????? (???) ? ???, ??????? ??????????????? HCV ? ?????????????? ??????. ?????????: ???????????? ????????? ??????? (??????????? ???????????? ?????????? CD3+, CD4+, CD8+, CD16+, CD19+, CD95+ ?
?????????????? ?????????????? ???????), ??????? ?????????????????? ?????????? (????) ? ??????????????????? (???), ???????????? ??????????? ??????????, ??????
????????????? ???????? ?????????? (???). ??????????
???????????? ? ????????? ????? ??????? ??? ? ?????????????? ????-?????? ╚??????????? ??????╩ (?. ?????-?????????) ????????? ?????????: ?????? ??????? ????????-? (???-?), ??????????? (??)-1?, ??-2, ??-4, ??-10,
???-?, ????? ???? ???????????? ??????-???????????? ???????, ??????? ???????????? ? ?????? ???????????, ?????
???????? ????????? ????? 4?6 ?, 24 ?, ? ????? 4-? ??? ???????, ????? 3 ??? ?? ?????? ??????? ? ????? ??????????
????? ???????.
?????? ??????????????? ?????? ???????? ? 17 ???????
?? ?????????? ????????? ??????, 19 ??????? ???????
????????????. ? ??????????? ?????? ????? 25 ???????????
???????? ????? ? ???????? ?? 21 ?? 35 ???. ??? ?????? ????????????? ??????????????? ??????? ?????????????????
??????? 1. ???????-????????????? ?????????????? ???????
???
??????????
????????
??? ???(+) (n = 56)
(n = 25)
?????????????
??????
??????
???????????? ???????????
???????? ? ?????????? ???????(n = 23)
??????????????
???????
??????????
??????????
(n = 8)
(n = 25)
??????? ???????,
???
28,1 ╠ 2,5
31,4 ╠ 2,7
29,1 ╠ 3,4
31,7 ╠ 1,6
??? ???/???, ???.
15/10
14/9
15/10
5/3
??????? 1/ 2 ??? 3,
???.
?
10/13
21/12
7/1
???????? ????????,
?
?? 800
?? 1200
?? 500 ??
??/??
?? 26 000
?? 300 000
300 000
????????? ?????,
??????/?
14,9 ╠ 1,2
17,1 ╠ 2,4
22,7 ╠ 3,9
31,2 ╠ 4,1
????. ?? ??????, ?? 1,41 ╠ 0,34
1,1 ╠ 0,32
0,8 ╠ 0,48
0,6 ╠ 0,18
???, ??/?
20,7 ╠ 2,8
18,4 ╠ 1,9
84,5 ╠ 5,5
114,5 ╠ 7,5
???, ??/?
23,4 ╠ 1,7
23,7 ╠ 2,7
68,6 ╠ 5,9
87,6 ╠ 8,9
???, ??/?
27,5 ╠ 2,5
29,3 ╠ 1,1
39,1 ╠ 4,9
59,5 ╠ 5,4
????????
?????????, ??/?
91,9 ╠ 5,7
94,8 ╠ 4,5
101,4 ╠ 5,9
131,1 ╠ 14,1
????????? ?????
2,3 ╠ 0,7
5,9 ╠ 2,3
14,9 ╠ 1,4
16,4 ╠ 1,2
?????????,?/?
42,2 ╠ 1,2
39,4 ╠ 2,2
42,3 ╠ 4,9
49,3 ╠ 6,1
???
85,4 ╠ 2,1
78,2 ╠ 2,3
72,4 ╠ 3,9
71,4 ╠ 5,7
????????????
??????, ???/??
136,7 ╠ 1,2 131,7 ╠ 2,2
141,7 ╠ 5,9
156,9 ╠ 7,2
?????????????? ?? ??????? ???????? ?: ╚????????????????????╩ (?????, 2002). ?????????????? ????????? ?????? ????????? ????????????? ???????? ????????????
?????????? ? ?????????????? ?????????????? ???????????:
t-???????? ????????? ? ???????????? ??????????. ?????????????? ????????? ?????? ??????????? ? ??????????????
????????? Excel ? Windows-2000.
?????????? ???????????? ? ?? ??????????
? ?????????? ???????????? ????????????? ???? ???????????? ? ???? ??????? ??? ??????? ???, ??? ???????????????
??? HCV ?????????? ???? ??????????? ??????? 1b (n = 31)
(p < 0,05). ?? ??????????? ???????????? ???????????? ???????-????????????? ??????????? (????. 1) ???????? ?????????
?? 3 ??????: 1-? ? ??????? ? ????????????? ????????? ???
???(+), 2-? ?????? ? ? ??????????? ??? ????????? ????????????? ??????????? (????????? ?????????????????????? (???) ?? 3 ?? 5 ????) ? 3-? ?????? ??????? ? ? ?????????? ????????????? ??????????? (????????? ??? ?????
5 ????) ?? ???? ???(+).
??? ??????? ?????????? ???? ????????? ? 17 ???????
??????? ?????????????? ????, ????????? ? ????????????? ????????????? ??????? ? ????????, 7 ????????? ????????? ??????????? ? ???????? ? ???????????, 5 ? ? ???????????????, 3 ??????? ? ? ???????????????? ?????????????? ???, 7 ? ?? ????? ???????? ?????-???? ???????
?????????????.
??? ??????????????? ???????????? ????????? ??????
(n = 17) ???????? ??????? ???????????? ???????? ? ??????????? ???????? ?????????? ??????????????? ????????
(1?3 ?????) ? 9 ?????????, ?? ?????? (4?8 ??????) ? ? 6,
? ????????? ??????????? (9?12 ??????) ? ? 2. ? 9 ???????
??????? 2. ?????????? ?????????? ? ??????? ??? ? ???? ??????????? ? ??????????? ?? ??????
??????????
????????
??????? ??? ???(+)
p
p1
p2
(n = 25)
????????????????????
??????
???????? ??????????
(n = 23)
(n = 33)
CD3+, %
61,8 ╠ 1,7
57,5 ╠ 1,3 53,9 ╠ 1,4 <0,05 <0,01 <0,05
CD4+, %
39,5 ╠ 1,2
34,8 ╠ 1,01 31,4 ╠ 0,8 <0,05 <0,01 <0,05
CD8+, %
20,8 ╠ 1,1
25,7 ╠ 1,7 27,1 ╠ 1,4 >0,05 <0,05 <0,05
+
CD16 , %
10,5 ╠ 0,8
9,5 ╠ 0,5
8,6 ╠ 0,7 >0,05 <0,05 >0,05
CD19+, %
11,5 ╠ 0,9
12,9 ╠ 0,6 13,1 ╠ 0,5 >0,05 <0,05 >0,05
CD95+, %
5,8 ╠ 0,7
9,06 ╠ 1,1 11,00 ╠ 1,2 <0,01 <0,01 <0,05
CD4/CD8
???
1,8 ╠ 0,1
1,5 ╠ 0,1 1,38 ╠ 0,02 <0,05 <0,01 <0,05
????????????
?????, ???. ??.
7,4 ╠ 0,1
6,8 ╠ 0,2
6,1 ╠ 0,5 <0,05 <0,05 >0,05
??????
?????????????
??????????,
???. ??.
1,00 ╠0,04 0,78 ╠ 0,01 0,67 ╠ 0,01 <0,05 <0,05 >0,05
???-????
??????????,
???. ??.
15,0 ╠ 1,4
31,2 ╠ 1,8 42,4 ╠ 1,6 <0,05 <0,05 <0,05
IgA, ?/?
2,14 ╠ 0,3
2,06 ╠ 0,2
2,2 ╠ 0,2 >0,05 >0,05 >0,05
IgM, ?/?
1,3 ╠ 0,2
1,9 ╠ 0,3
2,1 ╠ 0,2 <0,05 <0,05 >0,05
IgG, ?/?
12,1 ╠ 0,3
13,5 ╠ 0,2 14,1 ╠ 0,2 <0,05 <0,05 >0,05
???, ??/?
101,4 ╠ 7,4 130,40 ╠ 8,6 149,6 ╠ 9,1 <0,05 <0,05 >0,05
? ? ??? ????????? ??????????? ??????? ? ????????????? ????????? ? ??????? ????????; p1 ? ??? ????????? ??????????? ??????? ? ?????????????
??????????? ? ??????? ????????; p2 ? ??? ????????? ??????????? ?????
???????? ? ????????????? ????????? ? ???????????.
9
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.??????, ?.?.???????? / ???????????? ???????, 2009, ?. 7, ?3, ?. 8?11
??? ???????? ??????? ?????????????, ? 5 ?????????????
????????? ?????? ??????, ? 2 ????????? ? ?????????
??????, ? 1 ? ??????? ??????. ???????????? ?? ???????
????????? ??????? ? 12 ???????, ?????? ?????? ????????? ? 6 ??????? ? ????????? ?????? ????????? ? 1 ????????. ??????????? ??????????? ???????????????? ???????????? ??????? ??? ??????? ??????? ?????????? ?????????? ?? ???? ??????? ???????? ??????? (????. 2).
??? ???????????? ????????? ??????? ???????? ??????????? ???????? ?????????? CD4+ ? 48 ?? 56 ??????? ???.
???????? ?????? CD4+ ??????????????? ? ?????? CD4+-?????????? ?????? ??? ??????????? HCV-????????. ?????????? CD8+-, CD95+-?????????? ???? ????????, ??????????????, ? 37 (66,1%) ? ? 29 (51,8%) ????????? ? ???. ?????????????? ????????? ???? CD8+-?????????? ????? ????????????????? ? ???, ??? ????? ??????????????? ?-?????????? ???????????? ??? ?????????? HCV. ??? ???? ? ????? ????????? ???????? ????????????? ???????? ???????? ???????????????? ?????? ?-?????????? ??? ?????????? ???, ???
????????????? ???????? ?????????????? ??????????
?-?????????? (? < 0,01). ? ??????? ? ??? ???????? ???????? ???????? ??????? ????????????? ??????????????
?????? (? < 0,05), ??? ???? ? 29 ????????? ?????????? ?????????????? ????????????????? ????????? ? ???-?????
(? < 0,05).
??? ???????? ???????????? ????? ?????????? ?????????? ?????????? CD19+-?????? (?-??????????) ? IgM, IgA, IgG,
???. ???????????? ????????, ??? ??????? CD19+-?????? ?
??????? ??? ??? ?????????? ???? ?? ????????? ? ???????
????????. ???????? ??????? ???????????????? IgM ? IgG ?
??????? ??? ??????? ????????? ??????? ? ?????? ?????????, ? ???????? ? ??????????? IgA ???? ?? ??????????. ???
?????? ????????? ?? ????????? ????????????? ??????????
? ??????? ???. ?????????? ?????????? ???????????? ?????????? ????????? ?? ?? ???????? ??????? ? ??????????????? ??????????. ? 42 ????????? ???????? ?????????????
??????????? ????????? ?????? ?????????? ???. ????????
????????? ?????? ??????????, ?????????? ?????????
?????? ????????????????? ???????? ?????????? ? ????????? ??????? ? ??? ????? ???? ??????????? ??????????????????? ???? ????????? ??????? ? ???????? ???????????????????? ??????? ? ?????????? HCV-???????? ? ?????
???????????? ??????????? [5, 6].
???????? ?????????? ?????????? ??????????, ????????? ???????????? ???- ? ??????????????? ????????? ?
????????? ?????. ???????????? ?D4+-?????????? ?????????????? ?????????? ?????????, ??????????? ? ???????????? ???????-?????????????? ?????????? (Th1) ? ???????????? (Th2) ???????? ??????? [7, 8]. ????????? ?h1,
????????????? ???-?, ??-2, ???-? ????? ? ??????????
??????? ?-??????????, ?????????? ? ???????? ????????? ?????? ?? ?????????? ????, ??????? ????? ????????
???????? ? ?????? ?? ??????????????? ???????????????
[9, 10]. Th2 ??????????? ??-4, ??-10. ????????? ???????
Th1/Th2-???????? ????????? ????????? ????? ?????? ???????? ? ???????????????? ?????????? ? ????????????????
HCV-???????? [3, 5, 11].
?????????? ?????????? ??????????????? ? ???????????
????????? ???????????? ? ????????? ????? ??-1?, ??-4,
10
??-10, ???-? ? ???????????, ???????? ???????? ???????????? ???-? ? ??-2 ?? ????????? ? ??????? ????????? ??????????? ??????. ??????????? ???????????? ??????? ???????? ? ??????????? ????????? ??????? ???-? ? ??-1? ?
??????????? ?? ?????? ? ?????????? ??? (? < 0,001). ? ????????? ????? ??????? ??? c ???(+) ??????????? ????????
????????? ?????? ???-? (? < 0,001), ??? ???????? ?????????? ?????????? ??????????, ??????????? ? ??????????? ??????????????? ????????. ?????????? ?????? ?????????????? ??????????? ????? ??????? ???-? ? ?????????
? ????????????? ???????? ?? ?????? ???. ?????????? ????????? ?????????????????? ?????? ??? ???????? ?????????? ??????????? ????????? ??-4 ? ???? ??????? ? ???(+).
?????????? ????????????? ??????????? ????????? ???????????? ??-4 ??? ????????????? ??????????, ?? ??????????????? ? ??? ????????????? ???????? ???. ?????????????? ?-????????? ??????????? ????????? ??-10, ??????????? ????????? ??-2. ??????? ??-10 ? ????????? ????? ?
??????? ??? ? ????????????? ??????????? ?????????? ??????? (p < 0,01) ? ??????? ?? 108,1 ╠ 4,9 ??? ?????
21,2 ╠ 2,4 ??/??, ??????? ????????? ??? ????????????? ????????, ?? ???????? ?????????? ? ? ?????? ????????
(? < 0,05). ?????? ??-10 ???????? ?? ????????? ??????????
?????????? ? ?????????? ??????? ??????????, ????????
?????? ??-2, ???????????? ???????? ????? ??? ? 2 ???? ???? ?? ????????? ?? ?????????. ??? ???????????? ????????
???????????????? ???????????????? ????????? ??????. ??????? ??-4 ? ????????? ? ??? ??? ??????? ??????? ?? ????????? ? ?????????, ??? ????????????? ???????? ????? ??????????????? ?? ?h2-????. ? 11 (19,6%) ??????? ????????? ?????? ??-4 ?????????? ? ?????????? ?????? ??-2,
???????? ?? ????????????? ????????? ??????? ?h1 ? ?h2,
??? ???????? ???????? ????? ????? ????????? ?????? ?
??????????? ?????????? ??????????????? [1, 4, 12].
????????, ??? ??????? ?????? ??????????? ??????? ??
?????? ?? ?????? ?????????, ?? ? ?? ??????????? ???- ? ????????????????????? ?????????, ???? ???? ?????????? ???????????? ???????? ?????????. ??? ????? ?? ?????????? ?????????????????? ?????? (???) ? ???????????
CD4+/CD8+ ? ???????????? ???????? ????????? (?): ?1 ?
??????????? ??????? ??-2/??-10 (? ????? ?1 = 0,09), ?2 ?
???-?/??-10 (? ????? ?2 = 1,8) ? ?3 ? ???-?/??-4 (??? ????? ?3 = 4,95) ? ?????????? ??????? ??????????? ???? ????????????? ?? ?????????? ??? (????. 3)
?????????? ? ????? ???????????? ????????? ???????????? ??-4 ??? ?????? ????????? ??????? ???-? ?????????? ???????????? Th2-???? ????????? ??????, ??? ?????
??????? 3. ???????????? ???????? ????????? ??? ???
????- ??????- ???????? ??? ? ???? ??????????
p
p1
p2
????????
???????- ??????????
??????
??????
?????????? ????????
?1
??-2/??-10 0,01 ╠ 0,04 0,001 ╠ 0,01 0,01 ╠ 0,01 <0,05 <0,05 <0,05
?2 ???-?/??-10 0,9 ╠ 0,1
1,2 ╠ 0,5 1,1 ╠ 0,08 <0,05 <0,05 >0,05
?3
???-?/??-4 4,5 ╠ 0,4
0,9 ╠ 0,5 1,9 ╠ 0,4 <0,001 <0,01 <0,01
???
?D4/CD8 1,8 ╠ 0,1 1,5 ╠ 0,1 1,38 ╠ 0,02 <0,05 <0,01 <0,05
? ? ????????????? ???????? ?????? ??? ??? ? ?????? ?????????????? ?????????? ? ????????; p1 ? ????????????? ???????? ??????????? ??? ??? ? ??????
???????? ? ????????; p2 ? ????????????? ???????? ????? ???????????? ???
?????????? ? ???????? ? ??????? ???.
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?????? ???????? ????????? ? ??????? ??????????? ????????? ?
???????? ????????????????? ?? ????????????????????
???????, ???????????? ???????????? ???????????????
?-???????? ? ???????? ???????????????. ???????? ????????? ??? ??? ??????? ?????????? ????????????????? ????????? ?????????? ?????????????? ???????
?-??????????, ????? ?????????????? ????????? ? ??????? [6, 8]. ???????????? ???? ????????? ????? ??????????? ??? ?????????? ????????????????? ???????????????? ??????????????? ?????????? ??? ????????? ??????????? Th1- ? Th2-?????????? ? ?????? Th2 ? ?????????
????????? ???-? ???????????, ??? ???????? ???????
??????????????? ??????????????? ?????? ? ???????? ???????????????? ????????? ?????????????? ???????????????? ???????? ??????? ??? HCV-????????. ???? ????
?????????? ???????????? ???????? ????????? ? ??????? ??? ?????????? ? ?????????? ? ???????-?????????????? ? ????????????????? ???????????? ????????? ? ???.
???????? ?????? ?????????? ?2 ? ???????????? ?????????? ? ???, ? ?3 ? ???. ?????? ??????? ????????? ???????? ???????????? ????????? ??????????? ?, ??? ???????????? ???????????????????? ???????, ?????????? ?
???????????????? ???. ??? ?????????? ???????????????
??????? ???????? ???????? ??????????? ?????? ??-4 ??
????? CD3+-??????????. ?????? ?????? ???-? ? ????????? ????? ??????? ??? ??? ?????????? ??????, ??? ????
????? ??????? ? ??????? ??? ? ?????? ??????????. ?? ?????????? ??????????? ???????? ??????????? ???-? ?
??-4 ? ??????????? ?? ??????????? ???????????, ?? ???????? ???????? ???????? ?????? ???-?, ????????????? ?
???????? ????????? ??? ???. ???????????? ??????? ????????????? ??????????? ????????? ? ??? ???(+) ??? ???
? ?????? ?????????????? ??????????, ??? ? ? ????????, ??
????? ?????????? (? < 0,05) (????. 3). ??? ???????? ?????????????? ?????? ? ? ???????-?????????????? ?????????? ???? ???????? ??????? ?????????? ?????????????
?????????? ? ?1, ???????? ??-1, ? ??-10 ? ???????????
???????? (? < 0,01). ??? ???????? ????????? ???????????? ? ?????? ??????? ????? ???????????, ??? ????????
??????????????? ? ?????????????? ????????? ? ??????.
? ?2 ??????????? ?? ???????? ??????? (?? ?????? ???????????????? ??????? ????????, n = 17). ???????? ??
?????? ?????????? ??????????????? ???????? ? ??????
(?? ??????????? ??? ? ??????????? ???????), ??????????? ??????????? ??????????? ??? ? ??????????? ??????? ??? ???????????? ???????. ???????????? ????????
????????? ?????? ????????? ????????? ????????????, ???
????? ?????????? ??? ????????, ??????? ????????????, ??????? ????????? ???????? ??? ????????? ?????????. ??????????? ????????????? ????????????? ? ??????? ??????????????? [1, 6, 11]. ?????????? ????????? ??????? ? ????????? (?????????? ?? ????????????? ??????????) ?????
?????????? ? ???????? ?2 ? ?3, ? ????? ?????????? ???-
??????? ? ???????? ????????? ?????????: ???-?, ??-10
? ??-4, ?? ????????? ? ?????????.
????? ???????, ??? ??? ?????????? ?????????? ????????? ?????????? ? ??????? ?????????. ???????????? ???????? ????????? ???????? ????????? ?????????? ??????????: ???????? ??? ? ????????? ??????? ???- ? ????????????????????? ?????????. ?????????? ??????????? ? ???????? ???????? ?3 ? ???? ??????? ??? (? < 0,01), ?????????? ?? ?????? ???????????. ?????????? ?1 ? ?2 ? ???????
??? ??????????? ? ????????????? ?????????? ??????????????? ????????, ?1 ????? ?????????? ??????? ??????? ? ????????????? ???????????, ? ??????? ?3 ? ? ???.
??????????
1. ???????? ?.?., ???????? ?.?., ?????? ?.?. ??????????? ???????????????????? ??????? ???????????? ???????? ?: ??????? ??? ??????-??????????, ?????????????????, ???????????, ??????????????. ???.: ???-?? ??? ???,
2004; 167.
2. ??????? ?.?., ?????? ?.?., ?????????? ?.?. ? ??. ???????? ????????? ╚???????????╩ ??? ??????????? ???????? ?. ????. ?????? ?????????????. ???????. ???????????. 2002; 2: 55?60.
3. ??????? ?.?., ????????????? ?.?. ???????????? ??? ??????????? ????????
????????. ???. ???. 2001; 2: 17?20.
4. ?????? ?.?., ?????? ?.?., ???????? ?.?. ??????????? ???????? ????????:
??????-????????????????, ???????-??????????????? ? ??????????????? ???????. ??????: ?????? ╚??????╩, 2005; 300.
5. ????????? ?.?. ??????? ?.?., ?????????? ?.?. ????????? ??? ?????? ?????? ???????? ?. Russ. J Immunol. 1999; 4(2): 91?112.
6. Koziel M.G. The role of immuneresponses in the pathogenesis of hepatitis C virus
infection. J Viral. Hepat. 1997; 4(suppl. 2): 31?41.
7. ???????? ?.?., ????? ?.?., ????????? ?.?. ??????????????? ???????? ???????????? ??????? ????????? ? ??????????? ????????. ???????? ? ?????????? 2003; 2(5): 20?35.
8. ?????? ?.?. ??????? ????????? ? ???????? ?? ???????????????? ? ?????
? ??? ?????????. ??????????? 1997; 5: 7?14.
9. ??????? ?.?., ?????? ?.?., ??????. ?.?. ? ??. ??????? ????????? ? ???????
??????????? ????????? ? ??? ??????? ????????????-?????. ??????????????? ????? 2002; 2: 41?4.
10. ?????? ?.?. ??????? ?????????????? ????????? ? ????????????? ???????
????????????????? ?????????. ???. ?????? ????????-?????., ???????., ???????????. 1998; 5: 7?13.
11. ??????????? HCV-????????: ??????????? ????????????????????? ???????. ??? ????????? ????. ?.?.??????????. ?.: ???????????? ????,
2006; 214.
12. ?????? ?.?. ?????? ???????????. ?.: ????????, 1999; 608.
?????????? ? ?????????:
???????? ????? ???????, ???????? ??????????? ????,
????????? ??????? ???????????? ???????? ???????????? ??????????
?????????-??????????? ???????????????? ????????????
?????: 360004, ???????, ??. ?????????????, 175
???????: (8662) 40-7447
11
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????????? ??????
?????????????? ? ??????????????????
???-???????? ????? ?????? ? ?????
?.?.???????????
??????????? ???????? ??????????? ?????? ????? ? ?????? ??????????????? ??????????????????? ??????
?????????? ? ????????????? ??????? ???-???????? ?????? ??????????????? ????????? ??????????????? ???????? ??????? ? ????? ?????????????? ???-????????? ?????????? ?????? ?? ?????????? ?????????? ?????????, ???
? ???? ???????, ??????? ??????? ?? ??????? ??????????? ?????, ??????? ????????????? ??????? ?? ???-???????? ? ?????????????? ?? ???-?????????. ? 7 ????????? ?????????? ????????? ???? ?????????? ? ???-?????????
????????? 1% ? ????? ????????? ??????????. ?????? ???? ??????????????? ? ???????? ???? ???????? ?? ????? ?????????? ? ?????????????? ????????? ???-???????? ? ????????????????, ??? ???????? ??????????????? ??????????????? ????????? ??? ??????????? ???????? ????????, ?? ???????????? ?????????? ??????????? ?????????? ??
???-????????, ? ??? ????? ????? ?????? ? ?????. ???? ????????????? ???????? ???-???????? ?????, ?????????
?? ??????? ? ???-?????????, ???????? ???????, ??? ??????? ????????????? ??????????? ????????????????? ??????????? ??????? ??????-?????????? ?????? ???? ??????? ? ?????.
???????? ?????: ???-???????? ? ?????? ? ?????, ??????????? ????? ? ????????????? ????????? ?? ???-????????,
???? ????????????? ???????? ???-????????, ?????????-???????? ???????, ???????? ???-????????
HIV-infection morbidity and incidence rate
among women and children
V.N.Sadovnikova
Department for Development of Medical Aid to Children and Obstetric Service, Ministry of Public Health and Social
Development of the Russian Federation
Involvement of women predominantly of active reproductive age into the HIV infection epidemic lead to a higher incidence rate
of HIV infection among pregnant women on the territory of the Russian Federation, which in its turn influenced a higher birth
rate of children with a perinatal exposure to HIV infection and more cases of HIV infection among them. In 7 subjects of the
Russian Federation the presentage of pregnant women with HIV infection exceeded 1% of the total population of pregnant
women. This fact indicates that these regions pass from the group of territories with a local HIV infection epidemic to those with
the generalized one, and is an unfavorable prognostic sign for further progress of the epidemic, with a considerable increase of
mortality rates due to HIV infection, including those among women and children. A risk for perinatal transmission of HIV infection to children born by HIV-positive mothers remains high, which necessitates further improvement of organization of the system of medico-social aid to such mothers and children.
Key words: HIV-infection in women and children, birth rate of children with perinatal exposure to HIV infection,
risk of perinatal transmission of HIV infection, socially relevant diseases, HIV infection epidemic
?
????????? ????? ? ???? ???????????????? ?????
30 ??? ??? ? ???-?????????, ?? ??????? ????? 40% ?
???????, ? ?? ???? ????????? ?????????????. ? ?????? ???????? ???????? ???-???????? ???????????????? ?????
5 ??? ?????, ?????????? ?????? ??????? ?????????? ????????????? ???????? [1].
??????? ???????? ????????? ???-????????? ????? ?
???????? 0?18 ??? ???????? ????????????? ???????? ??????.
??????????? ??????????????? ???-???????? ????? ????????? ?????????? ????????? (????? ??????????? ??? ?
???-?????????, ?????????? ? ??????? 2008 ?., ??????????
????? 470 ??? ???????, ????? 16 ??? ????? ? ???????? ??
??? ???????????????:
??????????? ????????? ??????????, ???????? ??????????? ????,
????????? ?????? ???????????? ???????? ??????????? ?????? ?????
? ?????? ??????????????? ??????????????????? ??????
?????: 127994, ??????, ???-4, ???????????? ???., 3
???????: (495) 692-3044
?????? ????????? 28.05.2009 ?., ??????? ? ?????? 15.09.2009 ?.
12
18 ???) ????????, ??? ???????, ?? ?????? ? ????????? ??????????? ?????????????? ?????? ?????????, ?? ? ?????????? ?? ???. ?? 31.12.2008 ?. ? ????? ?? ?????????? ????????? ???? ??????????????? ? 6590 ???????, ??? ?????????
1,4 ╠ 0,1% ?? ?????? ????? ??? ? ???-?????????. ?????
??????? ??? ? ???-????????? ????????? 34 865 ???????, ?
??? ????? ????? ???? 5282 ??????? [2].
???????? ???-???????? ? ??????, ???????? ? ????? ???????? ??????????? ?????????, ? ?? ?? ????? ????? ???
????????????, ?????????? ????????? ??????????? ? ?????????? ??????????? ??? ? ???-?????????, ??? ? ????? ?????????, ??? ? ? ???????, ??????? ??????? ????? ????????????? [3].
????? ?????????? ???????????? ??????? ???????? ?????????????? ? ?????????????????? ???-???????? ?????
?????? ? ?????, ????????? ???, ??? ??????????? ??? ??
????????????????? ??????? ???????? ??????-??????????
?????? ?????????? ???????? ? ???-????????? ? ????? ?
????????????? ????????? ?? ???.
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?????????????? ? ?????????????????? ???-???????? ????? ?????? ? ?????
????????? ? ??????
???????? ?????? ??????????????? ?????????????? ?????? (????? ?61 ╚???????? ? ???????????? ??????? ????????????╩ ?? 1999?2008 ??., ????? ?32 ╚???????? ? ??????????? ?????? ??????????, ????????? ? ???????????╩ ?? 2004?2008 ??.). ? 8 ????????? ?????????? ????????? (?????????, ??????????, ????????????, ????????, ????????? ????????, ?????????, ???????????, ????????????
?????) ???????? ?????????? ??????????????? ?????? 1457
??????? ????? ? 1071 ??????? ??????? ? ?????? ? ???-?????????. ?? ???? ??????? ??????????? ?????? ? ??????????????????? ??????????? ? 2002?2005 ??. ??????? ?????????? ????????????? 458 ?????? ? ???-?????????,
??????? ? ???????? ???? ? ??????. ?????????????? ????????? ??????????? ???????????? ????????? ? ??????? ?????????????????? ???????????? ????????.
?????????? ???????????? ? ?? ??????????
??? ?????????? ??????? ?????? ??????????? ?????????????? ?????????? ???????????, ??? ?? ????????? 10 ??? ?????????????? ???-????????? ????? ?????? ? ????? ??
?????????? ????????? ??????????? ? 6,6 ???? ? ??????????
? 2008 ?. 37,1 ?? 100 000 ?????? (? 1999 ?. ? 5,6) (???. 1).
? ????? 2008 ?. ??????? ???????????? ???-?????????
?????? ? ?????? ????????? 195,5 ?? 100 000 ???????? ?????????. ???????????? ???????????? ?????? ?????????? ?
????????? ? ??????-???????? ??????????? ??????? (340,0
? 267,8, ??????????????). ? ?????? ??????? ?????? ???? ?????????? ???????? 92,7?210,7 ?? 100 000 ?????? (????. 1).
??????????? ?????? ? ?????? ????? ???, ???????
???-????????, ???????? ???????? ? ??????? ??????????
?????????? ????????? ???? ?????? ????? ????? ?????????? ??????? ???????????. ?? ????????? 10 ??? ???? ?????????? ?????????? ? 2 ???? ? ???????? ? 2008 ?. 43,2 ??????
21,5% ? 1999 ?., ? ??????????? ?????? ? ?????? ? ????????? ??? ? ???-????????? ????????? 1,3 : 1,0.
? ????????? ? ????????? ??????????? ??????? ????
?????? ? ???-????????? ?????????? 51,0 ? 47,6%, ? ??????
??????????? ??????? ? 35,6?44,6%. ? ????????? ??????????
????????? ???? ?????????? ????? ??????????? ??????????
?? 17,8% ? ???????? ??????? ?? 63,8% ? ?????????????
????. ? ???????? (50,6%), ???????????? (54,2%), ?????????
(56,7%), ???????????? (50,9%), ??????????? (55,6%), ????????? ???????? (54,3%), ?????????? ??????? (54,3%)
???????? ??? ??????? ?????????? ??????? ???-????????
? ?????? ???????? ??????????? ?????????? ????? ??????. ??? ???? ????? ???????? ??????? ?????????? ???????
???-???????? ????? ?????? ????????? ??????????? ?????????? ????? ??????.
??????????????? ???-???????? ??????????? ??????????????? ????? ?????? ? ???????? ?? 20 ?? 40 ??? (77%),
??? ???? ?? ???? ?????? ????????? ??????????????? ???????? 20?30 ??? ??????????? ????? 60%.
???? ????? ??????? ???-???????? ? ??????, ??????????????? ??????????? ????????, ? ???????????? ???????? ?????????????????? ???? ???????? ???-???????? ??????????????
??????????????? ???????? ????? ?????????? ?????? [4, 5].
??????? 1. ??????? ???????????? ???-????????? ?????? ?
??????????? ??????? ?????????? ????????? (? ????? 2008 ?.)
??????????? ??????
?????????? ???????????? ??????
?????????? ?????????
???-?????????
????? ??????? % ????? ????????
?? 100 000
?????????
???????? ?????????
??????????? ??????????? ?????
198,2
0,20
??????-???????? ??????????? ?????
267,8
0,27
????? ??????????? ?????
59,2
0,06
??????????? ??????????? ?????
194,9
0,19
????????? ??????????? ?????
340,0
0,39
????????? ??????????? ?????
210,7
0,21
??????????????? ??????????? ?????
92,7
0,09
?????????? ?????????
195,5
0,20
?? ?????? ???????????? ??????-????????????? ??????
?? ???????????? ? ?????? ?? ??????, ? ?????? ????????
?????????? ??????? 22?25 ??? ???????????? ?? ???-???????? ??????? ????????????????? ???????, ?? ??? ?? 2,5 ??
4,8 ??? (11,4?19,2%) ? ?????????? ??????.
?? 1996 ?. ? ?????????? ????????? ????????? ????? ???
???? ?????? ???-???????? ? ?????????? (0,1?0,2 ?? 100 000
?????????????). ? 2002 ?. ???? ?????????? ?????? ????????????? ???????? ? 119,2 ?? 100 000 ?????????????, ?
2003?2008 ????? ?? ????????? 105,6?116,3 ?? 100 000 ?????????????.
????? ????????? ?????? ?????????????????? ???-???????? ????? ?????????? ??????, ??????????? ?? ??????
?????? ???????????????? ??????????????? ??????????, ???????? ??????? ????????? ?????????????? ??????????? ?
???????? ?????????????? ???????? ????? ???? ?????? ??????. ?????? ?????? ???-???????? ? ?????????? ??????
???? ???????? ? ?????? 90-? ?????. ? ????? 2001 ?. ???????????? ????? ??????? ???-???????? ? ?????????? ??????
???????? 6090 ???????, ??? ???? ???????????????? ?
84 ????????? ?????????? ?????????. ? ?????? 2002?2008 ??.
???????? ?????????? ?? 8748 ?? 14 364 ??????? ???-???????? ? ?????????? ?????? ?? ???? ?????????? ??????????
????????? (???. 2).
???? ?? ????? ????????? ?? ???? ??????????? ???????
??????, ???? ????? ?? ?????? 2008?2004 ??. ? ??????????
????????? ???????? 130%. ?????????? ???? ????? ?????
30 000
40
35
25 000
30
20 000
25
15 000
20
15
10 000
10
5000
0
5
1999 2000 2001 2002 2003 2004 2005 2006 2007 2008
???. ?????
0
?? 100 ???. ??????
???. 1. ???????? ?????????????? ???-????????? ?????? ? ?????????? ????????? ? 1999?2008 ??. (????? ?????????? ??????).
13
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.??????????? / ???????????? ???????, 2009, ?. 7, ?3, ?. 12?17
15 000
??????? 2. ????????????? ?????? ?????? ????? ????? ???????
???-???????? ? ?????????? ?????? ? ??????????? ???????
?????????? ?????????
???????????
????? ??????? ???-????????
???? ?????
??????
? ?????????? ??????, ???.
2004?2008 ??.,
2004 ?. 2005 ?. 2006 ?. 2007 ?. 2008 ?.
%
12 000
9000
6000
3000
0
1987?
2001
2002
2003
2004
2005
2006
2007
2008
????
???. 2. ???????? ?????????????? ???-????????? ??????????
??????, ???.
??????? ???-???????? ? ?????????? ?????? ????????? ?
????????? ??????????? ?????? ? 169% (????. 2).
???????? ??? ??????? ???-???????? ????? ??????????
?????? ? ????? ????????? ?? ????????? 5 ??? ??????????
? 1,4 ???? ? ???????? ? 2008 ?. 0,49% (? 2004 ?. ? 0,36%).
?? ????????? ?????? ? 7 ????????? ?????????? ????????? ???????? ???-???????? ??????? ? ????????????????
??????. ??? ???? ???? ?????????? ??????, ??????? ???????????, ????? ????? ????????? ?????????? ?????????
1% ? ?????????? ? 2008 ?. 1,1?1,8% (? ????????? ???????,
?????-?????????? ?????????? ?????? ? 1,78%, ???????????? ? ????????? ???????? ? 1,3%, ????????? ? ??????????? ? 1,2%, ??????????? ??????? ? 1,1%).
? 18 ????????? ???? ?????????? ????????? 0,5?1,0%
(? ?. ?????? ? 0,6%, ?. ?????-?????????? ? 0,8%, ??????????
??????? ? 0,6%, ?????????? ??????? ? 0,5%, ????????? ?
0,5%, ???????? ? 0,8%, ???????? ? 0,6%, ??????????????? ?
0,8%, ????????????? ? 1,0%, ?????????? ? 0,5%, ???????????? ? 0,5%, ???????????? ? 0,9%, ???????? ? 0,6%, ??????????? ? 0,6%, ??????????? ? 0,5%, ???????????? ???? ? 0,5%,
????????????? ???? ? 0,5%, ?????????? ??????? ? 0,5%).
? 2004 ?. ?????? ? ???? ?????????? (?????????, ?????????????, ??????????, ????????????, ??????????? ????????, ?. ?????-??????????) ???? ?????????? ??????????? ? 1%
? ????????? 0,5?0,8%.
???????????? ?????????? ? ?????????? ??????? ?????????? ?????????, ?????????????? ????????? ? ??????????? ?????? ?????? ??????????? ? ??????? ? ??????? ??
???????????? ? ?????? ?? ???? ? ???????????? ? ???????????? ???????????? ???????????, ???????? ? ????????????
??????? ????????? ??? ?????????? ???? ??????????? ???????????????? ??????????? ?? ?????? ???????? ???????
?? ???-???????? [6].
??-???????? ?????? ???? ???????????? ??????????? ????? ?????? ? ???-?????????. ? ????? ?? ?????? ? 2008 ?.
?????? ??????? (14,6%) ?? ????? ???????? ?????? ?? ??????????? ?? ?????? ????????????, ? ??????? ???-???????? ???????? ?????? ??? ??????????? ?? ???? ? 2001 ?.
? ?????? ????????? ???????.
????? ? ????????, ??? ??????? ?????????? ???-???????? ? ?????????? ??????, ?? ?????? ?????????? ???????
? ?? ????????????? ?????????? ?? ???????????? ? ?????-
14
???????????
??????????? ????? 2122 2837 2637 2356 2680
??????-????????
??????????? ????? 1324 1290 1195 1188 1465
?????
??????????? ????? 537
596
632
672
743
???????????
??????????? ????? 2852 3438 3689 3626 3747
?????????
??????????? ????? 2548 2956 3058 3051 3123
?????????
??????????? ????? 1431 1506 1608 1989 2417
???????????????
??????????? ????? 207
213
230
228
189
??????????
?????????
11 021 12 836 13 049 13 110 14 364
126
111
137
131
123
169
91
130
????? ????????? ??????????? ?? ???????????? ????????????? ??????????? ???-????????, ? ??? ????? ????????????????? ???????????? ? 28-? ??? ???????????? [7].
?????? ??????????? ???????????? ????????? ??????????, ??? ????? ???? ?????????? ?????? ???-????????
???? ???????? ?? ???????????? ? 50,6% ??????, ??????????? ????????????, ? ? 70%, ?? ??????????. ? ???????????
?????? ???????????? ????????? ? ??????? ??????? ????
(57,3%) ??? ????? ??? (21,8%) ????? ????????? ???, ???? ?
? ????? ??????? ?????.
?? ????? ???????????? ???-???????? ???? ???????????
? 37,3% ??????, ??????????? ???????????? ? ? 13% ??????, ?????????? ????????????, ? 10,8% ??? ???? ???????? ??? ??????????? ?? ????.
???-???????? ?? ?????? ?????? ???????????? (10 ??? ?
?????) ???? ???????? ?????? ? 17% ??????, ???????????
????????????, ? ?? ?? ????? ????? ??????, ?????????? ????????????, ???? ?????????? ????????? 61,9%. ? ??????
?????? ???????, ??????????? ????????????, ???-???????? ???? ??????????? ? ????? ?? 10 ?? 28 ???. ??????? ????????, ? 32% ??????, ??????????? ????????????, ???????
???-???????? ???? ??????????? ????? 29-? ???. ? 4 ??????, ??????????? ????????????, ? ? 5, ?????????? ????????????, ???? ????? ????.
?? ?????? ?????????????, 57,6% ?????? ??????????
??? ?????????? ???????????? ????????, 31,7% ? ??? ???????? ??????????, ????????? ??????? ?????????? ????????
??? ???????????? ? ???????.
? ?????? ??? ???????????? ??????? ????? ????? ???
????????, ??????????? ?? ??????? ? ?????????????? ?????????????? ?????????????, ? ????? ????????? ???????? ????? ? ????????? ???????? ?????????????? [8].
???????????? ?????????????? ???????????, ??? ? ??????, ??????????? ???????????? ??? ??????? ???-????????, ????? ????? ??????? ??????? ????????????? ???????????? ? ?????? ????????????????? ???????????, ?????
??????? ??????? ????? ???????? ???????? ????????
(56,9%): ??????? ? (???) (47,1%), ??????? ? (???) (2,9%),
??? + ??? (6,7%) ? ????????, ???????????? ??????? ??-
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?????????????? ? ?????????????????? ???-???????? ????? ?????? ? ?????
??????? 3. ??????? ????????? ?????????-???????? ????????
? ?????????? ?????? ? ???-?????????
?????? ??????,
?????? ??????,
???????????? ???????
??????????
??????????? ??????
????????????
(n = 1457), ???. (%)
(n = 1071), ???. (%)
??????????? ?? ????????
1228 (84,3)
860 (80,3)
?? ???????????
191 (13,1)
93 (8,7)
??????????
38 (2,6)
118 (10,9)
???????? ?????? ????????:
699 (56,9)
574 (66,7)
??B
35 (2,9)
17 (2,0)
??C
580 (47,1)
481 (55,9)
??B + ??C
83 (6,7)
61 (7,1)
??????
1 (0,08)
25 (2,9)
??????????? ?? ????
1051 (72,1)
911 (85,2)
???????? ????
389 (37,0)
190 (20,9)
(533 ??????
(264 ??????
???????????)
???????????)
???????
41 (3,9)
40 (4,4)
???????
3 (0,3)
3(0,3)
?????????
67 (6,4)
33 (3,6)
??????
134 (12,8)
30(3,3)
???????????
94 (8,9)
43 (4,7)
???????????
93(8,9)
46 (5,0)
??????
101 (9,6)
69 (7,5)
????????? ??????? ????
301 (77,4)
153 (80,5)
??? (????) (37%). ??? ???? ? ??????????? ??????? ? ?????
??????? ???? ???????????? ???????? 2?3 ???????????
(? 389 ?????? ???? ???????? 533 ???????????): ???????
(3,9%), ??????? (0,3%), ????????? (6,4%), ?????? (12,8%),
??????????? (8,9%), ??????????? (8,9%), ????????, ??????????, ??????????????? ? ??. (9,6%) (????. 3).
? ?????? ??????, ?????????? ????????????, ??????? ????????? ???????? ????????? ???? ???? ? 1,2 ???? ?? ????????? ? ??????? ??????, ??????????? ????????????, ?
???? ? ? 1,5?2 ???? ????, ?? ??????????? ???????? (4,4%).
??????? ????????, ??? ?? ????? ???????????? ???????????? ?? ???????? ???????? ?? ??????????? ? 16?20% ??????,
?? ???? ? ? 15?28%.
???????????? ??????? ?? ???????? ?????? ? ?????, ?????????? ? ???????? ??????????, ????????? ??????? ???????? ?? ????? ???????????? [9]. ? ??????????? ??????
?????? ????????: ????????????? (39,0%), ??????????
(0,7%), ???????????? ?????????? (50,2%), ???????????? ??????? (35,2%).
????? ?????????? ? ???-????????? ??????????? ??????? ? ???????? 21?24 ???? (46,7%) ? 25?42 (42,4%) ? ?????? 21 ???? (10,9%). ??? ???? ??????? ??????? ?????? ????????? 23,5 ╠ 1,3 ????.
? ????????? ???? ???????? ?????????????? ?????????
?????? ? ???-?????????, ??? ???? ??? ????????? ????????????.
???? ???????????? ????????, ??? ????? ???? ?????????
?????? ???????????? ??????????? ? 2,5?3 ???? ???? ??
????????? ? ????? ?????????? ?????????? ??????.
?? ??????????? ??????? ?????? ???? ??????, ?????????? ????????????, ?????????? ?? 32,8% ? ??????????? ??????????? ?????? ?? 44,0% ? ??????-???????? ??????????? ?????? (???. 3).
? ???????? ????? ?????????? ??????? ????????? ? ??
?????. ?? ????????? 10 ??? ? ????? ?? ?????? ????? ?????
??????????? ? 15,2 ????, ? 2008 ?. ? 53,1 ?? 10 000 ????? ?
?????? ? ????? ?????????, ? 1999 ?. ? 3,5. ?????????? ????? ????? ?????????? 8873 ? 413 ?????, ??????????????. ????
????? ????? ? ?????? ? ???-????????? ????????? ? ??????????? (52,2%), ????? (11,8%), ??????????? (58,2%),
????????? (53,7%), ????????? (84,0%) ??????????? ??????? ?????????? ????????? (???. 4).
?????? ?? ????????? 5 ??? ? ?????????? ????????? ??
??????? ? ???-????????? ???????? 36 774 ???????, ??? ????????? 80,0% ?? ???? ?????, ????????? ???????? ? ???????????? ?? ????? ??????????????? ???-????????
(51 920 ????? ? 1987?2008 ??.).
???? ????? ??????????? ????? ? ????????????? ????????? ???-???????? ? ????? ?? ?????? ? 2008 ?. ?? ????????? ? 2004 ?. ???????? 146%, ? ????????? ??????????? ?????? ? 517%, ????? ??????????? ?????? ? 171%, ??????????? ??????????? ?????? ? 147%, ????????? ???????????
?????? ? 136%, ??????????? ??????????? ?????? ? 131%
(????. 4).
?????????? ????? ????? ? ????????????? ?????????
???-????????, ??? ? ? ?????????? ????, ?????????? ??
3 ??????????? ??????: ???????????, ??????????? ?
????????? ? 67,2% ????? ?? ?????? ????? ?????, ?????????
???????? ? ???-????????? ? 1987?2008 ??.
2500
????
????
????? ?????, ???.
2000
???
1500
????
???
1000
????
500
???
??
0
0
3000
????????????
6000
9000
12 000
15 000
???.
????
???. 3. ?????? ???????????? ? ?????? ? ???-????????? ? ??????????? ??????? ?????????? ?????????.
2003
2004
2005
2006
????
???
???
???
???
????
2007
2008
????
???
???. 4. ???????? ????? ? ?????? ? ???-????????? ? ??????????? ??????? ?????????? ?????????.
15
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.??????????? / ???????????? ???????, 2009, ?. 7, ?3, ?. 12?17
??????? 4. ????? ????? ??????????? ????? ?? ??????? ? ???-????????? ? ?????????? ????????? ?? 2004?2008 ??. (%)
??????????
????? ?????, ????????? ?? ??????? ? ???-?????????, ???.
???? ?????
?? 31.12.2008
%
2004 ?.
2005 ?.
2006 ?.
2007 ?.
2008 ?.
2004?2008 ??., %
??????????? ??????????? ?????
11 692
22,5
1376
1481
1602
1519
1799
131
??????-???????? ??????????? ?????
5824
11,2
1153
796
706
775
821
?29
????? ??????????? ?????
2548
4,9
284
251
315
399
486
171
??????????? ??????????? ?????
12 467
24,0
1538
1658
1751
2030
2263
147
????????? ??????????? ?????
10 724
20,7
1342
1447
1558
1726
1827
136
????????? ??????????? ?????
7836
15,1
314
952
989
1311
1623
517
??????????????? ??????????? ?????
829
1,6
107
114
95
124
106
?1
?????????? ?????????
51 920
100,0
6114
6699
7016
7884
8925
146
?????????? (????????????) ????? ?????, ??????? ????????????? ??????? ? ???-?????????, ??????????? ? ???????????? (5457), ????????? (4044), ????????? (3572), ?????????? (3222), ??????????? (2323), ???????????? (1875),
????????????? (1376), ??????????? (1274) ????????, ????????? ??????? ? ?????-?????????? ?????????? ??????
(2705), ??. ?????? (4781) ? ?????-?????????? (3047).
?? 31.12.2008 ?. ???????????? ????? ?????, ??????????
??? ?????????? ????????????? ???????????, ?????????
3424, ?? ??? 2429 ????? (71%) ???? ???????? ?? ?????????
4 ????: 490 ????? ? ? 2005 ?., 603 ??????? ? ? 2006 ?., 613 ????? ? ? 2007 ?., 723 ??????? ? ? 2008 ?. (???. 5).
???????? ??? ?????, ???????????? ??? ?????????? ????????????? ???????????, ?????????? 99,4% ?? ?????? ?????
?????, ??????? ???-???????? ? ???????? ?? 0 ?? 14 ???
(3424 ?? 3443) ? ??????????????? ? ???, ??? ?????????????
??????????? ??? ???????? ??????? ???????? ???-???????? ? ????? ? ???????? 0?14 ???.
??????? ????????????? ??????????? ???-???????? ??
31.12.2008 ?. ? ????? ?? ?????? ????????? 9,6% (3424 ??
35 700 ?????), ??? ????? 16 220 ?????, ????????? ?? ???????????? ?????????? ?? ???????????? ???-???????? (??
31.12.2007 ?. ? 10,6%, ?? 2002 ?. ?????? ????? ??????? ???
??????? ???-?????????). ?? ??????????? ??????? ????
?????????? ??????????? ?????????? ? ?? 8,0% ? ??????????? ??????????? ?????? ?? 12,3% ? ????????? ??????????? ?????? (????. 5).
10 000
800
700
8000
600
500
6000
400
4000
300
200
2000
100
0
1987? 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008
1997
0
????? ?????, ?????????? ?? ?????? ? ???-?????????
? ??????? ????
????? ????? ? ???-?????????
???. 5. ???????? ?????????????? ???-????????? ? ?????,
????????? ?? ??????? ? ???-?????????, ? ?????????? ????????? (???.).
16
??????? ????????????? ???????? ???-????????, ??????????? ? 1,5?4 ???? ??????-?????????? ?????????? (9,6%),
?????????? ? ?????????? (15,6%), ????????????? (15,8%),
???????? (14,5%), ????????????? (16,5%), ?????????????
(16,4%), ?????? (41,7%), ??????? (19,5%), ???????? (15,6%)
????????, ??????????? ???????? (20,0%), ???????? ??????
(??????) (20,5%), ??????? (14,0%), ??????? (15,4%), ????????? ?????????? (21,1%).
? 26 ????????? ?????????? ????????? ?????????? ???????
????????????? ??????????? ???-???????? ???? ???? ??????-??????????? ?????????? (9,6%) ? ?????????? 1,2?9,5%:
? ??. ?????? (5,3%), ?????-?????????? (8,6%), ???????????
?????? (5,9%), ???? (5,4%), ???? ?? (5,4%), ????????
(7,5%), ???????????? (9,3%), ???? (??????) (9,5%), ?????????-?????????? (7,1%), ?????????? (7,0%), ??????? (6,7%),
???????? (6,8%), ?????????? (8,7%), ????????? (1,2%),
????????? (7,8%), ?????????? (9,5%), ?????????? (8,3%),
????????? (6,0), ???????? (6,8%), ????????? (7,7%), ?????????? (7,5%), ??????????? (7,3%), ????????? (7,9%) ????????, ??????????? (3,8%), ???????????? (7,8%) ?????,
?????-?????????? ?? (6,6%).
? ??????????? ???????, ????????, ?????, ????, ?????????-?????????? ??????????, ?????????, ????????????,
??????????? ????????, ?????????? ???? ?? ??????????????????? 5. ??????? ????????????? ???????? ???-????????
???????????
????? ?????, ?? ??? ????? ??????? ????? ?????,
??????
?????????
?????
????????????????????
? ??????????
????? ??
? ???????????? ???????? ??????????????????
(??
??????
(??
31.12.2008) ???????? ???????31.12.2008)
(???.)
(??
??? ? ?????
(???.)
31.12.2008)*
? ???(%)
?????????
? ??????
? 2008 ?. (???.)
???????????
??????????? ?????
11 692
690
8,0
3088
??????-????????
??????????? ?????
5824
399
9,1
1429
?????
??????????? ?????
2548
190
12,0
968
???????????
??????????? ?????
12 467
794
9,3
3959
?????????
??????????? ?????
10 724
690
9,6
3516
?????????
??????????? ?????
7836
587
12,3
3059
???????????????
??????????? ?????
829
74
11,8
201
??????????
?????????
51 920
3424
9,6
16 220
*??? ????? 16 620 ?????, ??????????? ?? ???????????? ?????????? ?? ??????? ??????? ? ??????? ? ??? ???-???????? ? 2008 ?.
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?????????????? ? ?????????????????? ???-???????? ????? ?????? ? ?????
???? ?????? ???-???????? ? ?????, ????????? ?? ???????
? ???-?????????.
?????? ??????? ?????????????? ???-????????????? ????? ??????? ???????? ????????? ? ????????????? ??????????? ? ?? ?????? ??????? ? ?????????????? ?? ???????????
?????????? ?????????? ?????? ??????????? ??????? ???,
??????????? ????-?????? (2%), ? ????? ? ??????? ????????????? ????? ????? ?? ?????????? (30%). ????? ?????, ?????????? ?? ??????????, ? 80% ??????? ?????? ??????????, ? ?
20% ??? ??????? ? ??????????? ?????? ??????????, ??? ??????, ??????? ?? ??????????? ??????.
??????
1. ? ????????????? ??????? ???-???????? ??? ???? ??????????? ???????, ???? ??????? ?? ????????? 10 ??? ??????????? ? 2 ????, ??????????? ?????? ? ?????? ????????? 1,3 : 1. ? ???? ????????? ?????????? ????????? ?????
???????? ??????? ?????????? ??????? ???-???????? ?????
?????? ????????? ??????????? ?????????? ????? ??????.
2. ???? ?????????????? ???-????????? ?????? (? 6,6 ????), ??????????????? ????????? ??????????????? ????????
(?????? ?????? ??????? ? ???????? 20?30 ???), ??? ???????
?????????????????? ???-???????? ?? ?????????? ?????????? ?????????, ? ????? ??????????? ???? ????????
?????????????????? ???? ?? ???????? ???????? ???????????????? ???????????????? ?????????? ??? ???????????
???????? ???????? ???-???????? ? ????????????? ????????? ??????????? ?????????? ?? ???.
3. ? ????????????? ??????? ???-???????? ??????? ??????????? ?????????? ?????? ? ????????? ??? ????.
???-???????? ? ?????????? ?????? ?????????????? ??
???? ?????????? ?????????? ?????????, ? 6 ???????????
??????? ?????? ?????????? ???????????? ???? ????? ?????????????? (?? 111?169%).
4. ?????????????????? ???-???????? ????? ??????????
?????? ? 7 ????????? ?????????? ????????? ?????????
1%, ??? ??????????????? ? ???????? ???? ???????? ?? ?????????????? ? ???????????????? ?????? ???????? ???-???????? ? ?????? ?? ????? ???????????? ???? ????? ????????????? ? ????????????? ????????? ?? ???-????????.
5. ? ??????, ???????????? ??????? ??????????? ??????,
??????? ??? ??????????????? ??????-?????????? ????????: ??????? ??????? ?????????-???????? ???????? (???????? ?????????, ????), ???????????? ?????????????
???????, ???????, ??????????, ???????????? ???????, ?????? ?????????? ????, ????????????? ???? ??????????????? ?????, ?????????? ? ????? ?, ??? ?????????, ?????????????? ????????????? ???????.
6. ?????????????? ????????? ?????????? ? ???-????????? ?????????? ? ?????? ???????? ???????. ????? 60%
?????? ????????? ????????????. ????? ????? ????? ?? ????????? 10 ??? ??????????? ? 15,2 ????. ? 5 ?? 7 ??????????? ??????? ?????????? ????????? ?? ????? ???????????
? 11 ?? 84%.
7. ???? ????? ??????????? ????? ? ????????????? ????????? ?? ???-???????? ? ????? ?? ?????? ?? 5 ?????????
??? ???????? 146%, ? 3 ??????????? ??????? ?????? ?? ???????? ??????-??????????, ? ? ????????? ??????????? ?????? ?? ???????? ? 3,5 ???? ???? (517%).
8. ??????? ???????? ????????? ???-????????? ????? ?
???????? ?? 14 ??? ??????? ????????????? ???????? ???????? (99,4% ????? ?? ?????? ????? ????? ?? 14 ??? ? ???-?????????).
9. ?????????? ????????? ???????????????? ???????????, ???????????? ?? ?????????????? ????????? ???-????????? ??????? ?? ??????, ? ?????? ???????, ????? ?????????? ????????????????? ????????????, ??????????????
???????? ??????? ????????????? ??????????? ???-????????. ???? ?? 2001 ?. ? ?????????? ????????? ?????? ?????
???????, ?????????? ?? ?????? ? ???-?????????, ????????? ???-?????????, ?? ? 2008 ?. ?? ??????? ?????????? ?????? 9,6% ?????. ?? ???? ???????? ??? ?? ?????? ??????? ???????? ??? ????? ???????. ? 13 ????????? ?????? ???????
????????????? ???????? ?????? ????????? ??????-?????????? ?????????? ? 1,5?4 ????.
10. ???? ????? ?????????? ??????, ??????? ???-????????, ? ????????? ??? ?????, ????????????? ???????
???? ????????????? ???????? ???-???????? ??????? ????????????? ??????????? ????????????????? ? ??????????
????????? ??????????? ??????? ??????-?????????? ?????? ???? ????????? ?????????, ?????????? ? ?????????? ?????????????? ??????????? ?? ?????????? ???????????? ????????????? ???????? ???-???????? ? ?????? ?????? ???????? ?????? ? ??????? ? ?????????? ??????, ????? ???????
??????????? ??????? ??????????? ? ?????????? ??????????. ????????? ?????? ??????????? ????? ? ??????? ??????
?????????? ? ????? ? ???-?????????, ????????????? ?????? ?????????????? ???? ??????, ???????? ???????? ???????????? ????????????? ???????? ???-???????? ? ???????.
??????????
1. AIDS Epidemic Update: December 2006 /- UNAIDS/00/44R-WHO/. Geneva 2006; 23.
2. ?????????? ?.?., ?????? ?.?., ???????? ?.?. ? ??. ???-????????. ?????????????? ?????????. ?., 2009; 33: 5?20.
3. ?????? ?.?. ? ??. ??????? ?????? ? ?????? ??????????? ?? ???????????????
???/????? ? ????? ???????? ??????? ??????? ????? ? ??????????. ?????.
??????????? ?? ???????? ???/????? ? ????????? ?????? ? ???????????
????. ?., 2006; 90.
4. ??????. ???? ? ??????? ? ???-???????? ? ?????????? ?????????. ?.,
2004; 3?7.
5. ??????? ?.?. ???????????? ? ???? ? ???-?????????????? ?????? ?????????? ?????????. ???????. ????. ? ????. ???. ????. ?., 2005; 126?7.
6. ????? ?.?., ??????? ?.?. ?????????????? ???????? ? ???-????????. ?., 2009;
107?14
7. Working Group Public Health Service Task Force. Perinatal HIV Guidelines
Recommendations for Use of Antiretroviral Drugs in Pregnant HIV-1-Infected
Women for Maternal Health and Interventions to Reduce Perinatal HIV1Transmission in the United States, 2005. http://AIDSinfo.nih.gov.
8. ?????????? ?.?., ????????? ?.?., ???? ?.?. ??????? ? ???????? ????????????
?????????? ? ???-?????????????? ??????. ????????? V ??????????? ???????? ?????? ?????? ???????? ?????? ? ???????, 2003. ?.: ?????????, 2003; 17.
9. ????????? ?.?. ???-????????. ??????? ? ???????. ???., 2000; 323?4.
17
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????????? ??????
???? ?????????????? ?????? ? ????? Nef
? ?????????? ???-1
?.?.????????1, ?.?.??????2, ?.?.????????2, ?.?.????????2, ?.?.??????3, ?.??????????4
??????????????? ????? ?? ???????????? ? ?????? ?? ???? ? ????????????? ?????????????
???????????? ??????????????? ?????????? ?????????, ??????;
2
????????? ??????????????? ??????????? ???????????;
3
??????????? ????? ????????????????? ? ???????????? ????????????, ??????;
4
??????????? ??????????? ????????? ????????????, ???
1
????????? ???????????? ??????? ?????????????? ?????? ? ????? ???-1 Nef ?? ???????? ?????????? ???-1 ?
CD4+-??????????. ???????????, ??? ?????????????? ?????? ???????? ???????????? ???????????? ?D4+-?????????
? ???????????? ?????????? ???-1 ? T-?????????? ?????? (?D4+?D45RO+). ?????????? ???-1 ? CD4+-??????????,
?????????????? ? ??????????????? ????????, ??????????? ???????-?????????????? ???????????? ??????????????
?????? ? ??????? ? ???????? ????? Nef ? ???-1.
???????? ?????: ?????????????? ??????, ?????????? ???-1, ????????? CD4+-??????????, Nef
The role of endothelial cells and Nef protein
in replication of HIV-1
M.V.Makarova1, S.V.Boychuk2, I.G.Mustafin2, A.V.Ivankova2, A.V.Ivanov3, L.Alexander4
Republican Center for Prevention and Control of AIDS and Infectious Diseases,
Ministry of Public Health of the Republic of Tatarstan, Kazan;
2
Kazan State Medical University;
3
Federal Center of Toxicological and Radiation Safety, Kazan;
4
Laboratory of Virology, Yale University, USA
1
The authors studied the influence of endothelial cells and HIV-1 Nef protein on the processes of HIV-1 replication in CD4+-lymphocytes. It has been found that endothelial cells are capable of activating ?D4+-lymphocytes and induce HIV-1 replication in
memory T-lymphocytes (?D4+?D45RO+). HIV-1 replication in CD4+-lymphocytes cultivated with endothelial cells is conditioned
by the antigen-presenting ability of endothelial cells and is related to the presence of Nef protein in HIV-1.
Key words: endothelial cells, HIV-1 replication, CD4+-lymphocyte activation, Nef
?
???????? ??????????? ????????? ?D4+-??????????
(??), ?????????? ????????? ???????? ??? ???-1,
???????? ?? ?????????????? ? ????????????????? ???????-??????????????? ???????? (???), ??????????????? ?
???????? ? ?????????? ?????. ?????? ????, ??????????
??????????? ?????????? ? ???????????, ??? ?? ?????, ??
????????? ?????????? ?????????? ???-1 ? ????????????
??????? ?? ??????? ???????????????? ??????????? ? ???????? ?????, ????????????????, ??? ????????, ?????????????? ??????????? ????????????? ??????? ??????????
???????. ???????????, ??? ????? ?? ???????? ??????????
?????????? ???-1 ???????? ????????? ??????, ??????????-
??? ???????????????:
???????? ????????? ????????????, ???????? ??????????? ????,
??????????? ???????? ????? ???????????????? ?????? ?? ????????????
? ?????? ?? ???? ? ????????????? ????????????? ????????????
??????????????? ?????????? ?????????
?????: 420097, ??????, ??. ???????????, 2?
???????: (843) 238-0165
?????? ????????? 15.01.2009 ?., ??????? ? ?????? 15.09.2009 ?.
18
?????? ?????????? ????????? ???????? ????????????
(? ?????????, NF-??), ????????????? ? ???????????? ????????? ??? ??????????? ???, ??? ? ??????? ???????? ???????? (LTR) ????????? ???-1, ???????????????? ? ?????
??????-???????. ???, ? ???? ???????, ???????? ? ???????????? ???????? ???, ?????????? ????????? ?????? ????????
?????? ???????? ? ?????????????? ???????.
? ????? ? ???? ???? ????????? ????????????? ? ??????????? ????????? ?? ? ???????? ?????????? ???-1 ??
????????? ?????????? ????? ? ??????????????? ? ??????????? ?????. ??????????????, ??? ?????????????? ?????? (??) ???????, ????????? ??? ????????????????????
??? [1, 2], ???????? ???????? ????????? ??????????
(??) [3, 4], ????? ???????????? ?????????? ???-1. ???????? ?????? ??????? ??????? ?? ?????????? ???????????
??????? ??????? (???? ? ?????????? ?????????? ????????????????? ???????) ? ?????? ?????????, ??????????????
???-1, ??????? ??????? ???? nef [5?7], ???????????? ??????? ???????? ???? ??????? ????? ???-1 ? ??????????
???????? ??????????, ?????????????? ??.
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???? ?????????????? ?????? ? ????? Nef ? ?????????? ???-1
????????? ? ??????
? ???????? ????????? ???-1 ???????????? ????? NL4-3
(NIH AIDS Research&Reference Reagents Program, USA),
????? ???????? ??? ??????????? 2 ?????????? (?83-2 ?
?83-10), ??????????? ?????????????? 5?- ? 3?-?????????????????? ?????? ???-1 [8]. ???????? p83-10, ?????????? ??????? ?? ???? nef, ???? ??????? ?????????????
?-??? ?.???????????? (Yale University, USA). ??????????
??? ??????????????? ???????????? ????????????? EcoR1
? ??????? ?4 (New England Biolabs) ? ??????????? ? ?????????????? ????????? ????? Ultracompetent-X10-Gold
(Stratagene). ?????????? ??? ???????? ? ?????????????? ?????? QIAprep Spin Miniprep Kit (Qiagen). ???????????
?????????????? ??????? ? ????????? ????? ????174
(NIH AIDS Research&Reference Reagents Program, USA)
???????????? ? ?????????????? DEAE-????????? (Sigma).
?????? ????174 ?????????????? ? ????? RPMI 1640
(GIBCO BRL) ???????????? ????????, ????????????
?????????????? ? ??????? ??? ?70╟?. ???? ???-1 ? ????????????? ?????????? ??????? ??? (EIA ?24gag Coulter). ?????????? ????? ???-1 ???????????? ??? ?????????????
?? ?????????????? ????? ???????, ?????????????? ??
???-1. ??, ?????????? ?????????????????? ?? ????????? ????????? Ficoll-Hypaque (Pharmacia), ???????????? ?
??????? 3 ???? ? ?????? ????? RPMI 1640 ? ???????????
??? (GIBCO BRL) (4 ??/??) ? ????????????-2 (??-2)
(Sigma) (10 ??/??) ? ??????????? ????????? ???-1
(? 24gag ? 100 ??/??), ??????????? ? ?????????? ??????????? ????????? ?????? ? ?EM?174. ? ???? ??????? ????????? ????????????? ?? ?????????????? ?? ? ??????????? ????????? ? ???????? ???. ???????????? ??????????????, ???? ?????? ?????????? ??????? ???
(EIA ?24gag, Coulter) ? ??????? ??? ?70╟?. ??????????? ???????????? ?????????? ???-1 ????????? ? ?????????????? ????????? ????? HeLa/CD4-?-gal ? MAGI-CCR-5 (NIH
AIDS Research&Reference Reagents Program, USA).
?????????????? ?????? ???????? ?? ?????????? ???? c
?????????????? ??????????? IV ???? (Sigma) ? ??????????? ???????????????? ? ???????? ????????? ???????????
????????? (Falcon) ? ????? 199 (Sigma) ? ??????????? 20%
??-2, ??? (GIBCO), 2,5 mM L-????????? (Sigma), ????????
(Sigma) ? ??????? ????? ?????????????? ?????? (BD). ? ???? ????????????? ?? ??????????? ? ??????? 10 ??? 1%
????????? ????????????????? ? ??????????? 5-???????
?????????? ? ??????? ???.
???????????? ?????????????? ????? (????) ????????
??????? ?????????????????? ?? ????????? ?????????
Ficoll-Hypaque (Pharmacia). CD4+-?? ???????? ?? ????
??????? ??????????????? ???????? (Dynal). ?-?????? ?????? (CD45RO+) ? ??????? ?-?????? (?D45RA+) ????????
??????? ?????????? ??????????????? ???????? ? ?????????????? ??????????????? ?????????????? ???????
(???). ??????? ????????? ?? (84?94%) ?????????? ??????? ???????? ??????????????????? ?? ????????? ????????? FACSCalibur (BD).
??? ???????? ?????????? ??????? ??? II ??????, ?? ???????????? ? ??????? 3?4 ???? ? ????????????-? (???-?)
(1000 ??/??) (BioSource) ? 24-???????? ???????????? ??????-
????? ????????? (Linbro). ? ?????, ?????????? ?? (1 в 105),
??????? ?? (1 в 106) ? 1 ?? ????? RPMI 1640 ? ???????????
10% ???, L-????????? ? ???????????? (GIBCO BRL). ? ???
?? ????? ? ???????? ??/?? ??????? ????????????? ????
???-1. ????? 12 ? ???????????? ?????? ?????? ?????
RPMI 1640 ? ????? ???????? ?? ???????????? ???-1. ?????? ?????????????? ? ??????? 15 ???? ??? 37╟? ? 5% ??2.
?????? ???????? ????? RPMI 1640 ???????????? ??????
3 ???. ???????????? ????????? ??????? ??????? ??? ?70╟?.
??????????? ?????? ???????? ??-2, ? ????? ?????? ?????????? ?????? ???-1 ???????????? ??????? ??? ? ?????????????? ??????????????? ????-?????? (R&D Systems ?
Coulter, ??????????????). ?????????? ???-?????????????? ?????? ?????????? ??????? ????????? ?????????? ?
?????????????? ?24gag ??? (?oulter).
? ???? ??????? ??????????????? ?? ? ?? ???????????? ?
??????????? a???-?D2 ???(TS2/18) (American Type Culture
Collection (ATCC), USA), a???-CD58 ??? (AICD58,
Immiunotech), ????-ICAM-1 ??? (MCA532, Serotec), ????-HLADR (L243)(ATCC) ??? ????????????? (IgG1) ?? ????????????? ??? (HB64 ??? ?16/16)(ATCC). ? ????????? ????????????? ???????????? ??????????????? ??, ?????????? ?? ??
??????????? ??????????????? ???????? (0,2 ??) (Nunc Life
Technologies).
?????????? ????????????
??? ???????? ???? ????? Nef ? ????????? ??????????
???-1 ???? ????????? ???????????? ? ??????????????
?????? NL4-3 (Nef+) ? ??? ??????????????? ????????????,
??????????? ??????? ???? nef (Nef?).
??????? ?????????? Nef+ ? Nef? ? ???????? ???-?????????????? ?? ?????????????? ????? ??? ???????? ??????????, ?????? ???????? ?????????? Nef+ ???? ???? ??
????????? ? Nef? (???. 1). ??????????? ???????? ?????????? ? ?????????? ???????? ? ?????? ?????????? Nef+ ? Nef?
??????????? ????? ??? ????????????? ?????? ?????
????174.
? ?? ?? ?????, ??? ???????? (?? 5-? ????) ??? ? ????????
?????????????? ?????????????? ?? ?????? ??????????
?24gag, ??/??
800
700
600
500
400
300
200
100
0
0
4
5
6
7
9
11
15
??? ???????????????
Nef?
Nef+
???. 1. ?????????? ???-1 (Nef+; Nef?) ? ???-??????????????
??????????.
19
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.???????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 18?24
???????. ??????? ?? ?? ??????? ?????????? ???-1 (Nef+; Nef?) ? CD4+-??
?????????? ?24gag (??/??) ?? ????????? ?????? ???????????????
1-? ????
3-? ????
6-? ????
9-? ????
12-? ????
CD4+ (Nef?)
0
0
0
0
0
CD4+ (Nef+)
0
1,3 ╠ 0,11
1,1 ╠ 0,12
1,6 ╠ 0,19
1,3 ╠ 0,21
?? (Nef+)
0
0
0
0
0
?? (Nef?)
0
0
0
0
0
??/CD4+(Nef+)
0
5,1 ╠ 0,4**
15,2 ╠ 1,4**
70,4 ╠ 2,6**
120,8 ╠ 9,6**
??/CD4+(Nef?)
0
0
0
2,0 ╠ 0,21
2,3 ╠ 0,19
**????????????? ???????? ??? ? < 0,01 ?? ????????? ? ??/CD4+(nef?).
Nef+ ? Nef? ??????????? ??????????? (???. 2). ? ???????????????? ?? ?????????? ???-1 ??????? ??? ?? ????????????????.
??????????????? CD4+-?? ? ??????????? ?? ?????????????? ?????????? ???-1. ??? ?????????? Nef+ ??????????????? ?? 12-? ????? ??????????????? ??????. ??????? ?????????? ?????? ???-1 ? ????????? Nef+ ??? ? 100 ??? ????
?24gag, ??/??
400
350
300
250
200
150
100
50
0
5
7
Nef+
9
11
Nef?
13
15
??? ???????????????
???. 2. ?????????? ???-1 (Nef+; Nef?) ? ??????????, ?????????????? ??? ?? 5-? ????? ????? ?????????????.
?24gag, ??/??
150
120
90
60
30
0
0
3
6
9
Nef+ (???)
Nef? (???)
Nef? (???)
Nef+ (CIITA)
Nef+ (???)
Nef? (CIITA)
12
15
??? ???????????????
Nef+
Nef?
???. 3. ??????? ???-, ???- ? CIITA-??????????? ?? ?????????? ???-1 (Nef+, Nef?).
20
15-? ????
0
0
0
0
90,2 ╠ 3,5**
1 ╠ 0,12
?? ????????? ? ??? ??????????? ? Nef?, ? ? ???? ????????????? ??????? ?????????? Nef? ?? ???????? ??????? ???????? (???????). ??????? ?????????? ???-1 ???????????? ?
??????????? ?24gag-?????????? ?? ? ????????? ??/CD4+-??,
?????????????? Nef+ ? Nef?. ??????????????? ???? ?????
?????? ?? ??????????? ?? ???????????? ?????????? ???-1.
????? ????????, ??? ? ???????? ?? ??????? ?? ?????????????? CD4+-??, ? ??? ???????????????? ?????? ??????????
????????????? ???????? (HLA-DR, CD69, CD25), ???????????? ????? ????????? ??????.
???? ????????, ??? ???????? ?????????? ??????????
Nef+ ? ??/CD4+-?? ???????? ?-?????? ??????. ??????? ?????????? Nef- ? ???????? ??/CD45R?+-?? ??? ???????????
? ???????? ?????? ???? ???? ?? 15-? ????? ???????????????.
???????? ? ?????????? Nef? ????? CD45R0+- ? CD45R?+-??????????? ?? ???? ????????.
??????????? ?????????????? ? ???????? ??????????
Nef+ ? Nef? ? ???????? ??/CD4+-?? ??????????? ??? ???
?????? NL4-3, ??????????? ? ?????????? ??????????? ?????? ???-1 ? ????174 ??????, ??? ? ??? ????? ?? ?????? ??????, ???????????? ???????? ???? ???-?????????????? ??
?????????????? ???????.
???? ??????? ??? II ?????? ? ?????????? ???-1
?????????? ?????????? ???-1 (120?150 ?24gag ??/??)
??????????? ?????? ? ?????? ??????????????? CD4+-??
? ??, ????????????????? ? ??????? ???-?. ???????????? ?? ? ???????? ??????? ????????-? (???-?) ????????? ??????????? ??????? ??????. ? ?? ?? ?????, ???????
?????????? ???-1 ? CD4+-??, ???????????????? ? ????????????????? ??, ???????? ???? 5?15 ??/?? ?? ??????????? ?????? ?? ?????????? ????????? (???. 3).
?????? ?????????? ????????????? ???????? ???-?-?????????????? ?? ?????? ???????????? ????????? ??????
?????????? ??????? ??? II ??????, ? ????? ??????? ???????
(????????, I???-1) ?? ????????? ? ????????????????? ??.
??????? ???-? ?? ??????? ?????????? ??????? ??? II ?????? ?? ??????????? ?? ???????? ?? ????.
??????????? ?II?? (class II trans activator) ??????????????????? ? ?? ???????????? ?????????? ?????? ??? ???????
II ?????? ?? ?? ???????????. ????????? CD4+-?? ? ???????
?? ???????????? ?????????? ???-1, ???????????? ?? ????? ????????? ? ??????????? ???-1 ? CD4+-??, ???????????????? ? ???-?-??????????????? ?? (???. 3). ???????????
???-? ?? ??, ???????????? ??????????????? ?II??-???????????, ?? ????????? ? ??????????? ?????????? ?????????? ??????? ??? II ??????. ??????? ?????????? ???-1 ?
CD4+-??, ???????????????? ? ??, ???????????? ╚????????╩ ???????????, ????? ?? ???????? ??????? ???????? ?
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???? ?????????????? ?????? ? ????? Nef ? ?????????? ???-1
?? 6-? ????? ?? ???????? ??????? ????????. ????????
?????? ?????????? ???-1, ????????????? ? ?????????? ????????? ???????????? ????????? (????????????? ??????????? ???, ╚??????????╩ ??????????????? ?? ? CD4+-??),
????? ????????????? ?? ????????? ?????? ??-2 ? ????????????? ??????????? ????????.
??? ?? ?????, ??????? ???????? ??????? ??????? ????????
??-2 ? ????????????? ??????? ??/CD4+-??, ??????????????
??????? ???-1 ? ????????? Nef?. ????? ????, ??????? ???????? ??-2 ? ????????????? ???????????????? ???????
??/CD4+-?? ?? ????????? ?? ?????? ???????? ??-2 ? ????????????? ??????? ??/CD4+-??, ?????????????? Nef+ ? Nef?.
?24gag, ??/??
150
120
90
60
30
0
??????????
0-
3-
6-
9-
Nef+
1215??? ???????????????
Nef? (anti-LFA-3)
Nef?
Nef+ (anti-CD28)
Nef+ (anti-HLA-DR)
Nef? (anti-CD28)
Nef? (anti-HLA-DR)
Nef+ (anti-CD2)
Nef+ (anti-LFA-3)
Nef? (anti-CD2)
???. 4. ??????? ???????????? ?????????????? ?? ??????????
???-1 (Nef+, Nef?).
????????????? CD4+-??, ???????????????? ? ???-?-??????????????? ??. ??????? ??????? ??? II ?????? ? ???????
??? ????????? ? ????????????? ???????? ?????? ?????????? ???-1 ? ???????? ??/CD4+-?? (???. 4).
???? ???????????? ??????????????
? ?????????? ???-1
???????? ? ???????? ??/CD4+-?? ???, ???????????
?D58/LFA-3, CD2/LFA-2 ? ICAM-1/LFA-1 ?????????????? ???????????? ???????? ?????????? Nef+. ???????????? ??????????? ??????, ???????????? ? ???????? ????-?LA-DR
???, ??? ??????? ??? ??????? LFA-3 ??????? (???. 4). ???????? ????-CD28 ??? ? ???????? ??/CD4+-?? ???????? ??????? ?????????? Nef+ (p < 0,001), ?? ?? ???????? ??? ????????. ??????? ?????????? Nef? ? ??????????? ????-CD28
??? ????? ?????????, ?? ??? ???? ?????? ?????????? Nef+
?? ???? ????????????????? ???????? (???? ? ???????? ?????????? ????????????, ?????????????? ????-CD28 ???)
(? < 0,001).
??????????????? CD4+-??, ?????????? ?? ?? ??????????????? ?????????, ????????? ? ????????????? ????????
?????? ?????????? ???-1, ??? ??????? ?????????? ???? ??
15-? ????? ???????????????.
??????????????? CD4+-?? ? ?????????????? ?????????????? ?? ????? ???????????? ???????? ??????????
???-1. ??? ?? ?????, ??????? ?????????? ? ???? ?????? ???
??????????? ???? ?? ????????? ? ?????????????? ? ╚??????????╩ ???????????????? ??????.
????????? CD4+-?? ? ?????????? ???-1
???? ????????, ??? ?????????? ???-1 ? ????????
??/CD4+-?? ?????????????? ?????????? ??, ? ??? ????????????????? ????????? ?????? ???????? ??-2. ??? ???????? ??-2 ??????????????? ?? 3-? ????? ???????????????, ?
????????????????? ???????, ?????????????? ??? ???????? ?????????? ?????????? ???-1, ??????? ??????????????? ???-?-????????????????? ?????????? ?? ? CD4+-??.
????? ?????? ?????? ??? ?????????? ?????????? ?????????:
1) ???-?-?????????????? ????????? ?? ?????????? ?????????? ??????? ??? II ??????. ???????? ???????? ????????????? ? ???, ??? ?????????? ???????? ??? II ??????
?????????? ???????, ?????????????? in vivo ??? ????????????? ??????????? ??????? ? ????????? ? ???????????? ?????????? ??? II ??????, ??? ????????? ?????????
CD4+-?? ? CD8+-?? ? ??????? ?????????? ?? [9?11].
?????????????, ??????????????? ?????????? ?????? ????????? ???????????? in vitro ????????, ????????????
in vivo, ?, ????? ????, ????????? ????????????? ??????????????? ?????????? ???????? ??? ??? ?? ????????????
????????????? in vitro. ????? ????, ???????? ?????????,
??? ?????????? ??????, ???????????? ?????????? ???????? ??? II ??????, ? ????? ??????????? ?? ??????????
??????????? ???? ?? ????????? ? ?????????????? ??????????? ???????, ??????????? ? ??????????? ????????
??? II ??????.
2) ?????????? ??????? ???-? ? ?????????????? ?????
? ?????????? ?????? ? ???-?????????????? ?????????
[12?14] ???????? ?????????????? ??????? ??????????? ???????? ?????????????? CD4+-?? ? HLA-DR+-??.
3) ??????? ????????? ?????????????????? ???????? ???
???-???????? ???????????? ?????????? ?????????? ?????????? ???????? ?? ?? ? ?????? ????? ???, ??? ????? ???????????? ??????? ??????????? ????????? ?????????????? CD4+-?? ? ??????? ??.
4) ?? ??????? ???????????????? ???-???????? ? ???????? ????? ?????????????? ???????????? ????????? ???????????? ???-1 ? ?????, ????????? ??? ???????? ????????. ? ?? ?? ?????, ??????????? ??? ????????? ?????????????? CD4+-?? ? ??????? ???????????????? ??? ??????????? (??. ????????). ? ????? ? ????, ???? ????????? ?????????????, ??? ?????????? ???-1 ?? ?????? ???????????????? ??????????? ????? ???????? ?????????? ????????? ??
?? ????????? ?????????? ?????, ? ??????, ? ?????????????? ?????.
?????????? ???????????? ???????????? ??????????????? ? ?????????? ???-1 ? ???????? ??/?D4+-??. ????????,
???????????? ?????????? ???-1, ? ?????? ??????, ????-
21
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.???????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 18?24
???? ??????????? ? ???????? ??, ??? ??? ???????????????
?D4+-?? ??? ?? ?? ????????? ? ?????????? ???-1. ?????? ? ??????????? ????????????? ? ?????????? ???-1
? ?? ???????? ?? ?????????? ??????? ????????. ???? ?????????????? ??????? ?????????? ???????? ???? ? ??????????? ??? ? ????????? ????? ?? ? ????????? ??????
?? ????????? ?????? ????? ?? ?????????????. ??? ?? ?????, ??? ?????????? ??????????????? ??, ??????? ? ???
???????? ???, ? ????? ????????? ???-1 ??????? ?? ??????? [15]. ???????? ????????????? ?? ???????????? ??
???????. ??????????????, ???, ???????? ?? ??????????
CD4-?????????, ???-????????????? ?? ???????? ?????
C?CR4 ? ??R5 ?????????, ????????????????? ?? ????????? ?????????????? ?? [16]. ????? ???????, ? ?????????
????? ?????????? ?????? ? ???, ??? ?? ????? ???????? ???????????, ?? ?? ?????????? ?????????? ???-1 [17, 18].
?????????? ?????????? ???????? p24gag ? ?????????????
??, ???????????????? ??? ?D4+-?? (??. ?????????? ????????????), ???????????? ?????? ????? ??????. ??? ?????????????? ??????????????? ? ???, ??? ??????????? ?????????? ???-1 ? ?????? ????????????????? ?????? ???????? ?????? CD4+-??.
???? ???????????, ??? ?? ???????? ???????????? ?????????? ?????? ???-1 ?????? ? ?-??????? ?????? (CD45RO),
?? ?? ? ??????? (CD45R?) ?-??. ???? ???? ??????????? ?
??????? ?? ??-?????????????? ???????????? ????????????? ?-?????? ?????? [19].
????????, ??? ????? ?? ????????, ??????????? ??? ?????????? ???-1 ? ??, ???????? ?? ?????????. ???? ???? ?????????????? ??????????? ???-1 ?????? ? ???-??????????????? CD4+-?? (??. ???. 1 ? 3). ???????? ??? ????, ??? ?
???????? ?? ??????? ???????????????? CD4+-??, ???????
????????????, ??? ???????? ???????? ??? ??????????
???-1 ? ???????? ??/CD4+-?? ???????? ??-??????????????
????????? CD4+-??.
???????? ??? ??????? 2 ???? ???????????? ??????????????, ??????????? ??????? ?? ???????? ????????????
CD4+-??. ?????? ? ?????????? ??????-???????????? ????????????????. ?????? ? ?????? ? ?????????? ?? ? ???????????
????????? ??????????? ???????? (????????, ?????????).
??? ??????????????? ?? ? CD4+-??, ??????????? ???? ??
????? ??????????????? ????????? (??????????? ??????????? ?? ??????????? ??????????????), ??????? ??????????
?????? ???-1 ?? 9-? ? 12-? ????? ?? ???????? ????????? ???????? ? ???? ????????? ? ??????????????? ????? ???? ??
15-? ?????. ? ?? ?? ?????, ??????????????? CD4+-?? ? ?????????????? ??, ??????????? ???????? ??????????? ????????, ???????????? ?????????? ???-1. ??? ?? ?????, ??????? ????????, ??? ??????? ?????????? ??? ???? ?? ????????? ? ????????? (???????????? ? ???????????????? ??).
????? ???????, ?????????? ?????????? ???????????????
? ???, ??? ? ?????????? ???-1 ??????? ???? ????????? ??????-??????????? ??????????????? ????? ?? ? CD4+-??.
????????? ?? ?????????????? ?? ?? ??? ? ???????????????????? ???, ???? ????????? ????????????? ? ???, ???
?????????? ?????? ???-1 ? ???????? ??/CD4+-?? ?????
???? ??????????? ?? ???????-?????????????? ????????????. ?????????? ??? ????? ????????????? ????? ???????
???????????? ???????? ? ?????????? ???-1 ? ?????????
22
CD4+-??, ???????????????? ? ???-?-??????????????? ??
(HLA-DR+) ? ????????????????? ?? (HLA-DR?) (???. 3).
???????????, ??? ??????? ???????, ??????????? ? ??????????? ???????? ? ?????????? ??????????????? ???????? ???????? ? ???????? ?????????? ???-1 ? ????????
??/CD4+-?? (???. 4) ? ??????????? ? ??????? ?????????
CD4+-??, ???????????? ?? ?????? ???????? ??-2 ? ?????????? ????????????? ????????. ???????????? ???????????? ?????? ??? ??????? ??? ??????? ??????? ???
II ??????. ????? ???? ????????, ??? ?????????????? ?????????? CD4+-?? ? ??????? ????-CD28 ??? ???????? ? ????????? ?????????? ???-1 ? ???????? ??/CD4+-??.
????????, ??? ?????? ???????? ?????????? ??????? ???
II ?????? ?? ??????????? ?? ???-? ???????? ???????? ???????? ?????????? ???? ?????? ???????, ????????, ???????
??????? ? ICAM-1 [10], VCAM-1 [20], ??????????? ? ???????????? ??????????????? ? ????????? ??? ????? ????????
?? ?????????? ???-1 ? ???????? ??/CD4+-??.
??? ????????? ???? ????????????? ??????? ? ?????????? ???-1 ???? ????????? ????? ????????????? ? ?????????????? ??, ???????????? ??????????????? ???????????
?IITA-???????????????????, ?????????????? ??????????
?????? ??????? ??? II ??????. ????????????? ?????? ?????? ?????????? ???-1 ? ???????? ??/CD4+-?? ? ?????????????? ??(CIITA+) ? ??(IFN-?+) ?? ?????? ????? ???? ????????????
????????. ???? ???? ????? ???????????????? ? ??????? ????
???????-?????????????? ??????? ?? ? ?????????? ???-1.
????????, ??? ??? ?????????????? ?? ??????????????
?????? ????? ???????????? ????????, ? ?? ???????? ???????????? ??? ???????, ????????????????? ?? ???????? ?????? ???????. ?????? ??????? ????? ????????????? ????????
? ?? ??????? ?? ???????????? ???? ??????? ?? ???????????
?????????????? ?????? [21]. ???? ????? ???????? ?? ?????
?? ???????, ???? ????????????? ????????????? ? ???, ???
???????? ??????????? ???????????? ??????? ???????? ???????????, ?????????????? ???????? ???????????? ?????????? ???-1 [22].
?????????????, ???????? ?????? ?????????? ???-1 ?
???????? ??/CD4+-?? ? ??????????? ??????????? ??? ?????
???? ??????????? ??? ?????????? ???????????? ??????????????, ????????? ? ???????-?????????????? ???????????? ??, ??? ? ????????? ???????????? ??????????? ???-1.
??? ??????????? ???????? ?????????, ???????????????? ???????? ?????????? ?????? ???-1 ? ????? ????????????????? ??????, ???? ????????? ???????????? ?? ????????? ?????? ??La-CD4-LTR-?-gal ? MAGI-CCR-5, ??????????
???????? ??? ?????? ???????????? ?????????? ??????
???-1 ? ????????????? ?????, ????????? ??? ╚single-round
infectivity assay╩ [23].
???? ???????????, ??? ???????? ???-1 ? ???????? ????
????????? ????? ? ??????????? ??????????? ??? ?? ????????? ? ???????? ????? ?????????????? ??????. ?????????????, ???????? ?????????? ?????? ???-1 ? ????????
??/CD4+-?? ? ??????????? ??????????? ??? ?? ??????? ??
????????? ???????????? ?????????? ???-1, ? ????????
?????????? ????????? ???????????? ?????????????? ?????? ????? ??????.
????????, ??? ???????????? ?????????????? ????? ?? ?
CD4+-?? ????? ???????????? ????????. CD4+-??, ????????-
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???? ?????????????? ?????? ? ????? Nef ? ?????????? ???-1
?????? ? ??????? ??, ????????, ? ???? ???????, ???????????? ????????? ?? [24, 25]. ??? ????? ???????? ????????????
??? ?????????????? ?????????? ?? ??????????????? ??.
??? ??????????? ??????????? ???????, ????????????
?????????? ???-1 ? ????? ????????????????? ??????, ???? ????????? ???????????? ?? ??????????????? ?????????????? CD4+-?? ? ?????????????? ?????????????? ??.
?????? ????????????????? ?????? ???????? ?????????:
?) ????????? ?? ??? ???????? ?????????????? ??; ?) ??????? ??????????? ????????, ????????????? ??. ????? ???????, ??????? ?????????? ?????? ???-1 ? ?????? ????????????????? ?????? ??????? ????????????? ?? ????????????????? ??????????????, ???????, ????? ????, ???????????????? ???????? (???CD4+-??).
???? ????????, ??? ??????? ?????????? ???-1 ? ????????????? ? ?????????????? ?? ??? ??????????? ???? ??
????????? ? ????????? (??????????????? ??/CD4+-??).
??? ?? ?????, ?????????? ???-1 ????? ??????????? ????????, ???????? ???? ?? 12-? ????? ???????????????. ?????????????, ???????????? ??????????????, ????????????
?????????? ???-1 ? ???????? ??/CD4+-??, ????? ???????????? ????????, ??? ????????????? ?????????????? ?????????? CD4+-?? ?? ??????? ?????????????? ?? ????? ?????????? ?????????????? ????????? ? CD4+-??.
????? ???????????, ??? ?? ???? ????????????????? ????????, ?????????????? ? ????????? ????????????, ??????????? ?? ???????????? ?????????? ???-1 ? CD4+-?? ??????????? ?????? ? ?????? ????????????? ???????? ???-1,
?? ??????????? ??????? ???? nef (Nef+). ??????? ?????????? ???-1, ???????? ??????? ???? nef (Nef?), ?? ???? ??????? ??????????????? ?? ? CD4+-?? ??? ?????? ?????????????? ? ? ???? ??????? ????????? ??? ?????? ???????????????? ????-??????. ? ?? ?? ?????, ??????? ?????????? Nef+
? Nef? ? ?????????????? ???-?????????????? ?? ??????????? ?? ??????????, ???? ? ??????? ????????? ??????? ?
???????? ?????????? (???. 1).
????? ???????, ???? ??????????? ??????????? ???????? ?????????? ???-1 ? CD4+-?? ?? ????????? ?????????? ?????, ? ??????, ? ?????????????? ?????. ??????????? ?????????? ???-1 ???????? ??, ????????????
CD4+??? ??? ???????????????????? ???. ? ???? ???????, ????? Nef ???????? ????????, ????????? ??? ?????????? ???? ?????????? ??. ??????? ????????????, ???
?????? ????? ???-1 ???????? ???????????? ???????? ????? ???????????????? ?????? ? ????????????? ????????,
????????? ?? ??????? ???, ?????????, ??? ?????, ?????????? ???-1. ??? ????? ?????????????? ????????????
???????????? ? ??????????????? ?????????????? ?? ?
?? ??????????? ??????????. ? ?? ?? ?????, ??????? ????????, ??? ??????????? ?????? ?????????????? ??-2 ???????? ???????????? ????????????? ?????????, ?????????? ????????? CD4+-??.
??????????
1. Pober J.S. Immunobiology of human vascular endothelium. Immunol. Res. 1999;
19: 225?32.
2. Rose M.L. Endothelial cells as antigen-presenting cells: role in human transplant
rejection. Cell Mol. Life Sci. 1998; 965?78.
3. Ma W., Pober J.S. Human endothelial cells effectively co-stimulate cytokine production by, but not differentiation of, naive CD4+ T cells. J Immunol. 1998; 161:
2158?67.
4. Mestas J., Hughes C. Endothelial cell costimulation of T cell activation through
CD58-CD2 interactions involves lipid raft aggregation. J Immunol. 167:
4378?85.
5. Huang Y., Zhang L., Ho DD. Characterization of nef sequences in a long-term survivors of human immunodeficiency virus type 1 infection. J Virol. 1995; 69:
93?100.
6. Kirchhoff F., Greenough T.C., Brettler D.B., et al. Brief report: absence of intact nef
sequences in a long-term survivor with non-progressive HIV-1 infection. N. Engl.
J Med. 1995; 332: 228?32.
7. Learmont J.C., Geczy A.F., Mills J., et al. Immunologic and virologic status after
14 to 18 years of infection with an attenuated strain of HIV-1. A report from the
Sydney Blood Bank Cohort. N. Engl. J Med. 1999; 340: 1715?22.
8. Adachi A., Gendelman H.E., Koenig S., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected
with an infectious molecular clone. J Virol. 1986; 59: 284?91.
9. Epperson D.E., Pober J.S. Antigen-presenting function of human endothelial cells:
direct activation of resting CD8+ T cells. J Immunol. 1994; 153: 5402?10.
10. Murray A.G., Libby P., Pober J.S. Human vascular smooth muscle cells poorly costimulate and actively inhibit allogeneic CD4+ T cell proliferation in vitro. J
Immunol. 1995; 154: 151?61.
11. Pober J.S., Ma W., Biedermann B., Libby P. Vascular cells have limited capacities
to activate and differentiate T-cells: implications fro transplant vascular sclerosis.
Transplant. Immunology 1997; 5: 251?4.
12. Boyle M.J., Berger M.F., Tschuchnigg M., et al. Increased expression of interferon-gamma in hyperplastic lymph nodes from HIV-infected patients. Clin. Exp.
Immunol. 1993; 92: 100?5.
13. Cohen O.J., Kinter A., Fauci A.S. Host factors in the pathogenesis of HIV disease.
Immunol. Rev. 1997; 159: 31?48.
14. Fauci A.S. Host factors and the pathogenesis of HIV-induced disease. Nature
1996; 384: 529?34.
15. Scheglovitova O., Capobianchi M.R., Antonelli G., et al. CD4-positive lymphoid
cells rescue HIV-1 replication from abortively infected human primary endothelial
cells. Arch. Virol. 1993; 132: 267?80.
16. Gupta S.K., Lysko P.G., Pillarisatti K., et al. Chemokine receptors in human
endothelial cells. Functional expression of CXCR4 and its transcriptional regulation
by inflammatiry cytokines. J Biol. Chem. 1998; 273: 4282?7.
17. Abbate I., Dianzani F., Bianchi F., et al. RANTES stimulates cell-mediated transmission of HIV-1 infection. J Interfer. Cytokine Res. 1999; 19: 345?50.
18. Bussolino F., Mitola S., Serini G., et al. Interactions between endothelial cells and
HIV-1. J Biochem. Cell Biol. 2001; 33: 371?90.
19. Marelli-Berg F.M., Hargreaves R.E., Carmichael P., et al. Major histocompatibility
complex class II-expressing endothelial cells induce allospecific nonresponsiveness in naive T cells. J Exp .Med. 1996; 183: 1603?12.
20. Mirakami S., Morioka T., Nakagawa Y., et al. Expression of adhesion molecules by
cultured human glomerular endothelial cells in response to cytokines: comparison
to human umbilical vein and dermal microvascular endothelial cells. Microvasc
Res. 2001; 62 (3): 383?91.
21. Arthur L.O., Bess R.P., Sowder R.C., et al. Cellular proteins bound to immunodeficiency viruses: implications for pathogenesis and vaccines. Science 1992; 258:
7941?5.
22. Cantin R., Fortin J.F., Lamontagne G., Tremblay M. The presence of host-derived
HLA-DR1 on human immunodeficiency virus type 1 increases viral infectivity. J
Virol. 1997; 71: 1922?30.
23. Kimpton J., Emerman M. Detection of replication-competent and pseudotyped
human immunodeficiency virus with a sensitive cell line on the basis of activation
of an integrated beta-galactosidase gene. J Virol. 1992; 66: 2232?9.
23
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.???????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 18?24
24. Monaco C., Andreakos E., Yuong S., et al. T cell-mediated signaling to vascular
endothelium: induction of cytokines, chemokined and tissue factor. J Leukoc. Biol.
2002; 71(4): 659?68.
25. Yarwood H., Mason J.C., Mahiouz D., et al. Resting and activated T cells induce
expression of E-selectin and VCAM-1 by vascular endothelial cells through a contact-dependent but CD40 ligand-independent mechanism. J Leukoc. Biol. 2000;
68: 233?42.
???????? ?????? ????????, ?????? ??????????? ????, ??????????
???????? ???????? ?????????? ???????????????? ???????????? ????????????
?????: 420012, ??????, ??. ?????????, 49
???????: (843) 236-2889
???????? ???? ??????????, ???????? ??????? ??????????????
?????????? ???????????????? ???????????? ????????????
?????: 420012, ??????, ??. ?????????, 49
???????: (843) 236-0563
?????????? ? ?????????:
?????? ??????? ??????????, ?????? ????????????? ????, ?????????,
???????? ???????????? ?????? ????????????????? ? ????????????
????????????
?????: 420075, ??????, ??????? ???????, 2
???????: (843) 239-7114
?????? ?????? ??????????, ?????? ??????????? ????, ????????? ???????
?????????????? ?????????? ???????????????? ???????????? ????????????
?????: 420012, ??????, ??. ?????????, 49
???????: (843) 236-0563
Alexander Louis, Department of epidemiology and public health, Yale University
School of Medicine, New Haven, Connecticut, United States of America
?????: 60 College St., New Haven, CT 06520
???????: (203) 785-6917
????????????? ??????????? ??????
???????????? ??????? ? ?????? ? ???? ???????? ????????
??????? ??????????? ????? ? ?????????? ??????
????? ????????????, ???????????? ?? ???? ????????? ????????????? ???????????? ??????? (???? ???????????, ???)
???? ?????? ????? ????? ????????????? ??????? ? ?????? ? ???????? ????????????? ???????? ??????? ??????????? ????? (????) ?? ????? ????????????. ? ???????, ?????????? 1034 ?????????????????? ??????, ?????? ????????? ???? ?????????????? ???????? ?? ???????????? ??????? ? ?????? ?? ?????????? 6 ??????? ?? ???????????? ? ??????? ???????? ??????? ??????????? ????? ? ?????? ???????? ????????????. ?????????????? ???????????????? ????????? ??????
???? ?????????? ? ?????????????? ?????? ???????????????? ?????? ?????.
??? ?????????, ???????????????? ????????? ????? ???????? ???? ? ?????? ? ?????????? ????????????? ??????? ?
?????? (? ???????, 8,54 ??????? ? ????) ?? ????????? ? ??????????? ???????????? (? ???????, 1,91 ??????? ? ????) ????????? 0,74 (95% ????????????? ???????? 0,53?1,05) ?? 5-???????? ?????? ???????????? ?????????? ? 0,61 (95% ????????????? ???????? 0,39?0,97) ?? 3-???????? ?????? ??????????. ???????????? 6,71 ?????? ??????? ? ?????? ? ???? ???????? ? ?????????? ???????? ????? ????????????? ????. ?????? ????????, ??? ???????????? ?????? ??????? ??? ?????? ?????? ?? ???????? ? ???????? ????? ???????? ???.
????? ???????, ? ???????????? ? ??????????? ???????????? ????????????, ??????????? ???????? ? ??????? ?????
????? ???????????????? ???????????? ???????? ? ????????? ???????? ???? ? ?????????? ??????.
Li L., Werler M.M.
Fruit and vegetable intake and risk of upper respiratory tract infection in pregnant women.
Public Health Nutr. 2009: 1?7
www.antibiotic.ru
??????? ??????????? ????? ? ?????
??????? ??????????? ????? ? ????? ???????? ?????? ???????????????? ???????? ????????? ?? ???????????? ???????, ?????? ????????, ?????????? ?????? ????????????? ??????????? ????? ? ?????, ?? ??? ??? ????????????.
? ????????????, ??????????? ?? ???? ???????????? ?????? ╚???? ??????????╩ ? ???????????? ?????? ????????????
?????? (????? ??????, ???) ??????? ??????? 40 ????? ? ???????? ?? 5 ?? 12 ???, ???????????? ? ????? ? ????????? ??????????? ????? ??????????????? ?????????, ??????? ??????????? ????? 8 ??????. ? ???? ???????????? ???? ????????
????????? ??????????: ????? ?????????????? ?????? ???????? ??????????? ????? ? ????? ?????????? ??????????????????? ?????????? ??????? (27,5%), ???????????????? (22,5%), ???????????? ????? (12,5%), ???????????? ??????????? (5%),
????????? (2,5%) ? ?????????????????? ??????? (20%). ?????????? ???????, ??????????? ? ???????????? ? ??????? ? ??????? ?????, ????????? ? ????????????? ????????? ????????? ?????????.
????? ???????, ??????????????????? ???????, ????????????? ??????????? ? ???????????? ????? ???????? ?????????
????? 80% ???? ???????? ??????????? ????? ? ?????. ????????? ??????????? ?????????????? ? ??????????? ??????? ?????????????? ????????????? ??? ???????????? ??????????? ????????????? ?????.
Khoshoo V., Edell D., Mohnot S., Haydel R. Jr., Saturno E., Kobernick A.
Associated Factors in Children With Chronic Cough. Chest. 2009 Jun 30.
www.antibiotic.ru
24
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????????? ??????
??????? ????????????????? ???????
?? ???????? ?????
?.?.????????, ?.?.?????????, ?.?.???????
??????????? ??? ????????????? ????????????????, ??????
????????? ???????? ??????? ? ???????????? ????????? ??????????? ????????? ?????? ??? ????????????? ??????
???? ????????????????? ??????? ?? ?????????? 72 ??? ? 146 ???-?????????????? ?????????, ??????? ?????????? ???????. ???????? ?????? ?????????????? ?????????? ???? ????????? ?????? ????????????? ??? ????????????? ????????? ??????????? ??????????? ????????, ???????? ??????????. ?????? ?????? ????????????? ? ??????
? ??????????? ????? ????????? ??? ??????????? (1,29) ??-?? ??????????? ?????????? ???????????? ????????????? ??????? ?????????. ?????????????? ?????????? ???????? ????????????? ???, ??? ???????, ?? ?????? ?? ??????? ?????? ???????????, ????????????? ? ????????????? ?????? ?????????, ?? ??????? ???????????? ????????????? ??????? ?????????, ??? ??????? ????? 72 ??? ??????? ? ??????????? ?????????? ??????? ????????????? (4,4).
???????? ??????????? ???????????, ? ????? ?????? ?????????????? ?????????, ???? ??????????? ??????????
???????? ?????????? ? ??????????. ????? 72 ??? ??????? ?? ? ?????? ???????? ?? ????????? ?????????????. ?????????? ?????? ???????????? ???????????????? ???????? ??????????? ????????? ?????? ? ???????????? ?????
??????? ??????? ?, ??? ???????, 1 ??? ? 6 ??? ? ????? ?????????????? ???????? ????????????? ?/??? ?????????????????? ???????????.
???????? ?????: ???-????????, ????, ????????????, ?????????????
Influence of antiretrovirus therapy on lipid metabolism
V.G.Kanestri, A.V.Kravchenko, M.O.Deulina
Central Research Institute of Epidemiology, Federal Supervision Service for Consumer Rights
Protection and People?s Welfare, Moscow
The authors studied the frequency and severity of changes in the indices of lipid metabolism when using varied schemes of
antiretrovirus therapy for 72 wks in 146 HIV-positive patients starting therapy for the first time. The most common metabolic disorder was an increased level of triglycerides in using ritonavir-reinforced protease inhibitors, especially lopinavir.
However, the atherogenicity index in the group that used this drug was minimal (1.29) due to a marked increase of the concentration of high-density lipoproteides. Non-nucleoside reverse transcriptase inhibitors of HIV, as a rule, did not influence
the level of total cholesterol, triglycerides and low-density lipoproteides, but reduced the concentration of high-density
lipoproteides, which after 72 wks of treatment resulted in a marked increase of the atherogenicity index (4.4). The safest
drugs, from the viewpoint of metabolic disorders, were the non-reinforced protease inhibitors atazanavir and nelfinavir. After
72 wks of treatment no patient developed lipodystrophy. These data show the expediency of controlling the indices of lipid
metabolism and of the constitution before starting therapy and at least once in 6 months to prevent the development of
lipodystrophy and/or cardiovascular diseases.
Key words: HIV infection, ARVT, dyslipidemia, lipodystrophy
?
?????? ????????????? ????????????????? ???????
(????) ????? ???????? ?? ???????????? ???????
???-???????? ? ??????? ? ?????????? ?????????? ? ????? ????????? ???-?????????????? ??? [1, 2]. ??? ?? ?????, ?????????? ???-?????????? ????? ????????? ? ????????????? ?????? ??????? ? ?????????? ? ?????????????
???? ????, ???, ? ???? ???????, ?????? ?? ???????? ?????
????????? ?, ??????????????, ?? ???????????? ?????????????? ??????? [3?5].
????? ?? ?????????????? ?????????, ????????? ? ?????????????? ????, ???????? ????????????, ??????? ????-
??? ???????????????:
???????? ???????? ???????????, ???????? ??????????? ????, ???????
??????? ????????? ???????????? ??? ????????????? ????????????????
?????: 105275, ??????, 8-? ??. ????????? ????, 15, ????. 2
???????: (495) 366-0518
?????? ????????? 18.06.2009 ?., ??????? ? ?????? 15.09.2009 ?.
????? ? ?????? ??????????? ??????? ? ???????? ?????
???????? ? ???? ????????????????????, ? ????? ?? ????????? ? ???????????????????? [3, 4, 6]. ??? ??? ??????????
???? ??????????? ??????????? ????????????????? ?????
???-?????????????? ?????????, ??????? ??????????????
????? ?????? ?? ???????????? ??????? ? ????? ??????????
????? ????????-?????????? ???????????. ?????????? ?????????? ???????????? ????? ??????????????? ? ???????
?????? ?????????????? ????? ????? ???????? ????????????? ?????? ????????? (????) ? ??????????? ??????????,
??????????? ??????????? ??????? ???????? ? ??????????
????? ???????? ???????? ? ???????-??????????? ????????? ? ?????????, ??????????? ????.
????????????? ??????????? ??????????? ???-??????????????? ???????????? ?? ????? ?? ???????, ?? ??????? ??? ?????????? ? ???????? ??????????? ???????, ?????????? ? ???????? ???????? ????????, ? ????? ?????-
25
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.???????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 25?29
???????? ? ??????? ???????? ? ?????????, ????????????
???-????????? [7?9]. ???????? ????? ???????? ?????????????????? ??????????? ??? ????????? ??????????? ??????? ??????? ???? ???????????? ?????????????
╚DAD╩, ??????? ???????? 23 468 ???-??????????????
???????? ?? 11 ????????? ??????. ????????????? ????????, ??? ?????????? ???? ?? ?????? ??????????? ????????
(??) ??????? ? ??????? ? ??????? ???????? ?????? ??????? ?????? ?????, ?????????? ? ?????????? ?? 26% ??
????? ?????????? 10-??????? ????? ???????? ?????????????????? ??????????? ? ??????? ?????? 4?6 ??? ??????? [10?12].
??????????????? ??????????, ??????? ??? ??? ?????
?????? ╚?????????????╩, ???????????????? ??? ???????
?????????? ???? ? ??????? ?? ???????????? ?????? ????
(???????????) ?? ????????, ??????????? ? ???? ??? ?????????? ???? (???????????????) ?? ??? (╚???? ???????╩),
?????? ? ?????. ??????????? ? ??????????????? ??????????? ??? ? ????????? ???? ? ??????, ??? ? ?? ???????????.
???? ??????????????? ????????? ???? ????? ?????????????? ??????????????? ???????????, ???????? ?????????????????????, ???????? ???? ?? ??????????, ??? ???????????? ??????????? ???????? ? ????????? ??????????
????. ????????? ???????? ????????????? ?????? ??????
? ?? ????? ?? ???????. ???? ????????? ??????????? ???????? ? ??????????? ??????? ????? ?????????????? ???????, ?????? ?????????? ????????????? ????????????????? ??????? ? ???? ???????? ??. ?????? ????? ???????, ???
????????? ?????? ??????? ? ?????? ????? ? ??????????????? ?????????? ?????????? ??? ?????? ?? [3, 4, 6]. ????????? ???? ????????? ? ??????????????? ? ????????,
????????? ?????????? ? ?????????? ? ? ????????? ?????????????????????, ????? ??? ?????? ?????????, ????? ???
?????????? ?, ????????, ?????????? ???????? ???????????? ????????????? ???????? ???????? [13]. ???? ??
? ???????? ????????????? ?? ??? ??????, ??? ???? ???????????? ???????? ???????? (????), ??????? ??????? ????????? ? ? ??????? ??????? ? ??????????. ?????? ??????????????? ????????? ??? ????????????? ???? ?????????? ??????????? ????????? ????????? ????????????????
??????????? [14, 15]. ??? ?????????? ???? (? ??????? ?????????? ???) ?????????? ???????? ?????????? ????
2 ???????, ????????, ??????????? ???? ????????? ?????
????. ? ?????? ?? ??? ??????? ???-???????? ???? ????
???????????, ? ???????? ???????????? ???? ?????????????? ?????????.
? ????????? ????? ????? ???-?????????? ???????????
?????????? ? ????????? ????????? ? ?????? ?????????????? ???????? ?????? ???????? ??? ?????????. ????? ???????, ??? ???????????? ?? ??? ????????? ????? ????????
????????????? ????????? ?????? ???????. ?????????????? ??????????? ???????????? ???????? ?????????????
?????? ??? ???????????? ? ?? ?? ?????????????? ?????????? ???????? ????????????? ??? (?????), ?? ?????????
?? ????????? ??? ????????, ? ????? ? ????????? ?? ?? ?????????? [16, 17].
????? ???????????? ???? ???????? ??????? ? ???????????? ????????? ??????????? ????????? ?????? ???
????????????? ?????? ???? ???? ?? ?????????? 72 ??? ?
26
???-?????????????? ?????????, ??????? ??????????
???????.
???????? ? ??????
??? ???????? ?????? ??????????? ????????? ?????? ?
146 ???????? ???-?????????????? ???, ??????? ????
??????? ????????? ????. ????? ??????? ??????? ?????
(?????????, ?????????, ?????????) ? 23 ????????? ? ?? ?
123 ?????????. ?????? ???????, ?????????? ??, ? ???? ???????, ???????? ?? 58 ?????????, ??????????? ?????????
??????????? ?? (??????????, ?????????? ? ?????????);
30 ?????????, ??????????? ??????????? ?? (??????????, ??????????) ? 35 ?????????, ??????????? ?????????, ????????? ??????????? (LPV/r). ? ???????? ??????? ??????? ? ????
????????? ? ?????? ????? ???? ???????? 2 ????. ????????????????? ?????????? ????????? 72 ???.
??????????? ?????? ? ?????? ?? ???? ?????? ???????
???? ???????? ??????????: 65/35% ??? ???? ? ?????????????? ?????, 69/31% ? ??? ????? ? ???????????/???????????, 74/26% ? ??? ????? ?????????????? ??, 70/30% ? ???
????? ? ???????????????? ??.
? ???????????? ???? ???????? ???????? ?? 22 ?? 45 ???.
??????? ??????? ??????? ???????? 31 ??? (?? ???????). ??
?????? ??????? ? ???? ??????? ?????????? ?????? ?????
????. ?????????? ??? ????? ???? 14 ????????? (9,6%), ??????? ???? ?????????? ???????????? ?? ???????????
???????. ?????? 2 ???????? ????? ??????? ??????? ?????
????????????? ????????-?????????? ??????????? (???
1-? ???????, ???? ???????????). ?? ??????????????? ?????? ????????, ??? 42,5% ??????? ?????.
?????????? CD4-?????????? ?????????? ?? 45 ??
274 ??????/??? ? ?????? ??????? (186 ??????/?? ?? ???????). ? ??????? 72 ??? ??????? ? 89,7% ????????? ???-??????? ???? ?????????? (??? ?? ????????????????, ??? ? ??
???????????????? ??????????). ?? ???? ? ?????? ?????????? ???????? ??????? ?? ??????? ?????-???? ???????????? ?????????? ?? ?? ????????? ?? ?????? ?????? ???????? ????????? ???????????, ??????? ????? ?? ????????????????? ? ??????????? ?????????? ???-????????.
????????? ???????? ?????? ????????? ?? ????????? ???????? ??????? ?????? ??????????? (??), ?????????????
(??), ????????????? ??????? ????????? (????), ????????????? ?????? ????????? (????), ??????? ????????????? (??),
?????????? ?? ?????? ???????, ????? 24, 48 ? 72 ??? ???????. ?????? ????????????? ????????????? ?? ???????
?? ? ????/????. ????? ????, ??? ??????????? ???????
????????? ??????? ??? ?????????? ????????? ?????????????, ???????? ????? ???????????? ???????? ?????????.
?????????????? ????????? ??????????? ????????????
??? ?????? ???????????? ????????? Biostat, ?????????
???????? ????????? ? ?????????????? 95% (p < 0,05).
?????????? ???????????? ? ?? ??????????
?? ?????? ???? ????????? ?? ???? ????????????? ?
9 ??????? (3 ???????? ? ?????? ??????? ?? ????? ? ???????????????? ?? ? ?? 2 ???????? ? ??????? ? ??????????????
?? ? LPV/r). ?????????? ????????, ??? 50% ?????????, ????-
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
??????? ????????????????? ??????? ?? ???????? ?????
?????? ??????????? ?????????? (ATV) ? ?????????? (NFV),
????? ??????? ?? ???? ???????????? ??????????. ????????? ????????? ?? ???????? ?? ????? ?????????? ????????
? ???????????? ??????????? ???????.
????? 24 ??? ???? ??????????? ??????? ? ?????????
???????? ?????? ?? ? ??????????? ??????? ?? ???? ??????????. ?????? ???????? ????? ?????????? ??????? ???????
????? (???) ???????? ?? ???? ????????????? ? ?????? ?????????, ?????????? LPV/r ? ??????????????? ?? (28,5 ?
26,7%, ??????????????, ? ????????? ? 13,8% ? ?????? ? ?????????????? ?? ? 8,7% ? ? ?????) (p < 0,05). ??????????
???????? ?????? ?? (?? ???????) ???? ???????? ? ?????? ?
LPV/r (?? 0,22 ?????/?), ? ?? ????? ??? ??? ?????????????
????????? ????????????? ?? ???? ?????????? ?? ?????????, ? ? ?????????, ??????????? ??????????????? ?? ?
?????, ?? ???? ?????????? ?? 0,14 ? 0,16 ?????/?, ?????????????? (p < 0,05). ?????????? ??????? ? ???????????
????? ?????????? ??? ? ?????? ? LPV/r ??????? ?? 20%, ????? ??? ? ?????? ??????? ????? ????????? ?????? ?? ????.
?????? ???? ?????????? ?? ?????????? ?? ???? ???????,
?????????? ????? ????????? ????????? ?????? ? 3 ???????
?? ?????? ??????? ????. ??? ???????? ?????? ????, ?? ???
??????? ???????? ???????? ?? ???? ??????? (?? 0,14 ?? 0,22
?????/?), ????? ?????? ? ???????????? ??, ??? ???? ?????????? ??????????? ???????? (?? 0,43 ?????/?) (p < 0,05).
?????? ????????????? ??????????? ?? ????????? ?? 24 ???
??????? ? ? ??????????? ????????? ?? ???????? ?????.
????? 48 ??? ?? ?????? ???? ?????????? ??????????
???????? ?? ?? ????????? ???? ? ?????? ??????? ?? ??????, ?????????? ?????, ? ????????? ??????? 10?14% ????????? ????? ?????????? ?????? ???????????. ?????? ?
???, ??????? ???????? ?? ??????? ?? ???? ???????, ???????? ????? ???????, ?????????????? ????????? ??. ??????????? ?????????? ????????? ? ?????????? ??????? ?? ?
?????? ???????, ?????????? LPV/r, ??? ???? ????????? ?
34,2% ?????????. ?????? ? ? ???????, ??????????? ??????
????????? ??, ??????? ??????? ?? (?? ???????) ????? ??
0,25 ?????/?. ????? ????????? ?????? ????? ??????? ?? ??????? ???????. ??????? ?????? ???? ??????????? ???????? ????????? ?? ???? ???????, ????? ?????? ??????? ?? ????? ? LPV/r, ? ??????? ???? ?????????? ?? ?????????, ???
????, ???????? ??? ?? ???? ????????? ?? ? ?????? ????????. ??-????????, ?? ????????? ???? ?????? ???? ?????
??????? ?? ????? ?????????? ??, ???????? ? ?????? ?
LPV/r. ???????? ?? ???????? ???????? ?????? ???? ? ???????, ??????????? ??????????? ??, ?? ????????? ??????
(1,93), ??? ???????? ? ??????? LPV/r (1,97). ???????? ?? ???? ???????? ???????? ?????? ???? ? 26,1% ???????, ??-
???????????? ? ?????? ?????, ???, ? ???? ???????, ?????????????? ?????????? ?? ???????? ??.
?????????? ???????? ??????????? ???????? ?????? ????????? ?????????, ????????? ?? 48 ??? ???????. ????????
?? ????????? ???????? ?????? ?? ????? 72 ??? ??????? ??
???? ???????, ??? ???????? ????????? ??? ?????? ? 15?20%
????????? ?? ????? ?? ??????, ?????????? ??? ?????????
??. ???????? ????? ????????? ?????? ?? ????????? ? ?????? ???????, ??????????? LPV/r ? 28,6% ????????? ????? ?????????? ???????? ????? ???????. ?? ?????????? ???????? ? ??????? ???? ????????????? ?? ????????? ???????????? ????. ??????? ??????? ???? (?? ???????) ????????
? ?????? ? LPV/r 1,91 ?????/?, ??? ????????? ??? ? ??????????? ???? ?????????? ? ?????? ???????: 1,48 ?????/? ? ?
?????? ????????? ?? (p < 0,05); 1,39 ?????/? ? ? ?????? ??????????? ?? (p < 0,05) ? ????? 0,74 ?????/? ? ? ?????? ????? (???????). ?????? ?????????, ??????????? ?????, ?????????? ?????????? ????????? ???? (30,4% ??????? ????? ???????????? ???? ???? ?????). ??? ????????? ?? ????? ?? ?????????? ?? ??. ????? ?????? ?? ??? ??????????????? ? ???????, ?????????????? LPV/r ? ??????????????? ??
(1,29 ? 1,95, ??????????????), ????? ??? ? ?????? ? ?????
???? ?????? ???????? 4,4 (p < 0,05), ??? ??????????? ????????? ??????????? ??????????. ?????? ???????, ??????????
????????????? ??, ???????? ????????????? ????????? ??
?? (2,24). ??? ????????, ?? ????? ???????? ??????, ?? ???
?? ????????????? ??????????? ??? ???????? ? ?????????
??????????????? ?????? ? ?????? ????? ??????? ????????
?????????????. ??? ??????????? ??????????? ???? ????????? ?????????? ????? ??????????? ???????????? ????, ?.?.
?????? ??? ???????? ??????? ???????? ??????? ??????????
? ???? ?? ?????? ???????. ??? ???? ?????????? ?? ?????
3 ??????????? ????????? ??????????? ???????? ?????? ??????????????????? ?????????.
????? ???????, ? ???????? ???????????? ?????????
??????? ??????? ? ?????? ????? ???? ??????? ?? ?????
???-??????????? ? ?????????????? ?? ??? ????? ???????
???????. ?? ?????? ???? ?????????? ???????, ???????????? ????? ????????? ? 70?80% ???-?????????????? ?????????, ?????????? ??, ? ???????? ? ??????????? ???????
???????????????????? (60?100% ?????????), ? ????? ????? ?????????????? ???????????????????? ? 10?50% ??????? [4]. ? ????? ???????????? ????????? ?? ???????? ????? ??????????? ? ?????????, ??????????? ????????? ?
?????????? ? ???????????, ??? ??????????? ? ??????? ?????????? [18]. ?? ?????? ? ???????, ?????????????? ????
????????, ?? ???? ??????????? ?????????? ?????? ???? ???????? ????? ?????? ??. ?????????? ????????? ???????-
???????. ????????? ???????? ?????? ??? ????????????? ????????? ???? ??????? ???-???????? ? ???????? ?????????
?????????,
??????????? ??
????????? ??
LPV/r
?????
???????
n = 30
n = 58
n = 35
n = 23
(?????/?)
?? ???????
????? 72 ???
?? ???????
????? 72 ??? ?? ???????
????? 72 ???
?? ???????
????? 72 ???
1
2
3
4
5
6
7
8
??
3,83
4,1
3,86
4,79
3,88
4,38
3,86
4,01
??
1,31
1,41
1,05
1,19
1,31
1,67
1,33
1,07
????
2,18
2,61
2,12
2,78
2,45
2,66
2,34
2,46
6
6
2,4
8
????
1,74
1,39*
1,06
1,48*
1,25
1,91* ; **
0,97
0,74**6
??
1,2
1,95*8
2,64
2,24
2,1
1,29*8
3
4,4*2,6
???????? ? ???????????????? ???????? ?????????? ??? * p < 0,05; ** p < 0,01
27
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.???????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 25?29
?????? ?? ????? ?????????????? ????? ???????????? ??, ??
? ??????? ???????. ???????? ?? ????????, ??? ??????? ?????????? ??????? ?? ?? ????????? ????? ???? ? ????????? ????? ?? ????????.
???? ???????? ? ??????????, ??????? ???????????? ???
???????? ????????????? ??, ??, ??????????, ?? ?????? ????
????? ? ????????? ????????? ???????. ??????????????? ??,
? ????? ???????????? ?????????? ? ???????????, ????????
???? ??? ???????? ????????? ????????? ?? ??????? ?? ???????? ?????. ??? ?????? ?????????????? ????????????
?????????????? [11, 18]. ??? ???????? ?????, ??? ??????????? ?? ?????? ?? ??????? ??, ?? ? ????. ?? ? ????? ? ??????????? ??????? ????, ?? ??? ?????????? ? ???? ??????.
??? ????? ????????? ???, ??? ??????????? ????????? ??????
???????? ????????? (15 ???????), ??????? ???????? ?????
??????????????? ???????? ???????? ? ????? ?????? ???
??? ???????????? ?? ???? ? ??, ??? ? ? ?????????, ???????
?????????? ??????? [19]. ???????? ???????????? ????????,
??? ? 96-? ??? ???? ??????????? ??????????? ? 2 ???? ????
??? ????????????? ? ?????? ??????????, ??? LPV/r [20].
? ?????, ? ???????? ???????????? ?? ? ?????? ????????
????????? ??????????? ????????? ?????? ?? ???????????
?????????? ??????????????? ??????????. ????????? ????? ???? ? ??????? 72 ??? ???? ???? ??????????????? ? ??????? ???????????????? ??????????? ????? ? ??????????? ??????????. ??????????? ????????? ??????????? ?/???
???????????????, ?? ???????????? ?????? ??????? ? ??????????, ?? ?? ?????????. ??????, ???????? ?????????? ??????? ??????? ??????????? ??????? ? ???????????????? ?
???????????????? ????????????? ??????????? ????????????????? ??????????, ????? ????????????, ??? ??????????
?????????? ??????????? ??????? ?? ???????? ????? ???????? ? ????????????? ????????-?????????? ??????????? ?
????? ????????? ??????? ??????, ??? ? ????? ?????????.
? ????? ? ????, ?????????? ?????? ???????????? ? ???????????? ??????????? ??????????? ? ??????? ???????? ??
?????? ?????? ??????? ? ????? ?? ?????? ?????? ? ???????. ??? ??????????? ????? ???? ?????????? ?????????
??????? ????????? ?????????? ?? ????????? ??????????
???????? ??????, ???????? ? ???????????? ???????????.
??? ???????? ???????????? ?????? ????? ????????? ???????? ?????? ?????, ?????????? ?????????? ? ???????????
??????????? ????, ? ????? ?????? ?? ???????. ???? ????????? ?????? ????? ?? ???????? ? ???????? ???? ???? ???
????????? ????? ????, ??????? ??????????? ???????????
????????????? ?????????????????? ??????????. ? ????????? ? ??????? ?????? ???????? ??? ? ??????? 10 ??? ??? ?
????????-??????????? ????????????? ? ????????, ????
???????? ?????? ????????-?????????? ????????? ? ??????
?? ??? ????? ?????, ??? ???? ???????? ????? ? ??????????
? ??? ?????????? ??????. ??????? ??? ????? ??????? ????????? ???????? ????? ????????-?????????? ????????? ?
????? ????? ???? ???????? ???????.
? ????? ?????? ??? ????????? ??? ??????? ????????????
??????????? ??????????, ?? ???????? ??????????????
10-?????? ???? ???????? ????????-?????????? ???????????.
??? ???? ??????????? ???????, ???, ??, ????, ???????????? ????????, ??????? ? ??????? ????????? ???????. ?????
????????? ????????? ? ?????? ????? ???????????? ??????-
28
?? ? ????????? ???????????? ? ???????????? ?????? ???????????? ????????? ????????? ??????.
??????????
?????????? ?????? ????????, ??? ??? ??????????? ???????????? ?????? ?? ???????? ??????? ??? ?? ?????? ?????? ???????. ???????? ?????? ?????????????? ?????????? ???? ????????? ?????? ?? ??? ????????????? ????????? ??????????? ??, ???????? ??????????. ?????? ?? ?
?????? ? ??????????? ????? ????????? ??? ???????????
??-?? ??????????? ?????????? ???????????? ????. ?????????????? ?????????? ???????? ????????????? ???, ???
???????, ?? ?????? ?? ??????? ??, ?? ? ????, ?? ???????
???????????? ????, ??? ??????? ????? 1,5 ???? ??????? ?
??????????? ?????????? ??. ???????? ??????????? ???????????, ? ????? ?????? ?????????????? ?????????, ????
??????????? ?? ?????????? ? ??????????.
????? ???????, ???? ????????? ????????????? ?????????? ?????????? ????????? ?????? ? ????????? ???????????? ????? ??????? ??????? ?, ??? ???????, 1 ??? ? 6 ??? ?
????? ?????????????? ???????? ????????????? ?/??? ????????-?????????? ???????????.
??????????
1. Palella F., Delaney K., Moorman A., et al. Declining morbidity and mortality among
patients with advanced HIV infection. HIV Outpatient Study Investigators N. Engl.
J Med. 1998; 338: 853?60.
2. Manfredi R. HIV infection and advanced age. Emerging epidemiological, clinical,
and management issues. Ageing Res.Reviews 2004; 3: 31?54.
3. Chen D., Misra A., Garg A. Lipodystrophy in HIV-infected patients. J
Clin.Endocrinol. Metab. 2002; 87: 4845?56.
4. Dube M., Fenton M. Lipid abnormalities. Clin. Infect. Dis 2003; 36(Suppl. 2):
79?83.
5. Calza L., Manfredi R., Chiodo F. Hyperlipidemia in patients with HIV-1 infection
receiving highly active antiretroviral therapy: epidemiology, pathogenesis, clinical
course and management. Int. J Antimicrob. Agents 2003; 22: 89?99.
6. Gelato M. Insulin and carbohydrate dysregulation. Clin. Infect. Dis 2003; 36(Suppl.
2): 91?5.
7. Lewis W. Atherosclerosis in AIDS: potential pathogenetic roles of antiretroviral
therapy and HIV. J Mol. Cell. Cardiol. 2000; 32: 2115?29.
8. Dronda F., Moreno S., Perez-Elias M., et al. Vascular disease in HIV-infected
patients: a comparative study of two different therapeutic periods (1994-1997 versus 1998-2000). AIDS 2002; 16: 1971?3.
9. Hadigan C., Meigs J., Corcoran C., et al. Metabolic abnormalities and cardiovascular disease risk factors in adults with human immunodeficiency virus infection
and lipodystrophy. Clin. Infect. Dis. 2001; 32: 130?9.
10. The Data Collection on Adverse Events of Anti-HIV Drugs (DAD) Study Group.
Combination antiretroviral therapy and the risk of myocardial infarction. N. Engl. J
Med. 2003; 349: 1993?2003.
11. Kannel W., Giordano M. Long-term cardiovascular risk with protease inhibitors
and management of the dyslipidemia. Am. J Cardiol. 2004; 94: 901?6.
12. Grinspoon S., Carr A. Cardiovascular risk and body-fat abnormalities in HIV-infected adults. N. Engl. J Med. 2005; 352: 48?62.
13. Goldsmith D., Perry C. Atazanavir. Drugs, 2003; 63: 1679?93.
14. Van der Valk M., Gisolf E., Reiss P., et al. Increased risk of lipodystrophy when
nucleoside analog reverse transcriptase inhibitors are included with PI in the treatment of HIV-1 infection. AIDS 2001; 15: 847?55.
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
??????? ????????????????? ??????? ?? ???????? ?????
15. Bogner J., Vielhauer V., Beckmann R., et al. Stavudine versus zidovudine and the
development of lipodystrophy. JAIDS 2001; 27: 237?44.
16. Podzamczer D., Ferrer E., Consiglio E., et al. A randomized clinical trial
comparing nelfinavir or nevirapine associated to zidovudine/lamivudine in
HIV-infected naive patients (The Combine Study). Antivir. Ther. 2002; 7:
81?90.
17. Staszewski S., Keiser P., Montaner J., et al. Abacavir-lamivudine-zidovudine vs.
indinavir-lamivudine-zidovudine in antiretroviral-naive HIV-infected adults: A randomized equivalence trial. JAMA 2001; 285: 1155?63.
18. Tsiodras S., Mantzoros C., Hammer S., et al. Effects of protease inhibitors on
hyperglycemia, hyperlipidemia, and lipodystrophy: a 5-year cohort study. Arch.
Intern. Med 2000; 160: 2060?6.
19. Manfredi R., Calza L., Chiodo F. An extremely different dysmetabolic profile
between the two available nonnucleoside reverse transcriptase inhibitors:
efavirenz and nevirapine. J Acquir. Immune Defic. Syndr 2005; 38: 236?8.
20. Haubrich R. et al. 14th CROI, Los Angeles, 2007; Abstr.38.
?????????? ? ?????????:
????????? ??????? ??????????, ?????? ??????????? ????, ?????????,
??????? ??????? ????????? ???????????? ??? ?????????????
????????????????
?????: 105275, ??????, 8-? ??. ????????? ????, 15, ????. 2
???????: (495) 366-0518
??????? ?????? ????????, ??????? ????????? ???????????? ???
????????????? ????????????????
?????: 105275, ??????, 8-? ??. ????????? ????, 15, ????. 2
???????: (495) 366-0518
????????????? ??????????? ??????
??????? ??????????? ????? ???????? 7-?????????
?????????????? ??????????????? ???????
?? ????????????????? ???????????? S. pneumoniae ? ?????
???????????? ??????? ??????? ??????????? ? ???????????? ???????? ???????????????? ???????????? ?????? ?.
?????? (??????????) ???? ????????? ????????????????? ?????????????? ????????????, ????? ???????? ????? ?????? ??????? ???? ???? ?????????? 7-????????? ?????????????? ??????????????? ??????? (7-???) (2 ???? ??? 2+1 ????) ?? ????????????????? ???????????? ???????????? ? ????? ???????? ???????? ? ????????? ? ??????????? ???????.
??????????? 1003 ???????? ????????????? ????? ????????? ??????????? ? ?????? ? ???? 2005 ?. ?? ??????? 2008 ?.
?????? ???????????? ?????????? ??????????? ?? ?????????? ?????? ???????? 2 ???. ???? ???? ????????? ???????
???????????? ?? 3 ??????: 1-? ???????? 2 ???? ?????????????? ??????? ? ???????? 2 ? 4 ??????; 2-? ?????? ???????
????????? ?? ????? 2+1 ? ???????? 2, 4 ? 11 ???????, 3-? ?????? ???? ??????????? (??????? ?? ???????????). ???????? ????????? ?????? ? ?????? ??????? ???????????? ???? ??????????? ??????? ???????????? ????????? ?????????
???????????? ? ????? ?? ?????? ???? ?????.
? ???????? 12 ??????? ???????????? ????????? ????????? ???????????? ???? ?????????? ???? ????? ?????????????
????? ???? ?????????? 7-??? ? ???????? ???????????? 25% ? 20% ??? ????????????? 2 ??? ? ????? 2+1, ??????????????, ? ????????? ? ???????? ???????????? 38% ? ??????????? ?????? (? < 0,001 ? ????? ???????). ? ???????? 18 ???????
? ?????? ?????????, ??????????????? ?? ????? 2+1, ???????????? ????????? ????????? ???????????? ????????? ??
16%, ? ? 24 ??????? ? ?? 14% (? < 0,001). ? ?????? ?????????, ??????? 7-??? ????????? ??????, ??????? ???????????? ????????? ????????? ???????????? ?????????? ??? ????????? ? ???????? 18 ??????? (24%, ? < 0,001), ?????? ?
24 ??????? ????????? ?? 15% (? < 0,001). ? ??????????? ?????? ????????? ?????????? ????????? ?????????? (36?38%)
?? ?????????? ?????? ???????? 2 ???.
????? ???????, ?? ????????? ? ??????????? ??????????, ????????????? 2 ? 3 ??? 7-??? ???????? ? ???????????? ???????? ???????????? ????????? ????????? ???????????? ?? ?????? ???? ?????.
van Gils E.J., Veenhoven R.H., Hak E., et al.
Effect of reduced-dose schedules with 7-valent pneumococcal conjugate vaccine
on nasopharyn-geal pneumococcal carriage in children:
a randomized controlled trial. JAMA. 2009; 302(2): 159?67.
www.antibiotic.ru
29
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????????? ??????
?????? ?????????? ? ????????????? ???????
?????????????? ??????????
?.?.??????????1, ?.?.??????????2, ?.?.????????3
????????? ??????????? ???????? ?40, ????????????;
????????? ??????????????? ??????????? ????????, ????????????;
3
???????-??????????????? ?????, ????????????
1
2
? ???????????? ??????????????? ???????? ????????? ?????? ??? ????????????? ????? ?????????????? ???????? ?
?????????? ? ???????? ???????. ????????? ??????????????? ?????? ??????????? ??????????. ?? ????????? ??????????? ?????????? ? ???????? ???????????? ??? ?????????? ????????????? ??????? ????????? ???????? ????????,
??????????? ? ?????? ??????????? ????????????????? ? ?????????? ????????????.
???????? ?????: ?????????????? ????????, ????????, ??????????-?????, ????????
The immune status and immunotropic
therapy of enterovirus meningitis
N.A.Batskalevich1, V.K.Verevshchikov2, Yu.G.Lagereva3
City Clinical Hospital No.40, Yekaterinburg;
Urals State Medical Academy, Yekaterinburg;
3
Clinical and Diagnostic Center, Yekaterinburg
1
2
The study analyzed the character of immune response in the meningeal form of enterovirus infection in adolescent and adult
patients. A prognostic evaluation of immunity values is made. Based on the revealed imbalance of immune reactivity the drug
Anaferon belonging to the group of complex immunomodulators and inductors of interferons has been proposed for
immunotropic therapy.
Key words: enterovirus infection, meningitis, interferon-gamma, Anaferon
?
????????????? ???????? (???) ????????? ? ??? ????????????, ? ???????? ???? ???? ????????????, ???
?????? ???? ???????, ??? ??????? ? ???????????? ????????????????, ???????????? ????????????? ?, ?????????????, ????????????? ?????? ???????? ? ???? ????????? ??????????? ????????? ? ????????? ?????????? ?????? ???
?????????? ??????? ? ?????? [1?6].
????? ?? ???????? ?????? ?????? ?????????????? ???
??? ???????? ????????? ??????? ??????? ?? ?????? ???????????????? ????????? ?? ??????? ??????????? ? ????????? ???????. ? ?????????? ??????????????? ??????
????? ????????, ??? ?? 80 ?? 92% ???? ???????????? ?????????? ?????????? ?????????????? [2, 3, 6, 7].
? ????? ???????, ??????????? ??? ?????????? ???????????? ??????????? ???????? ???????? ????????????, ? ??????
???????, ??? ??????????????? ??????? ????????? ?????????????? ?????????? ?????????????????? ?????? ? ?????????? ?? ? ?????? ??? ???????? ??????????????? ?????? [7, 8].
??? ???????????????:
?????????? ??????? ?????????????, ????-????????? ?????????????
????????? ?1 ????????? ??????????? ???????? ? 40
?????: 620102, ????????????, ??. ?????????????, 189
???????: (343) 266-9782
?????? ????????? 13.07.2009 ?., ??????? ? ?????? 15.09.2009 ?.
30
???????? ???????? ? ?????? ?? ???????? ???????? ????? ????????? ?????????. ??????? ?????????? ???????????? ?? ?????????? ??????? ?????? ???????? ???????? ??????????? ???????? (NK-??????) ? ??????????????? ??????????. ??????????????? ????????? (CTL) ? NK-?????? ?????????? ???? ?????? ??????? ?????????. CTL, ??????????? ?
?D8+-??????????, ?????????? ???????? ??????? ?? ???????? ??????, ???????????????? ?????????? ??????? ?????????????????? (???) ?????? I. ????????? CD4+-?????????, ?????????? ???????????????? ??????????, ??????????
???????, ????????????????? ?? ???????? ?????? ? ????????? ? ?????????? ??? ?????? II [7, 10?13].
????????????? ???????? ????? ???????? ? ??????????
?????????, ??????? ?????? ?? ??????? ? ????? ?????????
??????, ???????????? ??????????? ????? ???????????????? ????????? ????????? ? ????????? ???????????, ?????????? ???????????????? ??? ?????????????? ?? ???????????? ??? ?????????? ????. ?????????????? ????? ????????? ?? ??????? ?????? ??????????? ????? ??????? ????????? ???? ??????? ? ???????????? ???????????????? ????????????? ???????? [7, 9].
??????????-????? (???-?) ? ????????? ????????????????? ???????, ??????? ????????????? ???????????????
?-??????????? ? ???????????? ?????????. ?????????
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?????? ?????????? ? ????????????? ??????? ?????????????? ??????????
???-? ?-??????????? ??????????? ??? ????????????? ????????? ??????????? ??????? ? ???????????? ?????????? ?????????????????? ? ???????????? ??????? ??????????: ???????? ???????????? ? ?????????????-2 (??-2) ? ????????
??????????? ? ??-10. ??????? ????????? ???-? ??? ???????? ?????? ? ???????????? ??????? ???????????? ?????????????? ???????????? ???????????? ?-????????: Th1- ???
Th2- [12, 14]. ??????? ???-? ? ????????? ??????????: ??
??????????????? ? ???????????????, ????????? ??? ?????????, ????????????? ? ???????????? ?????????, ??????????????? [9, 12].
???-? ???????? ?????????????? ?????????? ??????????????? ?-?????????? (CTL, CD8+), ???????? ??????? ?? ???????
?-???????? ??????? ?? ?????? ?????????? ???????????????
?????????? [13, 15]. ????????, ??? ???-? ???????? ???????
?????????? ?????????? ??????????. ??????? ??????? ???
????????? ?????? ????????????? ? ??????????? ????????
??????? ?????? ??????????????? ????????? [15?17].
????? ????? ?????? ????? ????????? ????????? ? ?????????? ??????????????????? ??????? ??????? ????????????? ?????? ??? ?? ????????? ???????? ?????????
?????????? ? ???????????? ??????? ??????????.
???????? ? ??????
? ??????? ???????????? ???????? ???? ?? ???? ??? ?40
?. ????????????? ??????? ????????? ??????? ???? ???????????? 2 ?????? ??????? ?????????????? ?????????? (??):
1-? ?????? ? 37 ???. ? ???????? 19?40 ??? (?????? ? 19, ?????? ? 18) ? 2-? ? 36 ??????? ????????????? ???????? (??????? ? 13, ????? ? 23). ??????? ??? ??????????????? ???????????? ???????????? ?????? ??????? (???), ???????????? ??
??????????? ??? ????????????? ? ?????????????? ???????? [2]. ??????????? ?????? ????????? ??????? ???????????
??????: ?? 1-? ?????? ??????????????, ?? 3-? ?????? ???????
(?????? ?????? ????????????????). ??????????? ??????? ????????? ?????? (35 ???.), ???????????? ?? ???? ? ???????? ?
???????????? ????????. ?????? ??????????? ???????????
??????????? ?????? CD3+-??????????, ?????????? ? ?????????? ????????????????? (??-2, ???-?, ? ?????? ???????
????????-? (???-?)) ? ????????????????????? (??-4) ????????, ??? ?? ?????????? ??????? ? ? ????? ?? ??????????. ?????????????? ????????? ??????????? ??????????? ? ?????? ?????????? ???????? STATISTICA 6,0 ????? StatSoft Inc. (???).
????????? ????? ?? ???????????? ????????? ?????????????
? ??????? ?????????? ?????? ????????????? ? ??????????
???????? ?? ??????? ???????? ???????? ? ??????????? ????????????? ?????? ? ?????????????? ??????? ?2 ?? ???????,
?2 ? ????????? ?????, ??????? ???????? ?????? [18].
?????????? ???????????? ? ?? ??????????
???????? ??????????????? ???????? ??? ?? ? ??????????
????????????????? ??????????? ? ??????????????? ? ????????? ???????: ?????????? (p < 0,05), ??????????
(p < 0,0001), ???????? ?????? NK-?????? (p < 0,0001), ??????????????? ?????????? (p < 0,01) ? CD3+-?????? (p < 0,01)
(???????). ???????????????? ??????????? ? ??????? ?????????? ?????? ????????????????? ?????????? ?????????
???????????? ?????????? ????????? (p < 0,05) ? ??????????
(p < 0,01), ??? ? ? ??????????, ?? ????????? ?????? ???????? ??????????????? ?? ???? CD3+, CD8+, ? CD16+-?????????? (p < 0,01).
?????????? ?-??????????, ???????????? IgG ? IgA ??????????? ? ???????? ?????????? ????? ? ??????? ?????? 3 ?????? ??????? ??? ? ???????? ???????, ??? ? ? ??????????.
????????? ?????????? ?????? IgM (p < 0,001) ? ??? ????????
? ?????? ?????? ???????????????? (p < 0,01) ??????? ? ????????? ?????????? ????????? ??????.
???? ??????? ???? ??????????? ??????? ????????????
???????????? CD3+-??????????, ?????????? ? ??????????
????????????????? ? ????????????????????? ???????? ?
????????? ??????? ????????. ?????????? ?????? ???????????????, ??? ? ?????? ?????? ??????????? ? ??????????
? ?? ?????????? ?????????? ??????? CD3+/???-?+ ?
CD3+/??-4+-?????????? (p < 0,05). ? ???????? ???????, ? ??????? ?? ??????????, ??????????? ???????? CD3+/???-?+-?????????? (p < 0,05) (???????).
?????????? ???????????? ?????????? ? ????????????
??????? ?????????? ???????????? ? ???????. ???????????
???????? ??????????? ????????? ?? ?????? CD3+-??????,
?????????? ????????????????? ????????, ????????????
????????????? ?????? ????? ????????????? ? ?????????????? ???????? ???? ? ?????? CD3+/???-?+-??????????
(r = 0,61; p < 0,05), ? ????? CD3+/??-2+-??????????
(r = 0,56; p < 0,05), ????? ??????? ?????? ???????, ? ????????? ?????????? ???????, ? ?????? CD3+/??-2+-??????????
(r = 0,52; p < 0,05).
???????? ???????? ????? ????? ????????? ???????
CD3+/???-?+-??????????, ? ????? CD3+/???-?+-??????????????. ?????????? ?????????? ? ???????????? ??????????
? ??????? ??????????????? ???????????
??????????
????????? (M ╠ m)
???????? (M ╠ m)
n = 36
n = 37
1-? ??????
3-? ?????? 1-? ??????
3-? ??????
9
?????????, 10 /? 5,9 ╠ 0,24?* 6,53 ╠ 0,24
5,8 ╠ 0,4
5,66 ╠ 0,45
?????????, 109/? 1,96 ╠ 0,1?* 1,94 ╠ 0,1?
1,7 ╠ 0,16?* 1,9 ╠ 0,11?
???????????, 109/? 3,57 ╠ 0,2
4,1 ╠ 0,29
3,7 ╠ 0,38
3,38 ╠ 0,38
????????, 109/? 0,36 ╠ 0,02
0,45 ╠ 0,05 0,36 ╠ 0,03
0,37 ╠ 0,04 ?
??????????
3,05 ╠ 0,22
3,5 ╠ 0,25 3,19 ╠ 0,3
3,1 ╠ 0,3
??????????
???????????,
109/?
??????????
0,25 ╠ 0,02
0,33 ╠ 0,05 0,27 ╠ 0,03?* 0,28 ╠ 0,04?
??????????
?????????,
109/?
?????????????
41,2 ╠ 3,1
35,48 ╠ 1,7? 41,8 ╠ 2,7
33,7 ╠ 3,02?
??????????, %
???
15,4 ╠ 2,0?* 12,04 ╠ 1,5? 13,2 ╠ 2,02
9,5 ╠ 1,86
??????????, %
???
20,4 ╠ 2,3
20,9 ╠ 2,4
21,4 ╠ 3,04
16,0 ╠ 2,75
????????, %
IgG, ?/?
11,0 ╠ 0,69
9,5 ╠ 0,6
11,8 ╠ 1,3
10,35 ╠ 1,4
IgA, ?/?
1,63 ╠ 0,17?* 1,4 ╠ 0,12? 1,8 ╠ 0,19
1,75 ╠ 0,2
IgM, ?/?
1,66 ╠ 0,11?* 1,67 ╠ 0,11? 2,0 ╠ 0,21?* 2,2 ╠ 0,2?
???, ??/??.
72,8 ╠ 5,4
72,1 ╠ 5,1
94,1 ╠ 13,4
84,4 ╠ 14,3
CD20, 109/?
0,38 ╠ 0,03
0,29 ╠ 0,03? 0,23 ╠ 0,03
0,26 ╠ 0,03
CD3+, 109/?
1,37 ╠ 0,11?* 1,44 ╠ 0,08? 1,3 ╠ 0,14?* 1,46 ╠ 0,1?
+
9
CD4 , 10 /?
0,84 ╠ 0,07
0,87 ╠ 0,04 0,83 ╠ 0,11
0,94 ╠ 0,09
CD8+, 109/?
0,45 ╠ 0,04?* 0,5 ╠ 0,04? 0,43 ╠ 0,05?* 0,44 ╠ 0,05?
NK, 109/?
0,12 ╠ 0,01?* 0,08 ╠ 0,009?**0,15 ╠ 0,02?* 0,16 ╠ 0,026?
* ????????? ????? ? ??????????? ?????????? ?????,
** ????????? ????? ?? 1-? ? 3-? ??????? ???????????,
? ? ? ? ??????????? ?????????? ?? ????? (? < 0,01).
31
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.?????????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 30?34
??/??
?????????
0,1
0,0*
-0,1
-0,2
-0,3
-0,4
-0,5
-0,6
IFN(sp)
IFN(st) TNF(sp) TNF(st) IL-2(sp)
IL-2(st)
IL-4(sp)
IL-4(st)
?????? ??????
??/??
0,1
0,05
0,0*
-0,05
-0,1
-0,15
-0,2
-0,25
-0,3
-0,35
-0,4
-0,45
-0,5
-0,55
-0,6
IFN(sp)
????????
IFN(st) TNF(sp) TNF(st) IL-2(sp)
IL-2(st)
IL-4(sp)
IL-4(st)
????????????????
???????. ?????????? ?? ????? ?????????? ????????? ? ?????????? CD3+-?????????? ??? ?????????? (sp) ? ??????????????? (st)
??????? ??? ?????????????? ????????? ? ?????????? ? ????????. * ? ??????? ? ???????? ???????.
??? ? ??????? ?????? ??????? (r = -0,64; p < 0,05) ?? 3-? ?????? ???????. ?????? ??????? CD3+ ??????, ?????????? ?
?????????? ???-?, ???????????? ??????? ????????????
??????????? ????????????? ???????????? (r = -0,65;
p < 0,05) ? ?????? ?????? ??????? ? ?????????? ? ???????? ??? ??.
???????????? ??????? ????????? ? ???????????? ????????? ?????? ? ?????? ?????? ??????????? ???????? ?
?????? ????? CD3+/??-2+, CD3+/???-?+-??????????? ? ?????????????? ??????????? ?????????? (r = 0,65; p < 0,05).
????? ??????????????? ???????????????? ???????????
???????????? CD3-??????, ????????????? ????????????????? ???????? ??-2, ???-?, ???-?, ??????? ?? ?????? ?????????????? ?????????? ? ????????? ??????????? (???????).
??? ????????? ??????????? ??? ? ?????? ?????? ???????????, ??? ? ? ??????? ?????? ????????????????.
?????? ??????????? ????? ????????? ????????????
CD3+/???-?+? ? CD3+/???-?+??????????? ? ??????? ??????????????? ?????????? ?????????????? ? ?????? ??????
??? ????????? ????????-?????????????? ?????????? ?????????? ????????? ?????? (r = 0,66; p < 0,05).
????? ???????, ?? ????????? ???????????? ??????? ????? ???????? ????????? ???????????????? ??????????? ??????? ?? ? ???????? ??????? ? ??????????:
1) ???????? ??????????? ?????????? ?????????? ?????????????? ?????, ???????? ?????????? CD3-, CD8-?????????? ? ??????????? ????????;
2) ?????? ?????????????? ?????????? ? ????????? ??????????? CD3+-??????????, ?????????? ????????????????? ????????;
3) ??????????? ???????????? ? ???????????? ??????????? ???????? ??????????? ????????? ??????????? ?? ?????? CD3+-??????, ?????????? ? ?????????? ????????????????? ????????.
????????????, ??? ???????? ??????????? ???????? ???
?? ?????????? ? ??????? 1-? ?????? ???????????. ??????????? ????????????? ????????? ???????????? ???????????
???????. ??????????? ???????????? ???????, ??? ? 56%
?????????? ? 40% ???????? ??? ?? ?? 18?20-? ???? ??????-
32
????? ??????? ?????? ??????? ????????? 20 в 106/?, ? ????? ???????????? ?? ???????? 23,6 ╠ 4,1 в 106/? ? ??????????, 28,0 ╠ 5,2 в 106/? ? ? ???????? ???????. ???????? ?????? ??????????? ??????? ??????? ??????? ?? ???????????
??????????? ? ??????????? ???????????.
??? ??????? ??????? ????????????? ?????? ??????? (????? <20 ?????? ? ????? >20 ??????), ? ????? ??????????? ????-, ???????????? ???????? ????????? ???????????:
1) ??? ???????? ?????????? ?????? ?????????? ?????????????? ????? ???? 2,0 в 109/? ?? ??????????? ??????? ??????? ?? 3-? ?????? ??????????? ? 64% ??????? (p < 0,05);
2) ??? ??????? ?????????????? ???????? ??????????
?????? NK ? ??????????????? ?????????? ?? 18?20-? ????
??????? ??????? ??????? ?? ?????????? (????? > 20 ??????)
(p < 0,001). ????? ??????? ???????? M = 42,8; ? =17,2;
m = 6,0 в 106/?;
3) ??? ??????? ?????????? ?????? ????????? ???????????
??????????????? ?????????? ? NK-?????? ? ???????? ?????????? ????? ??? ????, ????? ??????? ?? 3-? ?????? ??????????? ??? ????? 20 ?????? ? ???? ????????? ? ????????
?? 18?20-? ????: M = 11,0; ? = 4,1; m = 1,4 x 106/?;
4) ??? ?????? NK ???? 0,097 x 109/? ?? ???? ???????? ??????? ??????? ?? 18?20-? ???? ???????;
5) ??? ??????? ??????? ??????? ??????? CD3+/???-?+?????????? ????????: M = 0,05; ? = 0,03; m = 0,01 в 109/?,
??? ?????????? ?????? ?? 3-? ?????? ???????????:
M = 0,025; ? = 0,015; m = 0,06 в 109/? (p < 0,05).
????? ???????, ???????? ??? ?????????????? ?????????, ?????? ?????, ??????????? ??????????? ??????????
????????????? ???????? ??????? ???????.
???????? ??????????? ??????? ??????? ??????? ?? ?????? ?D3+-??????, ?????? ?????????????? ??????????
CD3+/???-?+-??????????, ?????? ????? ???-? ????? ?????????, ?????????? ??????????-????????????? ?????????,
??????? ???????? ?????????????????? ?????????? ????????? ??????????, ?????????? ? ?????????? ????????? ????????????????? ?????????, ? ??????????? ??????? ????????????? ????? ??? ????????????? ???????????? ????????????? ????????, ???????????? ?????????????? ???????.
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.?????????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 30?34
? ???????? ?????? ????????? ?? ??????????? ??????????? ?????????? ????????? (╚??????? ??????╩, ??????),
??????????? ????????????????? ? ??????????????? ???????????. ????? ????????? ??? ????????? ?????????????????? ?????????? ? ??????? ?????????????. ????????
???????? ?????????? ???? ??????? ? ?-??? ???????? ? ???? ???????? ????? ?????-????????? ?????, ??? ???????????? ??? ??????? ????????????. ???????? ?????????? ? ?????????? ??????????? ?????????? ???, ?????? ?????,
???-?. ??????????? ????????? ????????? ?? ????????????,
? ??????????? ??????? ?????????? ?????????????? ???, ???
?? ???????? ?????????? ?????????? ?h1- ? ?h2-???? ????????? ??????: ???????? ????????? ????????? Th1 ? ?h2, ?????????? ?????? ?h1-/?h2-???????????. ????? ????, ???????? ???????? ?????????????? ?????? ?????????, N?-??????, ?-????????, ? ??? ?? ?????? ??????, ??????????? ? ???????? ??????. ??????? ????????? ?? ??????????? ?????
??????????? ?????????? ????????? ??????? (??????? ??????????? IgA).
????? ???? ??? ??????? ???? ?????????? ?????????
(? ???????? ???????????????? ?????????) ? ????????? ? ???????????? ?????? ??????? ??. ?????? ???????? ?????????? ???? ? 2-4-?? ??? ??????? ? ??????? 7 ???? ?? ?????:
? 1-? ????? 5 ??????? ?? 1 ???????? ? ?????????? 30 ???, ????? 3 ?????? ?? 1 ???????? ? ?????????? 2?3 ?. ? ??????????? ??? ? ?? 1 ???????? 3 ???? ? ????. ??? ??????? ??????????? ???? ?????????????? ???? ????????? ?????????????
????????????. ????? ???? ???????? 30 ??????? ???????
???????? ??????? (28,7 ╠ 3,2 ???), ?????????? ???????? ?
??????????? ??????? ??, ? ??????? ?? ??????? ???????
???????? ???????, ??????? ???????? ?? ??????????. ?????? ?????? ???? ???????? ????? ????? ?? ????, ????????
? ?????? ??????????, ???????? ?? ?????????? ???????
(????? ?????????????? ? ?????? ???????, ??????? ????????????? ?????????). ???????? ?????? ???????, ???????????
?????? ????????? ????????? ??????????? ????????????????? ????????????? ??????? (5,0 ╠ 0,8 ?????? 7,2 ╠ 0,9 ???
? ?????? ?????????) (p < 0,05) ? ????????????? ?????????
(7,3 ╠ 1,2 ?????? 9,8 ╠ 0,6 ???, ??????????????) (p < 0,05). ????? ????, ???? ???????? ?????????? ???? ?????????, ? ??????? ??????????? ???????? ?????? ? ?????????????? ???????? ? ??????????? ?????? ??????????. ???, ?? 18?20-? ????
??????????? ? ?????? ?????????, ??????????? ????????,
??????????? ??????? ??????? ? 89% ??????? (?????? 60% ??
???? ???????? ???????). ?????????? ?????????? ???????????????? ??????? ??????????? ??????????? ?????????????
?????????? ????????? ? ??????????? ??????? ??.
????? ???????, ?????????? ???????????? ????????????
????????? ???????????????? ???????????????? ??????????? ?? ? ?????????? ? ????????. ???? ?????????? ?????? ??????????????? ?????????? ? ??????????? ???????? ???, ???
???????, ?????? ?????????? ?????????????? ?????, ????? ????????? ?????????????? ????? ?????????? ???????????? ???????????? ??????? ?, ??? ?????????, ???????????
????????????? ??????? ??? ??, ?????????? ????????? ?
?????????? ????????????????? ???????????? ? ?????????? ??????????????????? ???????. ?????????? ??????????? ?????? ????????????? ?????????? ????????? ????????? ????????? ?????????? ?????? ? ??????????? ??? ??-
34
??????????? ? ??????? ??. ? ?????? ??????? ? ?????????
?? ?????? ??????????????? ??????????, ?? ? ???????????
??????????????????? ??????????, ? ????? ???????????
???????????? ? ???????????? ?????? ???-?, ?? ???????
????????????? ?????????? ??????????? ??????????? ???
?????????? ? ??????? ?????????????? ???????????, ? ??????? ??????? ???????? ????????? ??????? CD3+/???-?+??????????, ? ????? NK-?????? ? ??????????????? ??????????, ? ????????????? ????????????.
??????????
1. ??????? ?.?., ????? ?.?., ????? ?.?., ? ??. ?????????????? ????????: ????? ???????. ???????????: ?????. ???. ????????? ????. 1990; 224.
2. ?????????????? ???????????: ???????, ???????????? ???????????, ?????????????, ????????????: ???????????? ???????? (?? 3.1.1.2130-06). ?.,
2006.
3. ?????? ?.?., ????????? ?.?., ??????? ?.?. ????????? ? ??????????. ???.,
2001; 55?110.
4. ???????? ?.?., ??????? ?.?., ?????? ?.?., ? ??. ???????????????? ?????????????? ????????: ?????????????, ?????????????? ?????????????, ???????,
???????????, ????????????: ???????????? ???????. ??????????? ?????
????????????????? ??. ?., 2004.
5. ?????? ?.?., ???????? ?.?., ??????? ?.?. ????????????. ????? 1: ??????? ????????, ??????????, ???????? ??????, ?????????????. ????????? ?? ????.
2008; 1: 92?100.
6. ???????? ?.?., ????????? ?.?., ???????? ?.?. ????????? ??????????????
????????? ? ?????: ??????????? ??????? ? ??????????? ? ??????????? ???????????? ???????. ???????????? ??????? 2008; 6(1): 31?4.
7. ??????? ?.?. ????????? ? ????????. ?.: ╚?????╩, 2002; 352.
8. ????? ?.?., ????????? ?.?., ????? ?.?., ? ??. ?????????????? ???????? ?
?????. ????????????, 1991; 38?98.
9. ?????????? ?.?., ???????? ?.?. ???????? ?????????????? ????????? ? ????????? ??????? ?????????? ? ??????????. ??????????? 1995; 3: 30?44.
10. ?????????? ?.?., ????????? ?.?., ???????? ?.?. ?????????? ????????????????. ???.: ?????????, 1992; 94.
11. ??????????? ?.?. ???? ????????? ? ?????????? ? ??????????? ???????????? ???????????. ???????????? ??????? 2008; 6(3): 70?6.
12. ?????? ?.?., ??????? ?.?. ??????????? ????????????? ? ?????? ?????????
?? ????????. ??????????? 2000; 1: 62?4.
13. ???? ?., ???????? ??., ???? ?. ???????????. ??? ? ????. ?.?.????????,
?.?.????, ?.?.??????????, ?.?.???????. ?.: ???, 2000; 592.
14. ?????? ?.?., ????????? ?.?., ????? ?.?. ??????????? ???????????: ??????????? ??? ??????. ???.: ?????, 2001; 576.
15. ?????????? ?.?., ???????? ?.?.. ??????????? ??? ?????. ???., 1998; 156.
16. ???????? ?.?. ???????? ??????? ? ?? ???????: ??????????? ??? ??????.
???., 1998; 113.
17. Billiau A. Interferon-? in autoimmunity. Cytokine & Growth Factor 1996; 7: 25?34.
18. ??????? ?.?. ?????????????? ?????? ??????????? ??????. ?????????? ?????? ?????????? ???????? STATISTICA. ?.: ????? ?????, 2006; 305.
?????????? ? ?????????:
?????????? ????????? ??????????????, ???????? ??????????? ????,
?????? ??????? ???????????? ????????
????????? ??????????????? ??????????? ????????
?????: 620102, ????????????, ??. ?????????????, 189
???????: (343) 266-9629
???????? ???? ???????????, ???????? ??????????? ????,
?????????? ???????????????? ????????????
???????-???????????????? ??????
?????: 620102, ????????????, ??. ???????????, 38
???????: (343) 257-9524
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????????? ??????
??????????? ????????? ????????????????
??????? ???????? ?????????????
?.?.????????-???????
??????????? ??????????????? ??????????? ????????
??????????? ???? ???????-??????????????????? ????????? ? ?????????? ???????? ????????????? (???????? ?????????, ????????? ???????? ????????? ? ?? ?????????? ?????). ??????? ??????????? ????????????? ???????????
? ???????? ???????????????? ???????? ???????????????? ??????? ????????????? ? ????????? ?????? ??? ?????????????????????? ???????.
???????? ?????: ???????? ?????????????, ????? ?????, ?????????, ??????????
Modern strategies of pathogenetic therapy
of tick-borne neuroinfections
A.B.Kon?kova-Reydman
Chelyabinsk State Medical Academy
The author studied the role of cytokine-nitroxidergic processes in the pathogenesis of tick-borne neuroinfections (tick-borne
encephalitis, Ixodes Lyme borreliosis and their combined forms). The clinical efficacy of Cytoflavin as a drug of pathogenetic
therapy for neuroinfections has been studied and its nitroxide-modulating effect has been assessed.
Key words: tick-borne neuroinfections, nitric oxide, pathogenesis, Citoflavin
?
??????? ????????? (??) ? ????????? ???????? ?????????? (???) ????????? ? ???????? ???????????????? ???????? ? ????. ????????????? ????? ???????????????? ????????? ? ???????? ????????????? ?????? ? ?????????? ?????? ???????? ? ???. ??? ?????????? ?????????????? ?????? ??????????, ???????? ????? ???????????? ?????????????????? ????????? ?? ?????? ????????????, ???? ???????? ?????? ?? ????????? ?????? ?????
???????????. ? ??????? ?? ????????? ???????? ???????
??? ????????? ?????? ??????????? ? ????????? ??????? ?
??? ??????? ? ?????????? ?????- ? ?????????, ??????????
?????????????, ?????????????, ???????????????? ????????, ?????? ?????. ? ???? ????? ?????????????????? ????????? ????????? ????????????? ? ??????????, ???????? ????????? ??? ????????? ???????????????????? ????????? ???
??????? ????? [1, 2]. ???????????? ???????? ????????????
????? ?????????? ??????????? ??????? ??????????? ??????? ??????? (???), ?????????? ? ???????? ??????? ?????????? ??????, ???????? ?????? ? ????????????????? ??????????, ??????????? ??????? ???????? ??????????? ? ??????????????? ??????????? ????? [3, 4]. ???????????? ?????? ???????????????:
????????-??????? ????? ?????????, ???????? ??????????? ????,
????????? ??????? ???????????? ????????
??????????? ??????????????? ??????????? ????????
?????: 454080, ?????????, ??. ??????????, 64
???????: (351) 772-8388
?????? ????????? 21.01.2009 ?., ??????? ? ?????? 15.09.2009 ?.
???????? ?????????? ??????????? ???????? ???? ? ????????? ????????? ????? [1, 4]. ? ????????? 5 ??? ???????? ?????? ? ???? ???????????????????? ?????????? ????? ?????
(NO) ? ?????????? ??????????? ???????? ? ????????????
???????????????????? ?????????? ?????????????-??????,
???????, ???????? ??? ???????????? ??????????, ???????????? ??????? ???????????????????, ??? ???????? ?????????? ???????????????????? ?????????, ??????????? ? ?????? ?????? [5, 6]. ?????? ???? ? ??????????????????? ???????? ?? ?????? ????? ????????? Ca2+-??????????? ????????
???????? ???????-?????? ?????. ?????????? ????? ????????? ?????? ? ??????? ?????????? ???????? ????????????
??????? ????????? ??????, ???? ???????????? ????? ???????????? ????????? ???????????? ???????????? ??????????????? [3, 7]. ????? ???????, ??????????? ????????? ?????????????? ???????? ? ???:
1. ??????????????? ??????? ? ??? ????????? ??????? ??????????????? ???????? ?????? ?? [5];
2. ?????????????? ??????????? ??????? [4];
3. ???????????? ?????? ? ??????????????????? ?????????
??????? ???????? ? ???? [2, 8].
??????????? ?? ????????????? ???????, ??????????
NO-????????????? ??????????, ????????? ?? ?????? ????????????????? ???????????? ? ????????????? ?????????. ? ??
?? ????? ??? ?????? ????, ??? ?????????? ??? ?????????? ??????? NO-?????, ??? ? ??????????? ????????? ?????? ?????
????? ???????????? ????? ????????????? ?????????????????????? ????????? [6, 9]. ??????????? ??????????????? ????-
35
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.????????-??????? / ???????????? ???????, 2009, ?. 7, ?3, ?. 35?39
?????, ???????????? ?? ????????? ???????????????, ????????? ?????????????? ?????????? ??????, ?????????????? ???????? ?????????, ?????????? ?????????????? ? ????????????? ??????? ?? ???? ????????? ??????????? ???????????????
??????. ??? ??????????????? ? ????????? ????? ??? ??????????? ? ??????? ???????????? ?????? ??????????????.
???? ????????????: ???????? ??????????? ?????????????
??????????? ? ???????? ???????? ???????????????? ???????
???????? ????????????? ? ?????? ??? ?????????-????????????? ???????.
???????? ? ??????
??? ??????????? ?????????? 70 ??????? ? ?????????????
????????????????? ???????????? ??????? ???????? ?????????????: 42 ??????? ?????????????? ??????? ??, 8 ??????? ? ????????? ??????? ??, 15 ??????? ? ??????? ???????? ?????-????????? (??) (????????? ???????????? ??? ????????? ???? ??? ? ?????????????? ? ????????? ???????
??), 5 ??????? ???????????????? ? ???????? ?? 28 ?? 60 ???.
????????? ? ?????? ???????????? ??????????? ???????
?????????? ????????????. ??? ??????? ???? ????????? ??
2 ?????? (?? 35 ???????): ???????? ?????? ? ????????, ?????????? ???????? ??????? + ??????????????? ??????????????? (??????????); ?????? ????????? ? ?????????? ?????? ???????? ???????. ??????????? ?????? ????????? ???????? ?????? (n = 30). ?????????? (??? ???? ╚???????╩, ??????)
???????????? ????? ??????? ??? ????????????? ????????, ????????? ? ?????????????????????? ?????? ??????????????
???????. ???????? ?????????? ?????????: ??????? ???????? ?
100 ??, ??????????? ? 10 ??, ???????? ? 20 ??, ???????????
????????????? ? 2 ??.
???????????? ???????????? ??????????? ??? ?????????
????????? ? ?????? ???????????? (1?3-? ???), ????? ?????????
??????? (8?10-? ???) ? ?? 16?18-? ???? ?? ?????? ???????. ?????????? ??????? 1 ??? ? ??? ????? ??????????? ????????
(????????) ?? 10,0 ?? ?? 200 ?? 5% ???????? ??????? ? ??????? 7 ????. ????? ??????? ???????? ??????? ??????? ? ????
?????? ??????????? ?????????? ? ??????????? ?? ?????????
(??????????????? ??????????????, ????????? ??? ??, ??????????? ??? ??????????????? ? ??), ??????????? ???????
(5% ??????? ???????, 0,9% ??????? ?????? ???????, ??????????????), ????????????????? ??????? (????????????, ?????????). ??????????? ?????? ???????? ??????????????? ?????????, ???????????????????? ????????????, ????????? ??????????? ???????. ? ???????????? ?????????????? ?????????
??????????????? ?????: ?????????? MMSE (????????-????????????????), ????? C????????-??????, ????-???????? ???????. ?????????????? ?????? ?????????? ?????? ????? ????????? ????????????????????? ??????? ? ??????? ???????
?????? ? ??????????? ??????? ?.?. ?? ?????????? ?????????? ???????? ?????????? ??????????? ?????? ?????. ?????????????? ??????????? ?????????????? ??????? ????????????????? ??????? (???) ??? ????????? ????????????? ??????? ??????? ???????????????? (Ig) M ? G ? ?????? ?? ? ?????????????? ????-?????? ??? ╚??????-????╩ (?. ???????????). ??????????? ??? ??????????? ??????? ??? ??? ????????????? ????-??????? ╚Helex╩ (?. ?????-?????????) ? ??????? ???????????? ?????? ??????? (???) ????-?????????
36
╚?????-????-???-?????╩ (??? ╚??????-????╩, ???????????)
? ╚?????-????-??╩ (??? ╚??????╩, ?????-?????????).
?????????????? ????????? ????????? ????????? ????? ?????????? ??????? ?????????????? (M), ?????? ???????
?????????????? (m), ???????? ????????? (t), ?????????????
???????? (p). ????????? ?????????? ?????? ??????????? ?
????? ??????????? ?????? Ex?el ????? Microsoft. ????????
???????????? ????????????? ?????????????? ???????????
????????? ? ?????????????? ???????? ????????????????????. ? ?????? ?????????? ????????????? ?? ??????????? ???????????? ????????????????? ???????? ???????????, ??????????. ? ???????? ???????????? ?????? ? ???? ???????
(Me) ? ???????????? ??????? (QL?QU).
?????????? ???????????? ? ?? ??????????
???????????? ????? ? ???????? ???????? 89,6% ??????? ?????????? ??????? ???????? ?????????????. ????????????? ?????? ?????????? ? ??????? ????????? ?
?? 2 ?? 30 ???, ? ??????????? ??????? ?? ???????? 2 ???
? ? ??????? ????????? 9,1 ╠ 2,4 ???. ????????????????
??????? ?????????? ?????????? ?????????? ? 81,4% ??????? ?? ? 90% ??????? ??, ???????????? ???????? ????????????? ?????? ??????? ??????????????? ? ??????? ??
? ?? ? ?????????? ??? ?? ????? 2-? ????? ????????????
???????. ???????????? 1-? ????? ?????????? 2?10 ????,
2-? ? 2?17 ????, ????????????????? ????????? ????? ???? ???? ? ??????? 7,3 ╠ 0,4 ???. ?????? ???????? ??????????? ?????????? ????????? ??????? ??????? ? ???????
????????? ??????????????? ??????????? ? ????. 1. ?????????????? ???? ???????? ????????? ???, ??????????????? ? ???? ????????????? ???????? (71,4%). ? 14,2%
??????? ??????????? ???????? ?????????? ??? ????????? ????????? ????????? ?????. ??? ???? ????? ??????????? ????? ???????????????? ????????? ?? ???? ???????
?????????? ???????????? ?????????, ????????????????? ???????? ?????, ???????????? ??????, ? ????? ????????? ???????? ??????????? ???????? ?? ??????????? ?? ????. ???????? ???????????? ? 3,3% ??????? ????????????????? ????????? ??????????? ???????????? ????????? ??
????????? ???????? ???? ?? 2 ?? 4 ??????. ???????????
????????? ? ???? ???????, ??????????????? ???????? ???????????? ? 2 ???????. ? 1 ???????? ???????????????????????? 1. ?????? ???????? ??????????? ?????????? ????????? ??????? ??????? ? ??????? ????????? ???????????????
????????
???.
%
?????????????
50
71,4
?????????????????,
10
14,2
? ??? ????? ????????? ????????:
???????????
4
5,7
?????
2
2,8
????
0
?
??????????? ?????? ? ????????
2
2,8
?????????????
1
1,4
????????????????? ???????
2
2,8
??????????? ??????????
???????? ????? (VII)
1
1,4
??????????? ????????????
2
2,8
????? ?????? ? ????????
1
1,4
?????????????? ??????????
2
2,8
?????????? ???????
1
1,4
?????:
70
100
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
??????????? ????????? ???????????????? ??????? ???????? ?????????????
??????? 2. ???????? ?????????????? ? ????????????? ?????????? ??????? ? ??????? ????????? ???????????????
??
???
??
p
(n = 50)
(n= 5)
(n = 15)
KS
MU
KS
MU
KS
Me
QL-QU
Me
QL-QU
Me
QL-QU
1?2
1?2
1?3
1?3
2?3
?????, ? 1 ???
107,0
57,0?183,0 360,0
21,0?853,0
127,0
69,0?276,0
p < 0,025
0,136
p > 0,10
0,423 p > 0,10
??????????
9,0
5,0?20,0
12,0
11,0?30,0
19,0
8,0?32,0
p > 0,1
0,364
p > 0,10
0,128 p > 0,10
?????????
91,0
80,0?95,0
88,0
70,0?89,0
81,0
68,0?92,0
p > 0,0
0,373
p > 0,10
0,122 p > 0,10
?????, ??/?
522,5 321,5?655,0 562,0
200,0?980,0
735,0
515,0?1153,5
p > 0,1
0,755
p > 0,10
0,066 p > 0,10
???????, ?????/? 2,70
2,3?3,16
52,30
2,20?3,00
2,55
2,25?3,15
p > 0,1
0,370
p > 0,10
0,768 p > 0,10
???????, ?????/? 120,0 118,0?122,0 24,0
122,0?125,0
120,0
117,6?124,0
p > 0,1
0,091
p > 0,10
0,940 p > 0,10
????? ? ? ???????? 3 ? 4: KS ? ???????? ????????????????????, MU ? ???????? ???????????.
?????? ?????? ?? ???????? ???? ????????? ?????. ???????????? ???????, ????????? ? 2 ??????? (3,3%) ????????????????? ??????????????? (1) ? ????????????? (1) ???????????. ??????? ?????? ????????? ? ??????????? ???????
??????????????? ???????????? ????????? ?????????????? ????????. ???????? ?????????????? ? ?????????????
?????????? ??????? ? ??????? ????????? ??????????????? ? ??????????? ?? ????????? ???????????? ? ????. 2.
?????????????? ????????? ? ??????? ?????????????????
????????????? ???????????. ??? ??????????????? ? ??
???????????? ????????? ? ????? ???????? ?????? (Me 360
? 127 ? 1 ??? ???????, ??????????????). ?????????? ?????
? ??????? ? ??????? ??, ??? ???????, ?? ???? ???????.
???????? ????????? ? ????? ???????? ?????? ????? ?
??????? ???????????????? ? ?? (Me ?? 562 ?? 735 ??/?).
? 1 ???????? ?? ??????????? ???????-????????? ???????????. ????????? ?????????????? ??????? ??????? ????
???????? ???????????????? ?????????? ??? ??????????-
?U
2?3
0,221
0,894
0,894
0,355
0,635
0,230
?????. ? 1 ???????? ??????????? ????????? ???????? ????? ?? ??????????????? ????. ????? ??????????? ???????? ??????????? ????????? ?????????????? ??????? ??????? ?????? ??????????? ? ???? ???????????????????? ?
???????? ???????????, ?????? ????????????????? ??????????????? ???????? ? ????????????? ??????. ??? ???????????????????? ????????????? ? 2 ??????? ?????????? ??????????? ????????????????? ??????????. ? ????
??????? ??????????? ? ???????????? ????????????, ??????????????? ? ???? ???????, ??????? ???? ? ???????????
? ??????? ?????????? ??????? ???????????. ??? ??????????? ????? ??????????? ???? ?????????????? ? ??????? ???????????????? ??? ?????? ????????? ??????
(???, ???). ??????????? ??? ???????????? ??, ??? ? ???
????????? ? ??? ?????????????? ?????????? ?????? ????????????? IgM ? IgG ? ????????. ??????????? ????????
???????????????? ??????????? 3-??????? ??????????????
????????????, ??? ??? ? ???????, ?????????? ???????????
37
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.????????-??????? / ???????????? ???????, 2009, ?. 7, ?3, ?. 35?39
??????? 3. ?????? ?????????? ???????? ?????????? ??????????? ?????????-???????? ? ???-? ? ?????????? ????? ?????????
? ????????? ??????? ???????? ????????????? ? ? ???????? ???????
?????? ?????? ?????? ???????????????? ????????
????????????? ???????
(n = 70)
(n = 35)
(n = 30)
?????? ??????
?????? ????????????????
Me
Me
Me
?(KS)
p(MU)
?(KS)
p(MU)
QL-QU
QL-QU
QL-QU
???-?, ??/??
12,27
13,73
0,32
<0,001
0,153
<0,001
<0,152
0,00?19,56
0,00?22,70
0,22?0,40
NO2, ??????/?
5,14
3,35
3,70
<0,001
<0,001
>0,10
0,682
4,15?7,25
2,30?5,70
3,20?4,04
NOX, ??????/?
28,40
20,10
13,40
<0,001
<0,001
<0,001
<0,001
24,60?33,97
17,30?22,70
11,34?14,40
NO3, ??????/?
22,55
15,45
9,30
<0,001
<0,001
<0,001
<0,001
18,44?28,20
14,00?18,50
8,30?10,50
NO2 ? ???????, NO3 ? ???????, NOX ? ????????? ?????????? ?????????-????????
? ?????? ??? ???????, ?????????? ????????? ?????????
?????????? ????????????. ??????? ??? ??? ????????
???????????? ? 40% ??????? ??? ???????????? ????? ? ?
20% ? ??? ???????????? ???????.
?????????? ???????????? ????????, ??? ?????????? ???????? ???????? ?????????????? ????????? ?????????? ???????????????????, ???????????? ?? ???????????? ?????????? ???????????? ???????? ?????????? ??????????? ?????????-???????? ? ????? (????. 3). ???????? ??????????????
????????? ????????? ??????????????????? ???????????
(NO2, NO3, NOx) ??????????????? ? ????????? ? ?????????
??????? ? ????????? ?????????? ????????? ??????????? ?????? ?????. ??? ??????? ?? ????. 3, ? ???????? ???????? ???????
?? ??????????? ??????? ?????????????? ????????? ??????????????????? ???????????, ????????????? ? ?????? ????????
???????. ?? ?????? ??????????, ?????????? NO ? ??? ???????? ??????????? ???????, ?????? ?????????, ?????????, ?
????? ????????????? ???????. ???????? ????????, ?????????? ???????????? NOS, ????? ?????? ???????????, ??? ??????????? ??? ??????? ??? ????????????? ? ???????? ?????????? ??? ?? ????????? NO. ????????????? ??? ???????
????????? ? ???????? ???? ?????????????????? ? ??????????????? ??????, ??????? ???????? ??????? ? ?????? ?????????? ?????? [6, 9, 10]. ????????????? NO-??????? ? ????? ??????????? ?? ?????????????? ? ???????. ?????? ?? ?????? ???????????? ??? ???????????? ????????? ?????????, ???????
??????? ????????-? (???-?), ???????????-? (???-?). ????????????? ????? ?????? ?? ???????? (??? ??????????????
??????? ??????????????) ???????? ?????????? i-NOS ? ??????????? ????????? NO ? ?????? ?????????????? ?????????? ????? (NO-, ONOO-) ? ???????-????????. ???-? ??? ??????????? ????????? ????? TNFR1 ?????????? ??????????
i-NOS. ??? ???? ????????????? ??????? ?????????? ??????
????? ? ?????????? ?????????????? ?????? ?????? [2, 3].
??????? 4. ???????? ?????????? ??????????? ?????? ????? ?
?????????? ????? ??????? ????????? ??????????????? ?
???????? ??????? ????????????
??????????
???????? ??????
?????? ?????????
? (?????? ????
(n = 35)
(n = 35)
??????????)
Me
Me
QL-QU
QL-QU
NO2 ??????/?
2,70
3,35
0,001
1,90?2,95
3,30?4,60
NOX ??????/?
18,00
24,50
18,00?22,60
20,40?28,40
0,006
NO3 ??????/?
13,29
15,45
15,70?20,30
15,20?18,80
0,075
38
? ????. 3 ???????? ?????????? ???-? ? ????????? ???????
???????? ?????????????. ??? ??????? ?? ???????, ? ??????? ? ?????? ??????? ? ??????? ???????????????? ??????????? ??????????? ????????? ?????????? ???-? ?? ????????? ? ??????? ????????.
???????? ??????????????????? ??????????? ? ????? ??????????? ??????? ???????????? ? ????. 4. ??? ??????? ?? ?????????? ?????? ???????, ?????????-?????????? ???????????
??????????????? ??????????????? ??????? ????????????
??????? ? ???????????? ?????????? ??????????? ?????????????????. ?????????? ????????????? ?????????? ? ?????? ????? ??????????. ???????????????? ??????????? ????????
??????? ?? ???????? ???????? ?? ?????????-??????????? ?????????? ???????????? ?????????????? ???????? ?? ??????? ???????????? ??????????? ? ??????? 2-? ??????, ??? ????????? ??????? ????? ?? ???????????? ??????? ??????????? ?? ????????? ??????????? ?????? ?????.
???????? ?????????? ??????? ????????????? ??????? ????????????. ???????? ??????? ?? ???? ????????. ????????
???????????? ????? ??????? ?? ???? ??????? ????????????
????????? ? ??????? 5. ?????? ???????? ???????? ???????????? ????????? ??????????? ???????????????? ? ??????? ???????????? ???????? ????, ???????? ? ?????????? ?????????????????. ? ????? ??????? ? ??????????? ??????? ???????????????? ???, ?????????? ????????????????. ? ??????? ??
8-? ???? ????? ?????????? ??????? ??????????? ??????????? ?????????? ????????? ? ???????? ???????????? ???????????? ? ?????????? ?????????????? ?????????????????, ? ?
18-?? ??? ??????????? ??????? ? ???????????? ????????
?????????????? ? ?????????????? ?????????? ???????????.
? ??????? 6 ?????????? ?????????? ?????????????????????
???????????? ????????? ? 2 ??????????? ???????. ??? ??????? ?? ?????????? ???????, ? ?????? ?????????, ??????????
??????? 5. ???????? ???????????? ????? ??????? ? ???????????? ?? ???? ??????? ???????????? (%)
??????
?? ???????
?? 8-? ????
16-?
???????
???? ???????
???????? ????
70,0 ╠ 6,8
26,6 ╠ 8,11
10,2 ╠ 4,81,2
????????
60,0 ╠ 8,8
20,0 ╠ 7,211
11,0 ╠ 6,01
?????????????????
25,5 ╠ 7,1
13,0 ╠ 1,61
5,3 ╠ 3,51
????????? ???
66,2 ╠ 8,6
33,0 ╠ 8,51
12,4 ╠ 6,81,2
???????? ??????
33,0 ╠ 8,3
10,0 ╠ 5,41
10,0 ╠ 5,31
????????
50,0 ╠ 0,1
26,6 ╠ 8,1
12,0 ╠ 6,01
?????????????????
1 ? ????????????? ??????????? ???????? ? ???????????????? ????????????
?? ???????;
2 ? ????????????? ??????????? ???????? ? ??????????????? ???????????
????? 8-?? ? 16-?? ???? ???????.
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
??????????? ????????? ???????????????? ??????? ???????? ?????????????
??????? 6. ?????????? ????????????????????? ????????????
????????? ? ???????????? (?????)
?????
????????
??????
p
??????
?????????
???? MMSE
28 ╠ 0,4
25 ╠ 0,7
< 0,05
?????????
14,44 ╠ 0,68
17,37 ╠ 0,44
< 0,05
????????????
13,56 ╠ 0,45
11,41 ╠ 0,24
< 0,01
/???????????
????
1,7 ╠ 0,16
2,52 ╠ 0,14
< 0,05
?????????? ???????
27,6 ╠ 1,94
28,73 ╠ 1,52
> 0,5
?????????? ???????
35,57 ╠ 2,29
46,25 ╠ 1,29
< 0,01
???? ???????? ? ?? ???????????????? ?? ????????????. ? ???????????? ? ?????????? ? ???????????? ????????????
????-?????????? (????????????) ??????? ??? ? ??????????????? ??????????? [8, 11].
????? ???????, ????????????? ??????????? ??? ????????
???????????????? ????????? ? ????? ????????? ?????????????? ?????? ????? ? ??????? ????????? ???????????????
???????? ??????????????? ????????????.
??????????
??????? ???????????, ???????? ??????????? ?????????????? ???????? ? ??????????? ????????-????????????????? ????? (MMSE), ??????????, ?????????? ??????? ? ????? ????????????/???????????.
??????????? ????????? ?? ?????????? ?????????-???????? ????? ???????? ??? ????????, ? ??????? ?????? ????????? ????????????????? ?????????. ???????? ? ??????? ??????????????? ??????????, ??????????? ?? ??????????????? ???????????????? ?????????. ????????-????????????????, ??????? ????????? ? ??????????? NO, ????????? ??????????? ?????????????? NOS ????? ???? ????????????
????? (Gi). ?? ??????? ????????, ??? ???????????? NO-??????? ???????? ???????????? ????? ?????, ??????? ????? ?????????? ???????? ???????????, ? ?? ????? ??? ?????????????? NO-c?????? ???????? ????????? ????????????? ? ???????? ??????????????. ????????, ??? ?? ??? ? ???????? ???????, ???????????? ?????????????? ??????? NMDA-?????????? ? ???????????? ?? ??????????????????, ???????????
??????? Ca ? Na ? ??????? ? ????. ????? ???????? ???????
???????? ?????? ???????????? ????? ????? ?????????????
??????, ??????????? ????? ???????, ??????????? ??? ??????? ?????????????????? (???) ? ?????-????????????? ??????? (????). ?? ?????? ??????????, ???????? ????? ?????? ????????? ? ??????? ??????? ??? NO, ??? ?? ?????????
1. ?????????? ?.?. ???????? ??????????. ?., 2004; 256.
2. ????????? ?.?., ???????? ?.?. ????? ????? ? ?????????? ??????????? ?????,
????????????? ???????????????? ????????? ?????????. ???????? 1998; 63(7):
1020?7.
3. Brady T.S., Chang L.Y., Day B.J., et al. Extracelluar superoxide dismutase is upregulated with inducible nitric oxide synthase after NF-kappa ? activation. J Physiol 1997;
273(5): 1002?6.
4. Downen M., Amaral T.D., Hua L.L., et al. Neuronal death in cytokine-activated primary human brain cell culture: role of tumor necrosis factor-alpha. J Glia 2003; 28(2):
114?27.
5. ?????? ?.?., ??????? ?.?., ???????? ?.?. ? ??. ??????? ??? ???????? ??????????????? ???????? ?????? ????????? ??????????. ??????? ??????????? 1997;
4: 182?6.
6. Muscara M.N. et al. Theurapeutic potential of nitric oxide donors and inhibitors. Am.
J Physiol. 1999; 276: 1313?6.
7. Kendell E., Swartz J. Principles of Neural Sceinces. Apltton and Lange 2000; 1134.
8. ????????? ?.?. ?????????? ? ??????????? ???????. ???., 2005; 35.
9. Katsuama K., Kato N., et al. Dexametazoni inhibits i-NOS NF kappa B and mRNA iNOS expression. Endocrinology 1999; 140 (5): 76?8.
10. ???????? ?.?. ???????? ????????????? ???????????? ???????. ????????????,
2003; 18.
11. Clarck D. et al. Curculation of energy metabjlism in brain. In Basic N?urochemistry
1994; 5: 645?81.
????????????? ??????????? ??????
??????????? ? ???????????? ??????????????? ?????
? ???????????? ??????????????: ?????????? ????-???????
????????????? ?? ?????? ??????? ????-?????? ? ????? ??????????, ???????????? ?? ?????????? ???????????? ??????????????? ???????????? ? ???????? ???????????? ?????????????? ??? ??????????????? ??????? ??????? ????????
? ??????????????? ????? ?? 34-? ?????? ? ?????.
??? ?????????, ?????????? ???????????? ???????? ? ??????????????? ???????????? ??? ??????????????? ???????
??????? ???????? (p < 0,01), ?? ?? ??? ??????????????? ?????. ??????? ???????????? ???????? ???????????? ????????
????????? ? ????? ???????; ????? ????, ?????????? ????????? ???????? ??????? ????????????? ??????? ? ??????????????
???????????? ?????????????? ???????????? ??? ?????????? ???????????? ??? ??????????????? ??????? ??????? ????????. ?? ???? ?????????? ???????????? ??? ??????????????? ??????? ??????? ???????? ?????????? ???????? ???????
????????????? ?????????????????? ????????????? ???? ???????? ???????. ????????????? ????????????? ???????????? ??
?????? ?? ?????? ??????????? ? ???? ????-??????? ?????? ? ?????????????.
Hutzal C.E., Boyle E.M., Kenyon S.L., et al.
Use of antibiotics for the treatment of preterm parturition and prevention of neonatal morbidity: a metaanalysis.
Am J Obstet Gynecol. 2008; 199(6): 620.e1?8.
http://antibiotic.ru
39
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????????? ??????
?????????? ?????????????? ????????????
????????????? ? ???????????? ??????????
???????????-????? ? ????????????? ? ?????,
??????? ??????? ??????????????
????????? ??????????
?.?.???????1, ?.?.???????2, ?.?.?????????3, ?.?.??????????1
??????????? ??? ????????????? ????????????????, ??????;
?????????? ??? ????????????? ? ????????????? ??. ?.?.?????????????;
3
?????????? ????????? ??????-????????????????? ??????????? ???????? ??. ?.?.?????????????
1
2
????????? ??????????????? ???????????-????? (???-?) ? ????? ????????????? ??? ??????????? ???????? ???????? ??????? ??????????????? ? ??????? ?????? ????????????? ???????? ???????? (????) ? ?????. ? ?????? ???????????? ?????????? ?????????????? ???????? ????????????? ? ???????????? ????????????? ?????????? ???????? ????
(??? ╚??????╩, ??????) ? ????????? ????????? (???????????? ? ???-?, ?????????? ? ? ?) ? ??????? ????
? 60 ????? ? ???????? ?? 2 ?? 6 ???. ??? ????????????? ????? ?????????? ?????????? ???????????? ??????????? ????, ???????????? ????????? ????? ????????????, ?????????? ??? ??????????? ??????????? ???????. ????????
???? ? ???????? ????????? ????????? ?????? ?? ??????? ???????? ????????? ????, ??? ???? ???????? ???????? ????????? ??????????? ?????????? ??? ?????????? ????????? ???? ???? ????? ??????????. ?????????? ???????????? ???? ???? ????????????? ? 80% ??????? ??? ?????????? ????????? ???? ? ? 53% ??????? ? ??? ??????????
????????? ?????????. ???????????? ???-? ?????? ???????????? ????? ??????, ???????? ??????? ?? ?????????. ????? ???????, ? ?????? ???????????? ???? ???????? ??????? ????????????? ? ??????? ????????????? ?????????
???? ??? ??????? ???? ? ????? ??????????? ????????.
???????? ?????: ???????? ????, ?????? ????????????? ???????? ????????, ??????????-?????,
????????????, ????, ??????????????? ??????????
Results of a comparative study of the efficacy and safety
of interferon-alpha in suppositories for treatment
of acute respiratory viral infections in children
A.V.Gorelov1, N.M.Gracheva2, L.V.Feklisova3, O.O.Pogorelova1
Central Research Institute of Epidemiology, Federal Supervision Service for Control of Consumer Rights Protection
and People?s Welfare, Moscow;
2
G.N.Gabrichevsky Moscow Research Institute of Epidemiology and Microbiology;
3
M.F.Vladimirsky Moscow Regional Research and Clinical Institute
1
Preparations of recombinant interferon-alpha (IFN-?) in the form of suppositories for rectal introduction are widely used in therapy of acute respiratory viral infections (ARVI) in children. The work presents the results of a comparative study of the efficacy and
safety of the Russian drug Genferon Light (ZAO BIOKAD, Russia) and a reference drug (suppositories with IFN-?, vitamins C
and E) for treatment of ARVI in 60 children aged from 2 to 6 years. The use of the both drugs brought about normalization of the
body temperature, disappearance of the symptoms of general intoxication, a decrease or arrest of catarrhal inflammations.
Genferon Light and the reference drug equally influenced the frequency of the regress of ARVI symptoms; the dynamics of the
regress of particular clinical manifestations (signs of tonsillitis) when using Genferon Light was more marked. Elimination of the
infectious agents of ARVI was recorded in 80% of cases when using Genferon Light and in 53% of cases ? of the reference drug.
IFN-? suppositories showed good tolerance in all children, no side reactions appeared when using both drugs. Therefore, the
study demonstrated a high efficacy and good tolerance of Genferon Light for treatment of ARVI in preschoolers.
Key words: Genferon Light, acute respiratory viral infections, interferon-alpha, suppositories, children, antiviral activity
??? ???????????????:
??????? ????????? ??????????, ?????? ??????????? ????, ?????????,
?????????? ??????????? ??????? ???????????? ?????????
???????????? ??? ????????????? ????????????????
?????: 111123, ??????, ??. ??????????????, 3?
???????: (499) 182-0992
?????? ????????? 15.06.2009 ?., ??????? ? ?????? 15.09.2009 ?.
40
?
????? ????????????? ??????????? (???), ? ??? ?????
?????? ????????????? ???????? ???????? (????),
???????? ????? ?????? ???????????? ?????????? ????????.
? ?????????????? ????????? ???????? ??? ??? ????? ????
???????????? ????????? ?????????? ?? 90% [1?3]. ???????????? ?????????????? ???? ?????????? ? ????? ? ???-
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????????????? ? ???????????? ?????????? ???????????-????? ??? ??????? ???? ? ?????
????? ?? 6 ??? ?? 6 ??? ? ?????????? ? ??????? ?? 4 ?? 6 ???????? ? ??? [4, 5]. ??????? ????????, ??? ???? ? ?????, ???????? ??????? ????????, ??????? ??????????????? ???????
???????? ? ? ???? ??????? ????????? ? ?????????? ???????????? [6, 7].
????????? ????????????? ??? ? ????? ???????? ????????? ????????????? ??????, ?? ???? ??????? ?????????? ??
65?95% ???? ?????? ???????? ??????????? ?????. ???????????, ??? ????????? ??????????????? ???????? ???? ???????? ?????? ?????? ? ??????????, ????????????-????????????? ?????, ????-, ?????- ? ????????????. ???????? ??
????????? ?????????, ???? ????? ????? ?????? ? ?????????????, ?????????? ? ??????????? ???????????? [5, 6].
? ????? ??????? ???????? ????? ??????????? ? ?????????? ???????????????????? ??????? ??????????? ??????? ??? ???? ?????? ?????????. ??????? ??? ???? ? ????? ???????????? ??????????????? ????????? ????????
??????? ????????, ?????????? ??? ?????????????, ??? ?
??????????????? ?????????. ? ??? ????????? ?????????
???????????.
??????????? ?????????????? ?????????? ???????? ????????? ? ??????????? ?? 3 ???? (?, ?, ?). ???????? ??????
??????????? ? ??????????? ???????? ??????????-? (???-?)
????????? ? ????????? ???????????? ?????????. ?? ?????????? ????????-?????????????? ??????? ???????? ???????,
?????????, ????????? ????????? ??????? ?-???????????, ?
????? ???????? ?????????? ??????? ???????? ?????????
?????????????????? 1-?? ????. ??????????????? ??????
??? ??????????? ?????????? ????? ??????????????? ?????????, ??? ????????????? R, 2'-5'-???????????????????? ?
????? Mx, ??????? ????????? ?????? ???????????? ???????? ?? ?????????? ??????? [8, 9]. ????? ????, ??? ????????
? ???????? ???????? ?????????? ?? ???? ????????? ??????????, ???????????? ?? ???? ????? ????????? ????????; ??????????, ????????? ?????? ???????????? IgA [10, 11]. ????????? ?????????? ????????????????, ?????????????????, ??????????????????? ????????? ???-? ????? ??????? ?????????? ??? ????????? ???????????? ???????????? ? ????? ? ????????.
????????? ??????????????? ???-? ? ???? ????????????? ?????? ??????????? ? ?????, ??????? ? ??????? ??????????????? [12]. ???????????? ???-? ????? ??? ??????????? ????? ???????????? ????????? (??????????????, ?????? ??????? ???????? ???????, ? ????? ????????
??????????? (????? ?????????????? ? ????????? ?????)).
??????????? ???????????? ????????????? ? ???-? ???????? ??????? ????????????? ?? ?????????? ? ???????
??????????? ??????? ???? ? ??????? ??????? ? ?????
???????? ?????. ??? ?????????????????? ? ??? ?????????? ???????????? ?????????? ?????? ???????????? ??????????? ????, ????????????????? ????????????, ??????,
????????? ?????? ? ?????, ???? ??????????? ??????????
???? [13]. ????????? ???-? ????? ?????????? ??? ???????????? ???? ? ?????, ??????? ? ????? ??????? ??????? ??????? [4, 14, 15].
???????? ???? (??? ╚??????╩, ??????) ????????????
????? ???????? ??????????????? ???-? ? ????? ?????????? ????????????? ? ???????? ???????? ?????? ???????????? ? ?????? ? ?? ??????? ????????? ????????. ?? ???
?????? ? ????? ?????????? ??? ? ????? ?????????????? ????????? ????????? ? ????? ? ?????????? ??????.
???????????? ????????? ???? ??????????? ????????????? ??????? ??? ????????????? ?????. ???, ?????????????? ??????????? ????????, ?????????? ? ??? ?????? ? ?????? ? ???????? ????????????? ?????? ???????? ???-?
?? ???? ??????????????? ??????? ? ???????? ???????????
???????????? ??????. ?????????? ? ???????? ?????????
???????????? ??????? ????????? ???-? ? 125 000 ??.
???????? ????, ? ??????? ?? ???????? ?????????, ?? ???????? ??????????, ??? ??????? ???? ????????????? ????????????? ????????????? ???????. ????? ????, ? ???????
?? ?????? ????????????? ? ???-?, ?????????? ? ????????
?????? ????? ?????, ? ??????? ????????? ???? ?????????? ??????? ???, ??????? ???????? ?????? ???????????
???????????. ????????????? ??????????? ?????????
???? ???????????? ??? ????????????? ??? ??????? ?????????? ???-? ? ??????? ?????????????. ????? ? ??????????? ????????????? ???? ???????? ????????????? ?
???????????? ?????????? ????????? ???? ??? ???????
?????????????? ???????? ? ?????????? ? ??????????
?????? [16]. ???????? ?? ???????? ???????????? ?????????? ???-? ? ???????, ?????????? ????????? ????????
???? ??? ??????? ???? ? ????? ?????????????? ??????
?????????????.
????? ?????????? ???????????? ???? ???????? ??????????????? ????????????? ? ???????????? ????????? ???????? ???? ? ??????? ??????????? ??????? ???? ? ????? ?
????????? ????????????? ????????? ???????? ???? ? ?????? ?????????? ???-? ? ?????????????*.
???????? ? ??????
?????? ??????????? ????????? ???????? ????????,
?????????????, ????????????????? ????????????? ?????????????. ??? ??????????? ?? ???? 3 ???????: ???????????? ??? ?????????????, ??????????? ??? ????????????? ? ????????????? ??. ?.?.?????????????, ??????
??. ?.?.?????????????. ?????????? ??? ??? ??????????
???????? ?????????? ??????????? ?????? ?? ??????? ?
????? ??????????????? ? ??????????? ???????? ?107
?? 26 ????? 2009 ?.
? ???????????? ??????????? 60 ????? (42 ???????? ?
18 ???????) ? ???????? ?? 2 ?? 6 ??? (??????? ? 3 ????), ???????????? ?? ???????????? ??????? ?? ?????? ????, ? ??????? ???????? ????????? ?? ??????, ??? ?? 2 ??? ?? ??????????? ? ?????????. ????????? ????????? ????????? ?
????????? ? ????????? ??????????? ????????????. ?????
?????????? ?????????? ????? ????????????? ???????????????? ????????, ??????? ????????? ? ????????????.
???? ??????? ??????????? ???????????????? ??????? ?
??????????? ?? ???? ? ???????????? ????????? ???? (???????????????? ????? ? ???, ?????????????? ????????,
????????), ?? ?????????? ? ????????????????? ???????.
??????????? ???????? ???????????? (????? ?????????), ?
*? ???????? ????????? ????????? ?????????????? ?????, ?????????? ?????????????? ???????????? ???-?2b 150000 ??, ???????????? ???????, ?????????? ??????, ?????? ????? ????? ? ??????? ???.
41
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.??????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 40?47
??????? 1. ??????????? ?????????????? ???????
????????
???????? ?????? ?????? ?????????
?*
???????????
(n = 25)
(n = 35)
???.
%
???.
%
????? ????????
21
84
23
66
>0,05
(???????, ????????
????????, ????????
????, ??????????)
?????????? ???????
25
100
35
100
???**
??????????? ?????
(?????, ??????,
???????????? ????)
?????????? ??????
16
64
20
57
>0,05
??????????? ?????
(??????? ???????,
????? ? ??????)
????????? ????, ??????
25
100
35
100
???
?????????? ?????????? 13
52
16
46
>0,05
?????????? ????????
20
80
25
71
>0,05
????????????
1
4
1
3
>0,05
????
3
12
4
11
>0,05
????????? (??????????? 22
88%
26
74
>0,05
???? ???? 37╟?)
*???????? ? ??????? ???????? ????? ???????? ????????? ????????????
??? ? < 0,05.
**??? ??????? ???????? = 100% ?????????????? ?????? ?? ??????????.
?????????? ??????? ???? ???????????? 2 ???????. 25 ?????
????????? ???????? ??????, ?? ?????? ?? ??????????? ???????? ???? ????????? ???????????? ???????? ???? ????????? ? ???? 125 000 ?? 2 ???? ? ??? ? ??????? 5 ????.
? ?????? ????????? ????? 35 ?????, ??????? ?????? ??????????? ??????? ???? ????????? ???????? ????????? ?
???????????? ???-? ? ???? 150 000 ?? ?? ??? ?? ?????.
???????? ????????? ??????? ? ???????????? ???? ??
???????????? ????????? ?????????: ??????? ?? 2 ?? 7 ???,
????????????????? ??????????? ??????? ?? ????? 48 ?,
?????????? ??????? ??????????? ????????? (???????????? 1 ? 2, ????????????, ??? ? ????????? ?????????) ? ??????? 1 ??? ?? ?????? ????????????. ?????????? ?????????? ????: ????????????????????? ? ?????????? ???
??? ?????? ??????????? ?????????, ??????? ??????????????? ?????????????? ? ????????, ???????????????????? ??????????? ? ????? ????????????? ???????????,
??????? ????? ?? ??????? ??????? ?? ?????? ???????????
??????? ????.
???? ??????? ?? ???? ?? ?????????? ??????? ? ?? ????????? ???? ????? ?? ????????? ??????????? ????????????
???????????? ??????? ?????, ? ????? ???????????????????? ???????????? ??????? ?????? ???????????????????
(???) ???????? ?? ???????? ??????? ?????? ??????? ?????
?? ??????? ????????? ???????? ???????????????? ???????????? ???? ? ?????? ?, ?????? ?, ???????????, ????????????-?????????????? ?????? (??) ? ?????? ??????????.
?? ?????????? 5 ???? ??????? ????????? ???????????
??????????? ???????????? ??? ?????? ???????????? ?????
? ????????? ????????? ???????? ??????? ?? ???????????
?????????. ? ????? ?????? ???????? ????????? ????
????????? ??????????? ????????????????????? ???????
(???), ? ??????? ? ?????? ??????????? ??????? ? ???????
????????? ???????????. ????? ?????? ?? ???? ?????????
?????????? ???????? ????.
????? 30 ???? ????? ?????? ??????? ??????????? ?????????? ?????? ??????????? ??????? ??????????? ???????-
42
??????? 2. ????????? ??????????? ? ???????????? ?????????
???????? ?????? ?????? ?????????
(n = 25)
(n = 35)
??????????? ????, ╟? (M ╠ SD)
37,9 ╠ 0,8
37,8 ╠ 1,0
??????? ???????????? ????, ??? (%)
10 (40%)
17 (49%)
???????? ???? ?????? ?????????
(??????? ? ???????????????? ??????) 13 [11?17]*
10 [9?13]
????? ? ? ????.3: *???????? ????? ???????? ?????????? (? < 0,05).
???? ???????? ? ?????????? ????????. ?????????? ???????
?????????? ???? ?? ??????, ????????? ? ??????? ????????? ?????? ???????????? ?????????.
?????????? ????????????? ?????????? ????????? ????
? ????????? ????????? ????: ???????? ???????? ??????????? ????????? ????, ?????????? ??????????? (?? ??????
???), ?????????? ?????????? ???? ? ?????????? ???????.
????????? ???????? ????????? ?????????? 0 ?????? ??
?????? ???. ╚??????????? ???????????? ????????╩ ????????? ??? ????????????? ???????? ?? ???, ? ?????????
??????? ???????????????? ╚?????????? ????????╩.
????????????? ?????????? ??????????? ?? ?????????
??????? ??????? ????????????? ???????. ??????????????
?????? ?????? ?????????? ? ??????????? ??????? ???????????? ?????????? ? ?????????????? ???????. ?????????????? ??????????????? ?????? ?????? (t-???????? ?????????) ??? ??????? ??????????? ????????????? ????????? ???
????????????????? ?????? ?????? (?????????????????
???????? ??????????? ? ???????? ??????????) ??? ????????? ?????????????, ???????????? ?? ???????????. ??? ??????????????? ??????? ????????? ??????????? ????????????? ?????? ???????? ?????? (?-????????). ???????? ?????
????????????? ?????????? ???????????? ?????????????
???????? ??? p < 0,05.
??????????? ?????????????? ??????? ???????????? ?
????. 1. ????????? ???????? ???? ? ???????? ??????
??????????? ????, ??? ? ?????? ?????????, ?????? ????????????? ???????? ???????? ? ?? ???????? ????? ????????
?? ???? (? > 0,05).
??????????? ?????? ?? ??????????? ????? ?? ????????????? ????????????? ??????? ? ??????? ????????? ???????????? ???? ??????? ???. ?????? ???????? ???? ?????? ????????? ???? (?? ?????? ???), ?????????? ??????? ??????? ????, ?????????? ?????????? ????? ????????: ? ????? ???????? ?????? ???? ????????? ?????????
??????? (????. 2).
?????????? ????????????
???????? ????????? ????
? ?????????? ???????????? ??????? ????????? ???? ?????????? ? 5-?? ??? ??????? ? 95% (21 ?? 22) ??????? ? ???????? ?????? ? ? 92% (24 ?? 26) ??????? ? ?????? ?????????.
?????? ? 1 ???????? ? ???????? ?????? ??????????? ???? ??????????? ????????????? (????????? ? 37,2 ?? 37,0╟?).
? 2 ??????? ?? ?????? ????????? ??????????? ????, ??????? ??????????? 38╟?, ? ????? ??????? ????????? ??
37,0?37,5╟?.
???????? ???????? ??????????? ???? ???? ??????????
? ????? ??????? (???. 1). ? ???????? ?????? ??????? ??????????? ???? ? ?????? ???? ??????? ???? 38,1╟? (SD = 0,7),
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????????????? ? ???????????? ?????????? ???????????-????? ??? ??????? ???? ? ?????
38,5
100
6%
36%
?????????? ?????????, %
??????????? ????, 0?
38
37,5
37
36,5
36
35,5
1
2
???????? ????
3
4
???????? ?????????
80
60
40
64%
50%
20
0
5
??? ???????
44%
???????? ????
???????
???. 1. ???????? ??????????? ???? ? ??????????? ?? ???????.
???????? ?????????
??????????
??? ????????
???. 2. ???????? ???????????? ???? ? ??????????? ?? ???????.
?????????? ?????????, %
100
4%
20%
80
48%
60
40
80%
48%
20
0
???????? ????
???????
???????? ?????????
??????????
??? ????????
???. 3. ???????? ??????? ?????????? (????????? ? ?????????
?????? ????????) ? ??????????? ?? ???????.
100
?????????? ?????????, %
? 5-?? ??? ??????? ????????? ?? 36,5╟? (SD = 0,2). ? ??????
????????? ??? ?????????? ????????? 38,2╟? (SD = 0,8) ?
36,6╟? (SD = 0,3), ??????????????. ???? ???????????? ??????????? ???? ???????? 4 ╠ 0,1 ??? ? ????? ???????.
??????????? ??????? ??????? ????????, ?????????? ???????????? ??????? ?? ????????? ????, ? ????? ???????
??????? ?????????? ???????? ???????????? ????????. ???????????? ???? ?????????? ? 58 ?????. ??? ????????????? ??????????? ?????????? ?? ??????? ?????????? ? ???????? ?????? ? 64%, ? ?????? ????????? ? ? 50% ?????,
?????????? ???????????? ???? ? ? 36 ? 44%, ??????????????. ???????? ? ??????? ???????? ???????? ?? ???? (?-????????, ? = 0,30). ? 2 ??????? (6%) ?? ?????? ????????? ??
???? ????????: ? 1 ???????? ??????????? ?????? ???????????? ????, ? 1 ???????? ? ?????????, ? ?? ????? ??? ? ???????? ?????? ???????? ???????? ??????????? ? ????
??????? (???. 2).
??????? ?????????? (?????????, ????????? ?????? ????????) ??????????? ? 45 ?????. ?????? ??????? ???????
???????? ????????? ? 80% ??????? ???????? ?????? ? ?
48% ? ?????? ?????????, ?????????? ? ? 20 ? 48%, ??????????????. ???????? ? ??????? ???????? ????? ????????
???? ????????????? ????????? (?-????????, ? = 0,03). ?????????? ???????? ??????????? ?????? ? ?????? ?????????
? 1 ??????? (4%) (???. 3).
? ???? ????? ?????????? ???????? ????????? (????????? ?????? ?????? ??????), ??????? ??????????? ? ??????????? ??????? ? ? 60% ??????? ?????? ????????? ????
? ? 71% ??????? ?????? ?????????. ????????? ???????????? ?????? ???????? ? 40 ? 23% ???????, ??????????????.
???????? ? ??????? ???????? ???????? ???????? ?? ????
(?-????????, ? = 0,17). ?????????? ???????? ?????????? ?
?????? ????????? ? 2 (6%) ??????? (???. 4).
????? ? ???????? ??????????? ?? ???? ????????? ? 56 ?????. ?? ???? ??????? ??????? ???????????? ? ????????
?????? ? 60% ? ? ?????? ????????? ? 58% ???????. ????????
????? ???????? ? ??????? ???????? ???????? ?? ????
(?-????????, ? = 1,00). ? ?????? ????????? ? 3 (10%) ????? ??
???? ????????: ??????????? ????????? ?????????? ??????????? ?? ????.
?????? ????????????? ????????? ????????? ? 36 ?????.
?? ???? ??????? ????????? ??????? ???????????? ? 65%
6%
80
60%
71%
60
40
40%
20
0
23%
???????? ????
???????
???????? ?????????
??????????
??? ????????
???. 4. ???????? ??????? ????????? (????????? ?????? ??????
??????) ? ??????????? ?? ???????.
*? ???????? ????????? ????????? ?????????????? ?????, ?????????? ?????????????? ???????????? ???-?2b 150000 ??, ???????????? ???????, ?????????? ??????, ?????? ????? ????? ? ??????? ???.
43
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.??????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 40?47
100
15
80
60
40%
???????? ???? (???????)
?????????? ?????????, %
30%
40%
16%
40
20
0
44%
30%
9
6
3
???????? ????
??
???????????
???????? ?????????
???????????
????
??????? ???????? ?????? ? ? 42% ??????? ?????? ?????????. ???????? ? ??????? ???????? ?? ???? (?-????????,
? = 0,33). ? ????????? ??????? (35 ? 48%, ??????????????)
????? ??????? ??????????? ????????? ?????????? ???????.
???????? ??????????? ?? ??????????? ????? ?? ??????
??????? ??? ??????????????? ?????????, ???? ? 2 ?????
?? 60 ? ????????-???????, ??????? ?? ???? ??????? ????????? ?? ??????????. ????? ???????, ? ????? ??????? ? ???? ???????, ? ??????? ?????????? ??????? ?????? ? ????????????
??????, ?????????? ?? ??????????? ????? ???? ??????????
?????????.
???????????????? ??????? ?? ?????????? ??????????
???-? ?????????????? ? 58 ????? (2?3 ???? ? ????? ? ?????).
? 5-?? ??? ??????? ? 44% ??????? ???????? ?????? ? ? 30%
?????? ????????? ??? ????????? ???? ???????????. ???????? ? ??????? ???????? ??????? ???????? ?? ???? (?-????????,
? = 0,41). ? 16% ????? ???????? ?????? ? 40% ????? ??????
????????? ???????????????? ??????? ????? ???????????
?????? 1 ??? ? ?????. ??????????????, ? 40 ? 30% ??????? ???
?????????? ?????????????? 2?3 ???? ? ????? (???. 5). ??????
?? ???????? ????????? ???? ???????????? ? ????. 3.
????? ???????, ? ??????, ?????????? ???????? ????, ? ?
?????? ????????? ??????????? ??????? ??????? ???????????? ????????????????? ????????? ????, ? ?? ?????? ???????? (??????? ??????????) ???????? ????? ???????? ????
????????????. ? ????????? ????? ??????? ?????? ?????????,
? ??????? ?? ???????? ??????, ????????????? ?????????????
???????? ????????? ?????????. ?????????? ?????????? ??????????????? ? ???, ???, ???????? ?? ??????? ?????????? ?
???????????? ???-?, ???????? ???? ??????? ??????? ??-
1
2
???????? ????
???
?????????
3
4
5
??? ???????
???????? ?????????
???. 6. ????? ???????? ?????????.
??????????: ???????? ??????????? ? ?????? ? ??????????? ?? ??????? ????????????: 3 ? ??????????, 2 ? ?????????, 1 ? ??????, 0 ?
???????????.
???. 5. ????????????? ???????????????? ??????? ? 5-?? ???
???????.
??????????? ??? ??????? ???? ? ?????, ?? ??????????
????????? ?????????.
????? ???????? ????????? ????
????? ???????? ????????? ???? ??????????? ?? ??????
??? ? ????????? ? ??????????? ??????? 5 ????. ? 5-?? ???
??????? ??????? ???????????? ???? ? 75% ??????? ??? ????????????? ????????? ???? ? ? 76% ? ??? ?????????????
????????? ?????????; ????????? ?????? ???????? ? ? 75 ?
42%, ??????????????; ????????? ?????? ?????? ?????? ? ? 90
? 88%; ??????? ??????????? ?? ???? ? ??????? ? ? 88 ? 47%;
????????????? ???????????????? ??????? ? ? 73 ? 70%, ??????????????.
?????????? ?????? ????????? ???? ? ??????
? ??????????? ????????????? ?????????????, ?????????? ???-?, ??????????????? ????????????? ???????? ????????? ???? ?? ???? ???????. ???????????? ?????????
??????????? ? ??????. ?? ??????? ? ???????? ?????? ?????
??????? ?????? ?? ???? ????????? ? ???????? ???? (??????? ? ???????????????? ??????) ? ???????? 13 [11?17], ???
???? ????????????? ??????? ????, ??? ? ?????? ????????? ? 10 [9?13] ?????? (???????? ???????????, ? = 0,007).
????? ??????? ???????? ???? ? ??????? ?? ??????????, ????????? 3 [1?5] ? 4 [2?6] ??????, ?????????????? (????????
???????????, ? = 0,37). ????? ???????, ???????? ?? ??, ???
? ??????, ?????????? ???????? ????, ??????????? ???????
???? ???? ????????? ???????, ?????? ???????????? ??????? ????, ??????????? ??? ???????? ????, ??? ? ????????
?????????, ????????? ??????????? (???. 6).
??????? 3. ???????? ????????? ???? ? ??????????? ?? ???????
??????? ????
???????
???????? ?????? ?????? ?????????
???????????? ????
16 (64)
17 (50)
????????? ? ????????? ?????? ????????
16 (80)
12 (48)*
????????? ?????? ?????? ??????
10 (40)
8 (23)
??????? ??????????? ?? ????
15 (60)
18 (58)
??????? ???????
11 (65)
8 (42)
????????????? ???????????????? ???????
11 (44)
10 (30)
44
12
???????? ????????, ???. (%)
??????????
???????? ?????? ?????? ?????????
9 (36)
15 (44)
4 (20)
12 (48)
15 (60)
25 (71)
10 (40)
10 (32)
0
0
4 (16)
13 (40)
??? ????????
???????? ?????? ?????? ?????????
0
2 (6)
0
1 (4)
0
2 (6)
0
3 (10)
6 (35)
11 (48)
10(40)
10 (30)
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.??????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 40?47
?????????? ???????????? ????
? ???????? ?????? ??????????? ???? ?? ?????? ???????
???? ???????? ? 10 ?????, ?? ??? ? 8 ????????????? ?????? 1 ????? (??-????? ? ? 3 ?????, ????? ?????????? ? ? 2,
?????? ? ? ? 2, ?????????? ? ? 1) ? ? 2 ??????? ? 2 ??????
???????????? (?????????? ? ????? ??????????). ? ??????
????????? ?????? ???? ???????? ? 17 ???????, ?? ???
? 14 ? 1 ??? ??????????? (??-????? ? ? 6, ????? ?????? ? ?
? 4, ?????????? ? ? 3, ????? ?????????? ? ? 1) ? ? 3 ????? ?
2 ???? ??????????? (? 2 ? ?????????? ? ????? ??????????, ?
1 ? ??- ? ??????????). ? ????????? ????? ?????????? ????????????????? ???????????? ??????? ??? ????????? ??????????????.
?? ??????????? ???, ????? ???????????? ??????? ?
??????, ?????????? ???????? ????, ?????? ??????????
???????????? ?????????? ? 8 ?? 10 ??????? (80%), ? ?
?????? ????????? ? ? 9 ?? 17 ??????? (53%). ? 5-?? ???
??????? ? ???????? ?????? ???????? ???????? ????? ?????????? ? 2 ??????? (20%). ? ?????? ????????? ? 8 ?????
(47%) ???????? ????????: ????? ?????? ? (1), ??????????
(3), ??-????? (1), ?????????? (1), ???????????? ?????????? ? ????? ?????????? (2). ? ?????????? ??????? ? ????
??????? ?? ?????????? ?????????? ??????????? ??? ????????? ????.
????? ???????, ?????? ?????????? ??????????? ?????????? ? ???????? ?????? ????, ? 80% ???????, ?? ?????????
? ??????? ????????? ? 53%, ?????? ??? ?????????????? ??????? ???????? ? ??????? ?????????? ???????????? ???? ??
???? ???????? (?-????????, ? > 0,05).
?????????? ?????? ??????????? ???????
? ??????????? ????? (56 ?? 60) ????? ??????? ?? ?????????? ???????? ??????????? ????????????. ???????? ????
? ???? ????????????? ???????????, ??????????? ???????
??????????? ????? ??????? ? 2 (11%) ??????? ????????
?????? ? ? 2 (9%) ??????? ?????? ?????????.
?????????? ??????? ????? 30 ???? ?? ?????? ???????
??? ??????????? ? 40 ??????? ?? 60. ????????? ?????? ???
? ??????? 30 ???? ? ??????? ??????? ???? ?????????????
? ???????? ?????? ? 4 (22%) ???????, ? ?????? ????????? ?
????? ? 4 (18%) ?????.
?????????? ???? ??????????? ?????? ? 1 ??????? ??
???????? ??????: ? 2-?????? ??????? ?? ?????? ??????? ??????????? ????????????? ???????????, ??????????? ???????, ????? ??????? ?????? ????, ??????? ?? ???? ??????????? ??????? ??????????? ? ??????? ?????????? ????.
????????????? ??????????
??? ??????? ???????? ?????? ???? ??????? ??????????
???? ? ?????????? ????????? (2 ???? ? ??? ? ???????
5 ????). ?? ????? ???????????? ? ????? ??????? ?? ????
???????????????? ?? ?????? ?????????????? ?/??? ?????????? ?????????????? ???????. ??? ????????? ?????? ????????????, ?? ???????? ????????????? ? ?????? ??????? ???????. ????????????? ? ???????? ??????? ??????
????????? ?? ???? ???????? ? ????? ???????. ????? ???????, ? ?????? ???????????? ?????????????? ??????? ????????????? ?????????? ?????????? ????????????? ???????? ???? ? ?????.
46
??????????
? ??????????? ??????????? ???????????? ?????????
????????????? ? ????????????? ????????? ????????
???? ??? ???? ? ?????. ? 5-?? ??? ??????? ???? ???????? ??????? ??????????? ????????????? ? ??????????????? ???????? ?????????? ???-? ? ????? ?????????? ?????????????. ??? ?? ????????????? ?? ??????????? ???????? ????????, ? ?? ????? ??? ? ?????????? ?????????? ?
????????????? ?????????????? ???????? ??????? ???
?????????? ??????? ??? ???-? ? ????????? [17, 18]. ???
??????????? ????????? ?? ?????????? ????? ????? ??????? ?????? ???????????? ????? ??????, ??? ?? ????????????? ?? ????????? ?????????????, ????????????? ? ?????? ???????? ???????.
????????????? ? ???????????? ?????????? ?????????
???? ? ?????? ???????????? ???????????? ? ???????????
?????????? ??????????????? ???-? ? ???? ?????????????,
?? ? ????? ??????? ??????????? ???-?. ? ?????? ???????????? ???? ????????, ??? ? ?????????? 5-???????? ????? ??????? ? ?????????????? ????????? ???? ? ????????? ????????? ??????????? ?????????? ? ??????????? ????????
????????? ? ????? ? ????, ??????????? ?? ????????????
???????.
???? ???????? ????????????? ??????????? ??????????,
????????????????? ? ??????? ??????? ???????? ?????????
???? (???????????? ????, ????????? ? ????????? ??????
????????, ????????? ?????? ?????? ??????, ??????? ??????????? ?? ???? ? ???????) ??? ?????????? ????????? ???? ?
????????? ?????????. ????? ???????? ?????????? 4?5 ????.
????? ????, ? ?????????? ??????? ? ????? ??????? ????????
????? ???????????? ? ?????????, ???????, ???????? ????????, ???????? ????. ???????????? ??????????? ???? ??????????? ?????????? ??????, ?? 4-? ???? ???????.
???????? ????? ????????????? ???????? ????????????
???????????. ?????????? ?????????? ???-? ????????? ???????? ?????????? ????????? ?????? ? ??????????? ????? ?
????? ??????????? ????????????? ????. ? ??????????
??????? ?????????? ??????????? ???????? ?????? ? 1 ??????? ? ?????? ????????? ????????.
???????? ?? ??, ??? ? ?????? ?????, ?????????? ????????
????, ??????? ???? ????????????????? ????? ??????? ????????, ????????????? ?????????? ????????? ???? ? ??????? ??????????? ??????? ???? ?? ???????? ??? ???????.
???????? ???? ? ???????? ????????? ????????? ?????? ??
??????? ???????? ????????? ????, ?????????? ??????????? ? ????????????? ?????????? ???????????, ??? ???? ???????? ???????? ????????? ????????? ??? ?????????? ????????? ???? ???? ????????? ????? ??????????.
???????? ???? ???????? ?????????? ???????????????
???-? ?????? ?????????. ???????? ? ??? ?????? ???????????? ?????? ???????? ?????? ??????????? ? ???????? ????????????????, ???????????????????????? ? ?????????????????????? ??????????. ?????????? ?????????
???-? ? ??????? ???????????? ?????????? ??????????????????, ???????????????, ????????????, ????????????????????? ? ??????????????? ???????? ????????? ????.
????????? ??????????? ??????? ??????????? ????????? ??????? ?????????? ???-?. ????? ???????, ??????? ?????-
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????????????? ? ???????????? ?????????? ???????????-????? ??? ??????? ???? ? ?????
?????? ????????????? ????????? ????, ?????????? ????????? ??? ??????????? ????????? ????????????? ??????
???????? ??? ???????? ????????????? ? ??????????????
????????.
??????
1. ???????? ???? ?????????? ??? ?????????? ?????????
? ???? 125 000 ?? 2 ???? ? ??? ? ??????? 5 ???? ? ???????
??????????? ??????? ???? ? ?????.
2. ???????? ???? ? ????? ????????????? ?????????, ???????? ??????? ?????????????? ? ?????? ??? ?????????? ?
?????.
3. ?????????? ?????????? ????????? ????????????? ???????? ???????? ???? ? ???????? ?????????? ? ???????
???? ? ????? ??????????? ????????.
??????????
1. ?????????? ?.?. ???????????? ?????????: ?????, ???????, ??????. ????????????, ??????????? ? ?????????????? ????????? ???????????? ???????????. ?., 2002; 7?17.
2. ??????? ?.?. ??????????? ?? ???????????? ???????????? ? ?????. ?.: ?????? ????????, 1998; 700.
3. Red Book: 2000. Report of the Committee on Infection Diseases. 25rd: American
Academy of Pediatrics, 2000; 855.
4. ?????? ?.?., ???????? ?.?. ??????????? ??????? ? ??????? ? ???????????? ????? ???????? ?????. ?.: ????????? ???????????? ??????????,
2006; 53.
5. ???????? ?.?., ????? ?.?. ????? ???????? ????: ??????????? ??????????????. ?.: ???????????? ?????? ??????-?????, 2006; 191.
6. ??????????? ?.?. ???????? ???????????? ??????? ?????? ?????????????
???????? ???????? ? ????? ??????? ????????. ??????? ??????????? ??????
2004; 12(13).
7. ?????? ????????????? ??????????? ? ?????: ??????? ? ????????????. ??????-???????????? ????????? ????? ????????? ??????. ?.: ?????????????
???? ?????? ???????? ?????? ? ???????, 2002; 69.
8. Moulin F., Raymond J., Iniguez J.L., et al. Serum alpha-interferon in lower respiratory tract infections of children. Pediatr Infect Dis J 1996; 15(10): 883?6.
9. Ronni T., Matikainen S., Sareneva T., et al. Regulation of IFN-alpha/beta, MxA,
2',5'-oligoadenylate synthetase, and HLA gene expression in influenza A-infected
human lung epithelial cells. J Immunol. 1997; 158(5): 2363?74.
10. ????? ?.?. ??????????? (? 40?????? ????????). ??????? ???????????
1998; 6(43): 247?52.
11. Randall R.E., Goodbourn S. Interferons and viruses: an interplay between induction, signalling, antiviral responses and virus countermeasures. J Gen Virol. 2008;
89(Pt 1): 1?47. Review.
12. ??????????? ?.?. ????? ????????????? ??????????? ???????? ??????? ?
??? ?????????? ? ????????????? ? ????????? ??? ???????????? ?????????.
?????????? ??????? ????????????? ? ????????? 1993; 3: 36?43.
13. ?????????? ?.?., ?????? ?.?., ??????????? ?.?., ? ??. ?????????? ???????? ??? ?????? ? ?????? ?????? ????????????? ???????? ????????? ? ?????.
??????? ?????? 2000; 5: 16?8.
14. ?????????? ?.?. ??????????????? ????? ???????????? ?????? ? ???? ? ?????. ??????? ???????? 2004; 2: 34?7.
15. Isomura S., Ichikawa T., Miyazu M., et al. The preventive effect of human interferon-alpha on influenza infection; modification of clinical manifestations of influenza in children in a closed community. Biken J. 1982; 25(3): 131?7.
16. ???????? ?.?., ???????? ?.?., ????? ?.?., ? ??. ????????????? ?????????
???????? ???? ? ??????? ?????????????? ???????? ? ??????????. ??????????? ?????????????? ? ?????????? ? ??????????? 2009; 2.
17. Fried M.W. Side effects of therapy of hepatitis C and their management.
Hepatology 2002; 36(5 Suppl 1): S237?44.
18. Kraus M.R., SchДfer A., Csef H., et al. Psychiatric side effects of pegylated interferon alfa-2b as compared to conventional interferon alfa-2b in patients with
chronic hepatitis C. World J Gastroenterol. 2005; 11(12): 1769?74.
?????????? ? ?????????:
??????? ???? ??????????, ?????? ??????????? ????, ?????????,
??????????? ??????? ????? ??, ???????????? ???????????? ??????
??????????? ??? ????????????? ? ????????????? ??. ?.?.?????????????
?????: 125212, ??????, ??. ???????? ????????, 10
???????: (495) 380-2019
????????? ??????? ????????????, ?????? ??????????? ????, ?????????,
???????????? ???????? ????????????? ????????? ??????????? ??????????
??????-?????????????????? ???????????? ????????? ??. ?.?.?????????????
?????: 129110, ??????, ??. ???????, 61/2
???????: (495) 268-2226
?????????? ????? ????????, ???????? ???????????? ?????? ????????????
????????? ???????????? ??? ????????????? ????????????????
?????: 111123, ??????, ??. ??????????????, 3?
???????: (499) 182-0992
????????????? ??????????? ??????
????? ??????????????? D
???????? ?? ??, ??? ?????????????? D ??? ?????? ??? ????? 40 ??? ?????, ??? ???? ? ???????????????? ???????? ??????? ?????????? ???????. ? ???????? ?????? ??????? Nature Immunology ?? 2009 ?. ???????????? ?????????? ????????????, ??????? ????????, ??? ?-????????? ???????? ? ??????? ??????? ??????????? ????? ??????????? ?????????????? D.
????? ????????????? ?????????????? D ??????????? ? ?????????? ? ??????? ??????????. ???????? ╚IgD-?????????????╩
? ??????????? ????????? ????????? ????????????? ? ????????????????? ????????? ? ????????? ? ??????????? ??????? ?-??????????. ?-????????? ????? ????????????? IgD ??? ╚????????╩ ????????? ?????? ?????????? ????????????
??????? ??????? ??????????? ?????. ?????? ????????????? ? ???????? ???????? ??????? ????????????????? ???????
????? ?? ?????? ?????????????? ????????? ??????? ?????????????? ??????????, ?? ????? ???????????? ?-?????????
?????????, ?????? ??????? ? ?????????????? ????????.
Mystery Solved? Immunoglobulin D Improves Immune Surveillance
in Respiratory Tract. Nature Immunol 2009.
www.medscape
www.antibiotic.ru
47
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????????? ??????
????????????? ??????????? ???????????
???????? ???????????? ?????????
?.?.?????????1, ?.?.?????????????2, ?.?.??????2, ?.?.???????3, ?.?.??????4
?????????? ??????????????? ??????-????????????????? ???????????;
??? ????????????? ? ????????????? ??. ??????? ????????????????, ?????-?????????;
3
????????? ???????????? ???????? ?30 ??. ?.?.???????, ?????-?????????;
4
442-? ???????? ??????? ??????????? ????????? ?????????????? ???????? ?????? ?? ??, ?????-?????????
1
2
? ?????? ???????????? ?????????? ???????????? ???????-????????????? ???????????? ??????? ???????????? ? ??????????? ????????. ?????????????? ????????? ?????? ???????????: ??????????????????, ???????????? ??????
??????? (???), ???????????????? ?????? (??? ????????? ??????? ??????? A, M ? G ? ?????? ???????? ????????),
??????? ???????? ???????????????. ??????????? ?????????? ???????????? ????????? ??-1, -2, -6, ???-? ? ????????? ????? ???????. ?? ??????????? ???????????? ?????????? ??????? ??????????? ???????? ???????????? ?????????. ??? ??????????? ??????????? ???? ??????????? ? ??????????? ????????? ???????? ???????????? ????????
???????????????? ??????, ???. ??? ??????????????? ????????????? ???????????? ??????? ??????? ????????????? ????????? ???????????? ?????????? ?????????? ? ???????????? ??-6.
???????? ?????: ?????????, ??????, ???????????, ????????
Perspectives in diagnosing yersinia arthritis
O.A.Burgasova1, E.A.Voskresenskaya2, G.Ya.Tseneva2, V.B.Musatov3, D.A.Suprun4
Moscow State University of Medicine and Dentistry;
Pasteur Research Institute of Epidemiology and Microbiology, Federal Supervision Service
for Consumer Rights Protection and People?s Welfare, St.Petersburg;
3
S.P.Botkin City Infectious Hospital No 30, St.Petersburg;
4
442th District Military Clinical Hospital, Ministry of Defense of the Russian Federation, St.Petersburg
1
2
The article presents the findings of a complex clinicolaboratory examination of patients with yersinia infection and affected joints.
The following diagnostic methods were used: bacteriological, polymerase chain reaction (PCR), enzyme-linked immunoassay
(for detection of antibodies A, M and G to proteins of outer membranes), indirect hemagglutination reaction. Also, concentrations of cytokines IL-1, -2, -6, IFN-? in blood serum of the patients were detected. Based on the results of the study, a tactics
of diagnosing yersinia arthritis was proposed. For diagnosing chronic forms of yersinia infection with reactive arthritis enzymelinked immunoassay, PCR are the most effective. For additional confirmation of the infectious nature of arthritis a study of cellular immunity with detection of IL-6 might be expedient.
Key words: yersiniosis, arthritis, diagnosis, cytokines
?
????????? ???? ????? ?? ????????? ??????? ? ??????????? ???????????? ????????? ???????? ???????? ????????? ??????-????????????? ????????, ????????????? ? ???? ?????????? ??? ?????????? ????????.
?????? ?????????? ???????????????, ??? ? ?? ?????????
??????? ???? ??????????? ???????????????. ?????? ???????????? ???????, ?????????? ???????? ?????????????? ????????? ? ????????, ?????????? ????? (???????).
??????? ????? ????? ??? ???????? ???????? [1, 2]. ??????? ????????? ???????? ??????????? ???????? ????????? ???????????????:
????????? ????? ?????????????, ???????? ??????????? ????,
?????? ??????? ???????????? ???????? ? ?????????????
??????????? ???????????????? ??????-?????????????????? ????????????
?????: 103473, ??????, ??. ???????????, 20/1
???????: (495) 609-2263
?????? ????????? 07.07.2009 ?., ??????? ? ?????? 15.09.2009 ?.
48
??????????? ??????????????? ?????????? ???????? ?
Y. enterocolitica, Y. pseudotuberculosis, ?? ?????? ????????? ???????, ??? ?????????? ? 5?35% [3?5]. ????????, ???
??????? ???????? ????????? ???????? ? ????????? ??????? ??????????? ???????????? ?????????. ???, ? ??????
??????? ??????? ???????? ????????? ???????? ???????????? ????????? ?????????? ?? 14 ?? 97%; ??? ???????? ?
??????????? ??????? ??????????? ??? ??????????? ???? ? ? 2,7?8% ???????.
? ????????? ????? ??????? ??????????? ?????????
??????-????????????? ???????? ???????????? ?????????
???????? ???????????. ??? ??????????? ????? ??????:
????????????? ????????????? ??????? ?????????????? ?
?????????? ??????????? ?? ???????????, ???????? ???????? ? ?????????? ??????? ???????, ?????? ??????????
??????????? ??????? ???????????. ??????? ?????????
??????????? ???????????? ? ?????????? ???????? ????-
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????????????? ??????????? ??????????? ???????? ???????????? ?????????
?????
(Cryptosporidium,
Strongyloides)
??????????
(Giardia lamblia,
Amoeba)
??????
(Parvovirus B-19,
Hepatitis B)
????????
(Campylobacter jejuni,
Chlamidia trachomatis,
Lactobacillus spp., Salmonella (S. enteritidis,
S. typhimurium, S. paratyphi B, C), Shigella
(Sh. flexneri, Sh. sonnei, Sh. dysenteriae),
Ureaplasma urealyticum, Yersinia (Y. enterocolitica,
Y. pseudotuberculosis), Bacillus cereus, Bartonella,
Borrelia burgdorferi, Brucella abortus, Bacillus,
Chlamydia pneumoniae, Clostridium defficile, Escherichia coli,
Gardnerella vaginalis, Hafnia alvei, Helicobacter
(H. pylori, H. cinaedi), Leptospira, Mycobacterium
tuberculosis, Mycoplasma (M. hominis, M. fermentans),
Neiserria (N. gonorrhoeae, N. meningitidis),
Propionibacterium acnes, Pseudomonas
(P. migulae, P. fluorescens, P. putida), Rickettsia
rickettsii, Staphyloccocus (S. aureus,
S. epidermidis), Streptococcus
(S. ?-haemolyticus, S. salivarius),
Troferyma whippelii
???????. ??????????? ???????????? ???????, ?????????? ????????? ????????.
???? ??????????????, ? ??????? ??????????? ??????????
??????? ? ????????? ?????????? ???????? (???). ???????
? ??????? ????????????? ??? ??????????? ????????????
???????? ????????? ???????????????? ?????? (???)
??? ??????????? ???????????????? ??????? A, M, G ? ????????? ????? [6]. ??????? ???????? ???????????? ???????????? ?? ???????????? ???????? ??????? ?eA ???? ?????????? [7, 8]. ??? ???????? ??????? ? ????????????
???????? ??? ????????, ?????? ???????? ????????????
??????????????? [10]. ?????? ? ???, ???????? Y. enterocolitica ???? ?????????? ? ???????????? ???????? ? ???????? ??????????????? ??????? [7, 8]. ????????????????
(???) ????????, ? ????? ????? ???????? ???????? (???)
YadA ? ????? ????????? ???? (61 ???) ???????? ? ????????
??????? ?eA [9, 11]. ??? ???? ? ????? ??????? ??? ? ???
???????? ? ???????????? ???????? ? ??????? ?????????????? ????? ?????????????? ? ??????? 4 ???, ??? ?????????????? ???????? ??????????? ? ???????? ???????????? ?????? ? ???? ????????? ???????????????? ?.
????????????, ??????????? ???????? ????????? ?????? ? ???????????? ????????????? ???????, ? ????????? ???? ??????? ????????????????. ????????, ??? ? ???????????????? ???????? ??? ???????????? ????????
??????????? ?????? ???? ????????? ????????, ???????????
?????? ????? ????????? CD4+, ??????? ???????????
??????? ?????????? ?????????. ??? ???? ????????????
????? ???????? ??????? ??????????? ?? ???? Th1 (? ?????????? ?????????: ????????????? (??)-1, ??-2, ??-6, ???????????-? (???-?)). ???? ??? ???????????? ???????????? ?????????? ????????. ???????? ?????, ??? ????????
(?????? ??????? ????????-? (???-?) ? ???-?) ????????
?????????????? ?? ?????????? ????????, ? ?? ????????????? ????????? ????? ? ???????? ????????????? ????????????. ? ??????? ??? ???????????? ????????? ? ??????
????????? ???-? ??????????? ????? ?????????? ??????? ???????, ??? ? ??????? ? ??????? ????????? ?????
???????? [12].
???????????? ???????????? ???????? ???????????? ????? ??????? ?? ???????? ??? ???????? ????????????? ????????. ???????? ????? ??????? ???? ???????? ????? ????????
???????? ? YadA, ??????????? ??????? ????????? ???????? (Yersinia adgesin A) [13]. ????? ????, YadA ????? ???????? ????????????? ???????????, ?.?. ????????? ??? ?????????? ????????????? ?????????? ? ?????????? ??????????????? ?????? [14]. ?????? ? ???, ?? ?????????? ??????? ???
??????? ????? ???????? ???????????? ????????? ? ????? ?
??????????? ??????????? ???????? ? ????????? ???????????? ? ??????? ? ??? ? ???????? ???????????.
???? ?????? ? ????????????????? ??????????? ??????,
???????? ? ??????????? ???? ??????????? ? ??????????
???????? ? ????????? ??????? ???????.
???????? ? ??????
????????? ??????????? ???????-???????????? ???????????? 77 ??????? ???????????? (╚????????╩ ????????? ? ????????????????) ? ??????, ???????? ? ???????????
????????? ??????????? ? ??????????? ???????? ??? ????????????? ???????????, ??????????? ? ??????????
???????? ????? ?.?.??????? ? ?442 ???? ?. ?????-??????????. ???????, ???????????? ??? ???????????, ????
? ???????? ?? 17 ?? 48 ???, ?? ??? ?????? ? 61 (79,2%), ?????? ? 16 (20,7%). ?????????? ??????? ???????????? ??
?????? ? ??????????? ?? ??????? ??????????? (??????, ????????, ???????????) ????????? ???????? ????????????
????????????? ?.?.????? ? ?????. (1998, 2003 ?.).
??????????? ??????????, ?????????? ?? ???????,
??????? ?????, ????, ???, ????? ?? ??????????, ???????????? ????????, ?????????? ? ???????? ???????????.
???????? ??????? ??????????? ???????: ?????????????????? ?????, ???????????? ?????? ??????? (???) ? ?????????????? ????????????????? ????????? ??? ????????? ?????, ?????????????? ?? ???????? ????????????? ????????
?YV (42-47 ?D?), ? ????????????????? ????????? ??? ????-
49
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.????????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 48?52
??????? 1. ??????????? ?????????? ? ??????? ? ?????? ? ??????????? ???????? ???????????
??????????? ????????
?????? ?????????
???????????
????????? ? ???
???.
%
???.
%
??????????? >37,5
45
91,8
17
60,7
??????????? ???????
(????????? ????)
26
53,1
11
39,2
???????, ?????
17
34,7
1
3,6
???? ? ??????
35
71,4
15
53,6
????
22
44,8
9
32,1
??????? ╚????????╩, ╚??????╩
4
8,1
2
7,1
????????? ?????
11
22,4
5
17,9
?????????????
4
8,2
19
67,9
????????? ??????-?????????????
47
95,9
28
100
???????? (??????? ??? ?????????)
? ???????????
? ?????????
????? ??????????? ?????, ?????????? ????????????
YPMa/c Y. Pseudotuberculosis, ? ????? ????? ???????/???????
?il Y. enterocolitica (???????????? ??? ╚??????╩, ??????).
??? ??????????? ????????????? ??????? ????????????
??????? ???????????? (??) ?? ???????????? ????????;
??? ? ????-????????? ╚?????????-???-IgA╩, ╚?????????-???-IgM╩ (???????????? ??? ╚??????╩, ?????-?????????), ??????????????? ??? ????????? ??????? ???????
IgA, M ? G ? ???, ?????????? ????????? ?????????????
????????; ??????? ???????? ??????????????? (????) ?
??????????????? ??????????????? ? Y. pseudotuberculosis
1-?? ???????? ? Y. enterocolitica ????????? ?:3 ? ?:9 (???????????? ?????, ?????-?????????).
?????????? ???????????? ????????? ??-1, ??-2, ??-6,
???-? ? ????????? ????? ??????? ??????????????????.
??? ??????????? ????????? ???????????? ?????? ????????? ╚ProCon IL-1╩, ╚ProCon IL-2╩, ╚ProCon IFN-?╩
(??? ╚??????????? ??????╩, ??????).
??????????? ?????? ????????? 55 ???????? ??????? ?
???????? ?? 18 ?? 25 ???.
?????????????? ????????? ??????????? ????????????
???????? ? ????: ??? ?????????????? ??????????? ? ?????? ??????? ?????????????? (M), ??????????? ??????
(m), ???????????? ??????????; ?????? ???????? ?????
???????? ??????????? ?? ?????? ?????????????? ?????????????? ???????.
?????????? ???????????? ? ?? ??????????
??? ??????????? ?????????? ???????, ???????????
?? 2 ??????: ? ??????? ??????? ??????????? ? ??????????? ???????? ? ???? ????????? (?????? 1) ? ???????? ? ???????? ? ??????????? ???????? ??????????? ? ?????????
??? (?????? 2).
????? ????????, ??? ? ??????? ? ??????????? ????????
?????????? ? ????????? ??? ???????? ??????? ??????????? ???? ?????????, ???????????? ??????? ??????? ??????????? (????. 1). ? ?????? ??????? ? ?????? ???????????? ????????? ??????? ???????? ????????? ?????????
??????? 3. ????? ??????????? ??????? ??????? ??? ? ??????? ????????????
??????
????? ???????????
???????????????
A
? 9-?? ??? ???????
? ??????? 5?24 ???
M
? 6-?? ??? ???????
? ??????? 5?7 ???
G
? 6-?? ??? ???????
? ??????? 9?24 ???
??????? 4. ?????????? ??????????? ????????? ? ?????????
????? ? ??????? ?????????????????? (M ╠ m) (??/??)
?????? ???????
??-1
??-2
??-6
???-?
??????? ???????
178,65 ╠ 18,0 515,0 ╠ 38,4 301,7 ╠ 27,7
????????????
(n = 20)
(n = 16)
(n = 17)
??? ????????
???????????
442,6 ╠ 62,1 142,8 ╠ 18,0 753, ╠ 738,1 195,4 ╠ 10,7
???????
(n = 10)
(n = 20)
(n = 16)
(n = 17)
? ?????????
???????????
77,3 ╠ 118,2 34,12 ╠ 3,02 59,3 ╠ 6,08 135,8 ╠ 6,67
?????? (n = 55)
?????????????
?
1?2
1?2
1?2
???????? ? ??????? (?)
>0,05
<0,001
<0,001
90%. ?? 2-? ?????? ??????? ? ??????????? ???????? ???????? ???????? ??? ???????? ? 100% ???????: ?????????? ? 2 ?????????, ??????????? ? ? 16, ?????????? ? ? 10.
???????? ????? ?????????? ????????????? ? ????????
???????. ? 2 ???? ???? ??????????? ????????? ????????
????? ? ????????????? ????????.
? ???? ??????????? ??????? ??????? ??? ???????????
????? ??? ??????????? ???????? ?? ????????? ?????????????? ???????????? ???????????? (????. 2).
??? ?????????????????? ???????????? ????????????? ???????? ? ??????? 1-? ?????? ?????????? ???????? Y. ?seudotuberculosis ???????? ? 18,3% ???????. ? ?????? ???????????
??????? ???????? Y. ?nterocolitica ???????? ? : 3 ? Y. ?seudotuberculosis 1-?? ???????? ???? ???????? ? 2 ???????.
? ??????? ??? ????????? ??????????? ????????????
????, ??? ?????????????????? ???????. ???, ??? ??????
??????? ??????????? ? ??????????? ???????? ? ???? ????????? ??????? ????????????? ??????? ????????? 36,7%.
? ??????? ? ???????? ? ??????????? ???????? ?????????? ? ????????? ???????? ? ??? ????????????? ???????????? ???????????? ?????????? ? 42,8% ???????.
???????????? ?????????????? ????? ? ?? ? ?????????
?? ????????? ????? ???????????? ??????? ????????????.
????????????? ??????? ???? ??????? 1:160. ????? ??????????? ?????? ? ???????? ???????????. ? ?? ???????
??????? ??? ??????????? ? 100% ??????? ? ??????? ?????? ???????????? ????????? ? ? 71,4% ??????? ? ??????????? ???????? ? ???.
??? ?????? ????????????? ????????????? ?????? ??????????? ???????????, ???????????? ? ????????????
??????????????? ? ???? ? ??? ?????? ? ??????????? ?????????, ? ??? ????? ?????????????? ?????????? ????????, ????????????? ??????? ? ????? ??????? ??????????
????????? 24,4 ? 7,1%, ??????????????.
??????? 2. ?????????? ????????????? ???????????? ??????? ???????????? ? ??????????? ???????? (???./%)
?????? ???????
??????????????????
???
????
??
???
?????
IgM
IgG
?????? ??????? ? ??????????? (n = 49)
9/18,3
18/36,7
12/24,4
49/100
42/85,7
43/87,7
??????????? ??????? ? ?eA (n = 28)
2/7,2
12/42,8
2/7,1
20/71,4
8/28,5
22/78,5
50
IgA
43/87,7
3/10,7
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????????????? ??????????? ??????????? ???????? ???????????? ?????????
??????? 5. ??????? ???????????????? ???????????? ??????? ????????? ???????????? ?????????
?????
??????????????? ????????
????? ????????????
??????????????????
1?2-? ?????? ???????
???
????-??????? ??? ??????????? ?????????????
??? ??????? ???????
??????????? ? ?????????? ??????????? ????????????
??
?????????????? ???????? Y. ?seudotuberculosis
1-? ???????????? ?? 10?14-? ????
1-?? ????????, Y. enterocolitica ????????? ?:3; ?:4;
?? ?????? ???????, 2-? ? ????? 2?3 ???
?:5,27; ?:9; ?:13
???
????-??????? ??? ??????????? IgA, IgM, IgG
??? ??????? ???????
? ??????????? ?????????
????
?????????????? ????????????? ? Y. pseudotuberculosis 1-? ???????????? ?? 10?14-? ????
1-?? ???????? ? Y. enterocolitica ????????? ?:3 ? ?:9
?? ?????? ???????, 2-? ? ? ????????
??????????? ????? 2?3 ???
???????? ??????????? ?? ?????????????? ??????? ??????????? ???????? ????? ???. ???? ????? ????????????
??? ????????? ???????????? ??????? ??????? A, M ? G ?
???, ?????????? ????????? ????????????? ????????.
??????????? ???????????? ????????, ??? ? ??????
??????? ? ?????? ???????? ????????????? ???????? ?
????????? ????????? ??????? ??? ??????????? ???????????? ??????? ?????? ? ? G ? 87,7% ???????. ? ?????? ??????? ? ????????, ??????????? ???????? ? ????????? ??????? ??????????? ??????? ?????? G ????????? 78,5%. ???
???? ???????? ??????? ????? ??????? ???????? ? ??????? ??? ???????????? ????????? ? ?????????? ????????
???????, ??? ???????????? ???????????? ????? ??????? ?
??????? ??????????? ????????????. ??????? ???????????????? ? ????????????? ?????? ??????????? ????????? ????????????? ? ???????? ????????? ?????????? ?????????????? ???. ???????????? ????? ? ???????? ????????? ?????????? ???????? ?????????? ???????????????? ????????? ??????? ? ??????? ???????????? ? ????????? ??????? ??????? (????. 3).
?????????? ? ??? ?????? ??????????????? ? ?????????? IgA ? ????? ?? 5 ?? 24 ??? ? ??????? ? ???. ?????? ??????? ??????????? ??????? ????? ?????? ? ??????? ? ??????????? ???????? ??????????? ????????? ?????? 10,7%. IgM
? ??????? ? ??????????? ???????? ?????????? ???????????? ? 6-?? ??? ??????????? ?? ?????????? 5?7 ??? ? 28,5%
???????. ? 78,6% ??????? ???????????? ???????? ?????? G.
??? ?????????????? ???????????, ?????? ??????? ?
??????????????? ??????? ??????????? ? ??????? ?????????????????? ??? ???????? ????????????? ?????? ????????? ????????? ??-1, ??-2, ??-6, ???-? ? ?????????
?????. ??????? ???? ????????? ?? 2 ??????: ???????
?????????????????? ? ?????? ???????? ??? ???????? ?
??????? ?????????????????? ? ???????? ? ???????????
???????? ? ???????????? Pe?. ??????????? ?????? ????????? ???????? ?????? (????. 4).
???????????? ????????, ??? ? ?????? ?????? ? ???????
??? ????????? ????????? ???????? ?????????? ?????????
????????? ?????????: ?? ???? ???????????? ?????????
??????????? ???-? (??? ????????? ? ??????????? ???????) ???????? ????????? ?????? ????????????????? ????????? (??-2, ??-6). ??? ?????????? ??????????????
??????? ??????????? ???-? ? 2 ??????? ??????? ???????? ?????????? ??????? ?????? ????? ???????? ? ??????
??????? ??? ???????? (p < 0,001). ? ?????? ??????? ? ????????? ??????????? ?????????? ??????? ?????????? ??-6
? ???????? ??????????? (? < 0,001) ?? ????????? ?
????????
???, ????, ???????????? ????????
???, ????, ???????????? ????????
?????
?????, ???????????? ????????
?????
1-? ???????. ??????? ???????? ??-6, ?????????? ??? ???????????? ? ??????? ? ?????????, ????????, ??????????????? ?? ??????? ????? ?? ? ?????????? ??????????? ???
???????????? ????????? ??????? ???????, ??????????? ?
???????? ?????????? ? ???? ???.
?????????? ?????????? ???????????? ????????????
??????? ???????????? ????????? ?????????? ??? ????????????? ?????????? ????????? ??????? ??????????? ???????? ???????????? ????????? (????. 5).
??????
1. ??? ??????????? ??????????? ???? ??????????? ? ???
???????? ??????????? ???????? ??????????? ???????????? ? ?????????????? ??? ??? ??????????? ??????? ???????????????? A ? G.
2. ? ?????? ???????????????? ???????????? ???????????? ???????? ?????????? ????????? ???????????? ????????????? ?????????? ?? ??????? ?? ??????? ???????????
???????????? ???????? ??????? ???, ??? ??????????? ???????? ????????????? ???????????.
3. ? ???????? ???????????? ??? ??????????????? ????????????? ???????????? ??????? ??????? ????????????? ????????? ???????????? ?????????? ?????????? ? ????????????
????????????????? ?????????, ??????????????? ??-6.
??????????
1. Toivanen P. Managing reactive arthritis. Rheumatology 2000; 39: 117?21.
2. van der Linden S., van der Heijde D. Clinical aspects, outcome assessment, and
management of ankylosing spondylitis and postenteric reactive arthritis. Curr.
Opin. Rheumatol. 2000; 12:263?268.
3. ???????? ?.?., ????????? ?.?., ?????? ?.?. ? ??. ????????????????. ???????????: ?????, 2003; 320.
4. ????? ?.?., ? ??. ????????? ?????????????????? ??????? ? ???????-???????????????? ?????????????? ????????????????? ? ????????? ??????. ???????????????? ?????? ??????? ?????? ???????????? ???????????. ?.,
1999; 380?6.
5. Taccetti G., Trapani S., Ermini M., Falcini F. Reactive arthritis triggered by
Yersinia enterocolitica: a review of 18 pediatric cases. Clin. Exp. Rheumatol.
1994; 12: 681?4.
6. Hrycaj P., Lacki J.K. Antibodies to ubiguitin in relation to Yersinia infection statusin patients with ankylosing spondylitis. Clin Rheumatol. 2003; 2; 22(1): 33?6.
7. Granfors K., Jalkenen S., von Essen R., et al. Yersinia antigens in synovial fluid
cells from patients with reactive arthritis. N. Engl. J Med. 1989; 320: 216?21.
8. Hammer M., Zeidler H., Klimsa S., et al. Yersinia enterocolitica in the synovial membrane of patients with Yersinia-induced arthritis. Arthritis Rheum. 1990; 33: 1795?800.
51
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.????????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 48?52
9. Granfors K., Jalkanen S., Toivanen P., et al. Bacterial lipopolysaccharide in
synovial fluid cells in Shigella triggered reactive arthritis. J Rheumatol. 1992;
19: 500.
10. Sibilia J., Limbach F.X. Reactive arthritis or chronic infectious arthritis? Ann.
Rheum. Dis. 2002; 61: 580?7.
11. Granfors K., Merilahti-Palo R., Luukkainen R., et al. Persistence of Yersinia antigens in peripheral blood cells from patients with Yersinia enterocolitica O:3 infection with or without reactive arthritis. Arthritis Rheum. 1998; 41: 855?62.
12. Heesman J., Eggers C., Schroder J., Laufs R. The diagnostic and prognostic valueof Ig M,Ig A and Ig G antibodies to plasmid encoded Yersinia antigens. Zbl.
Bacteriol. Microbiol. und Hyg. 1986; 262(2): 261?2.
13. Bolin I., Norlander L., Wolf-Watz H. Temperature-inducible outer membrane protein of Yersinia pseudotuberculosis and Yersinia enterocolitica is associated with
the virulence plasmid. Infect. Immune. 1982; 37: 506?12.
14. Heesemann J., Gaede K. Mechanisms involved in pathogenesis of Yersinia infections. Rhevmatol. Int. 1989; 9: 213?7.
?????????? ? ?????????:
?????? ?????? ?????????, ?????? ??????????? ????, ?????????,
???????????? ??????????? ????????????? ????????? ????????
??? ????????????? ? ????????????? ??. ??????? ????????????????
?????: 197191, ?????-?????????, ??. ????, 14
???????: (812) 498-0939
????????????? ????????? ?????????????, ???????? ????????????? ????,
??????? ??????? ????????? ??????????? ????????????? ????????? ????????
??? ????????????? ? ????????????? ??. ??????? ????????????????
?????: 197191, ?????-?????????, ??. ????, 14
???????: (812) 498-0939
?????? ??????? ?????????????, ???????? ??????????? ????,
????????? ????????????? ????????? ????????????? ??????
442-?? ????????? ???????? ???????????? ?????????
?????????????? ???????? ?????? ?? ??
?????: 193163, ?????-?????????, ??????????? ??-??, 63
???????: (812) 271-8730
??????? ???????? ?????????, ???????? ??????????? ????,
??????????? ???????? ????? ????????? ???????????? ???????? ?30
??. ?.?.???????
?????: 193163, ?????-?????????, ??. ????????????, 3
???????: (812) 717-7761
????????????? ??????????? ??????
????????????? ?????????? ?????????????? ??????? ? ???
?????????????? ?????????? ????? ????????????? ????????
??????????? ????? ???????????? ????????, ??? ????-???-??????? ?????????????? ?????????? ????? ?????????????
????????, ?????? ?????????? ???????, ??????? ?? ????????? ???? ?? ???? ????-???-?????????. ? ????????????, ?????????? ???????? ???? ???????????? ? ???????? ?????? ??????? Arthritis & Rheumatism, ???? ???????????????? ??????????
? ????????????? ??????? ??????????? ?? ?????? ???????? ?????????, ?????????? ????-???-???????, ?? 3-?????? ??????
(2004?2007 ??.). ?? ????????? ?????? ????????????? ???????? ???? ??????????????? ? 69 ?????????, ?????????? ????????? ????-???-?????????, ? ????????, ?? ?????? ????????????? ???????. ?? ???? ????????? 5 ???????? ?????????? (???????? ??????????? ?????????? ???), ? ????????? ? ????????? ?????????????? ??????? ? ???: ??????????? (n = 36) ???
?????????? (n = 28). ????? ??????? ????????????? ???????????, ????????????????? ?? ???? ? ????????, ? ?????? ????????? ????????? ????????? 116,7 ??????? ?? 100 000 ????????-???. ? ?????, ????????????????? ??????????? ?????????????? (standardized incidence ratio ? SIR) ????????? 12,2. ?????? ?????????? SIR ???? ??????????? ???? ??? ??????? ????????????? (SIR = 18,6) ??? ???????????? (SIR = 29,3), ??? ??? ??????? ???????????? (SIR = 1,8). ??? ??????? ??????? ╚??????-????????╩ ?????????, ??? ????????????? ???????????? ??? ??????????? ?????????????? ?????????? ????? ????????????? ???????? ? ????????? ? ???????????? ? 13,3 ? 17,1 ????, ??????????????.
????? ???????, ???????????? ????????, ??? ??????? ??????????? ?????????????? ??????? ? ??? ??????????????
????? ??????? ?????? ???????? ???????????, ??? ??????? ? ?????????????? ??????????? ?????????? ???. ?? ?????? ??????????????, ?????? ???? ?????????? ?????????? ? ????????? ???????? ???? ????? ????-???-?????????? ??
?? ??????????? ?? ?????????-????????? ???, ??? ???????? ? ?????????? ??????? ?? ??????????? ? ????????????
?-??????.
? ???????????? ????? ?????? ????? ????????? ?????????? ???????? ????-???-??????????, ? ??? ????? ? ??? ??????????? ????????????? ????????????????? ? ????? ?????????????? ??????????? ????????? ????????????? ???????? ? ????????? ?? ???? ????-???-???????.
Tubach F., et al.
Risk of tuberculosis is higher with anti-tumor necrosis factor monoclonal
antibody therapy than with soluble tumor necrosis factor receptor therapy:
the three-year prospective French research axed on tolerance of biotherapies registry.
Arthritis Rheum 2009; 60: 1884?94.
www.antibiotic.ru
52
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????????? ??????
??????????? ?????????????????????
??????? ? ?????, ??????? ???????????????
?.?.??????????1, ?.?.??????????1, ?.?.???????2, ?.?.??????2
1
2
????????? ??????????????? ??????????? ????????;
????????? ???????????? ??????????? ????????
??? ???????????? ????????????????????? ??????? ? 69 ?????, ??????? ?????????-????????? ??????? ?????????????, ? ?????? ??????????? ???????? ????????????????? ????? ????????? ??????? ? ???????? ????????? ??
?????????. ?? ???? ???????? ????????? ??????? ? ????? ? ???????? ?? ????????? ??????? ??????????? ??????
?????????? ????????? ???????? ????????? ??????????. ?????? ??????????????? ? ????????? ????? ? ?????,
??????? ??????????????, ?? ????????? ?????? ???????????? ????, ?????? ??????????? ??????????? ??? ????????? ?????? ???????? ???????????? ?? ??????. ?????????? ????????? ????????????????????? ??????? ?? ??????????? ???????????? ???????? ? ??????? ????? ????????????? ???????, ??? ??????????????? ? ????????????? ?????????? ?????????? ???????????? ????????????????, ?????????? ????????????. ???? ?????????? ???????????????
? ???????? ? ???? ? ???? ????? ???? ??????????? ??? ????????? ????????? ? ?????? ????????????????? ????????? ?
?????? ? ????????? ????? ??????? ??????? ???????????.
???????? ?????: ????????????, ????, ?????????, ????????????????
Specific features of the enzyme excretory function
in children in salmonellosis
M.S.Grigorovich1, I.A.Chastoedova1, Yu.G.Votyakov2, E.V.Yurlova2
Kirov State Medical Academy;
Kirov Infectious Clinical Hospital
1
2
In studying the enzyme excretory function in 69 children with the gastroenteric forms of salmonellosis at the height of disease
a redistribution of the ways of excreting amylase and alkaline phosphatase from the body was revealed. On the background of
a high excretion of amylase with feces and its decreased renal excretion a sharp decrease of the excretion of alkaline phosphatase by the intestines was observed. The animotransferase levels in blood serum in children with salmonellosis did not
exceed standard values, however, a lower de Ritis ratio characteristic for liver damage was observed. The revealed changes of
the enzyme excretory system cannot be eliminated by conventional therapy at the standard terms of hospital treatment, which
indicates a need for further development of rehabilitation of convalescent patients after salmonellosis. Follow-up of the aminotransferase and hydrolase levels in urine and feces might be used to specify the state and terms of restorative processes in the
kidneys and the intestines after the acute period of disease is over.
Key words: salmonellosis, children, hydrolases, aminotransferases
?
???????????? ???????? ????? ?? ?????????? ?????????????? ???? ? ????????? ?????? ???????? ???????? (???), ??????????????? ?? ??????????? ????? ???????? ??????? ? ?????? ?????????? ????? ?????????
?????????? ????? [1, 2]. ????????? ??????????? ? ?????????? ? ????????? (????????? ??????? ?????????????),
??????????? ??? ??????????????? ????????, ????????
????????? ????? ????????? ????????? ???????????, ????????? ???????????? ??????? ?? ?????????????? ????????? ??????? ???????????, ?????? ??????? ? ??????, ?????
?????????? ?????? ?????? ??????. ? ????????????????
??? ???????????????:
?????????? ?????? ?????????, ???????? ??????????? ????, ??????,
?????????? ???????? ???????? ????????
????????? ??????????????? ??????????? ????????
?????: 610002, ?????, ??. ????????????, 161
???????: (8332) 37-6614
?????? ????????? 30.05.2009 ?., ??????? ? ?????? 15.09.2009 ?.
?????????????, ??? ? ??? ?????? ???, ??????? ??????????? ????????? ?????????? ??????????? ???????????,
????????? ? ????????????? ?????????????? ? ????????????? ?????????, ?????????? ?????????????????? ?????????, ????????????? ???????? ?? ?????????? ? ???????????
???????? ????? [3].
???????????? ????????? ??? ??????? ??????? ????????
????? ??????????? ? ??????????? ?????????????? ?????????? ???????????? ??? ????????? ??????????????? ? ?????????????? ?????????? [4, 5]. ????? ?????????? ??????????????? ???????, ????????? ????????? ???? ????????????????? ??????? ? ????????? [6?8]. ???????????????
???????? ?????????????? ? ? ????????????????? ???????
(??????, ?????).
?????? ?????????? ???? ?????????? ????????? ??????????????? ????? ? ?????, ?? ???????? ? ????? ? ???? ??????????? ?????? ??????????? ?????????? ???????????? ???????. ???????? ??? ???????? ??????????? ?????????? ???
53
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.?????????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 53?57
???????????? ???????. ?????? ? ???, ? ??????????? ?????????? ??????? ?????????? ?????? ? ???, ??? ? ?????, ?????????? ???, ??????? ?????????? ???????? ??????????
????????? ????? ????????????? ?????? ? ?????? ???
?????????????? ???????????? (???), ????????? ??????????? ????????? ?????????????? ?????????? ???????????????? ??????.
???????? ???????? ? ??????? ????????????? ? ?????
????????? ??????? ??? ? ?????????????? ?????????? ??????, ?????, ??? ? ? ??????????-????????????? ??????????
? ???????, ?? ?????????? ???????????? ???????????? ???????? ??? ??????????????? ?????? ??????? ?? ?????. ???????? ???? ????????? ???? ?? ????? ?????? ??????????????? ????? ????????? ????????? ? ????????. ? ??? ?????? ??????????? ??????????????? ??????? ????? ??????????? ?????????, ????????????? ????????, ?? ???????? ????????? ? ?????.
???? ?????? ? ?????????? ?????????? ???????????????
????????? (??????? ? ???????? ?????????), ??????????????? ? ?-?????????????????????? (????) ? ????????? ?????, ???? ? ??????????????? ? ????? ? ?????????????? ? ???????? ???????.
???????? ? ??????
??? ??????????? ?????????? 70 ?????, ??????? ??????????????, ? ???????? ?? 1 ???? ?? 13 ???, ?????????? ???????????? ??????? ? ??????? ???????? ????????? ?????????
???????????? ??????????? ????????. ???????????? ????????? ? ????????????? ???????? ?????????. ????? ?????????
????????????? ??????? ????????? ???????. ????????????
???????????? ???????? ? ?????? ??????? ??????? ??????????? ????????? ???????? ????????? ??????????? ????????????? [9]. ????????? ?????????????? ????????????? ????? ???????????? ? ????. 1.
? ????????? ????????????? ??????????? ???? ? ???????? ?????? 3 ???. ?? ????????? ???????-?????????????????? ?????? ???? ???????????, ??? ? 69 (98,6%) ??????? ????????? ?????????-???????? ????? ?????????????????? 1. ?????????????? ????????????? ????? ? ??????????????? ?????????
?????????
???.
%
?????
70
100
???????
?? 1 ???? ? 3 ???
19
27,2
?? 3?7 ???
18
25,7
?? 7?13 ???
33
47,1
?????????? ??????? ? ??????????? ?????
?????????????
8
11,4
???????????
26
37,2
?????????????????
35
50,0
??????????????
1
1,4
??????? ???????
?????????????
53
75,7
???????
16
22,9
????? ?????????????? ?? ?????? ???????????
1-? ???
24
34,3
2-? ???
25
35,7
3?4-? ???
21
30,0
??? ???????????
S. enteritidis
55
78,6
S. typhimurium
10
14,3
??. ???????? ??????????
5
7,1
54
??, ? 1 (1,4%) ? ??????????????. ??????????? ?????????
??????????????? ? ???? ?????????????????? ??? ????????????, ???? ??????????????. ??????????? ????????????? ????? ???????, ?????? ???? ?? ???? ????????????????. ? ??????????? ??????? ???? ????????? ? ?????????
?? 1?2-? ????? ???????????. ???????????? ?????????
???? S. enteritidis.
??????????? ?????????? ????? ? 61 (87,1%) ???????, ????????? ?????? ??????????? ? 8 (11,4%) ?????. ?????????? ???????? ????????? ? ?????????????? ??????? ?????????? ? ????????? ???? ?????????? ?????, ? ???????????????????? ????? ??????????? ?????? ? ????? ?????? 3 ???. ????????? ?????????? ???????? ?????? ?? ??????? ???????? ? 5 (7,1%)
???????. ??????? ????? ??????? ???? ????????????????
??? ???????? ?????????????, ?????????? S. enteritidis (75,0%)
? ????? ????????? ???????? (56,3%), ???? ? ? ????? ??????
??? ????? (6,3%) ? ??? ????????????? S. typhimurium.
??????????? ?????????? ? 46 (65,7%) ???? ???????? ?
??????? 2 ?????? ? ??????? ??????????? ? ???????. ???
???? ??????? ????????????????? ?????????????? ?????????
12,8 ?????-????. ???????????? ?????????? ? ?????????? ???????? ?? ??????? ???????????. ??? ???? ???????? ??????????? ??????? ???????? ????????? ??????????? ????????????? [9].
??? ?????? ????????????????????? ??????? ? ????? ?
?????????-????????? ??????? ??????????????? ???????? ??????????? ?????????? ???????, ???????? ?????????, ??????????????? (???????????????????????? (???)
? ?????????????????????? (???)) ? ???? ? ?????????
???????????? (????????? ?????, ????) ? ???????????????
? ??????????? ??????? ?????????, ??????????? ??????
VITAL DIAGNOSTICS (?. ?????-?????????). ???????????
??????????????? ?????????? ? ????????????? ????????????? ??? ?????? ???????????????? ?????? ??????? [10].
???????????? ?????????? ???????? ????????? ? ???? ?
????????? ?????, ???? ? ??????????????? ?????????????
???????????????? ????????, ? ???????????? ? ???????????? ????????????. ??? ??????????? ??????????? ???,
??? ? ????????? ????????????? ?????? ????????? ????????????????? ???????????????????????? ????? ?? ????????-???????? [11]. ????? ??? ???????? ?????? ???????????? ?? ??????, ??????? ?????????? ??????????? ??????????? ??? ? ??? ? ????????? ?????. ??? ???????????? ??????? ?????????????? ?????????????? ????????????? ????????? ? 5 ???.
???????????? ????????????????????? ??????? ? ???????
???? ????????? ? ?????? ??????????? ?? ???? ????? ??????????? ???????????? (3?5-? ???? ? ??????? ??????????? ?????????) ? ????? ???????? ?? ??????????. ?????????? ???????????? ? ????? ? ??????????????? ????????? ?????????? ? ???????????? ???????? ????? ???????????????? ???????? [12].
?????????????? ????????? ???? ?????????? ?????? ?????????????? ?? ?????????? ? ?????????????? Microsoft
Excel, ? ????? ??????????????? ?????? Biostat. ?????????
??????? ?????????????? (?), ??????????? ?????? (m).
??? ?????? ???????? ????? ???????????? ????????????
t-???????? ?????????. ???????? ????????? ????????????
??? p < 0,05, ?????????????????? ? ??? p < 0,01 ? p < 0,001,
?????????????? ? ??? p > 0,05.
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
??????????? ????????????????????? ??????? ? ?????, ??????? ???????????????
??????? 2. ?????????? ??????????????? ????????? ? ????????? ????????????? ?????? ? ????? ? ?????????????? ? ??????????? ?? ??????? ??????? ? ?????? ??????? ??????????? (M ╠ m)
????????
????????????? ?????
???????? ????, n = 30
??????? ? ?????? ??????? ???????????
????????????? ?????, n = 52
??????? ?????, n =17
???????
????????? ?????, ??/??
20,8 ╠ 0,5
17,2 ╠ 0,9**
19,9 ╠ 1,8
????, ??/??
54,7 ╠ 12,3
32,7 ╠ 4,0*
29,3 ╠ 6,2
?????????????, ??/?
676,0 ╠122,0
1132,9 ╠ 154,7*
1226,3 ╠ 192,9*
???????? ?????????
????????? ?????, ??/??
0,44 ╠ 0,02
0,75 ╠ 0,04***
0,53 ╠ 0,01
????, ??/??
9,4 ╠ 1,0
11,8 ╠ 1,6
9,7 ╠ 0,8
?????????????, ??/?
5,2 ╠ 0,22
1,980 ╠ 0,27***
2,463 ╠ 0,56***
????? ? ????? ? ??????? 3 ? ?? ??????? * p < 0,05, ** p < 0,01, *** p < 0,001, t ? ???????? ????????? ?? ????????? ? ??????? ???????? ?????
??? ???????, ? ?????? ??????? ? ??????? ?????????? ????????? ?? ?????????. ????? ????, ??????????? ??????????????? ?????????? ???? ?????????? ? ?? ???? ?-????
??? ????????????? ??????????? ??????????? ? ?????, ?????-??????? ?, ??-????????, ?-???????. ???? ?-??????? ????? ??????????????, ? ??????????? ?? ???????? ? ???? ???????????? ? ????????? ????????? ?????????????, ???????
?????? ???????? ? ?????????? ????????? ?? ???????????.
?????? ??????????? ?? ????????? ???????????, ??????
?????? ??????, ?????????? ??? ?????? ?????? ???????
??? ????????? ??????????? ???????? ?????? ?????????? ????????? ????? ??????? ? ?????????????? ? ?????????
?? ????????? ????????? ???????? ? ?????.
? ???????????? ???????? ?????, ??????? ??????? ???????? ??????? ??????????? ?????????? ???????? ???????????? ???????? ??????????????? ?????????? (p < 0,01)
???? ? ??????? ????? ???? ???????????, ??? ??????????
? ????????? ?? ????????????? ?????? ???????????
?????????? ?????? ???????? ????????? ? ????????? ???(????. 2). ?????????? ????????, ??? ?????????????? ??
?? (? 1,7 ???? ? ????????? ?? ????????????? ?????? ?????????? ???????? ?????? ?????????? ???????? ? ?????, ??
???????) ?????????????? ?????? ????????? (? 2,5 ????)
? ????????????????? ????? ????????? ?????? ?? ???????????????? ???????? ?????????? (???????). ????? ?? ????. ???, ????????? ??????? ??????? ??????????? ?
?????, ??? ? ??????? ? ??????? ?????? ???????????, ??1,5 ???? ? ???? ????????????? ?????????, ? ?????????
?????-??????????? ?????????? ????????? ????? ????????????? ??????????, ????????, ???????? (???????). ??????? ???? (p < 0,05), ??? ? ????????? ?? ?????????????
???????? ?????????? ???????????? ??????? ?????? ??????????. ??????? ?????????????? ??????????, ????????,
?????????? ???????????? ????? ???????? ? ??????????????? ? ?????????? ????????? ????????? ???????? ????????? ???????: ?????????? ???????? ???????? ? ?????
???????, ??????????? ??? ????????????? ? ????????????????????? ??-?? ????????? ??????????????? ??????????
???? ??????????? ???????? ? ??????? ??????????? ?
????????????? ?????? ? ??????? ????? ?, ????????,
?????. ?????????? ?????? ????????? ?? ????????? ?????????? ???????-??????????? [13]. ?????????? ?????????
?????????? ?????????? ????-??????????????? ? ????-?????????? ?????????? ??????? ? ???, ??? ? ????? ? ???????????? ???????? ??? ???????? ??? ??????????????? ???????? ????????? ??????????? ??? ?????????????, ???????? ? ?????.
????????? ?????? ????? ?????? ???? ?????????????????
?????????? ???????????? ??????????? ??????? ???,
???????? ? ?? ? ?????? ???? ??????????? ??????????????? ? ???? ? ????????? ?????, ???? ? ???????????????
???????????? ? ????. 3. ??? ??????? ??????????? ???????%
200
??? ??????????????? ? ??????????? ?? ??????? ??????? ??*
180
????????? ????? ?????????, ??? ?????? ??? ? ??? ? ????*
*
*
????? ????? ????????????? ??????????????? ?? ????????160
????? ???? ??????????? ? ???????. ???? ?????????? ???140
???????????? ? ????????? ????? ? ?????, ??????? ??????120
????? ????????, ?? ????????? ?????? ???????????? ????, ???
?????????? ???????????? ? ?? ??????????
100
80
60
*
*
*
*
*
40
*
20
0
???????
???????
???????
?????
??????
???????
???????
???????
???????
?????
??????
??
?????
????
???
???????. ?????? ??????????????? ????????? ? ?????????
????????????? ?????? ? ?????, ??????? ??????????????, ?
?????? ??????????? (% ?? ??????????? ???????? ?????, ???????? ?? 100%)
??????? 3. ?????????? ???, ???, ???? ? ????????? ????????????? ?????? ? ??????????? ??? ? ??? ? ????????? ?????
? ?????, ??????? ??????????????, ? ??????????? ?? ???????
??????? ??????? ? ?????? ??????? ??????????? (M ╠ m)
???????????
?????????????
?????????????
???????
??????????
?????
?????
?????
n = 52
n = 17
???, ??/?
????????? ?????
12,4 ╠ 1,2
20,1 ╠ 5,6
????
3,2 ╠ 0,2*
8,6 ╠ 4,5*
?????????????
38,1 ╠ 3,0
38,8 ╠ 2,3
???, ??/?
????????? ?????
16,7 ╠ 2,2
19,6 ╠ 2,8
????
4,3 ╠ 0,3
4,5 ╠ 0,4
?????????????
40,5 ╠ 3,7
41,1 ╠ 3,0
???/??? (????????- ????????? ?????
0,9 ╠ 0,1
0,6 ╠ 0,1
??? ?? ??????)
????, ??/?
????????? ?????
16,2 ╠ 1,0*
20,5 ╠ 1,8*
????
19,0 ╠ 1,0
18,7 ╠ 1,8
?????????????
178,5 ╠ 12,4
214,9 ╠ 23,4
55
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.?????????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 53?57
??????? 4. ?????????? ??????????????? ?????????, ??????????????? ? ???? ? ????? ?????? ?????, ??????? ??????????????, ? ???????? ??????????? (M ╠ m)
??????????
???????????????????? ?????
?????* ????????? ?????
????
?????????????
???????, ??/?? 1-?
17,5 ╠ 0,8
31,4 ╠ 3,5
1153,2 ╠ 122,6
2-?
16,6 ╠ 0,9
27,3 ╠ 3,6
1414,5 ╠ 195,1
????????
?????????, ??/?? 1-?
0,561 ╠ 0,04
10,8 ╠ 3,5
2,089 ╠ 0,248
2-?
0,519 ╠ 0,04
10,6 ╠ 1,2
2,217 ╠ 0,318
????, ??/?
1-?
17,4 ╠ 0,84
18,5 ╠ 0,84
180,4 ╠ 11,69
2-?
17,0 ╠ 1,0
15,0 ╠ 0,67
177,0 ╠ 10,02
???, ??/?
1-?
12,3 ╠ 0,9
3,4 ╠ 0,2
43,2 ╠ 4,3
2-?
11,0 ╠ 1,3
3,3 ╠ 0,3
35,4 ╠ 2,4
???, ??/?
1-?
17,5 ╠ 1,8
4,1 ╠ 0,1
42,6 ╠ 3,6
2-?
17,7 ╠ 2,5
4,2 ╠ 0,3
53,3 ╠ 7,0
???/???
1-?
0,86 ╠ 0,07
?
?
2-?
0,76 ╠ 0,04
?
?
*1-? ???????????? ? ? ?????? ??????? ???????, 2-? ???????????? ? ?????
???????? ?? ??????????
??????? ??????????? ??????????? ??? ? ??? ????????????
??????????? ??? ????????? ?????? ???????? ???????????? ?? ?????? (????? 1,0), ??? ??????????? ? ??????? ??????
?????????????? [14, 15]. ????? ????, ? ??????? ? ???????
?????? ??????????? ?????????? ??? ? ???? ???? ?????????? ???? (p < 0,05), ??? ? ????????? ?? ?????????????
??????. ???????????? ??????? ?? ?????? ??????????????? ? ??????????????? ? ??????????? ?? ??????? ??????????? ?? ????????.
?????????? ?????????? ???? ? ????????? ????? ? ?????,
??????? ??????????????, ?????????? ????? ? ???????? ?????? ?????????? ????? (2?40 ??/?). ?????? ??? ?????? ?????? ???????? ? ??????????? ?? ??????? ??????? ???????????
???????? ??????????? ????????? ???????? ? ????? ? ?????
? ??????? ?????? ??????????? ? ????????? ?? ?????????????. ?????????, ??-????????, ????????? ?? ??????? ????????? ? ???????? ????????????????? ????????? ? ???????
? ??????? ?????? ???????????, ??? ??????????? ? ???????
?????????? [15].
????????? ????????????, ??????????? ????? ????????
????????? ?? ??????????, ???????? ?????????? ????????
??????????? ???????, ???????? ?????????, ??????????????? ? ???? ? ??????????? ????????????? ??????????
(????. 4). ??????????? ?????????? ????????? ??????? ?????????? ?? ???? ?????? ??????????????? ?????????? ????? ? ????. ?? ??????????? ???????????? ?????? ????????
????????? ? ????? ? ????. ?????????? ?????? ??????????????? ? ???, ??? ? ???????????????? ????? ???????? ??
?????????? ?? ?????????? ??????? ?????????????? ?????????????? ?????????? ??????, ????? ? ?????????.
?????????? ???????????? ???????????? ????????????
????????? ? ???????????? ?????????? ???????? ? ???, ???
?????????????? ???????? ??? ??? ????? ????????? ???????? ? ?????????? ??????? ????????? ???????, ? ??? ?????
??????, ?????, ????????????? ?????? [14?17]. ???????? ????????????????? ???????? ??? ????????????? ? ???????
?????? ????????????? ????? ???????? ? ????????? ?????????????-????????????? ????????? ?? ?????? ??????? ?
????????, ?????????? ???? ??????????? ???????? ????????? ?? ?????? ??????. ????? ????, ??????????? ??? ??? ????????? ????????? ???????? ?????????????????? ?????????
??? ? ?????? ??? ??????????? ?????????? ???????????? ?
56
???????? ?? ??????, ????? ? ?????? ??????. ????????????
?????????????? ?????????? ??????????, ? ??? ????? ??????????????? ????????, ??????? ??????????? ????? ???????????? ??????????? ?????????? ??????? ??????? ???????????. ?????????? ?????? ????????? ?? ?????????????
?????????? ?????????? ???????? ????????????? ?????????? ??????????, ????????????????? ? ?????????????? ??????? ? ????????? ?????????? ??????????? ?????????? ? ?????, ??????? ??????????????, ??? ????? ??????????????
????????? ? ??? ??????? ???????.
??????
1. ? ?????, ??????? ??????????????, ??????????? ????????????????? ????? ????????? ???????? ?? ?????????
?????????? ????????? ?????????????-????????????? ????????? ?? ?????? ??????? ? ????????. ????????? ? ????????? ?????????? ??????????????? ? ????????? ????? ? ??????????? ?? ??????? ???????? ? ???????? ????????????
?? ?????? ? ??????? ?????????????? ???????? ??????????
? ?????????????? ??????? ??????.
2. ?????????? ????????? ?????????????????????
??????? ?? ??????????? ???????????? ???????? ? ???????
????? ????????????? ???????.
3. ????????? ??????????? ??????????????? ??????????
???????? ?????????? ?????????? ????????????, ?????????????? ??????????? ? ????????????? ?????????; ???? ?????????? ??????????????? ? ???????? ? ???? ? ???? ?????
???? ??????????? ??? ????????? ????????? ? ?????? ????????????????? ????????? ? ?????? ? ????????? ????? ???????
??????? ??????????? ??? ????????????? ? ?????.
4. ?????????? ???????????? ??????????????? ? ????????????? ?????????? ?????????? ???????? ???????????? ????????????????, ?????????? ????????????.
??????????
1. ????? ?.?., ?????? ?.?., ???????? ?.?. ??????????????????? ??????????,
?????????? ?? ??????? ????? ?? ??????????? ?????. ???????????? ??????? 2007; 5 (4): 41?4.
2. ???????? ?.?. ??????????? ??????????? ???????????? ?????????????, ?????????? S. ?nteritidis ? ?????. ???????????? ??????? 2003; 1(1): 26?9.
3. ?????????? ?.?., ???????? ?.?., ????????? ?.?., ? ??. ????????????????
??????????? ? ?????, ?????????? ?????? ???????? ????????. ????????? ?????-???????????? ??????????? ? ?????? ╚???? ????????2007╩ ╚????????????????? ?????????????? ???????? ? ????? ?????????? ????????????? ??????? ╚????????╩. ?? ???????? ? ????????╩ 13?14 ???? 2007. ?.,
2007; 13?4.
4. ????????? ?.?., ??????? ?.?. ??????? ? ??????????? ? ???????
???????????????????????. ??????? ??????? ?????????? 2008; 6(1): 9?11.
5. ???????? ?.?. ?????????????????? ?????????, ????????? ???????-???????????? ??????????? ? ?? ????????? ??? ??????????? ????????? ? ????? ??????? ????????: ???????. ????. ? ????. ???. ????. ?????, 2008; 37.
6. ????????? ?.?. ??????????????-????????? ??????? ?????????? ??????
?????? ????? ? ????? ? ??? ?????????. ??????? ???? 1996; 1: 37?41.
7. ?????? ?.?., ????????? ?.?., ????????? ?.?., ? ??. ???????????????
???????? ? ?????????-???????? ??????, ????? ? ????????? ??? ????????? ?????????????? ??????????. ??????. ????. ??. ?.?.???????? 1992;
78(9): 76?83.
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
??????????? ????????????????????? ??????? ? ?????, ??????? ???????????????
8. ??????? ?.?., ?????? ?.?., ??????? ?.?., ? ??. ???????? ??????? ?????. ??????. ?????? ??. ?.?.???????? 1993; 79 (6): 128?32.
9. ??????? ?.?., ???????? ?.?., ?????? ?.?. ??????????? ???????????? ?? ??????????? ? ??????? ?????? ???????? ???????? ? ?????. ?., 2005.
10. Riet H.G., Van Hockes J.O. Amylase and lipase values in normal subjects. Clin
Chim 1998; 19 (3) 6: 459?67.
11. Reitman S., Frankel S. Amer. J Clin. Pathol 1957; 28 (56): 257?60.
12. ?????????? ?.?. ????????? ???????????, ??????? ? ???????? ????????? ?
????? ? ???????? ? ??????????????. ???????. ????. ?????. ???. ????. ???????????, 2001; 18.
13. ??????? ?.?., ?????? ?.?. ??????????? ?????????????????. ?.: ?????, 1981;
277.
14. ??????? ?.?. ???????????????? ????????? ????????????????? ????????
??? ?????? ???????? ????????? ? ?????? ??? ?????????. ???????. ????. ?
???. ????. ?., 2007; 23.
15. ??????? ?.?., ??????? ?.?., ?????? ?.?. ? ??. ?????????????? ????????? ?????? ? ??????? ???????? ?????????????????. ???????????? ???????
2008; 6(2): 37?41.
16. ???????? ?.?., ?????????? ?.?., ????????? ?.?. ??????????? ?????????????? ??????? ? ?????, ??????????? ???. ????????? ????????????? ?????????????????? ??????????? ╚??????? ???????????? ? ???????????? ???????????? ??????????? ? ?????╩ 10?12 ??????? 2006. ???., 2006; 63.
17. ???????? ?.?. ?????????????? ??????????? ?????? ??? ????????? ?????????? ???????? ?????????. Consilium medicum 2005; ????????????: 3.
?????????? ? ?????????:
?????????? ????? ?????????????, ???????? ??????????? ????,
?????? ??????? ?????????? ??????????
????????? ??????????????? ??????????? ????????
?????: 610027, ?????, ??. ?. ??????, 112
???????: (8332) 37-4767
??????? ???? ??????????, ??????????? ???????? ?????
?? ??????????????-???????????? ??????
????????? ???????????? ??????????? ????????
?????: 610026, ?????, ??. ??????, 207
???????: (8332) 33-1329
?????? ????? ??????????, ????-?????????
????????? ???????????? ??????????? ????????
?????: 610026, ?????, ??. ??????, 207
???????: (8332) 33-1329
????????????? ??????????? ??????
?????? ?????????????? ??????????? ???????? ???????? ? ?????
???????? ??????????? ????? ???????????? ????? ???????????? ???????? ??? ??? ?????????, ??? ? ??? ??????????????
????????? ?????????? ??????. ????????????? ?? ??????????????? ????????? ?????????? ?????? ????????? ??????????
???????? (??????) ????????? ????????, ??? ??????? ???????????? ???????? ???????? ???????? ???????? ????????? ????????????? ?????????? ?????????????? ???????????? ? ??????? ??????? ??????????????? ?????????? ????????????.
????????? ????????????????? ?????????????? ????????????, ? ??????? ??????? ??????? 204 ??????? ? ???????? ?? 3 ??
36 ???, ???????? ??????? ?????????? ?? ??????? ?? ?????? ??????? ? ??????? ???????? ??????????? ?????, ??????????? ? ?????????? ???????????? ????. ????????? ???????????? ???? ????????? ??????? ???????????? ???? ? ?????? ?????????? ????????-???????????? ?? ?????? ????????? ?? ??????????? ??????? ??? ????????? ???????? ????????? ???????????, ???? ? ?????? ???????????? ??????? ????????? ? ???????????? ? ?????????? ????????? ?????????? ??????. ? ???? ???????????? ?? ???? ???????? ????????????? ??????????? ???????? ????? ???????? ?? ???????????? ???????, ?????????? ?????????????? ???????????? ? ??????? ?????????? ???????????? ? ?????????? ?????????? ??????. ? ?? ?? ?????
???? ???????? ?????????????? ???????????? ????????, ? ?????????, ???????????? ???????? ??????? ?????????? ???????????? ????? ??????? ?? ????????? ?????????? ?????? (? ?????? ?????????, ??????? ??????????? ????????-????????????,
????????????? ???? ???????? 0,36, 95% ????????????? ???????? 0,14?0,95).
????? ???????, ?????? ?????????? ????????-??????????? ???????? ???????? ??????????? ????? ? ?????????? ?????????? ?????? ?? ?????? ?? ??????? ??????? ????????? ? ????????? ?????????? ??????, ?? ????? ??????? ??????? ?????????? ???????????? ????? ??????? ?? ????????? ?????????? ??????.
Doan Q.H., Kissoon N., Dobson S., et al.
A randomized, controlled trial of the impact of early and rapid diagnosis of viral infections
in children brought to an emergency department with febrile respiratory tract illnesses.
J Pediatr. 2009; 154(1): 91?5.
www.antibiotic.ru
57
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????? ??????????
?????? ? ???-????????
?.?.????????, ?.?.?????????, ?.?.??????, ?.?.??????????
????????? ??????????????? ??????????? ???????????
?? ??????????? ???? ?????? ? ????? ?????? ???????????????? ???????? ???-?????????????? ?????????. ?? ??????
?????? ??????? ? ??????????? ???????????, ??? ?????????????? ???????? ? 30?80% ???????. ??? ???? ??????? ???????? ?????? ?????????? ? ????????????????? ???-????????. ????????? ???????, ?????, ??? ?????? ?????? ?????? ?????? ?? ?????? ??????? ?????, ??????????? ?????????????????? ???????, ????????????? ?????????? ???????????? ???????? ?????? ?? ?????? ?????? ????????????? ????????. ? ??????????? ??????? ?????? ????? ???????????????? ???????? ? ???????? ????????? ?????? ???? ╚?????? ???????????? ???????????╩. ???????? ?? ?? ??????? ??????? ? ????????? ???-??????????????, ???????? ??????????? ?????? ????? ??????????????? ???????, ? ???????? ???????????????, ????? ??? ??? ????????? ???????????????? ??????? ?? ???????? ? ????????????????? ????? ???????
???-?????????. ????????? ?????? ??????????? ????????????? ? ?????????? ??????????? ???????? ????? ???????.
???????? ?????: ???-????????, ??????, ???????? ?????
Anemia and HIV infection
G.R.Khasanova, E.Yu.Stepanova, V.A.Anokhin, A.A.Abrosimova
Kazan State Medical University
Presently anemia is the most common hematological problem of HIV-positive patients. According to data of various authors and
the authors? own observations, it is recorded in approximately 30?80% of patients. The frequency of development of anemia
increases with the progress of HIV infection. Various factors, such as the direct effect of the virus proper on blood red cells, impact
of opportunistic agents, drugs promote the development of anemia at varied stages of the infectious process. In the majority of
cases, anemia has a polyetiologic character and is a kind of ╚chronic disease-related anemia╩. In spite of its high incidence rate
among the population of HIV-positive individuals, symptoms of the developed anemia are often overlooked by medical doctors,
and its significance is underestimated, whereas it has a direct effect on the quality of life and survival time of patients with HIV
infection. Correction of hemoglobin levels is associated with improvement of the life quality indices in such patients.
Key words: HIV infection, anemia, quality of life
?
????? ? ?????? ??????? ???-????????; ?????????? ?
30% ??????? ?? ????????????? ?????? ??????????? ? ?
70?80% ??????? ?? ??????? ????? [1]. ? ????, ???????????????? ????????? ?????????????? ????????????????? ??????? (?????), ??????? ??????????? ?????? ? ??????? ????? ????? ??????????? ????????? 80?90% [2, 3]. ? ??????????? ????????????, ?????????? ????? 7000 ?????????, ????????? ?????? ???? ???????? ? 58% ??????? ???-?????????, ??????? ?
? 1,4% ????????? [4]. A.Levine ? ?????. ??????????? ?????????????????? ?????? ? ??????? 2056 ???-??????????????
?????? ? 569 ??????, ???????????????? ???. ?????? (???????? ??????????? ????? 120 ?/?) ???? ???????? ? 37% ?????? ? ???-????????? ? ?????? ? 17% ????????????????
(p < 0,001). ? 1-? ?????? ?????? ?????????? ???? ???????????
? ????????? ? ??????? CD4+-?????? ????? 200 ? ??3, ???????
??????? ??? ??? ? ??????, ???????? ????-????????? ??????????? ? ??????????? ?????????? [5]. ? ?????? ????????
?????, ????????? ? ??? ??? ???? ???? ? ????????? ?????? ?
????? ? ???-?????????, ????????????? ??????? ??????? ???,
???????????????? ????, ??????? ????? ????, ?????? ??????? ??????????? [5?8].
??? ???????????????:
?????? ???????? ??????????, ?????? ??????????? ????, ?????????,
?????????? ???????? ??????? ???????????? ????????
?????????? ???????????????? ???????????? ????????????
?????: 420012, ??????, ??. ?????????, 49
???????: (843) 236-0922
?????? ????????? 25.02.2009 ?., ??????? ? ?????? 15.09.2009 ?.
58
??????? ?????? ????????? ? ?????? ?????????????? ?
?????????? ? ????????? ? ???-????????? [9?12]. ? ????????????, ??????????? A.Mocroft, ?????????? 6725 ???-?????????????? ?????????, ??????? ??????????? ??????? ? ??????? ???? ?????????? ? ????????? ??? ??????, ?? ??????? ?
??????? ????????? ?????? ????????? 3, 16 ? 41%, ?????????????? [4]. ? ??????????? ????????????? ???? ???????????
?????????? ???????????? ?????? ? ??????? ???????????????? ???-????????. ? ????? ?? ???????????? ????????
???????????????? ?????? ?????? 2027 ?????????, ?????????? ?????, ? ??????? ?????????? ???? ????????????????
???-???????? (RH) ? ??????? ? ???????. ???????????????:
??????? CD4+-??????????, ???????? ????????, ???????
????-????????? ??????????? ?? ?????? ??????? ? ???????
??????????? (Hb). ?????? ? ????????????? ??????? ??????
????????????????? ??? ?????? ??????????? 80?140 ?/? ???
?????? ? 80?120 ?/? ? ??? ??????, ??????? ?????? ? ???
???????? ??????????? ???? 80 ?/?. RH ? ????????? ????????? ??? ??????? ?????? Hb, ????????? 2,2 ? 7,1 ??? ???????
? ??????? ??????? ??????, ?????????????? [13]. ? ???????????? ?.Levine ???? ???????????, ??? ?????? ?????? ? ??????
?????????, ??? ???????? ?????????? CD4-?????? ???? 200 ?
??3, ???????? ????????? ????? 50 000 ?????/?? ? ????????
??????????? ????????? ?????, ???????? ??????????? ?????????? ?????? ? ?????? (RH = 2,58; p < 0,001) [1]. ???????
?????? ???? ???????? ? ?????????? ????????????
╚WIHS╩[9].
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?????? ? ???-????????
? ???????????? P.S.Sullivan ? ??????, ????????????? ????
?????? ??? ????????? ? ??????? ??? ?????? CD4+-?????? ?????
200 ??????/??3 ??? ?? 148% ????, ??? ? ??????? ? ????? ??
??????? ???????????????, ?? ??? ??????. ? ????????? ? ??????????????? (??????? CD4+-?????? ????? 200 ??????/??3) ????
?????? ??? ??????? ?????? ???????????? ?? 58%. ?????????,
??? ????????? ?????? (?????????? ?? ?? ???????? ???????)
??????????? ???????? ??????? ??? ????? ????????? [3].
? ??????????????? ???????????? R.D.Moore ? ?????? ? ???????? 2348 ????????? ????? ???? ???????????, ??? ??????, ?????????? ?? ?????? ??????????????? ????????, ??????? ?? ????????? ???????????? ?????????, ? ????????? ?? ????????????? ? ?????????? ????????????????? ????? ??????? [14].
?????????? ? ????????? ????? ????????? ??????????? ???????? ??????? ? ????????? ????????????????? ????? ????????????????? ?????????. ? ????? ? ???? ? ????????? ??????????? ???????????? ???????? ????????? ???????? ????????
????? ???????. ????? ????????? ? ???????? ?????????????
??? ?????????????? ????????????, ????? ???????????? ????????????? ??????? ????????? ?????? ?? ????????????????? ?
???????? ????? ???????? [15, 16]. ???-???????? ? ? ??????????
?????? ?????????????? ????????? ? ??????? ?????????????.
?? 10 ?? 30% ??????? ?? ????????????? ?????? ???????????
? ????? 50% ?????????, ??????????? ?? ?????? ????, ????????, ??? ???????????? ?????? ?????????? ???????????? ? ???????? ???????? ?? ?????? [17, 18]. ?????? ?????????????
??????? ???????? ????? ????????, ???????????? ????????, ?????????? ????????????, ????????? ????????????, ?????? ?
????????? ? ???? ???????? ????????????????? ? ????????????? ??????????? ?????????? ?????????? [8, 19, 20].
? ??????????????? ???????????? R.D.Semba ? ?????? ?????? ??????? ??????? 1406 ???-?????????????? ?????????
?????? 13 ???. ??? ?????? ???????? ????? ???? ????????????
?????????????? ????? Medical Outcomes Study HIV Health
Survey (MOS-HIV). ???? ???????????, ??? ??????? ??????? ??????? ??????????? ?????? ? ??????? ?????????? ??????????? ?
???????? (??????????? ????????). ???????? ?????? Hb ?????????????? ??????????? ?????????? ??????????? ??????????
?????????? ? ??????????? ???????? (?????????? ????????????). ????????? ?? ????? ??????? ?????????, ? ???????, 1,5 ?
2,3 ??????? ?? ?????? 10 ?/? Hb ??? ????????? ? ??????????
??????? ??????????? ? ? ???????, ??????????????. ??? ?????????? ?????????? ??? ????? ????????? 2,7 ? 2,6 [8].
? ???????????? W.Breitbart ? ?????? ????? ???? ????????
?????? ????? ?????? ???????????? Hb ? ???????? ?????????.
?? 427 ????????? 52,7% ???????? ???????????? ?? ???????,
?????????? ????????, ? ????????? ????? Memorial Symptom
Assessment Scale ? ???????? ????????? ? ????????? AIDS-specific Physical Symptom Checklist. ???? ???????????, ??? ??????? ??????? Hb ? ???? ?????? ????????? ??? ?????????? ????,
??? ? ????????? ??? ????????? ? ???????? [21]. ????????????
D.I.Abrams ? ?????? ????? ???????? ????????????? ????????
????????? ???????? ????? ? ????????? ??? ????????? ?????? ???????????. ?????????, ??? ??? ????????? ?? ????? ?????????? ? ??????? CD4+-?????????? [22].
?????? ??????? ??????? ?????? ??? ???-???????? ?????????: ?????? ????????, ?????????? ?????? ? ????? ?????????, ???????????? ???? ?????? ???????, ???????????
??? ???-????????. ? ??? ?????????:
1) ???????? ?? ???????? ?????????? ???, ?? ????? ??????????????? ???????? ?????? ?????? ???????? ?????, ? ????? ????????????? ?????? ?????????????? ? ???????????
?????????, ??????????? ???????? [23]. ? ?????????? ??????????? ?.?. ╚?????? ???????????? ???????????╩. ? ?????????? ? ?????, ???????? ?????? ??? ???-???????? ?????
???? ? ????????? ????????? ????????????? ???????? ???????????. ?????????, ??? ????????????? ?????? ???? ??????
???????????, ?? ?????? ??????, ? 18?77% ???-?????????????? ?????????, ???? ? ???????? ?????? ???????? ??????
????? [24, 25]. ??????, ??? ???????? ?????????? ?????????????? ??????????????????????, ??????? ????? ???????????? ???-???????? [26];
2) ??????? ?????????????????? ???????????? ???????
(?????????? ????????, ????????????, ???????????????, ??????? ? ??.) ??? ?? ???????? ??????????, ??? ? ??????????
??????????? [10, 27?29];
3) ????????? ???????????? ???????? ????? ???????????
???????? [30];
4) ??????? ????????? ? ?????????????? ??-?? ??????????????????? ???????? ??????? (?????????? ???????? ??? ?????????? ??????????????), ???????? ?????????????, ?????????????? ??????????? ?????????? ?????????-????????? ?????? ??????????????????? ????????. ??? ?????????? ??????????, ? ????? ????? ????????? ?? ?????? ?????????????? ????????????? ?????? ???????? ?12, ? ??????????? ??????? ????????? ? ????????? ????????? [31];
5) ?????????-???????? ???????????? ?????????? ?????????? ?????????????????? ??????????? [28];
6) ??????????? ?????? ????????, ???????????? ??? ???????
??????? ???-?????????, ????????? ???????? ??? ????????
???????. ? ??????? ??????? ???? ?????? ??????? ? ????????????? ? ?????? ?? ???????? ????? ???????????? ????????????????? ?????????? [7]. ???????????? ????????????? ?????? ???????? ?????, ? ???????, ?????????, ????????????
??? ??????? ? ???????????? ????????????? ?????????: ??????????? ???????? ?????????? ???????? ???????; ????????????????, ?????? ? ???????? ????? ??????? ??????? ? ??????? ? ????????? ?6?? [32].
? ??????????? ???????, ?????? ? ????????? ? ???-????????? ???????? ??????????????? ?????????? [3, 33, 34]. ?????
????????, ??? ? ??????????? ???????? ??????, ????? ?????????? ?????? ?????????? ?????????? ??????? ? ?????? ??
???????????? ????????? ?????? ???? ?????????, ???????????
?? ?????? ??? ???-????????. ???????? ?????? ?????????
??? ????????? ????????????, ? ????? ? ??? ?? ? ???????? ??????????, ?????????????????, ??????????? ??? ???? ?????????????? ???? ????????? ??????????? ? ?? ??????????. ? ????????? ????? ?????? ??????????? ?????? ╚?????? ???????????? ???????????╩ [23, 35].
?????? ???????????? ??????????? ??????? ??? ? ??????
70-? ????? ???????? ???? [36]. ? ????? ???????? ???????? ?????? ???? ?????? ??? ???-???????? ?????? ? ??????? ???????????? ??????????. ?? ?????? ? ?????????? ???????????
??????, ? ??? ?????, ? ?????????? ??? ???????? ????????
????????-?????????????? ???????, ? ?????????? ?????????
?????????? ??????????? ?????????? ????????????? ????????
????????????, ????????????-1, ??????? ??????? ????????, ??
????????? ??????? ????????????? ? ??????????? ???????-
59
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.???????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 58?61
????????? ??????-???????????????? ??????????? ? ???? [23, 35].
???????????, ??? ??? ????? ???????? ???????????? ??????
CD34+ ? ??????? ????? ? ????? ??????? ?????????????? ???????? ??????. ???? ????????, ??? ????????????????? ??????? ????????????, ???????????, ????????? ? ?????????? ?????
?? ???? ???????? CD4 ? CXCR4, ?????? ? ????????????? ???
? ??????-??????????????? ????????? ???????? ????????????? [37, 38]. ??????, ?????????? ?????????? ???????? ????
????????????? ??? ?????????????? ???????????????? ??????????? (?-??????????, ??????????, ???????????? ? ?????????????? ??????), ? ?????????? ???? ????? ????????? ????????? ????????? ??????????????? ???????? ???????? ? ?????????? ?????????? ??????? ?????????? ???????????
[2, 39?41]. ????????, ??? ????????? ????????????? ?? ???? ?????? ?????????????? ????????? ?????, ????????? ?? ???????
???????? ????????????. ?? ????????? ???????????? ? ??????????????? ?????? ???????????????? ??????????? ? ????????????? ??????? ??????-???????????????? ?? ???????
??????? ?? ????????. ??????? ?????????? ????????????? ? ???? ?? ???????? ?????? ?????????????? ??????????? [42].
? ??????? ???????? ????????? ????? ????????????? ???????
??????????????? ?????????? ??????????? ? ??????? ??????????? ?????? [1]. ??????? ??????????? ??????????? ?????????? ???????? ???????? ??????? ? ???????? ????? ?????????
???????. ?????? ??? ???-????????, ??? ? ??? ?????? ??????
??????????? ????????????, ????????????? ???????? ?? ??????????? ??-?? ????????????????????? ??????? ?????????
?????????????, ?????????? ? ???????????? ?? ????????????????????????? ?????? ????????? (????????????-1 ? ???????
??????? ????????) ? ????????? ??????????? ?????????. ? ????????? ? ??????? ???????????? ??????????? ???????????
????? ???????? ???????????????? ?????? ???????????? ?????
? ????????????? [23, 43]. ????? ?????, ???-???????? ????????????? ? ????????????? ??????????? ? ????? ?????????????
? ?????????? ??? ??????????? [44].
??? ????????????? ????????????? ???????????????? ?????? ? ?????????????? ??????????? ??????? ??????????
?????? ????????? ????????? ????????? ???????? ??????
??? ???-????????. ?? ?????????????? ???????? ? ??????
?????? ?? ???????? ??????? ?????? ? ???-??????????????
?????, ??????? ???? ????????, ??? ???????? ???????????
?? ??????????? ???? ???????? ????????????? ?????. ???????? ?? ??, ??? ???? ????????????????? ????????? (? ???????????, ?????????) ???????? ?????????????? ???????? ?????? [7], ??????????? ????????????? ????? ? ??????????
?????????? ?????? ? ???????????????? ????????, ??-????????, ???????? ? ?????????? ??????????????? ???????? ???
? ????????? ? ??? ?????????????????? ????????? ?? ??????? ?????????? (??????, ???????????) ?????????. ???????? ??
??, ??? ????????? ??????? ???????? ????????? ????????? ??
???? ????? [45], ? ???????????? ??????????? ????????? ??????????? ?????????? ?????? ???? ????????? ???????????
?b ????? 6 ??????? ????? ?????? ??????? [4, 46]. ?????? ?????? ?????? ????????????????? ???? ??? ????, ??????????
????????? [1, 47]. ?? ???? ????? ????????????? ?????????????-? ??? ????????????-? ????????? ???????? ?????????????
??????????? ??????? [6].
Saag M.S. ? ??????? ???????? ?? ????????????? ????????????? ????????????? ? ?????? 786 ???-?????????????? ??-
60
???????. ?????? ?????????? ????????????? ?????? ?b ?, ???
?????????, ?????????? ??????????? ???????????? ????????
?????. 75% ????????? ???????? ?? ??????? ??????????
?????? Hb ??? ??????? ?? 10 ?/? ?? 4 ?????? ???????. ? ??????? ?????? ?? ????? ???????? ????? Linear Analogue Scale
(LASA) ???????? ?? 41%, ? ?? ????? MOS-HIV ? ?? 37% [48].
????????????? ??????????? ? ??????? ??????????????????
????????, ???????? ?? ???????? ??????, ???????? ???????????? ?????? ??????????? ??????? ?????? ? ???-?????????????? ?????????. ???????? ??????????? ????????????? ???????????? ???????? ??????????????? (? ???? 0,4 ?/?? ? ????? ?
??????? 5 ????) ? ??????? ??????, ????????????? ???????????? ?19 [49]. ????????? ?????? ????????? ╚????????????╩
?????? ????? ?????????? ??? ??????????? ??????? ?????????? ????????????? ??????????? (???????????, ?????????? ??????????????, ?????????????????? ????????, ????????? ???????? ? ??.) [6, 10]. ? ??????? ?????????? ??????, ????????????? ??????????? ???????????? ????????????? ??????????, ?????????? ?????? ????????? ? ?????? ?????????????? ???? ??????? [6, 32]. ????????????? ??????????????, ??? ????????
?????????????? ??????????, ?????? ?????????? ???-????????, ?????????? ??????????? ???????????? ? ????????????
???????????. ? ????? ? ????, ?????? ????? ??????? ????????????? ???? ??? ???????? ?????????? ??????? ? ?????? ??????
??????????? ??? ?????????? ??? ????? ?????? [50].
????? ???????, ?????? ???????? ?????? ? ?????? ???????????? ????????? ???-?????????????? ?????????. ? ?????????, ???? ?????? ????? ???????????????. ???????? ???????? ?????? ???????? ?? ???????? ?????? CD4+-?????? ? ???????? ????????. ? ?? ?? ?????, ?????? ?????? ????????????
?????? ?? ??? ???????? ??????????? ???????? ????? ????????, ?, ??? ???????? ????????, ? ???????? ????? ?? ????????????????? ????? ???????.
??????????
1. Levine A.M., Berhane K., Karim R., et al. Impact of highly active antiretroviral therapy
on anemia and relationship between anemia and survival in a large cohort of HIVInfected women: Women's Interagency HIV Study. J Acquir Immune Defic Syndr
2004; 37(2): 1245?52.
2. ?ildwan D. Implications of anemia in human immunodeficiency virus, cancer and
hepatitis C virus. Clin Infect Dis 2003; 37: S293?6.
3. Sullivan P.S., Hanson D.L., Chu S.Y., et al. Epidemiology of anemia in human immunodeficiency virus (HIV)-infected persons: Results from the multistate adult and adolescent spectrum of HIV disease surveillance project. Blood 1998; 91: 301?8.
4. Mocroft A., Kirk O., Barton S.E., et al. Anemia is an independent predictive marker for
clinical prognosis in HIV-infected patients from across Europe. EuroSIDA study
group. J Acquir Immune Defic Syndr 1999; 13: 943?50.
5. Levine A.M., Berhane K., Masri-Lavine L., et al. Prevalence and correlates of anemia
in a large cohort of HIV-infected women: Women's Interagency HIV Study. J Acquir
Immune Defic Syndr 2001; 26: 28?35.
6. Volberding P.A., Levine A.M., Dieterich D., et al. Anemia in HIV infection: clinical impact
and evidence-based management strategies. Clin Infect Dis 2004; 38: 1454?63.
7. Semba R.D., Shah N., Klein R.S., et al. Prevalence and cumulative incidence of and
risk factors for anemia in a multicenter cohort study of human immunodeficiency
virus infected and uninfected women. Clin Infect Dis 2002; 34: 260?6.
8. Semba R.D., Martin B.K., Kempen J.H., et al. Ocular Complications of AIDS Research
Group. The impact of anemia on energy and physical functioning in individuals with
AIDS. Arch Intern Med 2005; 165(19): 2229?36.
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?????? ? ???-????????
9. Berhane K., Karim R., Cohen M.H., et al. Impact of Highly Active Antiretroviral
Therapy on Anemia and Relationship Between Anemia and Survival in a Large Cohort
of HIV-Infected Women: Women's Interagency HIV Study. J Acquir Immune Defic
Syndr 2004; 37: 1245?52.
10. Sathe S.S., Gascon P., Lo W., et al. Severe anemia is an important negative predictor
for survival with disseminated Mycobacterium avium-intracellulare in acquired
immunodeficiency syndrome. Am Rev Respir Dis 1990; 142: 1306?12.
11. Moore R.D. Anemia and human immunodeficiency virus disease in the era of highly
active antiretroviral therapy. Semin Hematol 2000; 37: 18?23.
12. Adias T.C., Uko E., Erhabor O.N. Anaemia in human immunodeficiency virus infection:
a review. J Med 2006; 15(3): 203?6.
13. Lundgren J.D., Mocroft A., Gatell J.M., et al. A clinically prognostic scoring system
for patients receiving highly active antiretroviral therapy: results from the EuroSIDA
study. J Infect Dis 2002; 185: 178?87.
14. Moore R.D., Keruly J.C., Chaisson R.E. Anemia and survival in HIV infection. J Acquir
Immune Defic Syndr Hum Retrovirol 1998; 19: 29?33.
15. Demetri G., Wade J., Cella D. Epoetin alfa improves quality of life in cancer patients
receiving cytotoxic treatment independent of disease response: prospective clinical
trial results. Blood 1997; 90: 175a.
16. Gabrilove J.L., Cleeland C.S., Livingston R.B., et al. Clinical evaluation of once weekly dosing of epoetin alfa in chemotherapy patients: Improvements in hemoglobin and
quality of life are similar to three times weekly dosing. J Clin Oncol 2001; 19:
2875?82.
17. Sullivan P., Dworkin M.S. Incidence and associations of fatigue in HIV-infected persons [abstract WePeC4462]. In: Program and abstract book of the XIII International
AIDS Conference (Durban, South Africa, 9-14 July 2000), 2000; 13: 151.
18. Barroso J. A review of fatigue in people with HIV infection. J Assoc Nurses AIDS Care
1999; 10: 42?9.
19. Volberding P. The impact of anemia on quality of life in human immunodeficiency
virus-infected patients. J Infect Dis 2002; 185: S110?S114.
20. Hillman R.S. Anemia. In: Fauci A.S., Martin J.B., Braunwald E., et al.. Harrison's principles of internal medicine. 14th ed. New York City: McGraw-Hill, 1998; 334.
21. Breitbart W., McDonald M.V., Rosenfeld B., et al. Fatigue in ambulatory AIDS patients.
J Pain Symptom Manage 1998; 15: 159.
22. Abrams D.I., Steinhart C., Frascino R. Epoetin alfa therapy for anemia in HIV infected
patients: impact on quality of life. Int J STD AIDS 2000; 11: 659?65.
23. Weiss G., Goodnough T. Anemia of chronic disease. N ENGL J MED 2005; 352:
1011?23.
24. Telen M.J., Roberts K.B., Bartlett J.A. HIV associated autoimmune hemolytic anemia:
report of a case and review of the literature. J Acquir Immune Defic Syndr 1990; 3:
933?7.
25. Gupta S., Licorish K. The Coombs' test and the acquired immunodeficiency syndrome. Ann Intern Med 1984; 100: 462.
26. Lai M., Visconti E., D'Onofrio G., et al. Lower hemoglobin levels in human immunodeficiency virus-infected patients with a positive direct antiglobulin test (DAT): relationship with DAT strength and clinical stages. Transfusion 2006; 46(7): 1237?43.
27. Florea A.V., Ionescu D.N., Melhem M.F. Parvovirus B19 infection in the immunocompromised host. Arch Pathol Lab Med 2007; 131(5): 799?804.
28. Sloand E. Hematologic complications of HIV infection. AIDS Rev. 2005; 7(4):
187?96.
29. Liu W.J., Jin R.M., Fu X.D., et al. Effect of human cytomegalovirus on proliferation of
hematopoietic progenitor cells of cord blood. Zhongguo Dang Dai Er Ke Za Zhi 2006;
8(2): 85?9.
30. Seneviratne L.S., Tulpule A., Mummaneni M., et al. Clinical, immunological and
pathologic correlates of bone marrow involvement in 253 patients with AIDS-related
lymphoma. Blood 1998; 92: 244A.
31. Harriman G.R., Smith P.D., Horne M.K., et al. Vitamin B12 malabsorption in
patients with acquired immunodeficiency syndrome. Arch Intern Med 1989;
149: 2039?41.
32. Hughes W.T., LaFon S.W., Scott J.D., Masur H. Adverse events associated with
trimethoprim-sulfamethoxazole and atovaquone during the treatment of AIDS-related
Pneumocystis carinii pneumonia. J Infect Dis 1995; 171(5): 1295?301.
33. Nemechek P.M., Polsky B., Gottlieb M.S. Treatment guidelines for HIV-associated
wasting. Mayo Clin Proc 2000; 75: 386.
34. Snopkova S., Matyskova M., Husa P., et al. Haemopoiesis defects in HIV/AIDSanaemia. Klin Mikrobiol Infekc Lek 2005; 11(4): 123?27.
35. Means R.T. Recent developments in the anemia of chronic disease. Curr Hematol Rep
2003; 2: 116?21.
36. Cartwright G.E., Lee G.R. The anemia of chronic disorders. Br J Haematol 1971; 21:
147?52.
37. Deichmann M., Kronenwett R., Haa R. Expression of the human immunodeficiency
virus type 1 co-receptors, CXCR-4 (fusin, LESTR) and CKR-5 in CD34+ hematopoietic progenitor cells. Blood 1997; 89: 3522?8.
38. Molina J.M., Scadden D.T., Sakaguchi M., et al. Lack of evidence for infection of or
effect on growth of hematopoietic progenitor cells after in vivo or in vitro exposure to
human immunodeficiency virus. Blood 1990; 76: 2476?82.
39. Schwartz B.N., Kessler S.W., Rothwell S.W. et al. Inhibitory effects of HIV-1 infected
stromal cell layers on the production of myeloid progenitor cells in human long term
bone barrow cultures. Exp Hematol 1994; 22: 1288?96.
40. Moses A.U., Williams S., Henevild M.L., et al. Human immunodeficiency virus infection of bone marrow endothelium reduces induction of stromal hematopoietic growth
factors. Blood 1996; 87: 919-25.
41. Scadden D.T., Zeira M., Woon A., et al. Human immunodeficiency virus infection of
human bone marrow stromal fibroblasts. Blood 1990; 76: 317?22.
42. Maxwell A.P., Lappin T.R.J., Johnson C.F., et al. Erythropoietin production in kidney
tubular cells. Br J Haematol 1990; 74: 535?9.
43. ??rti-Carvajal Aj Sola I. Cochrane Database Syst. Rev 2007; 24 (1): CD004776.
44. Sipsas N.V., Kokori S.I., Ionnidis J.P.A., et al. Circulating autoantibodies to erythropoietin are associated with human immunodeficiency virus type 1 related anemia. J
Infect Dis 1999; 180: 2044?7.
45. Richman D.D., Fischl M.A., Grieco M.H., et al. The toxicity of azidothymidine (AZT) in
the treatment of patients with AIDS and AIDS-related complex: A double-blind, placebo-controlled trial. N Engl J Med 1987; 317: 192?7.
46. Hoffmann C.J., Fielding K.L., Charalambous S., et al. ????????????????? ??????? ???????????, ??????????? ? ??????????? ? ???: ????????????? ? ????????????? ???????. J Acquir Immune Defic Syndr 2008; 22: 71?74 (??????? ???????).
47. Sullivan P., Hanson D., Brooks J. Impact of hemoglobin of starting combination antiretroviral therapy with or whithout zidovudine in anemic HIV-infected patients. J
Acquir Immune Defic Syndr 2008; 48(2): 163?8.
48. Saag M.S., Levine A.M., Leitz G.J., et al. Once weekly epoetin alfa increases hemoglobin and improves quality of life in anemic HIV-positive patients. Program and
abstracts of the 39th Annual Meeting of the Infectious Diseases Society of America;
October 27, 2001; San Francisco, California. Abstract 708.
49. Garcia Tapia A.M., Lozano Dominguez M.C., FernИndez GutiИrrez D.A.C. Erythrovirus
B19 infection. Enferm Infecc Microbiol Clin 2006; 24, Suppl 1: 24?9.
50. Vamvakas E.C., Blajchman M.A. Deleterious clinical effects of transfusion associated
immunomodulation: fact or fiction? Blood 2001; 97: 1180?95.
?????????? ? ?????????:
???????? ??????? ?????????, ???????? ??????????? ????,
?????? ??????? ??????? ???????? ??????????
???????????????? ???????????? ????????????
?????: 420012, ??????, ??. ?????????, 49
???????: (843) 236-0922
????????? ????????? ???????, ???????? ??????? ???????
???????? ?????????? ???????????????? ???????????? ????????????
?????: 420012, ??????, ??. ?????????, 49
???????: (843) 236-0922
?????????? ????????? ?????????, ???????? ??????? ???????
???????? ?????????? ???????????????? ???????????? ????????????
?????: 420012, ??????, ??. ?????????, 49
???????: (843) 236-0922
61
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
? ?????? ?????
??????????? ???????
?????? ???????? ????????
?.?.??????1, ?.?.?????????2
??? ??????? ???????? ???????????? ??????-?????????????? ????????? ??????????????????? ??????,
?????-?????????;
2
??????-??????????? ???????? ??. ?.?.??????, ?????-?????????
1
?????? ???????? ???????? ???????? ????? ?? ?????????? ??????? ?????????????? ???????????????. ? ??????
??????????? ???????? ?????????????? ???????????, ??????????? ??????? ?????? ????????? ???????????.
???????? ?????: ?????? ???????? ????????, ???????????, ???????
Etiotropic therapy of acute enteric infections
Yu.V.Lobzin1, S.M.Zakharenko2
Research Institute of Children?s Infections, Federal Medico-Biological Agency, Ministry of Public Health and Social
Development of the Russian Federation, St.Petersburg;
S.M.Kirov Military-Medical Academy, St.Petersburg
1
2
Acute enteric infections remain one of the topical problems of the Russian public healthcare system. The article discusses the
problems of etiologic diagnosis and etiotropic therapy of this category of diseases.
Key words: acute enteric infections, diagnosis, treatment
?
????? ???????? ???????? (???) ?????? ???? ? ???????? ?? ?????????? ??????? ??????? ?????????
???????????????. ??? ??????? ? ????????????? ?????????????? ????, ?????????? ? ?????? ?????? ???????????
(????? 30), ????????? ??????? ???????????? ????? ???
?????????? ??????????? ????????????????? ????????.
????? ????, ????????????? ? ?????????????? ?????????
3 ????? ???????????? (??????, ???????? ? ??????????) ?????????? ????????????? ?????????? ??????????? ??????? ??????????? ? ????????? ???????? ? ??????????? ???????. ? ??????????? ???????? ??????????? ??????? ???
? ??????????? ??????????? ??????? ?????????? ???????????, ??? ??????????? ??????????????? ??????????????
???????????.
??????????? ??????????? ?????? ? ??????????? ???????? ???????? ????????? ???????????? ??????????? ????????. ╚???????????????╩ ???????? ?????? ????????? ??????????? ?????? ??????????? ???????? ???????????????? ???????. ?????? ????? ???????? ???????????????? ?????? ???????? ??? ???????????. ?? ???? ???????? ???????? ? ??-
??? ???????????????:
?????? ???? ????????????, ?????? ??????????? ????, ?????????,
???????? ????, ??????????? ??????? ????? ??, ???????? ??? ???????
???????? ???????????? ??????-?????????????? ?????????
??????????????????? ??????
?????: 197022, ?????-?????????, ??. ?????????? ??????, 9
???????: (812) 234-1862
?????? ????????? 01.06.2009 ?., ??????? ? ?????? 15.09.2009 ?.
62
???????? ? ????????-???????????????????? ??????? ?????????? ?????????????? (??????) ? ????????????? (????????). ? ???? ? ????????? ???? ??? ??????? ? XIX ???? ???????? ???????? ?????????????? ???????????, ? ??????
?.?.????????? ???????? ?????? ????????????????? ?????????? ???????? [1].
?????????????? ??????? ????? ??? ??????????? ?????
?????????????:
? ??????????? ????????????? ?????????? ??????????? ???????;
? ?????????????? ??????????? ???????? ???????? ?????????? (??????? ? ????? ????????) ? ????? ?????????? ??????;
? ????????? ????? ??????????? ??????????? ????????????;
? ???????????? ???????????? ??????????;
? ????????? ?????????????? ??????????? ??????????????
(????????????? ?????????????? ?????? ??????????);
? ????????????? ??????????? ?????? ??????? ???????????;
? ?????????????????? ?????????? ????????????????????
???????????.
?????? ?????????????? ??????? ???????? ? ? ??????????? ?????????????: ?????????? ????????????? ????? ??????????????? ? ??????????? ???????????? (?.?. ? ?????????
1 ??????), ??? ????????? ????? ???????? ? ???????? ?????????? ?????????????? ????????.
?????????????? ??????????? ?????????? ?? ???? ??????????? ? ???????????? ??????. ????? ??????????? ??????:
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
??????????? ??????? ?????? ???????? ????????
??????? ?????? ?????????????? ????; ?????? ??????? ????????? ???????????; ?????????? ?????? ????? ????????????
???????????; ????????????? ??????????? ??????????????
??? ???????, ??????? ? ????? ????????? ?????????????
????????????. ????? ???????????? ??????: ?????????????
???????????? ????? ??? ??????????? ????????? ?????????
???????????; ??????? ????? ????????????; ?????????? ???????????? ??? ????? ?????????? ??????????? ???????.
??? ??? ??????? ??????? ? ????, ??? ? ????????? ????
???????? ??????????????? ?????? ? ╚?????????╩ ?????????? ????? ? ?????????? ??????????????? ????????. ???????? ????????? ????? ????? ?????? ???????????? ? ??????
?.?.??????????? (2009): ╚?????? ????????????? ????????? ? ?????????????? ??????????? ??????????? ????????
????? ??????? ???. ?????? ?????????????? ???????????
???????????, ????????? ???????-??????????? ?????????,
?????????? ???????????? ???????? ? ?????????? ?????????? ??-?? ????????? ????????????, ??????????? ? ????????????? ??????????? ??????, ?????????????? ?, ? ???? ??,
???????????? ??????????? ??????????????? ?????? ?
???, ????????????? ????? ?????????? ?????? ???????????
??? ??? ?????????? ???????????????? ???????, ??????? ???????? ??????????? ?????????? ????????. ?? ????????,
??? ?????????????? ??????????? ??? ?????????? ?????? ?
2 ???????: ??? ?????????? ?? ??????; ??? ????????? ???????? ? ???????????????? ?????????. ?? ???? ????????? ??????? ?????????????? ??????????? ?????? ?????, ??? ??? ??????????? ???????????. ??????????? ??? ?????? ?????? ??
??????????????, ? ????????????? ????????, ???????????
???????????????? ???????? ???????? ?? ??????? ??????? ??????????????, ????????????????, ?????????????????
? ????? ????????????? ?????????????? ? ?????????,
????? ??????????????? ??????, ?????????????? ? ???????
???, ?????? (10,2?14,7%) ? ???????? ?????????? ?? ?????????? ?????? ???? ???????????? ????? ??????????? ????????? ??????????????? ????????? ??????? ???????????
????????? (???????????? ? ?????????????) ? ????????
??????????? ?????????, ??????????? ?????????? ???????
??????????? ??????? ???????????. ?????????????? ??????? ? ??????????? ?????? ????????????? ?????????????
???????? ??????????? ??????????????? ????????????????
??????????? ??????? ????????????, ?.?. ???????????? ?????????? ?? ????? ????? ?????????????? ????? ??????????????? ??????╩ [2]. ????? ???????, ? ???????? ???????? ?????????? ????????? ?????? ??????? ????????? ????????????
???????????, ??????? ????????? ??????????? 1 ?????? ? ???????? ? ??????? ???????. ?? ?????? ??????, ????? ?????? ????? ? ??????? ???????????, ?????????????? ? ???????????, ?? ?? ????????? ??????????? ????????. ??????? ???
??????????? ???????? ? ????????????? ?? ??? ??????? ??????????????? ???????!
? ?????? ???????, ?? ?????? ?.?.???????????? ? ?????.
(2009), ? ????????? ???, ???????????????? ?????????
??????, ????? 80% ?????????? ?? ??????? ??????????????? ??????????????? ?????????, ?????????????? ??????????? ???????? ??????? ? ?????? ????????????? ?????????????? ??????????? ???????? ????????????????, ??? ??, ???
? ?? ??????????? ??????? [3, 4]. ?? ???????? ????????????
??????? ? ?????????????? ????? ????????????? [5].
?? ?????? ?.?.???? ? ?????. (2002), ??? ????, ??? 70%
??????? ??? ?????????? ?? ??????????? ? ???????????????
????????????, ????? ??????? ?????????? ?????????????
??? ??? ╚??????????????╩ ???????? ???????????? ????????, ??????? ????????? ??????????? ???? ??? ????????????, ?? ??????? ?????????????? ?????????. ????? ????, ??
?????? ???????, ??? ????????????? ??? (? ?? ???????????)
???????? ??????????? ??????? ? ??????? ??????????? ????????? ????????? ????????? ?? ??????? ????? ?? ?????? ??????????? ???????????, ????????? ??? ??????????? ?? ?????? ?? ????? ????????? ? ??????? ???????. ??? ?????????????
??? ??? ????? ????? ?????? ????????? ? ?????????????
??????????? ???????, ????????, ?????????? ????????? ???????, ?????????, ? ?????????, ???????????? ?????? ???????
? ??????? ?????? ?????????? ???????????.
?????? ? ???, ?? ????? ??????, ?????????? ??????????? ??????? ??? ???????? ????????????????? ?????????.
???, ??? ?????? ??????? ??????????? ??????????? ???????
?????????? ? 84,9% ?????????, ????????????? ? ? 90,8% ?
??????? ? ? 93,9%. ?????? 1 ?????????? ???????? 54,7% ?????????. ??? ??????? ????????? ???????????, ??? ????
??????????? ??????? ?????????? ? ?????? ???????????:
??? ?????? ??????? ??????? ? 70,6% ???????, ??????? ?
68,6% ? ??????? ? 29,1%. ??? ???? ? ??????? ???????????
??????????? ?????????? ????? ? 2 ???? ????, ??? ? ??????????? ? 72,8 ?????? 42,3%, ?????????????? [6]. ?? ????
????, ? ?????? ???????? ?????? ????? ?????????? ?????????????? ??????? ???, ?????????? ????? ??????? ??????? ???????????, ????????????? ??????????????? ? ????????? ????????? ?????????? ???????? ????????????? ??????? ? ????????? ? ?????? ????????????????????????? ?????????? ????????? ??????? ? ?????????? ????????????
???????? ? ??????? ???????????? ??????? ? ????????? ??????? ????????? ???? ?????? ???????? ????????????? ? ????????????.
???????????? ?????????? ??????????? ???????, ?? ?????? ??????????? ??????????????, ???????? ?????????? ??????????? ????????????? ?????????? ?? ?????????? ?????????? ?????????-????????? ??????, ??????????? ? ????????????????? ???????? ???? ???????, ???????????? ????????? ???????????? ??????? ?????????? ???????????????, ?
???? ??????? ?????????? ??????? ?? ????????? ? ?.?. ? ???????? ???? ???????????? ??????? ? ??????? ???????? ???????? ???????????? ?????????? ? ??????????? ?????????
?????? ?? ?????????? ????????????? ?????????? ? ????
???????????? ??????????? ???????????????? ???????. ??????????? ????????????? ????????????????? ??????? ? ??????? ??? ???????? ??????? ? ?????????????? ??????? ????
??????? ??????? ?? ???????????? ???????? ????? ???????????? ???????????? ? ?????????????.
?????? ? ???, ?????? ???????? ?????? ?????????????
??????? ? ????? ??????? ???????? ??????? ????????? ?? ???????????. ? ?????? ?????????? ?????? ???????????????? ??????? ????? (????????) ?????????? ???????? ????? ?? ?????? ??????????? ????????????? ????????? ???????????
????????? ???????? ???????? ? ?????????????? ??????????
?????? ???????????. ??????????? ???????, ? ??????? ? ????? ???????? ??????? ????? ?????????? ?????????????
(??????????????? ? ????????????????? ????????) ? ????-
63
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.?????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 62?67
??????????? ?????????? ????? ???? ???????? ? ?????? ?????????????????? ??????? (???????? ???????? ? ?????? ???????? ????????????, ???????? ?????? ???????????), ????????????? (??????????????? ?????????, ????????) ? ????????????? ? ???????? ????????? ???????????? ╚????????????? ???????╩ ?? ?????????? ????? ??? ???? ???????? ?????.
?????? ?????, ?????????? ??????????? ??????? ?????????
????????? ???????????? ??????????? ????????? ? ????????????????? ???????????, ??????? ??????? ?????????? ?
???????????? ???????? ??????????? ?????????.
? ?????? ??????? ?????????????? ?????? ??????????? ?
?????? ? 90-? ???? XX ???? ??????? ????????? ??????? ???????????? ?????? (? ????????? Sh. flexneri 2a, ?????????????? ? ?? ?????). ????????? ????????????? ??????? ??????
????????????, ?? ? ????????? ????? ?????????????? ?????????? ????????? ???? ???????? ???????????. ??????????
???????? ?? ??, ??? ?????????? ????????? ????????????
?? ??????? ???????????? (╚??????? ?????????╩), ? ????????, ?????????????? ???????????? ?????? ? ??????????
????? ? in vivo (?????????????? ???????? ? ???????? ?????????????? ???????, ??????????????? ?????????, ????????????? ?????????? ? ?.?.). ??? ??????? ???????? ?.?. ? ?????. (2005): ╚?????? ????????? ?????????????? ?????? ?
????????? ???????? ????? ??????? ????????????? ??? ????????????? ???????? ????????? ????????? ?? ???? ?????????????? ??????????????? ? ???? ??????????, ? ??? ?????
? ????? ???????????? ????????????????????, ??? ?????????????? ????? ????????? ???????????? ? ?????????????
??????. ??? ???????? ? ??????? ?????????? ????? ???????
??????? ????????, ????? ????????????? ? ???????? ??????
??????? ???????????╩ [7]. ?????? ??? ????????? ? ??????????? ? ????????? ?????. ??? ?????????, ? ???????? ?????????? ??????? ???????????????, ???????????? ??????????
?????????? ?? ?????????????????, ?? ?????????????? ? ??
???????? ???????????? ???????????? ? ????? ?? ????????
?????????? ???????.
????????? ????????????? ??????? ?????? ? ?????? ???????????? ?????? ???? ?????? ??? ???????????? ???????????????????? ???????????, ?????????? ????? ??????????????? ??????? ? ??????? ?? ??????????, ??????????? ?????????? ??????????? ? ??????? ??? ????????? ???????? ?
????????? ????????? ? ????????????? ??? ? ?????? ????????????.
?????? ??????? ? ??????????? ???????? ?? ??????? ?????? ??????? ????????? ??? ??????????, ??????? ?????? ??????????; ?????? ?? ???????? ?????????????????? ?
???? ??????????????? ??????? ?? ?????????? ??????? ???????? ????????????. ?? ????? ??????, ??? ????????????
? ?????-?????????? 7387 ????????? (?? ??? 2843 ? ????,
4544 ? ????????) ? 2003 ?. ? 6501 ???????? (?? ??? 1829 ?
???? ?? 2 ???, 4666 ? ?????? 2 ???) ?? 6 ??? 2004 ?. ???????????? ?????????? ??????? ? 2003 ?. ????????? 5,9% ? ??
?????? 6 ??? 2004 ?. ? 6,49%, ? ???????, ? ????? ?? 1 ???? ?
7,6%, ?? 1 ?? 2 ??? ? 7,1%, ? ???????? ? 4,9%. ??????? ??????????? ??????, ? ???????, ?????????? 0,28% (? ????? ?
0,04?0,01% ? ? ???????? ? 0,4%), ?????????? ? 0,89% (? ????? ? 0,3%, ? ???????? ? 1,3%), ?????????? ???????? ?
4,67% (? ????? ? 7% ? ???????? ? 3,1%). ? ?????? ????????? 2004 ?. ???????????? ?????????? ???????? ?????????
64
4,78%, ? ?????? ? ?????????? ? ?????????? ???? ????????
(0,12 ? 0,13%, ??????????????) [8]. ????????? ??????????? ?
? ??????????? ????. ? ??? ?? ??????????? ???? ????????
69 ??????? ?????? ? 21 ? ??????????, ? ?? ????? ??? ??
???? ?? ?????? ??????? ???? ???????? 993 ????????? ???????? ??????? (????????????? ????????, ???????????????? (????), ???????????????? (????), ?????????????????
(????) ? ??????????? 3,3 : 1 : 47,3, ? ? 2008 ????: 23 ???????, 97 ? ?????????? ? 1312 ? ?????????? ???????? ? ??????????? 1 : 4,2 : 57 [9].
? ????????? ???????????? ?????? ???????????? (??????
????????????????) ????? ??????????? ?????????? ???????? ???????. ???, ?? ?????? ??????? 51 ?????????? ?? ?????? ????, ???????????? Shah N. ? ?????. (2009), ???? ?????????????? ? 30,4% ??????? ?????? ????????????????, ??????????????????? ???????? (????) ? ? 24,1%, ???? ???????? ??????????? ???????? ???? ? ??? ???? ?
Campylobacter, Shigella spp., Salmonella, Aeromonas spp.,
Plesiomonas, Vibrios, Rotavirus, Noroviruses, Giardia ?
Entamoeba histolytica [10]. ?.?. ????? 54% ??????? ??????????? ??????? ????????????? ??????????.
??????????? ??? ??????????? ??????????? ?????? ???
??????? ??? ? ?????? ???? ????????????. ???????????
??????? ???????????????? ? ??? ??????, ?????????? ? ?????????? ???????? ?????????? ??????????? ? ? ?????????
????? [7, 11, 12].
?????? ? ???, ? ???????? ???????????? ??????????????
? ?????????????? ???????? ???? ??????????? ?????? ??????????? ??????? ?????? ??????????. ? ?????? ????????????
? ????????? ????????????? ???????????? ????????? ???????? ???????????? ?????????, ????????? ?????????????
??????? ???????????? ? ????????? ??????? ??????? ???????? ????????, ? ????? ?????????? ????? ?????????, ?????????? ?????? ???????????, ???????? ? ???????????????? ?????? ????????????? ? ????? ???????? ???, ?? ????? ??????????????? ???????? ???????????? ????????????
?????????. ? ????? ????????? ????????????? ? ???????????? ??????????? ??????? ?? ????????????? ╚??????????????? ?????????╩ ?????????, ? ????? ???????, ??????? ??????
?????????? ??? ??????????? ???????????? ??? ??????????.
? ?????? ???????, ??? ?????????? ???????????? ??????????? ?? ????????? ? ?????????? ??????????? ??????? ????????????? ?????????? ?????????? ? ??????????????? ??????? ?????????? ????????, ?.?. ????? ????????????? ???
?? ?????????????.
?????? ????????? ? ??????? ????????????? ????? ??
????????????? ? ?????????-???????? ?????? ????????????? ????????? ? ???????? ? ?????????? ?; ??????????
????????????? ? ???????????? (???????????????) ? ?????????????, ? ????? ??????????? ????????????? ? ??????????, ????????, ?? ?????? ???????? ???? ????????????.
? ????? ? ??????? ??????? ?????????????? ?????????, ?????? ??????? ????????????, ??????? ???????? ????????????? ????????????? ??????? ? ?????????????? ????????,
?????????? ?, ??????????????? ? ???????????, ? ????? ??????????? ? ?????????? ??? ??? ????? ???? ???????????? ???????. ?????????? ? ???????????? ????? ???????????? ?????????? ? ??????????????? ??? ??????? C. difficile??????????????? ???????????. ??????????? ??????????
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
??????????? ??????? ?????? ???????? ????????
????????? ??? ??????? ???????? ???????? ? ? ?????????
?????, ???? ?? ???????? ?????????? ????? ???????? ???????????? ? ????? ????????? ???????????????? ? ??????, ???????? ?????????????? ???????? ?? ??????????????? ???????.
????? ??????????? ???????? ????? ??????????? ? ????????? ? ????????????, ??????, ?? ?????? ?.?.?????????
(2004), ??? ??????????????????? ?????????? ???????????? ?????? ????????????, ? ??? ????? ??????? ????????????? ????? ????????????????? ???????, ? ?????????, ???????????? ?????? ? ?.?.
????????? ????????????? ????????????? ??? ???????????? ??????? ????? ???? ????? ??? ?????????????? ????? ???????? ? ?????????? (????? ???????, ╚?????
?????????? ?.?.?.╩, ??????), ?????????? ????????????????? ??????????? ?????????? SV. ???????????????????
???????????? ??????????? ? ??????? ???????????? ????????? ??????? ?? ???????? ???????????? (Descombe J.J. et
al., 1994; ???????????? FDA, 2004), ? ????? ?? ????????? ?
???????? ??????? (Rizzello F. et al., 1998; Gionchetti P. et al.,
1999), ????????? ? ?????????? ?????????????? (???????????? FDA, 2004) ? ??? ???????????????? ??????????????
????????? (Taylor D.N. et al., 2003; ???????????? FDA, 2004).
???? ???????????, ??? ??? ???????? ?????? 400 ?? ??????????? ??????? ????????? ??????????? ???????????? ????????? ? ????? ???? ???? ?????????? ????????????? ??????? ? 2,5 ??/?? ? 50% ???????. ??????? ???????????? ??????????? ? ?????? ????? 3-? ? 9-? ???????????????? ???
??? ????????????????? ????????? ?????????? 0,81?3,4
??/?? ? 1-? ???? ? 0,68?2,26 ??/?? ? ?? 3-?. ??? ???????? ?????? ?????????? ??????????? ? ???? 400 ?? ????????? ? ????????? ? ????? ????? 0,009% ?????????? ????, ?.?. ??????????? ???? ?? ??????????, ??? ? ? ???????? ????????????,
? ??????? ????????????? ????????????? ??????? ??????????? ? ???????? ? ???????.
???????????? ???????? ??? ????, ??? ??? ?????????? ?
??????????? ???????? ????? ???????????? ????????? ? ????
?????????? 4000?8000 ???/?, ??? ? 160?250 ??? ?????????
???????????? ?????????????? ??????????? (???90) ???
????????? ????????????? ???????????????? ??????? [13].
??? ? ?????? ????????????? ????????? ??????????, ?????????? ???????? ????????????? ??????????? ???-????????? ????? ?????????? ?-????????? ???-????????? ???-?????????? ?? ???? ????????? ?????? ????? ?????? [14?16].
???????????? ?????????????? ? ??????????? ??????? ?
???????????? ??????????? ? ??????? ?? ??????????????????????? ???????????? ? ??????????????? (???????? ??? ??????????) [17, 18]. ??????? ???????? ??????? ???? ? ????????????????? ??????, ??? ? ????????????????? ?????????????? [19, 20]. ? ??????? ?? ??????????? ????????? ???????????? ?????????????? ??????????? ???????? ????????????
?????????? ? ??????????? ????? ??????? ??????? ????????????? ? ????? ? ???????????? ????? ??????????????
???????, ?????????????? ??????????????? ?? ????????? ?
??????? ?????????? ?????? ????? ?????????? ?????? ????????? [21?24]. ????? ????, ? ????????????? DuPont H.L. ? Jiang
Z.D. ???? ????????, ??? ????????????????? (? ?????????, ???????????) ? ????????????????? (????????, Escherichia coli)
?????????????? ??? ???????? ?????? ??????? (3?5 ????) ??
???????? ???????????????? ? ??????????? [25].
?????? ???????????? ???????????? ??????????? ???????????? ??????????? ??????? ?? ????????? ??????????? ?????????????, ??, ?????? ?????, ????? ??????? ?? ????????? ???????????? ?????????? ??????????? ?????????
?450 ? 1A2, 2A6, 2B6, 2C9, 2C19, 2D6, 2E1, 3A4 ? ?, ????? ????, ????? ??????????? ???????? ? ?????????, ????????????? pregnane X receptor gene (PXR), ??? ???????????? ?????????? ???????? ??????????? ?????? ????????????? [26?28].
?????????? (????? ???????) ????? ??????????? ? ? ????????, ? ? ???????????????? ?????, ???????? ??????????
??? ???? ???????? ?????? ???????????????? ? ?????? ?????? ???????? ????????, ????????? ????????????? ?????????? [29, 30]. ??? ???? ??????????????? ?????????????
??????????? ??????????? ? ?????????????? ???????????????. ???, ?? ?????? DuPont H.L. ? ?????. (1999), ??? ?????????? ??????????? ? ???? 400 ?? 2 ???? ? ??? ? ??????????????? ? ???? 500 ?? 2 ???? ? ??? ? ??????? 3 ???? ?? ???? ???????? ??????????? ???????? ????????????? ??????????, ? ????? ?? ?????? ??????? ?? ?????????? ?????????????? ????? ???? ????????? ? ????? ???????, ???????
????????? 27,3 ? 26 ? ? ??????? ??????????? ? ???????????????, ?????????????? (? = 0,334) [31].
???????????????? ???????? ??????????? ????????? ?
??? ?????????. ???, Taylor D.N. ? ?????. (2004) ? ????????????????? ???????????? ????????, ??? ????? ?????? 4 ??? ???????????, ???????????? ?? 200 ?? 3 ???? ? ????, ??? ????????????? ???????????? S. fl?xneri 2a (? ???? 1000?1500
???) ??????????? ??????? ?????? ?????????? ?? ??????????? ? ??????????? ????????? ???????????? ?? ???????????. ? ?? ????? ??? ? ????????????, ?????????? ???????, ?
60% ??????? ??????????? ??????, ? ?.?. ? 10% ? ?????? ??????? ?????? ??????????, ? ? 50% ??????? ???????????????
????? ?????????????? ??????? ????? (? = 0,001, ????????
??????) [32].
? ????? ?????? ???????????? ??????? ? ??????? ???????
???, ????????????? ?????? ???????? ????????????? ?????????????? ?????????? ??????? ??????????? ? ???????????????? ???????. ????? ?? ????????? ??????????? ????????? ????????????? ??????? ?????? ????????????????,
????????, ??????? ?????????? ????????????????????? ?????????? ???????????? ? ????????????. ????????????? ?????????? ???????????? ? ?????????? ????????? ?????????
????????????????? ?????? ? ????? ??????? ? 34 ?? 11 ?
(p = 0,0002) ?? ????????? ? ???????????? ?????????????
[33]. ??????????? ?????? ???? ???????? DuPont H.L. ? ?????.
(2007) ??? ????????? ????????????? ??????????????? ??????? ???????????? ? ???????????. ??????? ????? ?? ??????
??????? ?? ?????????? ?????????????? ????? ??? ?????????? ??????????? ?? 200 ?? 3 ???? ? ??? ? ???????
3 ???? ????????? 32,5 ╠ 4,14 ?, ? ?? ????? ??? ??? ??????? ???????????? ???????????? ? ??????????? (? ???? 4 ?? ??
1-? ????? ? ????? ?? 2 ?? ????? ??????? ??????????????
?????) ? 27,3 ╠ 4,13 ?, ? ??? ??????? ?????? ??????????? (??
????? ?? ?????) ? 69 ╠ 4,11 ? (? = 0,0019). ??????? ???????
????? ? ????? ??? ??????????????? ??????? ???????????? ?
??????????? ????????? 3,99 ╠ 4,28 ?? ????????? ? ???????????? ???????????? ? 6,23 ╠ 6,90 (? = 0,004) ? ?????? ??????????? ? 6,72 ╠ 6,93 (? = 0,002) [34]. ?????? ???????????? ??????? ???????, ??? ????????????????????? ????????? (??????-
65
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.?????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 62?67
??? ? ??.) ?? ?????? ??????????? ??? ??????? ?????????
?/??? ??????? ??????? ????? ? ????????????, ?? ?????????
?? ? ????? ?????? 2 ???, ?? ?????????? ????? 2 ???, ??? ????
???????????? ???????? ???? ?? ?????? ????????? 16 ??.
????????? ??????????????? ??????????? ? ??????????? ???????????? ??????? ???????? ???????? ????????
???????? ?????? ???????? ? ???????????? ?? ???? ??????????? ?? ??????????? ??????? ???????????. ?????????? ???????? ??? ??????????????? ?????????? ???????? ????????? ?????? ??????????? ? ???????-???????????, ?????????? ????????? (????????, 5-HT, ??????????????), ? ?????
????????? ???????????????? ????????? ? ?????????? ????????????. ????? ?????????, ??? ???????????? ? SP 303
(Provir) ???? ?? ???????? ????????? ????? ? ??????? ????
?????? ?????????, ????? ????????? ? ??????????? ???????? ????????? ???????????? ? ????????????, ?????????? ????????? ??????? ????? ? ????? ???????, ?? ???????
??????? ? ?? ?????????? ????? ???????? [35?37]. ???????
???????? ???????? ????????? ???????, ?? ??? ?????
??????? ????? ????????????? ????????.
?????????? ???- ? ??????????? ? ??????? ???????? ???????? ????? ?????? ???????, ?????? ? ?????????? ???????, ? ?????????, ??? ? ?? ????????? ???????????? ??????
??????????? ??????, ???????????? ??????????? ?? ?????????????. ?????? ??? ????? ?????, ????? ??? ? ???????????? ?????????????? ???????? ??????, ???????????? ???????? ? ????????????? ??????? ???????????, ???????, ???????? ? ???????? ?????????? ??????????, ? ?????????????
???????????? ?????????-????????? ?????? ? ?.?. ?????? ?
???, ?? ?????? L. McFarland (2007), 27% ?????????????????, ?????????????? ???????????? ?? ???????? ??????????? ?????????? ?????? ? ??????? ???????????? ??????, ?
?? ???????? ???????? ??? ????, ??? ? ????????? ????? ??
???????? ??????, ????????????????? ? ??????? ??????????????? ???????? ?????????? ???- ? ??????????? [38]. ?????????????? ???????? ???????????-??????????????? ?????? ? C.difficile-??????????????? ???????????, ??? ???????
???????? ????????????? ?????????? ?? ?????? Saccharomyces boulardii, Lactobacillus, Bifidobacterium.
? ??????????? ?????? ?? ????????????? ?????????
???, ??? ╚????? ????????? ?????? ??????????╩, ?????? ??
???? ?????????? ???????????? ?? ??????????? ??????? ?
?.?.? ??? ?? ?????? ????????? ????????, ??? ???? ???? ??????? ??????????? ???????? ? ?????????????? ???????,
?????????? ? ???? ??? ??????????? ????????????? ? ??????????, ??????????? ? ?????? ???????????? ??????????? ???????????? ????????????? ??????? ??????? ?????? ??????????????? ??? ????????? ????, ?????????? ? ???? ??????? ??????? ?????????? ???????????????? ???????? ? ????????????? ?????????????? ????? ??????.
???????? ????????? ????????????? ??????? ???????????,
????????? ????????? ??????? ??? ??????????????? ? ????????? ???? ???????? ???????? ??????????????? ? ???????
╚???????????????╩. ? ???????? ??????? ?????????????
??????? ??????????????? ????????????? ????? ?????????,
?????????? ?????? ? ???????????? ????????, ???????????? ????? ?????? ????????? ??????????????? ? ?????????
??? ? ? ?????????? ?????? ???????????? ????????? ??????????????? ??????????? ???????????. ? ????????? ????-
66
??? ?????? ?????? ????????? ??????? ????? ?????? ???????? ???????????????? ???????, ????????????? ??????????
??????????? ???????????? ???????? ????????????? ?????????? ? ????????? ? ??????? ??????????╩.
??????????
1. ??????????? ??????. ??????: URL http://ru.wikipedia.org/wiki/???????????
???????????? ????????.
2. ?????????? ?.?. ?????? ???????? ????????: ??????? ? ???????????. ??????????? ??????? 2009; 19 (488): 13.
3. ??????????? ?.?., ????????? ?.?., ????? ?.?. ???????????? ???????????
? ??????? ?????? ???????? ????????. Consilium Medicum. ????????????????? 2009; 1: 84?6.
4. ???? ?.?., ?????? ?.?. ?????? ???????? ????????: ??????????? ? ???????.
?.: ????????, 2001.
5. ??? ?.?., ???????? ?.?., ??????? ?.?. ???????????. ?.: ????????, 1988.
6. ????????? ?.?. ??????????? ??????? ?????? ???????? ????????. ???????
???? 2009; 2: 60?3.
7. ???????? ?.?., ??????? ?.?., ??????? ?.?. ? ??. ????????????? ???????? ??????, ????????????? ? ??????-????????? ??????? ??????? ? 1996-2003 ??.
????? ?????????????? ?????????. 2005; 1: 84?9.
8. ????????? ?.?., ??????? ?.?., ????????? ?.?. ? ??. ???????? ??? ???????
???????? ??????????. ????????? ????????? ??????? ????????? ????
╚????? ????????? ?????????????????╩. ???????????, 23-24 ?????? 2004 ?.
2004; 224.
9. ????????? ?.?. ??????????????? ??????????? ? ??????? ?????? ????????
????????. ??????? ??????????? ??????. ??????? ??????? ???????????
2009; 11(1): 28?32.
10. Shah N., DuPont H.L., Ramsey D.J. Global etiology of travelers' diarrhea: systematic review from 1973 to the present. Am J Trop Med Hyg. 2009; 80(4): 609?14.
11. ???????? ?.?., ???????? ?.?., ??????? ?.?., ? ??. ????????????. ???????
???.? ??????. 2004; 1(141): 22?4.
12. ??????? ?.?., ???????? ?.?., ????????? ?.?., ? ??. ???????-?????????????????? ?????????????? ????????????? ? ????????? ? ?????-??????????. ???????????? ??????? 2006; 7.
13. Jiang Z.D., Ke S., Palazzini E., et al. In vitro activity and fecal concentration of
rifaximin after oral administration. Antimicrob Agents Chemother 2000; 44: 22052206; Jiang Z.D., DuPont H.L. Rifaximin: in vitro and in vivo antibacterial activity.
A review. Chemotherapy 2005; 51(suppl 1): 67?72.
14. Dayan A.D: Rifaximin (Normix╝) Preclinical Expert Report. London 1997.
15. Umezawa H., Mizuno S., Yamazaki H., Nitta K. Inhibition of DNA-dependent RNA
synthesis by rifamycins. J Antibiot (Tokyo) 1968; 21: 234?6.
16. Artsimovitch I., Vassylyeva M.N., Svetlov D., et al. Allosteric modulation of the
RNA polymerase catalytic reaction is an essential component of transcription control by rifamycins. Cell 2005; 122: 351?63.
17. Al-Orainey I.O. Drug resistance in tuberculosis. J Chemother 1990; 2: 147?151;
Spratt B.G. Resistance to antibiotics mediated by target alterations. Science 1994;
264: 388?93.
18. Smith C.A., Baker E.N. Aminoglycoside antibiotic resistance by enzymatic deactivation. Curr Drug Targets Infect Disord 2002; 2: 143?60.
19. Marchese A., Salerno A., Pesce A., et al. In vitro activity of rifaximin, metronidazole and vancomycin against Clostridium difficile and the rate of selection of spontaneously resistant mutants against representative anaerobic and aerobic bacteria,
including ammonia-producing species. Chemotherapy 2000; 46: 253?66.
20. Hoover W.W., Gerlach E.H., Hoban D.J., et al. Antimicrobial activity and spectrum of
rifaximin, a new topical rifamycin derivative. Diagn Microbiol Infect Dis 1993; 16: 111?8.
21. Spratt B.G. Resistance to antibiotics mediated by target alterations. Science 1994;
264: 388?93.
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
??????????? ??????? ?????? ???????? ????????
22. Collignon P.J. Antibiotic resistance. MJA 2002; 177: 325-329.
23. Testa R., Eftimiadi C., Sukkar G.S., et al. A non-absorb-able rifamycin for treatment
of hepatic enceph-alopathy. Drugs Exp Clin Res 1985; 11: 387?92.
24. De Leo C., Eftimiadi C., Schito G.C. Rapid disappearance from the intestinal tract
of bacteria resistant to rifaximin. Drugs Exp Clin Res 1986; 12: 979?81.
25. DuPont H.L., Jiang Z.D. Infl uence of rifaximin treatment on the susceptibility of
intestinal Gram-negative flora and enterococci. Clin Microbiol Infect 2004; 10:
1009?11.
26. Rifaximin label approved on 05/25/2004. http://www.fda.gov/cder/foi/label/2004/
21361_xifaxan_lbl.pdf.
27. Gillum J.G., Israel D.S., Polk R.E. Pharmaco-kinetic drug interactions with antimicrobial agents. Clin Pharmacokinet 1993; 25: 450?82.
28. Xiaochao Ma, Shah Y.M., Guo G.L., et al. Rifaximin Is a Gut-Specific Human
Pregnane X Receptor Activator. J of Pharmacology And Experimental
Therapeutics. l 18, 2007; DOI: 10.1124/jpet.107.121913.
29. Al-Abri S.S., Beeching N.J., Nye F.J. Traveller's diarrhoea. Lancet Infect Dis 2005;
5: 349?60.
30. Robins G.W., Wellington K. Rifaximin. A review of its use in the management of
traveller's diarrhoea. Drugs 2005; 65: 1697?713.
31. DuPont H.L., Ericsson C.D., Mathewson J.J., et al. Rifaximin for the treatment of
infections diarrhea in travelers: a double-blind, randomized clinical trial (RCT) vs.
ciprofloxacin. Presented at the 39th Interscience Conference on Antimicrobial
Agents and Chemotherapy (ICAAC) Meeting, San Francisco, California, USA, 2629 Sep 1999: abstract no. 2227.
32. Taylor D.N., MacKenzie R., Durbin A., et al. Double-blind, placebo-controlled trial
to evaluate the use of rifaximin (200 mg tid) to prevent diarrhea in volunteers chal-
lenged with Shigella fl exneri 2a (2457T). Am J Trop Med Hyg 2004; 71(suppl 4):
1-303, abstr 2079.
33. Ericsson C.D., DuPont H.L., Okhuysen P.C., et al. Loperamide plus azithromycin
more effectively treats travelers' diarrhea in Mexico than azithromycin alone. J
Travel Med. 2007; 14(5): 312?9.
34. DuPont H.L. et al. Treatment of travelers' diarrhea: randomized trial comparing
rifaximin, rifaximin plus loperamide, and loperamide alone. Clin Gastroenterol
Hepatol. 2007; 5(4): 451?6.
35. Ma T., Thiagarajah J.R., Yang H., et al. Thiazilinone CFTR inhibitor identified by
high throughout screening blocks cholera toxin-induced intestinal fluid secretion.
J Clin Invest 2002; 110: 1651?58.
36. DiCesare D., DuPont H.L., Mathewson J.J., et al. A double-blind, randomized,
placebo-controlled study of SP 303 (Provir) in the symptomatic treatment of acute
diarrhea among travelers to Jamaica and Mexico. Am J Gastroenterol 2002; 97:
2585?8.
37. Primi M.P., Bueno L., Baumer P., et al. Racecadotril demonstrates intestinal antisecretory activity in vivo. Aliment Pharmacol Ther 1999; 13: 3?7.
38. McFarland L. Probiotics: Evidence Based Data. Clinical Application of Probiotics in
Human Health. September 14-15, 2007, Las Vegas.
?????????? ? ????????:
????????? ?????? ??????????, ???????? ??????????? ????, ??????,
??????????? ?????????? ??????? ???????????? ???????? ? ??????
??????????? ????????????? ? ??????????? ???????????
??????-??????????? ???????? ??. ?.?.??????
?????: 194044, ?????-?????????, ??. ????. ????????, 6
???????: (812) 292-3433
????????????? ??????????? ??????
?????????? Helicobacter pylori ??????? ??????? ???????????????? ??????
???????? ??????????? ??????????????? ?????????????????? ????????? ????????????, ??????????????? ? The Journal of
Infectious Diseases, ?????????????? ??????? H. pylori ??????? ?????????????????? ???????????????? ?????? ? ?????.
? ???????????? ??????? ??????? 219 ????? ? ???????? ?? 7 ?? 11 ???, ?????????????? H. pylori. ?????? 14 ??????? ????? ?????????? ?????????????? ??????? ??????? ????? ? ????????? ?????? ? ??????? ?? ??????????, ? ????? ? ??? ????
????????? ?????????????, ??? ?? ?????? ?????????? ??????? ?? ??????? ????????? ?????????? ??????????? ?????????
???????? ???????, ????????? H. pylori, ??????? ??? ???????? ????? ????? ??????????? ?????????? ? ?????? 40 ??? ?????
?????????????? ??????? ? 176 ?????. ??? ?????????, 44 ?? 85 ????? (52%) ? ??????????? ??????, ??????? ??????????? ?????????????? ???????, ? 53 (58%) ?? 91 ? ??????????? ?????? ????? ??????? ?????? (???????????????? ?????????????
???? 0,92, 95% ????????????? ????????, 0,68-1,26); 4 ??????? (5%) ? 17 ????? (19%), ??????????????, ???????? ???????????????? ??????? (???????????????? ????????????? ???? 0,25 (95% ????????????? ????????, 0,09-0,73)). ????? ??????????? ?????????????? ??????? ??????????????? ?????????? ? 33 (52%) ?? 64 ?????. ? H. pylori-????????????? ????? ??????? ?????? (???????????????? ????????????? ???? 0,62 (95% ????????????? ????????, 0,38-1,01)) ? ????????????????
?????? (???????????????? ????????????? ????, 0,22 (95% ????????????? ????????, 0,03-1,50) ???? ???????? ?????? ??
????????? ? ?????????? ? ?????????????? ???????????? ???????????? ?? H. pylori.
????? ???????, ?????????????? ??????? ??????? ? ?????????? ???????? ?????????????????? ???????? ?????? ? ? ????????????? ?????????? ?????????????????? ???????????????? ??????. ????????, ? ????????????? ???????????????? ????????? ? ????????? ????? ???????????? ????????-???????? ???? ?????? H. pylori.
Fagan R.P., Dunaway C.E., Bruden D.L., et al.
Eradication of H. Pylori Reduces Iron Deficiency Anemia Prevalence.
J Infect Dis 2009; 199: 652?60.
www.antibiotic.ru
67
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
? ?????? ?????
???????????????? ??????? ?????????????
?????????: ???? ?? ????? ? ???????
????????????
?.?.??????????1, ?.?.???????2, ?.?.?????????3, ?.?.?????????2, ?.?.?????????1
?????-????????????? ??????????? ???????? ??????????????? ???????????;
??? ????????????????? ???????? ????, ?????-?????????;
3
??????-??????????? ???????? ??. ?.?.??????, ?????-?????????
1
2
????? 25?30% ??????? ????? ?????? ???????? ???????? ????? ???????? ?????? ?? ???????? ????????????????
?????????????? ??????????? ?????????-????????? ?????? ? ???????? ????????????? ????????? (???). ? ??????
????????????????? ??? ???????????? ???? ?????? ?????????????? ????????????, ???????????? ? ??????????????
???????????, ?????????????? ??????????? ? ????????-???????? ???????????. ? ?????????? ╚?????????╩ ??????? ?
??????????????? ????????? ? ? ???????????? ???????????????? ?????????????? ??????????? ??????????????????
? ????????????????? ??????? ?????. ?????? ????? ?????? ? ????????? ????????? ? ??????? ?????????? ???????????
??? ???? ??????????? ?? ??????????. ? ?????? ??????????? ??????? ???????????? ?????????? ??????????? ?? ?????? ???????????? (??????, ????????; ??????????, ??????) ? ??????????? ?????????? ???????????? ???????? ?????????????????? ??????? ??? ???.
???????? ?????: ???????????????? ??????? ????????????? ?????????, ??????????, ??????, ??????????, ???????????
Post-infection irritable bowel syndrome:
is there place for probiotics in therapy?
V.I.Simanenkov1, A.N.Suvorov2, S.M.Zakharenko3, A.N.Bochkareva2, Z.R.Sundukova1
St.Petersburg Medical Academy of Post-Graduate Education;
Research Institute of Experimental Medicine, Russian Academy of Medical Sciences, St.Petersburg;
3
S.M.Kirov Military-Medical Academy, St.Petersburg
1
2
About 25?30% patients after acute enteric infection have symptoms of one of the most common functional disorders of the gastro-intestinal tract ? irritable bowel syndrome (IBS). A considerable role in the genesis of post-infection IBS belongs to dysbiotic disorders associated with subclinical inflammation, neuroimmune disorders and sensory-motor dysfunction. As a result of
local ? intrasystemic ? disorders ╚linking╩ to the central dysregulatory ones hypersensitivity and hyperreactivity of the large
intestine are formed. There is no single point of view on the strategy and tactics of using probiotics in this disease. The work
discusses issues of safety of using enterococci-based probiotics (Linex, Slovenia; Laminolact, Rossia) and prospects for applying an original method of autoprobiotic therapy in IBS.
Key words: post-infection irritable bowel syndrome, probiotics, Linex, Laminolact, enterococci
?
???? ?? ???????? ???????????????? ??????????????
??????????? ?????????-????????? ?????? ????????
??????? ????????????? ????????? (???). ? ?????????? ?????????? ?????????? ??????, ? ???????????? ? ???????? ????? 10?15% ????????? ????????? ????? ???????? ??? [1].
?????????? ???????????? ???? ???????????? ???????????????, ??? ?????????????????? ??? ? ?. ?????-?????????? ????????? 8,5% ????? ????????? ?????????, ??? ???? ???????
???????? ?????????????? ? 2 ???? ???? ?????? [2]. ?????????? ?????????? ??? ?????????????? ??? ??????, ???
??????? ??????? ????????? ?????????? 24?41 ???. ????? ???
??? ???????????????:
?????????? ???????? ?????, ?????? ??????????? ????, ?????????,
??????????? ???????? ?????? ????? ??, ?????????? ???????? ???????
? ??????????? ???????????? ?????-????????????? ???????????
???????? ??????????????? ???????????
?????: 191015, ?????-?????????, ??. ????????, 41
?????? ????????? 12.06.2009 ?., ??????? ? ?????? 15.09.2009 ?.
68
???????? ???????? (65?93 ????) ?????????????????? ??? ?????????? 10,9% ?? ????????? ? 17% ? ??? 30?64 ??? [3].
???????? ?? ???????? ????? ?????, ??????????? ???,
????????? ??? ???????? ? ??????? ???????? ?? ?????? ??????????????. ???????? ?????????? ???????? ?????????????????? ??????, ???????????? D.Drossman ??? ? 1998 ????
? ????????? ? ??????? ????????? II ? III [4].
? ???????????? ? ???????????? ???????????????, ????????????????? ? ??????? ????????? III, ??? ???????? ?????????????????? ?????????????, ? ?????? ???????? ???????? ????? 2 ???????? ?????????????? ????????? ? ??????????????? ??????????? ? ????????-???????? ?????????? ?????????. ??? ????????? ???? ???? ????? ???????? ??????????? ? ╚??????????? ?? ????????????????? ????????╩,
?????????????? ? 2008 ?. [5].
???????, ????????????? ??????, ???????? ????????
??????? ????????????? ???????????, ??????? ??????????? ????? ???????????? ??????????? ????????? ? ???????-
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????????????? ??????? ????????????? ?????????: ???? ?? ????? ? ??????? ????????????
???????? ??? ????????? ??????? ???????????? ???????????????? ??????????. ? ?????? ?????? ??? ???????? ?? ????? ???????? ??????????? ??????????? ????????, ??????? ?
??????? ???, ?????????????? ????? ???????????? ??????
???????? ???????? (???). ???? ????? ??? ???????? ???????????????? ??? (PI?IBS, ??????).
??????? ???????? ?????? ??????????? ??? ????? 60 ???.
??????? ????????? ???????? ??????? ???????? ??? ???
G.T.Stewart ? 1950 ????. ? ???? ?????? ???? ????????, ??? ?
24?32% ???????, ?????????? ???, ? ??????? 3 ??????? ??????????? ???-???????? ???????. ? ????????? ????? ????????, ??? ?????? ????????????? ?????????????????? ???????? ????????? ???????? ????? ???????? ???. ?? ??????
?????? ???????, ? 7?33% ????????? ????? ???????????? ???????? ???????? ? ?????? ?? 3?4 ??? ?? 6 ??? ???????????
??????????? ???????, ???????? ???, ? ????????????? ?????? [6?9]. ??? ???? ???? ????? 10% ????????? ? ??? ????????? ??????????? ? ???????????? ?????????, ? ????? 50%
?? ??? ?????????????? ? ??????? ????????? 6 ??? [10].
????? ??????? ??????? ?????? ????? ???? ?????? ? ????????????? ???????????, ???????????? ??? ????????
?????????????????? ?????? ??????????????? ??????. ?
????? ? ????, ?????? ??????? ???????????? ?????????????
?????????? ?? ??????????, ??????????? ???. ??? ???????????? ????????, ??? ? 24?32% ????????? ????? 3 ??????
????? ???????? ??????????? ???-???????? ??????? [6, 7].
? ??????? ???????? ??????? ???????????, ??? ???????????
???????? ?????? ????? ??????? ????????????? ?????????????? ?????????? 12%. ?? ?????? ????????? ???????, ?????????????? ??? ????? ?????????????? ?????????????? (??)
????????? 98,2 ?? 10 000 ??????? ? ???, ? ? ???????????
?????? ? 45,3 ?? 10 000 ??????? ? ???. ?????????????????
????????????? ???? ??? ????? ?????????????? ?? ????????
2,2 (95% ????????????? ???????? 1,5?2,9) ?? ????????? ?
??????????? ?????? [9].
????? ??????????????, ??? ????????? ???????????? ? ????????? ?????? ? ??????????? ???????? ???????? ?????????? ????????????. ? ????????????? ?????????? ????? ????????? ????????? ???????? ?????? [11]:
1) ???????????? ???????? ??????? ?????????;
2) ?????????? ? ???????? ? ???????????? ???????? ?????????, ?????????????? ???????????;
3) ??????????? ???????? ??? ? ????????????? ??????
????????;
4) ????????? ??????? ?????????? ? ??????????????????
??????? ????;
5) ?????????? ????????????? ???? ? ?????? ?????;
6) ????????? ???????? ?????????? ????????? ????????
?????? ?????;
7) ???????? ????????????? ??????????;
8) ????????????? ?????? ?? ??????? ????????? ????????????? ? ????????????.
??? ????? ?? ???? ??????, ?????? ????????? ? ????? ???????? ╚????????????????╩ ????? ???? ?????? ????????,
?????? ? ?? ?? ???????? ??????????? ?????????. ? ??????
???????????? ???????? ?? ???? ?? ????????? 3?7 ?? ?????
???? ???????? ????????? ? ????????? ? ???????? ???.
?? ?????? ??????????? ??????????????, ??????????
????????????????? ??????? ? ???????? ?????? ? ???, ??-
???????? ???. ????????????? ?? ???????????? ?????????
????????? ????? ???????????????? ?????????????? ???????? ????????? ??????? ??????? ??? ? ?????????????
???? 2,65 (95% ????????????? ???????? 1,28?5,50) ? ??????? ???????????? ?????? ????????????? ? ?????????????
???? 2,37 (95% ????????????? ???????? 1,07?5,25) [9]. ? ??????????? ???????? ????? ??????? ? ??????? ?? ??? ????????????? ??????????? ??????????????? ???????, ? ?????
?????????? ????? ????????????. ? ?????? J.Lehrer ?
G.Lichtenstein (2007) ? ???????? ????? ?????? ?????????
?????????? ??????? ???????????, ???????? ???????????, ?????????? ?????, ??????? ??????? ????????? [12].
???? ?????? ???????? ??? ??????? ??????? ??????? ????????? ??, ??????? ????????? ? ?????? ????????? ??????? ? J.Marshal ? ?????. (2007). ???????????, ??? ????????
???????? ???????? ????? ???????? ?????? ???????? ????? (????????????? ???? 10,5) [13]. ?? ?????? ??????????????, ????? ? ??????????? ??????? ????? ???????????? ????? ??????????? ?????????? ?????????? ???????? ? ???????
???????????. ?????????? ???????? ?? ??, ??? ???-???????? ????????? ???? ??????????? ????? ???????????? ???????????, ??????????? ? ?????????? ??????, ? ?????? ?
??????????????????? ?????????????? ? ? ???, ???????????? ????????????? ???????????? ? ?????? ??? [3, 14].
????? ?? ???????? ????????????? ???????? ????????
????? ????? ?????????? ??? ? ???????????? ????????
??????. ? ?????????? ??????? ???????? ???????????? ?????????????? ????, ??? ?????????? ??????? ??????? ??? ??????????? ?????????? ?? ?????????? ???????? ???. ???
?????????????? ? ???????????? ??????????? ?? ??????? ???????????? ?????? ?????? A.Kassinen ? ?????. (2007). ???????? ???????? ? ??????? ? ??? ?????????? ????????????
???????? ? ?????????? ????????? ????? ???????? ? ??????
??????????? ??????, ??? ???????????? ??????? ?????????????? ???????????? ?????? ??????? (???) ????????? ????? Coprococcus, Collinsella ? Coprobacillus [15]. ??????? ???
??? ????????? ╚?????????? ???????╩ ????????? ?????? ????????? ??????? ??????? ???????? ?????? ? ????????????
???????????? ???????. ? ????? ?????? ? ????? ?????, ??????????? ??? ???????????? ?????????? ?.?.?????????, ?
??????? ??????? ??-???????????? ???? ???????????, ??? ?
53,1% ??????? ? ?????? ???????????? ???????? ??????
?????????. ? ???? ?????? ??????? ??????? ???????? ?????????? ?????? ???????? ??????? (??????????, ??????????,
????????????? ???????? IgG). ???? ????? ????????, ??? ????????? ???, ? ????????? ????????????????, ????? ?????????
??? ?????? ?????????? ???. ??? ???????????????? ? ???????????????? ????????????? ? ???? ??????? ?????????????
??????????? ????????????????? ???????????? ? ?????- ? ????????????????? ??????????????? ??????????? ?????????
???????? ?????? ??? ??????? ????? [16].
? ??????? ?? ??????????? ???? ??????, ?????? ???? ???????????? ?? ????? ????????? ????????????? ????, ??? ?????-???? ?????????? ????????????? ?????????? ???? ???????? ? ???????? ?????????????? ???????? ?????????.
???????????, ??? ????? ??, ?????????? Campylobacter spp.,
???? ??? ??? ????????? ????, ??? ????? ??, ??????????
Salmonella spp., ?????? ??????? ?? ???? ????????????? ????????. ? ????? ?????? ???? ??????????????, ??? ?????? ??-
69
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.?????????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 68?75
????????? ???????? ??????????????? ????????? ?????????
?????? ??????????? ??????????? ?????????????? ?? ???????? ?????? [17].
??????????????, ??? ??????????????? ??????????????
??????????? ????? ???? ??????? ? 3 ?????????. ??-??????,
? ???????????? ????? ??????, ??????, ?????????? ???
??????????? ??????? ????, ???? ? ????? ??????? ????????
???????????? ? ?????????????? ??????? ?????????? ?????????. ??-??????, ?????? ???? ???? ??? ????? ??????????? ?????????????? ????? ?????? ???????? ??????? ???
????????????? ??????????? ????????????. ????????????????? ????????? ????????? ?? ?????? ???? ?????????? ???????????????, ?? ? ?????????? ?????????? ?????????. ? ?????????? ???????????? ??????????? ??????? ? ???????
????????????? ? ????????????? ??????????, ??????? ????????? ???? ?????????? ????????. ??? ???? ????? ????????????, ??????, ????????? ?????, ???????????, ???????????
???????, ?????????? [18, 19].
?-???????, ?? ???????? ? ??????????? ?????, ??????????? ??????, ? ???????? ???????? ????? ???????????????
???????????? ????????. ??? ???????? ????????? ?????????? ???, ??????????? ?????????? ???????????? ???????-??????????? ??????????? ??????????. ? ???? ????? ?????
????????????, ??? ??? ???????? ?????? ???????????? ???????? ????? ╚???????????????╩ ??????????? ???.
?????? ? ?????????? ???????? ??????, ??????????, ???,
??? ? ??? ?????? ????????? ???, ????????? ???????? ?????????? ?????????? ?????????? ???????????? ? ????????????? ?????. ?? ?????? ?.?.???????? ? ?????. (2000), ? ?????????? ?????? ????? ???????? ??????? ?????????????
??????????? ?????? ?????, ?????????? ? ??????? ???????????? ??????????? ?????; ???????????? ??????? ????? ?
??????????? ??????????? ??????? ??????? ??????????
??? ?? ???? ???????? ???????? ?????? ????????? [20].
? ?????????? ????????????? ? ??????????????? ????????
???????? ????? ????? ????? ??? ???????. ??????????????, ??? ??? ?????????????? ??????????? ??????????????
???????????, ?????????? ????????????? ???????? ??????,
????????, ? ????? ???????????? ?????????????. ?????????
D.Drossman ? ??? ????????????? ???? ?????? ????????,
??? ? ????????? ??????? ??? ?????? ????????????? ?????
?????????????? ?????? ? ?????????? ??????? ????????????????? ?????????. ????????? ???????? ? ?????????? ??????? ???????? ? ????????? ??????????, ?????????? ????
???????? ????????-???????? ?????????. ? ?????????? ????????????? ????????? ??????? ?????????? ? ????????????
?????????? ????????? ? ???????? ?????????. ???????? ?
????????? ?? ?????????? ???????????? ?????????? ????????? ??????????? ????????? ?????? ?-???????? ???? 2.
???????????? (??) -4 ? -13 ?????????? ????????????????????? ??????? ???????????. ???????? ??????????????? 2
(???-2) ????? ???????? ?????????????? ?????????? ?????????. ????? ???????, ? ????? ??????? ?????????? ? ????????? ????? ??????????????? ???????????? ??????????????????. ???????????? ???????-?????????????? ? ???????????????? ????????? ??? ?????? ???? ??????????????????
? ?????????????? ? 2007 ?. ?????? J.K.Lehrer ? G.R.Lichtenstein [12]. ??? ????????????????? ????????? ??????? ???
??????? ???????????? ??????????? ?????????????? ???-
70
???? ?????????. ? ???? ??????? ?????????? ????????????
???????????. ????????? ????? ???????????????? ?????? ?
????????? ??????? ????? ?????????? ? ????????? ????????
??????????, ??????????? ???????? ????????, ??? ?????
????????????? ??????. ? ???????? ?????? ?.?.????? ?
?.?.??????????? (2006) ??????????, ??? ???????? ??????
?????????????? ??????????? ????????-???????? ???????
????????????? ???? ? ????????? ????????????? ??????????? ???????? [21]. ??????? ? ????????????????????? ???????????? ? ????? ????????? ????????????? ??????????
?????????? ????????? ?????????, ??????? ??????? ?????????????????? ???????? ??-1? ? ????????? ? ??????????, ??????? ????????? ??? ??? ???????? ? ?????????? ??????????? ????????? ??????; ? ????? ???? ?????????????? ?????????? ?????????? ?????? ???????????? ?????????? ?
CD3+-?????????? ? ??????????? ????????? ????????? ???????? ??????? ????? [8, 22?24].
? ???? ??????? ??? ???????? ? ???????? ???????????????
? ???????, ??????? ??????????? ????????? ??????? ? ????????? ? ??????. ????? ????, ??? ??????? ????????? ??????
???????? ???-???????? ???????????? ?????? ???????? ?? ???? ??????? ????????. V.Jones (1982) ???????, ??? ? ?????????? ??? ???????? ???? ?????? ??????? ??????????????? ?
????????? ? ?????????? ????????? ?????? ?????????. ??
?????????, ??? ? ??????? ? ??? ? ??????? ???????????????? ????? ????????????? ?????????? ???????? ???????? [25].
???????? ??????????? ??????, ????? ????????????
????????? ???? ???????, ?????????? ? ???????? ? ??????? ??????. ? ??? ? ????????? ????? (?, ????????, ???????????? ????????????????????) ??? ? ????????? ? ??? ?????????????????? ???????? ? ????????? ??????????????? ?
????????????? ???????? ?????????? ?????????. ???????????? ????? ??????????? ????????? ????????????? ? ????????? ??????? ????????. ????????? ??????? ???????? ?
????????? ???????? ?????????? ? ???????? ??????????????? ??????????, ?????????? ???? ???????? ????????? ??????????? ???????????????? ?????????, ???????? ?????????????????? ? ????????????????? ?????. ? ??????????
?????????? ???????????? ?????????????? ??????????????
???????, ?????????? ???????-??????????? ???????????.
????? ???????, ??????? ?????? ???????????? ?? ??????
????????, ?? ? ???????????? ???????????.
?????????????? ?????? ?????? ???????? ????????????
???? ?????????????? ???????????. ? ????? ? ???? ????????????? ???????? ??????????? ?? ?????????. ?????? ???????
?? ??????? ?????? ??? ? ?????????????, ??? ? ? ?????????? ?????????? ???????????. ??? ?????????????? ?? ?????
?????-???? ????????????? ??????? ? ??????? ????? ???????? ???. ??????? ??????? ? ???????? ???????????? ???????
??????????? ??????????????????. ??? ?? ?????, ?????????? ????????????? ? ?????????? ?????????? ?????????
3 ???, ????? ??????????? ? ??????? ?????????? ?????????????? ? ???, ??? ? ??????? ? ?????? ??????????? ???????? ?????????? ????? ????? ??????????????? ??????????? [26]. ? ????? ?????? ?????? ???????? ? ????????, ????????????? ? ???????? ??????? ????????? III (Drossman D. et al.,
2006). ??????? ???????????? ??????? ?????????? ? ????????? ??????????????? ?????????? ???????????. ???????????? ? ???? ????? ?????? ???????? ??????? [27, 28]. ? ??-
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????????????? ??????? ????????????? ?????????: ???? ?? ????? ? ??????? ????????????
?? ????????, ???????, ?????????????????? ????????????
??? ???? ???????? ????????????? ?????????????? ???????
??? ???. ???????? ????????? ?????????????? ???????
?????? ?? ????????????? ????, ??? ???? ?????????? ??????? ???? ????? ? ??????.
? ????????????? ?????????? ??????????????? ????????? ?????????? ??????? ?????????????? ??????? ???
?????? [29]:
? ?????????????? ??????? ?????????? ???????? (??????????????? ??????????????);
? ????????? ????????????? ?????????? (????????, ????????????, ?????????);
? ??????????? ?? ??????? ?????????;
? ????????? ???????????????? ??????? (???????, ????????);
? ???????????? ??????????????? ???????????;
? ?????????? ????????? ?????? ?? ???????? (?????? SIgA,
IgG, ????????? ??????? ??????????? ? T-???????? ?????????, ???????? ??????????; ??????-??????);
? ????????????????????? ??????? ? ???????? ?????????, ??????, ?????, ????????, ???????????? ??????? ??????;
? ?????? ?????????, ???????????, ???????????, ???????
???????, ???????????? ??????;
? ?????????? ??????????? (?????????? ????????????
(??)-5, ?????? ?????? ? ?????????);
? ???????? ????????????? (???????????????? ?????
???????????? ??????????);
? ????????? ??????? ?????? (?????????? ???? MUC-3);
? ?????????? ??????? ? ????????? ????????? ?????????????? ??????? ????? (EGF);
? ?????????? ??????? ??????????.
????????????? ??????????????? ??????? ??????????? ??
??????? ??????????????. ???????????, ??? ?????????? ??????????? ? ??????????? ????? ? ??????? ? ?????? ????????? ??????? ???-2 ? ???????? ? ????????? ???????? ?????????? ?????????.
???? ? ?????????????? ????? ? ????????????????? ?????????? ??????????? ??? ?????? ???????? ???????????
??????????????, ?? ? ????? ?????? ?????????? ??????????????? ??? ????? ??????? ? ???????? ?????? ???????????.
? ????? ????? ??????, ???????? ????? ????? ??????, ????????? ??????????? ? ???????? ??? ??? ?????????? ??????????????? ???????, ??? ? ?????? ? ??? (???????? ? ????????? ? ??????????? ????????????). ????? ??????, ?????????? ????? ????????????????? ??????????? ? ????????? ???????????? ??????? ???????? ?????????? ?????
???????, ????? ??????????? ??????????? ??????????????
??????? ?? ?????????. ??????? ????????????, ????????,
?????/?????? ??????????? ? ????????? ?????? ??? ????
??????????? ??? ??????? ?????????? ????? ????????????.
???????? ?????? ??????? ????? ???? ???????? ?????????? ? ?????????????? ????????? ? ??????? ??????????,
?????????? ╚?????????????????????╩ ???????????. ??????????????, ??? ????????????? ?????????? ??????????? ?
?????????????? ?? ???????? ?????? ????????, ?????????
? ??????. ????????????? ?????????????? ?????????? ??????????? ? ?????????????? ???????? ????? ?? ????????????? ??????????? ?????????? ???????????. ???, ?? ????????? ??????, ????????????? ?????????? L. acidophilus
LA-5 ? Bifidobacterium animalis subsp. lactis BB-12 ??????????-
?? ?????????? ??????? BB12 ????? ??? ? 2 ???? [30, 31]. ?????? ? ?????????? ????????? ??-10 ?????????? ????????? ??????? ??????? ????????-? (???-?), ???????????-?
(???-?) ? ??-12, ? ????????????????? ???????? ?????????? ???? ??????? ??????????? ????? ╚??????╩, ??? ???
?????????? ??????????????, ?????????? ??????? SIgA ?
???????????? ?????????? ?????????? [32?34]. ???????? ?????????????? ??????? ?????????????? ? ??????????? ?????
???? ?????????? ????? ???????? ? ?????????????? ?????????? ??? ?????? ????????? ????????????? ??????????
?????????-????????? ?????? ???????? ? ???????????.
??????? ??????????? ?.?.????????? ? ?????. (2009) ???????????? ?? ????????? ????????? ? ??????????? ????????????, ???????? ? ?????? ?????????? ??????????, ????????, ???
?????? ????? ???????????? ???????? ? ????????????????
?????????? ??-10 ????????? ?????????. ??? ???? ? ????????????????? ???????? ? ??????????-??????????????? ????????? ??????????? ???????????? ??????? ????????????? ? ?????????????? ??-8 ?? ???????????????? ?????? ??-10 [35].
?????? ????????? ????????? ???????? ?????????? ????????, ????????? ??????????? ?????????????? ????????? [32].
??? ????? ???????????? ??????? ?????????????? ??????? ??? ?????? ???????? ?????????????? ╚????????????╩
?????????????? ????????? ? ?????????. ??? ??????????
???? ???? ???????? ??????????? ???????? ?????????? ???????????, ?????????? 3 ???????? ?????????? ? ?????????? ?????????????? ??????????? ? ??????????? ? ???????????? ?????????? ????????? ????????: ??????????????,
???????????? ? ???????????.
????? ????????????, ??????????? ????, ???????? ?????????? ??????????????? ? ??????? ???????? ???????????.
???????? ???????????? ??? ?????????? ???? ???? ?????
???????????? ???????? ????????? ???????????. ???? ???
????? ??????? ??? ????????? ?????????? ?????????????????? ???????, ?????????, ? ????? ???????, ?????????????
??????????, ? ? ?????? ??????? ? ???????????? ???????????? ??????????? ??????????? ??????????, ?? ?????? ????????????? ?????????? ????????????, ???????????? ?? ????????????? ? ??????????????? ????? ??????????-??????????? ? ??????????????????? ???????????????? ? ???????????, ?????????? ?? ??????????? ?????????? ????????,
??? ???????????????.
???????? ??????? ????????? ??????? ??? ????????????? ? ???????? ??????????????? ??? ?????????????? ?????????? ?????????? ?? ?????? ????????????. ??????? ??????
???????????? ????????? ?????????? ?????????????. ?????????????? ?????? ???????????? ????????? ???????????
?? ????????????? ??????????? ??????, ?? ????? ??????????????, ??? ?????????? ???????, ??? ????????? ?????? ????????????? ????????, ? ?? ?????????????????? ????????
???????? ???????????????? ?? ??????? ??????????????
??????? ? ??????????? [36, 37].
???? ?? ?????? ??????????, ??????????? ??????? ????????????, ???????????? ? ?????????-???????? ?????? ????????, ????????? ? 2 ?????: Enterococcus faecium ?
Enterococcus faecalis. ? ????? ?? ?????? ???????????? ????? ???? ????????????? ? ????????????? ?? ????????? ?????????? ? ??????????? ???????????? ????????. ??? ????,
???? E. faecalis ???? ????????? ? ?????????? ????????, ??
71
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.?????????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 68?75
E. faecium ???????? ????? ???????? ???? ???????????? ?
???????????, ??????? ??????????????? ? ???????? ?????????? ??????????? ??????? ??? ??????? ??????????????
???????? [38]. ??? ???? ???????????? ?????????? ? ?? ??????? ??????????? ????? ???????? ???????????? ? ? ??????? E. faecalis ?????? ???? ?????????????? ???????????
???? [39]. ? ?? ?? ?????, ???? ??????????????? ?????????
??????????? ??????? ?? ??????? ?????????? ? ?????? ?????
???????????? [40, 41].
???????? ????????????? ???? ?????????? ???? ???????
???????????? ? ??????????, ??? ?????????????? ????????
?????????? ??? ?????? ?????? ?????????????? ????????
???????? ?? ??? ??????? ?????????????? (? ????????????
???? ???????? ?????? ?????? E. faecium). ????? ?????????????? ??????????? ?????????? ????????????? ????????????? ???????????? ??????????? ?? ??????? ????? ???????????? ? ????????????? ??????????????? ???????????? ??
?????????? ??????????????? ? ????????????? ?? ????????????. ?????? ??????????????? ?????????????? ??????????????? ????????????????? ?? ??????????? ???????????
?????? ? ????? ????????? ?????? ??????? ? ??????????? ??????? ???????????? ??????????????. ???????????? ??????
??????? ???????????? ????????????? ? ?????????????? ?????? ??? ?? ??????? ?????????????? ? ???? E. faecium ? ??????????? ????? ????????????, ?????, ??? ???? ?????????
esp, asa1, efaA, ?????????? (gelE), ????????? ??????????
(sprE) ? ???????? (fsrB). ? ???????????? ?????????? ??????
?????? E. faecium, ????????? ?? ?????? ????? ????????????. ????? ?????? ??????????? ?? ?????? ?????? ????????
???????????????? ?????????????? ???????????? ?????????????? ???????? ? ??????????? ???????? ???? 1 в 108 ???/??,
??????? ?????????? ????????? ?????? ? ????? ?? 100 ?? ??
????? ? ??????? 10 ????. ?????????????????? ????????????
??????????? ????? ????????????? ? ?? ????????? ????
????? ??????????? ???????????. ? ??????? ????????????
???????? ???? ???????, ? ??????? ?????????? ??????, ????????????, ??????? ? ???????? ????? ?? ???????????? ?????. ????????? ????????????? ????????? ?????? ???????.
?????????????? ????????? ??????????? ? ??????? ????????? Statistica, ?????? 6.0.
??????????????? ???????????? ???? ????????? ?? 7 ???????? ???????????? ? ???????????? ?????????? ?????????? ???????????????? ????????. ???????????? ?????????? ?? ??????? ???????????? ??????? ? ????????? ????????, ????????? ? ????????????? ??????? ????? ??? ???????
???????? ??????????. ???????? ???? ????????? ? ?????????? ???????? ??????? ??????????? ?????, ?????? ?
????????????? ?? ???? ???????? ?????? ????????????.
?????????? ?????????? ????????? ??????? ? ???????? ??????? ?????????????????? ??????? ?? ??????? ???. ? ?????????? ??????? ?????????????????? ??????? ?????????
? 37 ?????????, ????? ??????????? ??????????????? ???????? ?? ?????????? ???????. ??????????? ??????????????
?????? ?????? ???????????? ????????? ?????? ???????????? ??????? ? ???? ???????-?????????????????? ??????????? (????. 1, 2).
?????????? ????????? ? ???????? ?????????? ????????????????? ?????????????? ? 2,57 ╠ 0,3 ?? 2,0 ╠ 0,0
lg ???/? (p = 0,098). ?????????? ??????????? ?????????? ??-
72
???????????? ? 8,10 ╠ 0,28 ?? 8,95 ╠ 0,05 lg ???/?
(? = 0,005); ??????????? ? ? 8,45 ╠ 0,19 ?? 8,71 ╠ 0,18 lg ???/?
(? = 0,019). ???????????? ?????????? ?????????? ???????????? ????? ?????????? ?????????????????? ??????? ?? ????????. ?????? ?????????? ????????????? ???????????????
??? ??? ???????????????, ??? ? ???? ??????? ???????? ????
╚????????? ??????╩. ??????? ???????????, ??? ? ?????? ?????? ????? ??????????? ?????????????? ????? ????????????, ??????????? ?????????????????? ???????. ??????????
???? ????? ????? ???????????? ? ??????????? ???????.
????? ???????????, ??????????? ?????????????? ?
??????????? ???????? ???????????????, ???????, ?? ???????? ??????????? ?????????? ??????????? ????????????????? ?????????????? ??????????. ??? ??????????????, ???
???? ?????????????? ???????? ?? ?????????? ???????????
????????? ? ?????????????? ╚?????????? ???????╩ ????? ?
?????? ???????????? ?? ??????? ??????????, ?? ???? ????????????????? ?????????????? ?????????? ??????????? ?
????? ??????? ? ??????, ?? ???????????? ?? ??????? ???????????, ?????????? ?? ?????????? ????????? ? ?????????????? ?????????????? ??????????, ???????? ??????????? ?????????. ? ???? ???? ??????????? ??????????
?????? ????????????, ???????????? ? ??????? ?????????
?????? (????????) ? ?????????????? ???????? ???????-????????????????? ???????? ╚??????????╩ (??????). ???
?????? ??????????? ? ╚??????╩ ? L3 ? ???????? ???????
???????? ?????? ??? ?????????? ???????, ?????, ??? ??????? ?????? ??????????? ? ????????????????? ? ????????????????? ?????????, ??????????? ??????????????? ?????????? ?????? ?????????? ? ?????? ?????????????????? ????????. ? ????? ??????? ?? ?????????? ???? ????????????, ???????? ??????????? ??????? ????????????
[42, 43]. ? ???????? ??????? ?.?.??????? ? ?????????? ????
????????, ??? ????????? ?????? ????????????? ???????????? ???????? ??????????? ????????????? ???????????
?? ??????, ?????? ?????? ?????????????? ???????? ????????? 1. ???????? ???????????? ????????? ????????? ? ???
?? ???? ?????????????????? ??????? (? ??????)
???????????
?? ?????? ?????????
????? ?????? ?????????
??????????
M╠m
min max
M╠m
min
max
???? ? ??????
1,75 ╠ 0,20 0,0
3,0
0,50 ╠ 0,18
0,0
3,0
??????? ???????
1,90 ╠ 1,16 1,0
3,0
0,40 ╠ 1,16
0,0
3,0
? ??????????????
???????
?????????
2,40 ╠ 0,13 1,0
3,0
0,70 ╠ 0,19
0,0
3,0
???????
1,00 ╠ 0,19 1,0
1,0
1,65 ╠ 0,10
1,0
2,0
???????? ?????
2,45 ╠ 0,36 1,0
6,0
3,55 ╠ 0,13
2,0
4,0
???????? ???? ??????????? ?? ? ????? ??????? ?????????? (? < 0,05)
??????? 2. ???????? ???????? ??????????? ???????? ?????????? ? ????????? ? ??? (?????? ???????????? ? ???? ?????????? log KOE/?)
??????????????
?? ?????? ?????????
????? ?????? ?????????
M╠m
min max
M╠m
min max
?????????????? 8,10 ╠ 0,28 4,0
9,0
8,95 ╠ 0,05
8,0
9,0
????????????
8,45 ╠ 0,19 8,0
9,0
8,71 ╠ 0,18
7,0
9,0
???????????
5,25 ╠ 0,09 5,0
6,0
5,45 ╠ 0,24
4,0
7,0
E. ?oli
6,15 ╠ 0,18 5,0
8,0
6,50 ╠ 0,13
6,0
8,0
?????? ????
2,57 ╠ 0,30 2,0
4,0
2,0 ╠ 0,0
2,0
2,0
??????
2,43 ╠ 0,43 2,0
5,0
2,0 ╠ 0,0
2,0
2,0
??????????
2,43 ╠ 0,43 2,0
5,0
2,0 ╠ 0,0
2,0
2,0
???????
0,90 ╠ 0,31 0,0
3,0
0,60 ╠ 0,35
0,0
6,0
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.?????????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 68?75
??????? 3. ???-????????, ?????????????? ? ??????, ? ???-????????, ?????????? ??? ?????????????? 16S RNA ???????
╚??????╩ ? L3
???????? ????????
???????????
??? ??????????????????
????????, ?????? ???-???????
?? ?????????????????? 16S
??? ??????????????
1F
1-24
GAGTTTGATCCTGGCTCAGGACGA
4R, 1R
3F
501-534
CTTACCAGAAAGGGACGGCTAACT
1R, 3R
4F
942-965
CGCGAAGAACCTTACCAGGTCTTG
1R, 3R
4R
456-473
TTACCGCGGCTGCTGGCACGTAGT
1F
3R
1040-1017
CTGACGACAACCATGCACCACCTG
1F, 3F, 4F
1R
1528-1504
CGCACCTTCCGATACGGGCTACCT
1F, 3F, 4F
1R-1
1476-1453
ACGGCTACCTTGTTACGACTTCAC
1F, 3F, 4F
????? ?? ????????? ???????? ???-??????????????????
????????? 16S ??????????? ??? [44]. ???????? ???? ?????????? ???????? ?????? ?????? ???????????? ? ????????? ??? E. lactis.
??????????? ???????????? ???????? ?????? ? ??????????????? ?????????????, ???? ???? ???????????? ??????????? ???????????? ??????? ???????????? ╚??????╩ ? L3.
??? ?????????? ???-??????? ???????? ???, ?????????? ?
?????????? ???????????? ????????? ??????????, ?????????? 16S RNA, ? ??????????? ?? ????????? ?????????
(????. 3) ??????????? ??????? ????????????? ? ?????????
????, ????? ???? ????????? ??? ?????????? ?? ??????????
???? ? ???????????? ?? ??????????????. ??????????????
?????????? ??????????? ? 2 ???????????? ??? ?????????
?????????? ????????? ??????????????????. ????? ????????? ???-??????????????????? ????????? ?????????? ?????????? ?????????????? ???????????? ? ??????????????
?????? ???????????? ???????? ? ????? ????????? ??????????????????, ??????????????? 16S RNA, ??????? ????????????? ? ??????? ???? ?????? ???????????? ??????????????????? BLAST.
?????? 16S RNA ?????? ╚??????╩ ?????? ??????????
?????????????? ? ?????????, ??? ????? ???????????????
???-???????????????????, ??????????? ?????????? ??????? Enterococcus lactis, ?????????????? ? ???? ??????
GenBank. ?????? ??????? ??????????? ???????????? ????????? ??????, ?????????? ?? ????? ??????. ? ????? ??????? ??????? ????????? 1 ????????? ?? 1490 ??????????? ? ??????????????????. ????? ?????????????? ???????? ?????
??????????. ???????????? ?????? L3 ??????? ???????
???? ? 3 ???????????? ?????, ??? ????? ?????????????.
?????????? ?????? ????? ??????? ? ?????????????? ???Enterococcus fa?cium strain.
Entero??ccus fa?cium 1*5 ?..
Enterococcus faecium strain I
Enterococcus faecium strain..
Uncultured bacterium clone...
Uncultured bacterium clone...
Bacterium ?? 58 R 16 s ribos...
Bacterium Te51A 1? 5 Hbos...
Bacterium re 50 A 16 5 ribos...
Rumen bacterium R+_91_1 3.
Rumen bacterium Rt-4 KSr,
Rumen bacterium Rt-38 165
Rumen bacterium Rt-25 165
Rumen bacterium R>13A 1...
Rumen bacterium R5-16 165
Enterococcus lactis strain ?
Enterococcus lactis strain ?
Enlerococcus lactis strain ?
???????. ?????????? ?????? ??????????????????? ???, ?????????? ??????? 16S ??? ???????????? ??????? ╚??????╩ ? L3.
74
?????? BLAST ???????, ??? ??? ?????? ???????? ?????????? ???????????? ???? E. lactis, ? ????? ????????????,
?????????? ?? ????? ?????? (Rumen bacterium) (???. 1).
???????????? ???? ???????? ????????? ??????????????
????, ??? ??????????? ??????? ????????? ? ???????????
?????????? ?? ???????, ??????? ????????????? ?????????????????? ?? ????????????? ?????????, ??????, ??????
????????, ??? ?? ???????????????? ???????? ????????? ????????, ?? ????????? ? ????????? ????????.
????????, ?????? ?????????????? ??????????? ????????????? ???????????? ????????? ? ??????? ?????????????
????????? ???????, ? ??????? ???? ???????????? ??? ??????????? ?????????? ??? ??????? ?????????. ?????????? ??????????, ???????? ????????????? ????? ?????????? ????????
???????????? ??????? ?????? ????????????, ????????? ??????????, ??? ?????? ???????????? ?? ????????? ?????? ? L3
??????????? ??????? ?? ??????? Enterococcus faecium, ????????? ???????? ???????????? ??????????? ????????.
???????? ?????? ??????, ??????? ???????????, ??? ?????? ?? ?????????? ??????????? ??? ??????? ??????. ???????? ?????? ??? ?????? ?? ???????-??????????????????
???????? ????? ????????????. ???????? ??????????????
??????, ????? ??????????????, ??? ? ?????? ?????? ???????????? ???? ?????? ?????????????? ? ????????????
????????? ?????????? ?????????. ????????? ?????????
????? ???????? ? ?????????????? ??????????? ? ??????????? ? ???????????????? ???????????? ???????? ?????.
? ??????? ?????? ???????????? ????? ?????? ?????? ?????????????? ?????????. ??? ???? ????? ?????????????? ???
???????? ?????????????? ????????, ?????????? ??????????, ??? ? ??????????????.
??????????
1. ???? ?.?., ?????????? ?.?. ??????? ????????????? ?????????. ???????
???????? III. Consilium Medicum. ????????????????? 2007; 1: 29?34.
2. ?????????? ?.?., ???????? ?.?. ??????? ??? ? ??????? ????????????? ????????. ???., 2008; 108.
3. Drossman D.A., Camilleri M., Mayer E.A., et al. AGA technical review on irritable
bowel syndrome. Gastroenterology 2002; 123: 2108?31.
4. Drossman D.A. The Functional Gastrointestinal Disorders and the Rome III.
Process. Gastroenterology 2006; 130(5): 1377?90.
5. ?????????? ?.?. ????????????????? ???????????? ? ???????? ?????????.
???., 2008; 335.
6. McKendrick M.W., Read N.W. Irritable bowel syndrome post salmonella infection.
J Infect. 1994; 29(1): 1?3.
7. Neal K.R., Hebden J., Spiller R. Prevalence of gastrointestinal symptoms six
months after bacterial gastroenteritis and risk factors for development of the irritable bowel syndrome: postal survey of patients. BMJ 1997; 314(7083): 779?82.
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????????????? ??????? ????????????? ?????????: ???? ?? ????? ? ??????? ????????????
8. Spiller R.C., Jenkins D., Thornley J.P., et al. Increased rectal mucosal enteroendocrine cells, T lymphocytes, and increased gut permeability following acute
Campylobacter enteritis and in post-dysenteric irritable bowel syndrome. Gut.
2000; 47(6): 804?11.
9. TЖrnblom H., Holmvall P., Svenungsson B., et al. Gastrointestinal symptoms after
infectious diarrhea: a five-year follow-up in a Swedish cohort of adults. Clin
Gastroenterol Hepatol. 2007; 5(4): 461?4.
10. Neal K.R., Barker L., Spiller R.C. Prognosis in post-infective irritable bowel syndrome: a six year follow up study. Gut. 2002; 51(3): 410?3.
11. ??????? ?.?., ???????? ?.?., ?????? ?.?. ???????????????? ??????? ????????????? ????????? ? ????? ??????????? ? ????????? ? ?????????? ?????????????? ???????????. Consilium Medicum 2006; (????????????): 8?12.
12. Lehrer J.K., Lichtenstein G.R. Irritable Bowel Syndrome. eMedicine. 2007; 8.
13. Marshall J.K., Thabane M., Borgaonkar M.R., et al. Postinfectious irritable bowel
syndrome after a food-borne outbreak of acute gastroenteritis attributed to a viral
pathogen. Clin Gastroenterol Hepatol. 2007; 5(4): 457?60.
14. Spiller R., Campbell E. Post-infectious irritable bowel syndrome. Curr Opin
Gastroenterol. 2006; 22: 13?7.
15. Kassinen A., Krogius-Kurikka L., MДkivuokko H.? et al. The fecal microbiota of irritable bowel syndrome patients differs significantly from that of healthy subjects.
Gastroenterology 2007; 133(1): 24?33.
16. ???????? ?.?., ??????? ?.?. ??????? ????????????? ?????????. ??????????? ??????? 2006; 16: 359.
17. RuigСmez A., Garcмa Rodrмguez L.A., PanИs J. Risk of irritable bowel syndrome
after an episode of bacterial gastroenteritis in general practice: influence of
comorbidities. Clin Gastroenterol Hepatol. 2007; 5(4): 465?9.
18. ????????? ?.?., ???????? ?.?. ??????? ????????????? ?????????, ??????????????? ? ??????????????. Consilium medicum. ????????????????? 2003;
2(7): 305?7.
19. Swidsinski ?., Ladhoff A., Pernthaler A., et al. Mucosal flora in inflammatory bowel
disease. Gastroenterology 2002; 122(1): 44?54.
20. ??????? ?.?., ????? ?.?., ???????? ?.?. ? ??. ???? Campilobacter jejuni ? ?????????? ???????? ????????????? ?????????. ???. ?????????????. ??????
2000; 2: 118?9.
21. ???? ?.?., ?????????? ?.?. ??????????????? ??????? ? ???????? ???????? ????????????? ?????????: ??????????? ???????. Consilium medicum. ????????????????? 2006; 7: 34?42.
22. Collins S.M. A case for an immunological basis for irritable bowel syndrome.
Gastroenterology 2002; 122: 2078?80.
23. Gwee K.A., Collins S.M., Read N.W., et al. Increased rectal mucosal expression of
interleukin 1beta in recently acquired post-infection irritable bowel syndrome. Gut.
2003; 52: 523?6.
24. Gwee K.A., Leong Y.L., Graham C., et al. The role of psychological and biological
factors in postinfective gut dysfunction. Gut. 1999; 44(3): 400?6.
25. Jones V.A., McLaughlan P., Shorthouse M., et al. Food intolerance: a major factor
in the pathogenesis of irritable bowel syndrome. Lancet 1982; 2(8308): 1115?7.
26. Parkes G.C., Brostoff J., Whelan K., et al. Gastrointestinal microbiota in irritable
bowel syndrome: their role in its pathogenesis and treatment. Am J Gastroenterol.
2008; 103(6): 1557?67.
27. Enck P., Zimmermann K., Menke G., et al. A mixture of Escherichia coli (DSM
17252) and Enterococcus faecalis (DSM 16440) for treatment of the irritable
bowel syndrome ? a randomized controlled trial with primary care physicians.
Neurogastroenterol Motil. 2008; 20(10): 1103?9.
28. Enck P., Zimmermann K., Menke G., et al. Randomized controlled treatment trial
of irritable bowel syndrome with a probiotic E.-coli preparation (DSM17252) compared to placebo. Z Gastroenterol. 2009; 47(2): 209?14.
29. ???????? ?.?., ??????????? ?.?., ????? ?.?. ?????????? ? ??????? ????????????????? ???????? ????????????? ?????????. Consilium Medicum. ????????????????? 2008; 1: 47?50.
30. Ouwehand A.C., Isolauri E., Kirjavainen P.V., et al. The mucus binding of
Bifidobacterium lactis Bb12 is enhanced in the presence of Lactobacillus GG and
Lact. delbrueckii subsp. bulgaricus. Lett Appl Microbiol. 2000; 30(1): 10?3.
31. Ouwehand A.C., Salminen S., TЖlkkЖ S., et al. Resected human colonic tissue: new
model for characterizing adhesion of lactic acid bacteria. Clin Diagn Lab Immunol.
2002; 9(1): 184?6.
32. Kekkonen R. Immunomodulatory Effects of Probiotic Bacteria In Healthy Adults.
Academic Dissertation. Helsinki, Finland. 2008; 119.
33. Link-Amster H., Rochat F., Saudan K.Y., et al. Modulation of a specific humoral
immune response and changes in intestinal flora mediated through fermented
milk intake. FEMS Immunology and Medical Microbiology 1994; 10: 55?64.
34. Hatcher G., Lambrecht R. Augmentatin of macrophage phagocytic activity by cellfree extracts of selected lactic acid-producing bacteria. J of Dairy Science 1993;
76: 2485?92.
35. ????????? ?.?., ???????????? ?.?., ???????? ?.?. ? ??. ???????????? ??????? ?????????????? ???????? ? ???????????? ?? ???????? ??????? ???????? ????. ?????? ??????? ?????-?????????????? ???????????????? ???????????? ???????????? ????? ????????? ?.?.???????. 2009; 3: 17?22.
36. Hlivak P., Janova E., Odrazka J., et al. Long-term (56 week) oral administration of
probiotic E.faecium M-74 decreses the expression of sICAM-1 and monocyte
CD49 in humans. Bratisl Lek Listy. 2005; 106(4-5): 175?81.
37. Benyacoub J., Czarnecki-Maulden G.L., Cavadini C., et al. Supplementation of food
with Enterococcus faecium (SF68) stimulates immune functions in young dogs. J
Nutr. 2003; 133: 1158?62.
38. Boyce J.M., Mermel L., Zevos M.J., et al. Controlling vancomycin ? resistant enterococci. Infect. Control. Hosp. Epidmiol. 1995; 16: 634?7.
39. Eaton T.J., Gasson M.J. Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates. Appl.
Environ. Microbiol. 2001; 67: 1628?35.
40. Coburn P.S., Gilmore M.S. The Enterococcus faecalis cytolysin: a novel toxin
active against eukaryotic and prokaryotic cells. Cell Microbiol. 2003; 5(10): 661?9.
41. Coque T.M., Patterson J.E., Steckelberg J.M., et al. Incidence of hemolysin, gelatinase and aggregation substance among enterococci isolated from patients with
endocarditis and other infections and from feces of hospitalized and communitybased persons. J Infect. Dis. 1995; 171(5): 1223?9.
42. ?????????? ?.?., ??????? ?.?. ?????????????? ??????????? ? ???????? ?????????????? ?????????????????? ????????. ?., 2007; 30.
43. ???????? ?.?., ?????????? ?.?., ????????? ?.?. ? ??. ???????????? ????????????? ??? ????? ??????????? ?????????? ? ?????????????? ??????? ????????????. ????. ?????????. ?????????. ??????????. 2008; 5: 83?7.
44. Botina S.G., Sukhodolets V.V. Speciation in bacteria: comparison of the 16S rRNA
gene for closely related Enterococcus species. Genetika. 2006; 42(3): 325?30.
?????????? ? ?????????:
????????? ?????? ??????????, ???????? ???????
??????? ? ??????????? ???????????? ?????-?????????????
??????????? ???????? ??????????????? ???????????
?????: 191015, ?????-?????????, ??. ????????, 41
???????: (812) 723-3924
??????? ????????? ??????????, ?????? ??????????? ????, ?????????,
???????????? ??????????? ?????? ???????????? ????????????? ???
????????????????? ???????? ??? ????
?????: 197376, ?????-?????????, ??. ???????, 12
???????: (812) 234-9319
????????? ???? ??????????, ???????? ?????? ????????????
????????????? ??? ????????????????? ???????? ??? ????
?????: 197376, ?????-?????????, ??. ???????, 12
???????: (812) 234-9319
????????? ?????? ??????????, ???????? ??????????? ????, ??????,
??????????? ?????????? ??????? ???????????? ????????
(? ?????? ??????????? ????????????? ? ??????????? ???????????)
??????-??????????? ???????? ??. ?.?.??????
?????: 195009, ?????-?????????, ?/? 35
???????: (812) 292-3433
75
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
? ?????? ?????
???????? ????????????? ??????????
? ?????? ?????????????? ???????????????
? ??????? ???????????? ?????????????
??????????
?.?.????????1, ?.?.??????????1, ?.?.?????????1, ?.?.?????2
???????????? ??????????????? ??????????? ????????;
????????? ???????????? ??????????? ????????, ?????????
1
2
? ?????? ???????????? ?????????? ???????????? 92 ??????? ???????????? ????????????? ?????????? (???) ???????
???????? ????????????? ?????????? (???). ?????????? ???????????????? ???? ??????????????? ? ??????? ???
? ?? ????????????? ? ???????? ? ???????? ???????. ???????? ?????? ????????? ? ?????????????????? ????? ?
??????? ??? ?? ???? ??????????????? ??????? ?????? ???????????.
???????? ?????: ???????????, ???????????? ????????????? ?????????, ???????? ????????????? ??????????,
???????????????
Laser Doppler flowmetry in assessing peripheral
microcirculations of ?strakhan fever rickettsiay patients
L.N.Niculina1, Kh.M.Galimzyanov1, N.I.Rasskazov1, T.E.Archba2
Astrakhan State Medical Academy;
Regional Infectious Clinical Hospital, Astrakhan
1
2
The paper presents the results of txamination 92 patients with Astrakhan fever rickettsiay assess laser doppler flowmetry (LDF).
An study LDF-test the revealed aspects the microcirculations Astrakhan fever rickettsiay patients and dynamics of therapy. The
were especially iary degeneration patients in the microvasalature.
Key words: diagnosis, astrakhan fever rickettsiay, laser doppler flowmetry, microcirculations
?
????????? ????? ?????????? ???????? ?????? ????????????????? ??????????? ????. ????????? ????????? ?? ??? ???????? ???????????, ??????????? ?? ????????? ????? ????????????-???????? ???????. ????? ?????
???????? ?????? ????? ???????? ???????? ????????? ????????? ? ????????-???????? ???????????, ?????????????
??????? ?????????? ? ?????????? ???????????????? ????????? ? ????? ????????????????? ?????? ?????, ? ??????? ????????? ???????????? ????????????? ?????????
(???). ? ????????? ????? ??? ??????????? ???????? ? ????????? ?????????????? ????? ???????? ???-10 (???
?79.8). ????????? ???? ???????, ? ?????? ???????, ? ??????????? ??????????? ? ?????, ??????? ???????????? ?????????? ????????? ?????????? ? ????????? [1]. ????????,
??? ??? ????????? ????? ???????-??????????????? ???????? ??????????. ? ?????????? ??? ??????? ???????? ??????? ???????????????:
???????? ????? ??????????, ???????? ??????? ??????????????????
???????????? ??????????????? ??????????? ????????
?????: 414000, ?????????, ??. ?????????, 121
???????: (8512) 44-7496
?????? ????????? 2.06.2009 ?., ??????? ? ?????? 15.09.2009 ?.
76
??????????? ??????????????? ??????????? ? ??? ?????????
? ??????? ?????????, ??????????????? ?????? ??????? [2].
???????? ? ????????? ??????????????? ? ????????????? ?????????? ???????? ???? (?????????, ????????? ??????)
??? ???? ??????????? ???????????.
? ????????? ????? ????????? ??????????? ?????? ????????? ??????????????????? ????? ???? ? ??????? ?????? ?????????????? ???????? ? ????????? ??????????? ???????????? ????????? ????-01 (??? ╚?????╩ ??????????????? ????? ????????, ???????? ?????????? ??,
42/99-1286-1418 ?? 17.10.1999 ?.), ??????? ????????? ??????? ????????? ??????????????? ?????????????? ?? ????? ??? 30 ??????????. ???????????? ??????? ??????
???????? ????????????? ?????????? (???) ????? ??????? ? ? ??? ??????????????, ??????????? ??????????? ???????????, ?????????? ????????????????. ???????? ?????? ??????????? ? ????????????? ?????-????????? ??????
????? ????????, ???????????? ? ????????????? ???? ????, ? ??????????? ??????? ?? ?????? ???????? ?????????? ????????? [3].
??????????? 92 ??????? ??? ? ???????? ?? 16 ?? 86 ???,
???????????? ?? ??????? ? ???????????? ????????? ?????-
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????? ????????????? ?????????? ? ?????? ?????????????? ??????????????? ? ??????? ???????????? ????????????? ??????????
??????? ???????? ? ?????? 2005?2008 ??. ?????? ????????
????????? 35 ?????????? ???????? ??? ??? ???????????
?????? ??? ???????????? ??????????? ? ????????.
??????????? ??????? ????????? ??????? ? 64% (59 ???????), ??????? ????????? 36% (33 ????????). ????? ????????????? ??????????? ?????????? ? ?????????? ??????
??????? ???????? (64 ????????) ??????????????? ??? ????
???? ? ???????? ???????????? ???????? ??????????.
??????? ??????????? ??????????? ?? ????????? ?????????????????? ? ???????-???????????? ??????. ???? ????? ??????? ??????????????????? ?? 2?5-? ????? ?? ??????
???????. ???????????? ?????????? ? ?????????? ????????? ? ??????? 7?10 ????. ??? ??????????? ? ???????????
??????? (91%) ????????? ??????????? ??? ?????????????;
??????? ? ? 8%, ?????? ??????? ??????? ? ? 1%. ? ??????????? ??????? ???????????????? ????????? (84%). ???
??????? ?? ????????? ??????? ???????????????? ??????????? ? ??????? ?????????????? ???????? ???????????.
????????????? ????????? ???????? ? 18% ??????? (??????????? ???????, ??????????? ??????? ??????). ?????????? ??? ????????? ? 10% (?????????, ???????, ????????????). ?????? ?????? ?????????? ? 1?2-? ???? ?????
??????????? ?? ?????? ?????????, ?? ?????? ?????????????????? ? ????????? ????????????????? ???????; ????????? ?????? ?????????? ??? ???????, ?? ?? ????? ??? ??
3?5-? ???? ?????????. ?????????? ??????????????? (??)
???????????????? ? 4 ?????, ???????? ??????????? ??? ??????????? ????????? ??? ???: ???? ?????, ??????? ??????????, ?????? ? ?????? ??????, ?????????? ???????????
? ????? ?? ?????? ??????. ????? ????????? ????? ??? ?????????? ???, ??? ???? ? ??? ????? ???????-????????? ????????????, ??????? ? ??????? ??????? ??????????? ???????? ? ??? ?????????? ╚???????????╩ ????????????, ??????? ????? ?????????? ??????? ???????????? ?? ????????? ? ?????????, ???????? ????????????. ? ????? ?????? ?????? ?????????? ? ??????????? ????????? ????????? ? ???? 9 ?????????? ? 11 ????????????? ???????.
? ????? ? ???? ????????? ?????? ? ????????? ???????? ???????????? ??????????? ?? ????????? ?????????? ??????????????? (?). ???????? ? ???????????? ????? ???????
???????? ??????? ?????? ????? ?? ??????? ??????? ? ?????????? ? ????????????? ???????? (???????????? ???????? ? ????. ??.). ???????? ????????????????????? ?????????? (???) ??????????? ??? ?????? ????????? ??????????????? ? ??????????? ?????????? ?? ?????????, ???????????????? ? ????? ???????? ?????? ? ???????????
???????. ???????? ??????? ???????????? ????????? (???)
??????? ? ???????? ????????? ????????, ???????? ????????
??????????? ??????????????? ????????? ? ?????? ??????????? ? ?????????? ???????????? ??? ??????? ?????????? ??????????? ?? ???? ??????????. ??????????
?????? ???-??????, ??????????? ? ??????????????? ??????? ???????????? ?????????? ? ??????? ?????????? ?????? ?????? Microsoft Access 2002. ?????????????? ????????? ??????????? ? ??????? ???????????? ?????????
?icrosoft ??cel 2002. ?????????????? ??????????? ??????
???????????? ?????????? ? ???????? ??????? ??????? (?),
??????????? ??????, ???????????? ?????????? ?? ????????. ???????????? ?????????????? ?????? ? ??????????
???????? ????????? (t) ? ??????? ????????????? ????????
??? ??????????????? ???????. ???????? ????????? ???????????? ??? t ? 2, ????????????? ????????? ??? ? < 0,05.
??? ??????? ?????????? ????????? ? ??????? ??? ? ?????? ??????? ???????? ?????????? ????????? ???????? ?
????? ?? 4 (?????? ??????), ??? ? ??????? ??? ?? ?????????
? ??????????? ??????? ?????????? ????? ??????? ?????????? ??????? ????????? ????????. ???, ???????? ???????? ?
?? ??????? ? ??????? ????????? 25,09 ╠ 1,4 ??????
13,25 ╠ 0,38 ????. ??. ??????????? ?????? (? < 0,01). ? ?????
1 (?? ???? ?????) ? ? ????? 2 (?? ???? ??????????) ? 18,06 ╠
╠ 0,89 ? 18,99 ╠ 1,1 ????. ??., ??????????????, ?????? 12,27 ╠
╠ 0,36 ? 9,18 ╠ 0,47 ????. ??. ? ???????? ??? (? < 0,01). ?? ???? ?????? ? ????? 3 ?????????? ????????? ? ?????????? ?????????? ? ?? ????????? ? ???????????? ????? ? 20,71 ╠
╠ 1,4 ?????? 11,16 ╠ 0,26 ????. ??. (? > 0,05). ??????????
??? ?? ??????? ? ?????? ??????? ??? ?? ???? ?????? ? ????? 4 ???????? 1,16 ╠ 0,19 ?????? 0,82 ╠ 0,10 ????. ??. ??????????? ?????? (? < 0,05). ?? ???? ????????? ?????? ???????? ??? ????? ????????? ? ?????????? (? > 0,05).
?????????? ?????????? ????????????? ? ?????? ????,
???????? ? ??????? ??????? ???????????. ??? ??????? ??????? ???????? ??????? ???????? ?????? ?????? ????? ???
???????? ? ???????? ???? ???????? ????????? ?????? ?????????? ??????????????? ? ? ????? 2 (?? ???? ??????????) ?
? ????? 4 (?? ???? ??????), ??????? ??? ??????????
(? < 0,05) ???? ? ?????? ????? ??????? ? ???????? 10,93 ╠
╠ 0,69 ? 10,22 ╠ 1,4 ????. ??., ??????????????, ?????? ???????? ? ? ?????? ? 17,47 ╠ 6,5 ? 18,64 ╠ 1,12 ????. ??.
??????? ???????? ?????? ?????? ???????? ? ????????? ?
??? ????? ????????? ? ?????????? ? ????? ? ???????? ??????? ???????????. ???????? ??????? ?????????? ???????? ? ???????????????? ? ??????? ? ??????? ????????, ???
???? ???????? ????????????? ???????? ??????? ????????
???????? ?????? ?????? ??????????? ? ??????? ?? ????????????? ???????? ???????????. ???, ? ????? 4 (?? ???? ??????) ???????? ? ?????????? ????????? ? 18,16 ╠ 0,94 ??
12,16 ╠ 1,2 ????. ??. (? < 0,01) ? ???????????? ? ?????????? ??????????? ?????? ? 9,18 ╠ 0,47 ????. ??. ???????? ??????? ?????????? ??? ?????????? ??????????????? ? ?????
4 (?? ???? ??????) ? ????????? ? ??????? ???????? ? 2,16 ╠ 0,1
?????? 1,02 ╠ 0,07 ????. ??. ??????????? ?????? (? < 0,05).
? ??????? ??? ? ????? ?? ???? ?????????? ??????????
???????????????? ????? ??????? ?????????? ? ? ?????????
? ??????????? ???????. ? ???????? ??????? ? ??????? ???
????? ?????????? ????????????? ???????? ?????????? ?
?????????? ? ?????????? ????????? 30?50 ???, ??? ????????
? ?????????? ??????????? ? ????? 2 (?? ???? ??????????)
? ? ????? 4 (?? ???? ??????) ?? 9,07 ╠ 0,16 ? 10,69 ╠ 1,08
????. ??., ??????????????, ? ??????????? ?????????? ????,
??? ? ??????? ??? ? ?????????? ????????? ?????? 50 ???
(? < 0,05).
? ????? ? ????????????? ???????? ???????????? ??????? ??? ???? ????????? ?? 2 ??????: 1-? ????????? ???????, ?????????? ??????? ??????? (n = 60), 2-? ? ????????,
? ??????? ??????? ????????????? ???????? ???????????
(n = 32). ??????????? ?? ?????????? ?????? ???-????????????, ????????, ??? ?? 2-? ?????? ???????, ??????????
???????? ???????????, ?????????? ????? ?????? ????????
77
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.???????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 76?79
?????????? ? ? ??????????? ??? ? ??????????? ??????????? ??????. ??? ??????? ??????? ???????? ???????? ? ?
??????? 2-? ?????? ????? ??????? ? ????????? ? ???????????? 1-? ?????? ?????????? ????????? (? > 0,05) ? ???????? ???????? ? ? ????? 3 (?? ???? ??????) (12,16 ╠ 0,18
?????? 16,31 ╠ 0,86 ????. ??., ??????????????). ? ?????????
?? ?????? ???????????? ?????????? ??????????? ????????
???????? ? ?? ????????? ? 1-? ??????? ??????? ? ????? 1
(?? ???? ?????) ? 14,18 ╠ 0,66 ?????? 20,6 ╠ 1,2 ????. ??.
(? < 0,05), ? ????? 2 (?? ???? ??????????) ? 8,07 ╠ 0,71 ?????? 14,36 ╠ 6,4 ????. ??. (? < 0,01), ? ????? 4 (?? ???? ??????) ? 9,81 ╠ 1,28 ?????? 16,10 ╠ 0,97 ????. ??. (? < 0,01). ???
??????? ??????? ??? ? ??????? ??? 2-? ?????? ????? ??????? ???????? ????? ??????? ???????? ??????? ??????????
?? ????????? ? ??????? ? 1-? ?????? ???????. ???????????
???????? ???????? ??? ???????? ? ????? 4 (?? ???? ??????), ??? ??? ?? 2-? ?????? ??????? ????????? 0,70 ╠ 1,16 ?????? 1,01 ╠ 0,1 ????. ??. 1-? ?????? ??????? (? < 0,05), ? ??????????? ?????? ???????? ??? ???? 1,02 ╠ 0,07 ????. ??.
????????? ??????????????? ? ???, ??? ?????????? ????????????? ??????? ? ??????? ??? ???????? ?????????????
????????? ????????????????? ????????? ? ?????????? ??
??????? ??????????????????? ????? ? ????? ? ????? ???????, ?? ????????? ? 1-? ??????? ?? ??????, ??????????????
??????????? ???????? ?????? ?????? ? ???????? ?? ?? ?????? ??????????? ??????. ??????? ???????? ??????????? ????????????? ????????? ??? ???????????? ???????? ?????????
?????????? ?? ??????? ??????????????????? ????? ? ?????????? ?? ?????????????? ? ??????????? ?????????
????????-?????????? ???????? (???).
??? ??????? ??????????? 20 ???????, ????????????? ????? 6 ??? ????? ???????, ???? ???????????, ??? ??????????
? ? ??? ???? ???? ?? ????????? ? ???????? ??? ???????
? ?????? ?????? ???????????????? ?? ?????????? ? ???????????? ? ??????????? ??????????? ??????. ???, ????????
?????????? ? ? ????? 1 (?? ???? ?????) ? ??????? ????? 6 ???
????? ??????? ???? ?????????? ???? ??????????? ???????
?????? ???????????????? ??????? 1-? ?????? ? ?????????
9,61 ╠ 0,33 ?????? 20,6 ╠ 1,2 ????. ??. (? < 0,05). ? ????? 2
(?? ???? ??????????) ???????? ? ????????? 5,41 ╠ 0,26 ?????? 14,36 ╠ 6,4 ????. ??. (? < 0,05). ???????? ????????? ???????? ???????? ? ?????????? ???????? ? ????? 4 (?? ????
??????) ? 16,1 ╠ 0,97 ?? 6,12 ╠ 0,37 ????. ??. (? < 0,01). ? ????? 3 (?? ???? ??????) ???????? ????????? ? ???????? ???????? ? ? 16,31 ╠ 0,86 ?? 9,42 ╠ 1,18 ????. ??. ????? ???????
(? > 0,05).
??????????? ?? ?????????? ???? ??????, ????????, ???
? ??????? ??? ????? ???????, ???????? ?? ?????????????
???????? ??????????? ?????????, ??????????? ??????????
?????????? ????????? ??????????? ????????? ????????
?????? ?????? (? ? ???) ?? ???? ??????, ??????? ?????????
??????????? ??????????? ?????? ?? ????? ????? ???????, ?
?????? ????? 6 ??? ????? ???????, ??? ????? ????????????????? ? ????????????? ????????? ??????? ????????? ??????????????????? ????? ? ????? ? ??????? ??? ???? ???
????????????? ??????????? ???????????? ? ?????? ??????
????????????????, ??? ?????????? ??????? ????????? ???????????? ?????. ????????????? ???????? ????????? ?
?????????????????? ????? ? ??????? ??? ????? ???? ???-
78
???? ? ?????????? ????????????, ?????????? ??????????
?? ??????? ??????????? ?????.
?????? ?????? ???????????? ??????????????? ?????????????? ??????? ??? ??????? ??????????? ????????????????? ???? ??????????????? (???). ?? ????????????
????????????? ???, ???????????? ?????????? ?.?. ? ?????. (2000 ?.). ??? ??????????? ??? ??????????? ??? ??????? ???????? ???????? ?????? ?????? ? ?????????? ??????????-?????????? ???????, ??? ? ?????????? ???????????
????. ?????? ???? ?????????? ??????????? ??????????????
????? (??????????). ???????????????????? ????????? ???????? ? ?????? ??????????-?????????? ??????? (???) ?????? ???? ??????????????? ????. ??? ??????????? ? 65 ??????? ??? ??????? ??? ??? ???? ?????????????? ???. ?????
?????????????? ????? ?????????????????? ????????????
?????????????? ?????? ???????? ??? ??????????? ????????????? ? ?????????? ??? ? 24 ? 22,1%, ??????????????. ?????????????? ? ??????????? ??? ?????????? ? 11,6 ? 9,2%.
? 7,3% ??????????? ????????? ??? ???. ????? ???????????? ??????? ???????? ??? ??????? ? ??????????????????
????? ??? ?????????? ? ???????? 57%. ? ????????? ?????????????? ??? ???????? ????????? ???? ?????????? ????????????? ????????????? ? ?????????? ???. ????????????
??? ??????????????? ? 16,1%, ????????? ? ? 13,4%. ???????
??????????? ???????????? ???? ?????????? ??????? ? 9,2%.
????????????? ??????????? ????? ??????? ?? ?????????
??? ? 6,4%. ??????? ??????????? ??????????????? ???, ????????, ????????? ???????? ? ????????? 13,6%. ?? ???????
????????????? ??? ????????? ????????????? ??????????????? ?????????. ????? ???????, ??? ??????????? ?
???????? ? 65% ??????? ???????????????? ??????????????
???. ????? ????? ??? ????????? ???? ????????????. ?????? ???? ?????????? ???????????? ? ????????? ????. ? ???????? ??????? ????????????? ????? ??????? ? ?????????????????? ????? ???????????????. ????????? ??????? ????????????? ? ?????????? ???. ????????? ?????????? ??????? ? ?????????????? ????? ??????????????? ?? ????????? ? ????????????? ???????? ??????????????????? ?????.
?????????????? ???????? ????? ????????? ??????? ???????????? ????????????, ?? ??????????????, ????????? ???????????? ?????????? ? ?????? ??????????????????? ?????.
??? ????????????? ??????? ???????? ????? ???????? ???????????? ???????? ??????? ???????????? ?????????????? ???????? ????? ? ??????? ??? ?? ????????? ? ??????????? ???????. ???, ???????? ??? ? ?????? ??????? ???
?? ??????? ????????? 238,09 ╠ 27,16% ?????? 425,39 ╠
╠ 34,42% ??????????? ?????? (? < 0,01). ??? ?????????
??????? ?? ????????? ???????????? ? ????????????? ?????????????????? ??????? ?? ??????????? ??????????? ??????? ?????, ????????? ? ?????????? ?????? ???????????
????????????? ?????????????? ????????? ?? ???? ????????????? ?????????.
??? ??????? ??????? ??????? ???? ??????????? ??????
?????????? ? ??????? ?????????? ? ??????? ???, ??????????? ? ??????????? ???????? ????????? ? ???????????????? ???????????, ??? ????????????? ???????????? ??????? ??????????? ???? ???????? ???? ? 16 ??????? (17,39%).
? ?? ?? ????? ??? ??????? ???? ????????????? ????????
????? ??? ???, ??? ? ???????? ?????????? ???????? ????
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????? ????????????? ?????????? ? ?????? ?????????????? ??????????????? ? ??????? ???????????? ????????????? ??????????
????? ???????? ???, ??????? ?????????????? ?????????
?????????????? ? 37 ??????? (40,2%). ???, ???????? ??? ?
?????? ??????? ? ???????????? ?? ??????? ?????????
216,01 ╠ 16,8% ?????? 425,39 ╠ 34,42% ??????????? ??????
(? < 0,01). ???????? ??????? ???????????? ??????????????
? 2 ? ????? ??? ????? ???? ??????? ? ???????? ???????????????? ????????. ??? ????? ????????????????? ?? ??? ????????? ?????????? ? ?????????????????? ?????, ??? ??????????? ????????? ????????? ???????????? ????????????
?? ?????????? ??????? ????? ?? ????? ?????????? ???????? ????????? ? ???????? ???????????? ???????????? ???????? ? ??????????? ???????????? ??? ??? ? ??????????
????? ??????????, ??? ??????????????? [2].
????? ???????, ?????? ?????????????????? ?????????
? ??????? ??? ???????? ???????????? ? ??????? ??????
????? ??????, ??? ? ??????????? ???????? ?????. ??????????? ???????? ???????? ?????????? ????????? ???????????????? ????? ? ???????? ?????????? ????????? ??????????. ???????? ???????? ??????? ???????????? ?????????????? ???????? ????? ? ??????? ??? ?? ????????? ? ??????????? ??????? ???????? ????????????. ???????? ???????
???????????? ????????? ???????? ???????? ????????? ? ????????????? ??????????? ? ?????????? ? ??????????? ??
??????? ?????????? ? ??????? ? ???? ??????????????? ?????????, ??????????, ????????? ? ??????? ?????? ??????
??????????? (??????????????? ?????? ???????????, ?????
??????????? ????? ?????????? ??????????? ??????????
???????????). ??????????? ?????? ??? ???????? ????? ???
????????????? ??? ????????? ?? ?????? ?????????????? ??????? ??????????????? ??????????, ?? ? ??????????????
?? ? ?????? ???????????, ??? ????? ?????????????? ??????? ???????. ????? ????????? ????????????? ? ???, ??? ??-
??????? ??????????????? ????? ???????? ? ??????? ????
?????? ???????????, ??????????????? ?????? ???????, ???
? ??????????. ??????????? ???????? ? ????? ????? ????????? ???? ?? ????? ????????? ????? ??????????? ??????????? ??????? ????????????? ?????????, ?????? ?????
?????????? ?????? ?????? ??????? ??????????????? ?
??????? ???????????? ????????. ???????? ?????? ?????????? ??????????? ???????????? ? ??????? ?? ????????????
???????????, ?????????????????? ? ??????? ????????? ??????? ? ????????????? ??????????.
??????????
1. ?????????? ?.?., ?????? ?.?., ????????? ?.?. ???????????? ????????????? ?????????. ?????????, 1999; 150.
2. ??????? ?.?. ?????????????? ?????? ?????????? ???????????? ?????????.
???????. ????. ? ????. ???. ????. ?., 1995; 24.
3. ?????? ?.?., ??? ?.?., ??????? ?.?. ?????????? ?? ?????????? ?????????
??????????? ???????????? ????????? ????-01. ?., 2002; 39.
?????????? ? ?????????:
?????????? ????? ???????????, ?????? ??????????? ????,
?????????, ??????????? ???? ??, ?????????? ???????? ????????????
???????? ???????????? ??????????????? ??????????? ????????
?????: 414000, ?????????, ??. ?????????, 121
???????: (8512) 44-7496
????????? ??????? ????????, ?????? ??????????? ????,
?????????, ??????????? ???? ??, ?????????? ????????
?????????????????? ???????????? ??????????????? ??????????? ????????
?????: 414000, ?????????, ??. ?????????, 121
???????: (8512) 44-7496
????? ??????? ????????, ??????????? ???? ??, ???????????
???????? ????? ????????? ???????????? ??????????? ????????
?????: 414000, ?????????, ??????????? ?????, 7
???????: (8512) 31-0607
????????????? ??????????? ??????
??????? ?????? ??????????? ???????????? ?? ?????????????? ?????
?? ?????????? ????????? ? ???????????????? ??????????????? ?????????
???????? ??????????????? ?????? ??????????? ???????????? 848 ????????? ? ???????????????? ??????????????? ????????? (???) ?? ?????? ? 1995 ?? 2000 ??. ? ???? ???????? ??????? (????????? ? ????????? ???????) ??? ????????????
????? ????? ??????????? ??????????? ????????????? ?????????? (???) ?? ?????????????? ????? ? ???????????? ??????????? ??????? ? ?????????????? ????????????????? ???????, ? ??????? ????????? ?????? ?? ???????????? ???????????, ?????????? ???????????? ? ??????????????? ?????????????? ?????????.
???????????, ??? ????????? ????? ??? ??????????????? ? 49 (5,72%) ???????. ?? ???? ?????????? ? ???????????? ????????? 226 ???????? ??????????? ??? (??????????????? ????-???????) ?? ?????????????? ????? (? ??????? 48 ?,
???????????????? ??????????????). ??? ??????? ??????????? ????? ??????????? ??? ? ???????????? (? ?????????
?? ??????? ? ???????????? ????????? ??????? ?? ??????? ????????? ????????? ???????? ?? ?????????? ??? ? ??????????) ?????????, ??? ?????????? ??????????? ??? ?? ?????????????? ????? ???????? ???????? ???????? ????????
??????????? ??????????? ????????? ? ??? (????????? ?????? ??? ?????????? ?????? = 0,37, 95% ????????????? ???????? ?? 0,15?0,93).
????? ???????, ????? ??????????? ??? ?? ?????????????? ????? ???????????? ???????? ??????????? ??????????? ?
????????? ? ???????????????? ??????????????? ?????????.
Perea-Milla E., et al.
Out-patient antibiotherapy and mortality caused by invasive meningococcal disease.
BMC Public Health. 2009 Apr 3; 9(1): 95.
www.antibiotic.ru
79
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????? ??????
????????????? ? ????????????
????????????????? ???????
? ????????? ????????? ????
?.?.???????1, ?.?.???????2, ?.?.?????????3
??????? ????? ???? ? ???????????? ??????????? ????????? ????, ?????;
???????? ???????? ? ???????? ??????????????? ???, ?????;
3
???????? ??????????????? ??????????? ???????? ??. ????. ?.?.???????
1
2
????? ???????????? ??????? ?????? ????????????? ? ???????????? ?????????? ?????????????? ?????????????????
???????, ????????? ?? ?????????? ????????? + ????????? ? ????????? ? ??????? 48 ???, ? ??????????? ??????? ????????? ?????? CD4+-T-?????????? ?? ???????? ?? ??????????????. ??? ??????????? ?????????? 30 ??????? ????????????, ????? ?? ?????????? ????????????????? ??????????. ???????? ???? ????????? ?? 2 ?????? ? ??????????? ?? ????????? ?????? CD4+-T-??????????. ?????????? ???????? ?????? ???????? ????????, ????? CD4+-T ??????????, ?????????? ?????????????? ??????? ????? ? ?????????? ????? 4, 12, 24, 36 ? 48 ??? ?? ?????? ???????.
???????????? ???????? ??????? ???????????????? ? ??????????? ???????????????? ????????????? ?????? ?????
?????, ??????????? ????? ?????????????? CD4+-T-?????????? ?? ?? ????????? ?????? ? ??? ?????? ?????? ?? ???????, ??? ??????? ?????????? ?? ??????? ? ???????? ???????. ??????????? ?????????? ?????????? ?????????? ? ????????? ????????? ?????? ??????????? ? ???????? ?????????? ????????????? ???????????.
???????? ?????: ???-????????, ?????????????? ????????????????? ???????, CD4+-T-?????????, ???????? ????????
Efficacy and safety of antiretrovirus therapy
in patients in the Perm region
N.G.Shmagel1, K.V.Shmagel2, N.N.Vorob?eva3
Regional Center for AIDS and Infectious Diseases of the Perm Region, Perm;
Institute of Ecology and Genetics of Microorganisms, Russian Academy of Sciences, Perm;
3
E.A.Vagner Perm State Medical Academy
1
2
The study was aimed at evaluating the efficacy and safety of using highly active antireptovirus therapy consisting of the
drugs lamivudine + zidovudine and efavirenz for 48 wks, and at determining the influence of the baseline levels of CD4+-Tlymphocytes on the dynamics of their restoration. The observation involved 30 patients with HIV infection, who previously
did not receive antiretrovirus medication. The patients were divided into 2 groups depending on the baseline levels of CD4+T-lymphocytes. The dynamics of the level of viral load was determined, CD4+-T-lymphocyte count, values of blood biochemistry and hemogram after 4, 12, 24, 36 and 48 wks from the beginning of treatment were detected. The study showed
a high virological and sufficient immunological efficacy of this scheme of HAART, dependence of CD4+-T-lymphocyte
restoration rate on their baseline values ? the more cell count before therapy, the faster their number increases during therapy. Toxic effects of the drugs were manifested in a moderate increase of the level of transaminases and development of
mild relative neutropenia.
Key words: HIV infection, highly active antiretrovirus therapy, CD4+-T-lymphocytes, viral load
?
????????? ????, ????????? ????????? ?????????
????? ????????????????? ?????????? ? ???????????
?? ?????????????, ?????????? ????????? ?????? ? ???????
???-???????? ? ????????? ????? ???-??????????????
??????? [1]. ? ??????? ????????????????? ??????????
????? ??????????? ??????????? ??? ? ????????? ?????????? ?????? ? ?????, ?????? ?? ??????????????? ?????? [2].
??? ???????????????:
??????? ??????? ???????????, ????-?????????
??????? ????? ???? ? ???????????? ??????????? ????????? ????
?????: 614088, ?????, ??. ????????, 21
???????: (342) 227-5862
?????? ????????? 25.02.2009 ?., ??????? ? ?????? 15.09.2009 ?.
80
????????????????? ??????? (???) ??????????? ??????? ?????????????? ? ?????????? ?? ??????, ????????? ? ???- ????????? [3]. ???????? ??? ?????????? ? 1987?1990 ???? ?
???????????. ?????? ?????? ??????????? ????????????????? ?????????? ???? ????????? [4]. ??????? ???? ???????????, ??? ????????????? ????????????? ???? ???????????? ??????????? ???????? ????????????? ??? ???????? ????? ??????????? ?? ????????? ? ???????????? [5]. ? ??????????, ?????????????? ????????? ??????, ???? ????????,
??? ??????? ?????????? ????????? ??????????? ???????
?????????? ????? ??????? ?????? ? 38 ?? 22% [6]. ??? ??????? ? ???????????? ????????? ??????????????? ??? ?
????????? ??????? ????? (?????????????? ???????????-
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????????????? ? ???????????? ????????????????? ??????? ? ????????? ????????? ????
?????? ???????). ? ????????? ????? ? ???????? ?????? ??????? 4 ?????? ????????????????? ??????????: ????????????
?????????? ???????? ????????????? ??? (????), ?????????????? ?????????? ???????? ????????????? ??? (?????),
?????????? ???????? ?????? (??) ? ?????????? ???????.
?????? ???? ?????????? ????? ? ?????? ??????? ?
1997 ?., ? ? 2006 ?., ????????? ?????????? ????????????? ????????????? ??????? ╚????????╩, ????? ????? ???????? ??
???? ??????. ? ???????? ??????? ?????? ?? ????????????
? ?????? ?? ?????? ??????? ?????????? ????? ????? ???????? ? 2006 ?. ? ????? ??????? ????????? ????? ?????????? ???????? ????? 1000 ???????. ???? ?? ???????? ????,
??????????? ? ?????????, ??????? ?????????? ??????????????? ???????, ???????????? ??????????? ??????????
?????????? 2 ?????: ????????? ? ?????????, ?????????????? ?? 300 ? 150 ??, 2 ???? ? ???? ? ????????? ? ?????,
?? 600 ?? 1 ??? ? ????. ??? ????? ????????????? ??? ?????
???????????? ??????? ??????????? ???, ???????????????? ??????? ?????????????? ?????? ? ??????? ??? ???-???????? ? ????? (2006?2007 ??.), ? ??????????? ?????????????????? ??????? ?? ???????????? ? ?????? ??
?????? [??????????? ????????????, 2006].
????? ?????????? ???????????? ??????? ?????? ????????????? ? ???????????? ?????????? ????????? ????? ??????? ? ???-?????????????? ????????? ????????? ????,
??????? ?????????? ????????????????? ?????????.
? ???????????? ???? ???????? 30 ???-??????????????
?????????, ????? ?? ?????????? ??? ? ???????????? ?? ??????? ?? ????? ╚????????? + ????????? ? ?????????╩ ? ??????? 48 ???. ??????? ??????? ??????? ???????? 29 ???.
????? ??? ?????? ???? 48%, ?????? ? 52%. ?????????
???-???????? ? ???????? C ???????? ? 76,3% ?????????????. ???????????????? ? ???????? ??????????? ? 60%
?????????. ???????? ??????????? ????????????? ??????? ?
???????????? ?? ??????????. ? ????????? ? ??????? ??????
??????? ???????????? ??????? ???-???????? ???? ?? 2 ??
10 ???. ?????????? ????? ????????? ? ?????? ???????????,
???????????????? ? ???????????????? ??????. ??????????? ?????? ???-???????? 4A ? ???? ????????????????
(?????????? ????????????? ???-???????? ?.?.???????????, 2001 ?.) ????? 87,7% ?????????, 4? ?????? ? 10%,
3-? (?????????) ? 2,3%. ???????? ??????? CD4+-T-?????????? ? ????? ?????????? ? ????????? ?? 69 ?? 350 в 106/?,
??????? ???????? ???????? ?? ?????? ??????? ? ???? ????????? ??? ????? 20 000 ?????/?? (? ??????? ? 72 166 ?????/??). ????????????? ??????? ????????? ?? ??????????
?????????? CD4+-T-?????? ? ???????? ???????? ????????
???????????? ??????????????? ???????????, ?????????? ??
?????? ???????. ??????????? ???????? ?????????? ?????????????? ?? ????????? ????????? ? ????????????? ?????????? ?????????????? ?????.
?????????? CD4+-T-?????????? ?????????? ??????? ????????? ???????????????? ?? ???????? FACS Calibur (Becton
Dickinson). ???????? ???????? ??????????? ????? ????????
???????????? ??? ??? ??????? ???????????? ??????
??????? (???) ? ???????? ??????? ? ??????? ????-??????
╚Amplicor HIV-1 Monitor v. 1.5╩ (╚???????-?? ???╩) (???????????????? ~ 500 ?????/??). ?????????? ??????????, ??????????? ? ???????????? ??????????? ?????????? ?? ???????????????? ??????????? Abacus Junior B (Diatron). ? ??????
????? ???????????? ????????????? ?????????? ??????????, ????? ???????????? ?? ?????????? ??????????.
????? ?????????? ????? ╚????????? + ????????? ? ?????????╩ ? ??????? 48 ??? ???????? ???????????? ???????????????? ???-???????? ????????????? ? ???? ?????????.
???? ???????? ???????????? ???????? ???????????? ???
? ?????. ????? 4 ??? ????? ????????????? ? ??????? ???????? ??? ? ????? ????? 500 ?????/?? (??????? ???????????????? ????-???????) ????????? ????? 50%, ????? 12 ??? ????? ??????? ???????? ???? 5%. ?????? 24 ??? ????? ??????
?????? ?????????? ? ???? ????????? ???????? ???????? ???? ???? ??????????? ????????????? ??????.
????? ????? ????? ?????? ??????? ? ????? ???-?????????????? ????????? ?????????? ?????????? ?????????? ?????????? CD4+-T-?????????? (? 217 ╠ 22 в 106/? ??
324 ╠ 44 в 106/?; p < 0,05) ? ??????????? ?? ???? ?????? ? ??????? ????? ??????? ??????????. ?? ?? ??????????? ??????????? ? ? ????????? ????????????? ??????????? CD4+-T??????. ??? ???? ??????? ?? ?????? ?? ????? ??????????
?????????? ????? (????. 1).
?????????????, ??? ???????? ?????? ? ?????? CD4+-T?????? ???? ?????????? ? ??????? ?????? 4 ??? ???????.
? ??????????, ???????? ?? ??????????? ???????, ?? ??????????? ??????????? ?? ????????. ??????? ????????, ???
???????, ?????????????? ? ???????? ???????, ??? ??????????? ???? ?????? ??????? ???????????? ????? ???
CD4+-T-?????????? (600?1600 ? 106/?). ??? ??????? ? ????????????? ? ???????? ? ???????? ??????? ???????? ?????????????? ???????? ??????????. ?????? ?? ?????, ????
???????????????? ???????? ?????????????? ????? ?????? ? ??????????? ?? ?? ?????? ?? ?????? ???????. ??????? ???? ????????? ?? 2 ??????: 1-? ?????? ? ????????,
??????? 1. ????????? ??????????? ?????????? ? ????? ???-?????????????? ????????? ? ???????? ?????????? ????????????????? ???????
??????????
?? ???????
4 ??? ???????
12 ??? ???????
24 ??? ???????
36 ??? ???????
48 ??? ???????
1
2
3
4
5
6
????? ?????????? ??????????, 106/?
4880 ╠ 236
4784 ╠ 349
4074 ╠ 247
4741 ╠ 362
4957 ╠ 279
5380 ╠ 477
p1-2 > 0,05
p1-3 < 0,05
p1-4 > 0,05
p1-5 > 0,05
p1-6 > 0,05
?????????, %
25,5 ╠ 1,7
29,8 ╠ 2,9
28,6 ╠ 1,9
27,5 ╠ 2,2
25,1 ╠ 1,6
29,5 ╠ 3,0
p1-2 > 0,05
p1-3 > 0,05
p1-4 > 0,05
p1-5 > 0,05
p1-6 > 0,05
?????????, 106/?
1213 ╠ 87
1349 ╠ 129
1139 ╠ 103
1217 ╠ 101
1231 ╠ 86
1447 ╠ 122
p1-2 > 0,05
p1-3 > 0,05
p1-4 > 0,05
p1-5 > 0,05
p1-6 > 0,05
CD4+-??????, %
17,2 ╠ 1,0
23,6 ╠ 1,8
24,5 ╠ 1,5
24,6 ╠ 1,4
25,3 ╠ 1,5
25,4 ╠ 1,6
p1-2 < 0,005
p1-3 < 0,001
p1-4 < 0,001
p1-5 < 0,001
p1-6 < 0,001
CD4+-??????, 106/?
217 ╠ 22
324 ╠ 44
300 ╠ 33
324 ╠ 40
339 ╠ 44
317 ╠ 31
p1-2 < 0,05
p1-3 < 0,05
p1-4 < 0,03
p1-5 < 0,02
p1-6 = 0,01
81
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.??????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 80?83
??????? 2. ?????????????? ??????????? CD4+-?????????? ? ????? ???-?????????????? ????????? ?? ???? ?????????????????
??????? ? ??????????? ?? ?? ????????? ??????
??????????
?? ??????? 4 ??? ??????? 12 ??? ??????? 24 ??? ??????? 36 ??? ??????? 48 ??? ???????
?????????
???????? ??????? CD4+-??????
1
2
3
4
5
6
????????????? ??????????
??????? (1)
19,8 ╠ 1,4
26,5 ╠ 2,3
27,8 ╠ 1,9
27,4 ╠ 2,0
28,3 ╠ 1,9
28,1 ╠ 2,1
CD4+-??????????, %
?????? (2)
14,2 ╠ 1,0
19,0 ╠ 1,9
20,7 ╠ 1,9
21,4 ╠ 1,8
21,9 ╠ 2,0
22,7 ╠ 2,2
? ????? ???????? 1 ? 2
<0,005
<0,03
<0,02
<0,05
<0,03
>0,05
?????????? ??????????
??????? (1)
301 ╠ 25
415 ╠ 54
380 ╠ 49
438 ╠ 56
441 ╠ 69
393 ╠ 45
+
6
CD4 -??????????, 10 /?
?????? (2)
122 ╠ 12
181 ╠ 31
207 ╠ 26
193 ╠ 34
222 ╠ 31
240 ╠ 30
? ????? ???????? 1 ? 2
<0,001
= 0,002
= 0,005
= 0,001
<0,001
<0,01
1 ? 2 ? ?????????? CD4+ T-?????????? ? ????? ?? ?????? ?????????? ??????? ????, ??????????????, ???? ? ???? 200 в 106/?
? ??????? ?????????? CD4+-T-?????????? ? ????? ?? ?????? ?????????? ??????? ???? ???? 200 в 106/?; 2-? ?????? ? ????????, ? ??????? ???????????? CD4+-T-?????????? ? ????? ?? ?????? ?????????? ??????? ???? ????
200 в 106/?. ??????? CD4+-T-?????????? 200 в 106/? ? ????
????????? ??????????? ??????-???????????? ??????? ??
???????????? ? ?????? ?? ?????? (??????????? ????????????, 2006), ??? ?????????? ???????????????? ????????? ? ?????????? ?????.
?????????? ?????????? (????. 2) ????????, ??? ????? ?
???????? ?????????????? ?????? ?? ???? ??????????? ?
?????????????? ???????. ? ??????? ????? ??????? ?????????? ???????????? CD4+-T-?????? ? 1-? ?????? ??????????
????????? ??????????????? ???????? ?? 2-? ??????. ???
?????? ???????? ?????? CD4+-T-?????????? ?? ???? ??????? ????????? ?????????, ?? ????????????? (?????? ?? 48
??? ???????) ???? ?? ???????????. ???? ?? ????????? ????????? ??????????? ???? ????? ??????????, ?????????
?????????? CD4+-T-?????? ??????????? ? ??????? ???????
?????? ????? ?????? ???????, ? ????? ?????????? ?? ??????????? ??????. ?? 4 ??? ??????? ?????????? ??????????
CD4+-T-?????? ? ????????? 1-? ?????? ????????? ?????
108/?. ??? ?????????? ?????? ?????? ???????? ?? 2-? ??????
????????????? ?????????? ????? ? ??????? 36?48 ???. ????? ???????, ????? ?????????, ??? ??????????? CD4+-T?????????? ? ????? ???-?????????????? ?? ?????? ??????? ?????????? ???????????? ??????? ?? ??????????? ???
?????????? ?????: ??? ?????? CD4+-T-??????, ??? ???????
?????????? ?????????????? ?? ????? ?, ????????. ?????? ?
???, ???? ? ????????????? ???????? ? ??????????? ????????? ?????????? ????????? T-?????????? ?? ???? ???????
?? ????????? ?????? ???????? ?????.
??? ?????? ???????????? ?????????????? ????? ╚????????? + ????????? ? ?????????╩ ???????????? ????????????? ? ???????????????? ??????????. ?????????? ?????? ??????????? (??????????????????????, ????????????????????????), ??????????????? 2-? ??????? ???????????
(????????? ? 2,5?5 ??? ?? ?????????? ????????), ???? ???????? ???? ? 13,3% ???????. ????????? ????????? ??
12?24-? ??? ???????, ????? ????????? ???????? ? ?? ??????????? ?????? ???????. ??????? ????????, ??? ??? ??? ???????? ???? ???????????? ??????? ???????? C. ?????????
?????? ?????????? ?? ???????????.
???????? ???????????????? ?????????? ???? ????? ????????????. ????? 12 ??? ????? ?????? ????? ?????????? ??????????? ?????????? ????? ?????????? (p < 0,05) ??????????? ???????????? ?????? ????? ?????????? ?? ?????? ??????? (????. 3). ??? ???????? ??????????? ?? ???? ???????????. ??? ???? ?? ????????????? ?????????? ?????????? ???
?????????. ???? ???????? ????? ?????? ? ??????????? ??????? ?????. ?????? ? ??????? ?????????? ????? ? ?? 12-? ?
48-? ??? ? ??????????? ??????????? (p < 0,05) ?????????? ?????????? ???????????. ??? ???? ??????? ??????????? ??????????, ???? ? ????????????? ????????????, ?????????.
????????, ??? ????????? ???????? ???????? ?????? ?
???????????. ???????????, ??? ??????, ??? ???????, ?????
???????????? ???????? [8]. ????????? ?????????? ??????????? ? ??????????? ?? ???? ???????? ?????? ? ????? ??
?????????? ?????????? ???????? ? ??????? ??????????????? [9]. ??????, ?????????????? ????? ????? ???????????
??????????? ? ????????? ??????, ????? ???????? ???????? ?? ???????? ??????????? [10]. ?????? ? ???, ???????????????? ?????????? ?????? ????? ?????????? ?????????
???????????? ?, ??? ???????, ?? ??????????? ? ??????????? ??????????, ??? ????????? ?????????? ????????? ? ??????? ????????? ??????? ???????.
? ?????????? ????? ??????? ????????? ??????:
1. ????? ????? ╚????????? + ????????? ? ?????????╩
????? ?????????? ??????? ?????????????: ? ???-?????????????? ????????? ??????????? ????????? ???????? ????????,
?????????? ??????? CD4+-T-?????????? ? ?????, ??????????? ??????????? ???????? ???????????????? ???-????????.
2. ???????? ?????????????? ?????????????????? ??????
? ???-?????????????? ????????? ? ????? ?? ????? ????-
??????? 3. ????????? ??????????? ???????????, ??????????? ? ?????????? ??????????? ? ????? ???-?????????????? ????????? ? ???????? ?????????? ????????????????? ???????
??????????
?? ???????
4 ??? ???????
12 ??? ???????
24 ??? ???????
36 ??? ???????
48 ??? ???????
1
2
3
4
5
6
????? ?????????? ??????????, 106/?
4880 ╠ 236
4784 ╠ 349
4074 ╠ 247
4741 ╠ 362
4957 ╠ 279
5380 ╠ 477
p1-2 > 0,05
p1-3 < 0,05
p1-4 > 0,05
p1-5 > 0,05
p1-6 > 0,05
??????????, %
68,1 ╠ 1,7
63,3 ╠ 2,4
66,0 ╠ 2,0
63,7 ╠ 1,9
65,3 ╠ 1,6
63,2 ╠ 2,9
p1-2 > 0,05
p1-3 > 0,05
p1-4 > 0,05
p1-5 > 0,05
p1-6 > 0,05
??????????, 106/?
3355 ╠ 211
3047 ╠ 274
2695 ╠ 188
3062 ╠ 274
3333 ╠ 207
3505 ╠ 428
p1-2 > 0,05
p1-3 < 0,05
p1-4 > 0,05
p1-5 > 0,05
p1-6 > 0,05
??????????, 1012/?
4,3 ╠ 0,1
4,2 ╠ 0,1
4,0 ╠ 0,1
4,3 ╠ 0,1
4,2 ╠ 0,2
4,0 ╠ 0,1
p1-2 > 0,05
p1-3 < 0,05
p1-4 < 0,05
p1-5 > 0,05
p1-6 < 0,05
??????????, ?/?
125,9 ╠ 4,8
126,5 ╠ 3,3
127,8 ╠ 2,7
129,3 ╠ 2,7
131,2 ╠ 4,1
131,0 ╠ 3,0
p1-2 > 0,05
p1-3 > 0,05
p1-4 > 0,05
p1-5 > 0,05
p1-6 > 0,05
82
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????????????? ? ???????????? ????????????????? ??????? ? ????????? ????????? ????
??? ?? ????????? ?????? CD4+-T-??????????: ??? ??????
?????? ? ????? ?? ???????, ??? ??????? ?????????? ?? ??????? ?? ????? ?????????? ???????.
3. ? ??????????? ????????? ? ???-????????? ???? ???
?????? CD4+-T-?????????? ? ????? ????? 200 ? 106/? ?????????? ????? ? ??????? 48 ??? ?? ????????? ????????????
????? CD4+-T-?????? ?? ?????? ?????.
4. ????????????? ????????????? ??????? ??? ????????????? ????? ╚????????? + ????????? ? ?????????╩ ??????????? ????????? ?????????? ?????????? ??????????? ?
????????? ???????????? ?????????? ???????????.
??????????
1. Lima V.D., Hogg R.S., Harrigan R.P., et al. ?????????? ???? ?????????????????
????? ???-?????????????? ????????? ????? ?????? ?????????????????
???????. AIDS 2007; 21. 685?92.
2. Palmer S., Maldarelli F., Wiegand A., et al. Low-level viremia persists for at least 7
years in patients on suppressive antiretroviral therapy. Proc. Natl. Acad. Sci. USA
2008; 105(10): 3879?84.
3. Simon V., Ho D.D., Abdool Karim Q. HIV/AIDS epidemiology, pathogenesis, prevention, and treatment. Lancet 2006; 368: 489?504.
4. Fischl M.A., Richman D.D., Grieco M.H., et al. The efficacy of azidothymidine (AZT)
in the treatment of patients with AIDS and AIDS-related complex. A double-blind,
placebo-controlled trial. New Engl. J Med 1987; 317(4): 185?91.
5. Hammer S.M., Katzenstein D.A., Hughes M.D., et al. A trial comparing nucleoside monotherapy with combination therapy in HIV-infected adults with CD4 cell
counts from 200 to 500 per cubic millimeter. New Engl. J Med 1996; 335(15):
1081?90.
6. Cameron D.W., Heath-Chiozzi M., Danner S., et al. Randomized placebo-controlled
trial of ritonavir in advanced HIV-1 disease. The advanced HIV disease ritonavir
study group. Lancet 1998; 351(9102): 543?9.
7. ?????????? ?.?. ??????????? ????????????. ???-???????? ? ????. ?.: ??????-?????, 2006; 128.
8. Sloand E. Hematologic complications of HIV infection. AIDS Rev 2005; 7(4):
187?96.
9. Sullivan P.S., Hanson D.L., Brooks J.T. Impact on hemoglobin of starting combination antiretroviral therapy with or without zidovudine in anemic HIV-infected
patients. J Acquir. Immune Defic. Syndr. 2008; 48(2): 163?8.
10. Hoffmann C.J., Fielding K.L., Charalambous S., et al. Antiretroviral therapy using
zidovudine, lamivudine, and efavirenz in South Africa: tolerability and clinical
events. AIDS 2008; 22(1): 67?74.
?????????? ? ?????????:
??????? ?????????? ????????????, ?????? ??????????? ????,
??????????? ????????? ?? ??????? ??????
????????? ???????? ? ???????? ??????????????? ?????????? ????????? ???
?????: 614081, ?????, ??. ??????, 13
???????: (342) 244-6712
????????? ??????? ??????????, ?????? ??????????? ????,
?????????? ???????? ???????????? ????????
???????? ??????????????? ??????????? ???????? ??. ????. ?.?.???????
?????: 614000, ?????, ??. ?????????, 39
???????: (342) 236463
??????? ?????
???????????? ??????????????? ? ??????????? ???????? ?????????? ?????????
??????????? ??????-????????????? ????????? ??????
??????????? ??????????????? ??????????
╚??????-????????????????? ???????? ??????? ????????╩
??????? ?? ??????????????? ????????????? ?????-??????????
?????????? ??????-?????????????? ?????-?????????? ? ????????????? ???????
????? ???????? ????????, ????? ? ?????????????? ????????
???????????? ??????????? ╚??????? ? ??? ????????╩
??????????????????? ???? ??????????? ??????
??? ???????????? ???????? ? ?????
?????????? ??????-???????????? ???????????
7?8 ??????? 2009 ????, ?????-?????????, ??. ?. ????????, 19
????????????? ?????????????? ?????? (?????? ?????????)
??????? ???????
?????: 197022, ?. ?????-?????????, ??. ????. ??????, ?. 9, ??? ??????? ????????
????????????? ????????? ???????????: ???????? ??????? ??????????
???????: +7(812) 347-6453; +7(812) 234-1038,
????: +7(812) 234-96-91
E-mail: nii_detinf@fmbamail.ru
???????????????? ??????????? (???????????, ????????????, ??????????)
?????: 191025, ??????, ?????-?????????, ?/? 2, ?? ╚??????? ? ??? ????????╩
???./????: +7(812) 542-7291; +7(812) 542-3591; +7(812) 542-2225; +7(812) 380-3155; +7(812) 380-3156; +7(812) 541-8898
E-mail: ph@peterlink.ru
83
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????? ??????
???????? ?????? ? ?????????????? ?????????
?????? ???????? ???????? ? ?????,
??????????????????? ? ????????? ?. ??????
?.?.????????, ?.?.??????, ?.?.?????????, ?.?.???????
??????????? ??? ????????????? ????????????????, ??????
??? ??????????? ?????????? 997 ????? ? ???????? ?? 1 ??? ?? 14 ???, ??????????????????? ? ??????? ???????????? ???????? ?5 ?. ?????? ? ????????? ╚?????? ???????? ????????╩ ? ?????? 2006 ?. ?? ???? 2008 ?. ??? ????????? ????????? ??? ???? ????? ????????? ???????????? ??????? ?? ??????? ???????????? ??????? ???. ????????
????? ???????? ?????????? (32,2%); ?????????? ???? ???????? ? 16,8%, ? ?????? ?????? ? ? 9,2% ????. ????????????? ?????? ????????? 14,9%. ? 26,9% ????? ??????? ??? ?? ???????????. ??????????? ????????????? ???????
? ????????? ??? ? ????? ??????? ???????? ? ? ???????? ????? ????.
???????? ?????: ?????? ???????? ????????, ????, ???-???????????
Viral diarrheas in the etiological structure of acute enteric
infections in children admitted to a Moscow hospital
E.A.Doroshina, G.A.Kozina, A.T.Podkolzin, A.V.Gorelov
Central Research Institute of Epidemiology, Federal Supervision Service for Consumer Rights Protection and People?s
Welfare, Moscow
The observation embraced 997 children aged from 1 month to 14 years admitted to Moscow Children?s Infectious Hospital No.
5 with the diagnosis of acute enteric infection from November 2006 to July 2008. In order to specify the etiology of AEI all children underwent a PCR investigation of feces for infectious agents. Rotaviruses were the most common (32.2%); noroviruses
were detected in 16.8%, and other viruses ? in 9.2% of samples. Bacterial agents accounted for 14.9%. In 26.9% of children
diagnosis was not specified. As was found, in the etiology of AEI in infants viruses dominated in the cold season, too.
Key words: acute enteric infections, children, PCR diagnosis
?
????? ???????? ???????? (???) ?? ???????????
????? ???????? ????? ?? ????????? ??????? ???????
???????????? ????????? ? ????? ? ??????? ??????? ??????????????, ???????????? ???????? ???????? ??????? ????
??????? ? ??????? ???????????? [1, 2]. ??????????????
????????? ??? ? ????? ? ????????? ???? ?? ???? ???? ? ?
????? ?????? ?????????? ???????????? ?????????: ???? ?
?????????? ???? ???????? ????????????? ???? ????????
(???????, ???????????, ????????), ?? ? ????????? ?????
50?80% ??????? ??? ? ????? ??????????? ????????, ?????
???????, ?????? ???????????, ?????????? ?????-, ??????-,
????-, ???????????? ? ??. [3, 4]. ????? ? ????????????? ?????????????? ??????? ????????? ???????? ????????, ??
???????? ????? ? ?????? ?? ????????? ? ??? ??????????
?????????? ?????? ?, ?????????? ? ???????????, ??????
?????????? ? ??????????? ???????? ????????? ?????????
??????? ???????? ???????? ??? ? ????????, ??? ? ? ?????.
??? ???????????????:
???????? ????? ?????????????, ???????? ???????????? ??????
???????????? ????????? ???????????? ??? ?????????????
????????????????
?????: 111123, ??????, ??. ??????????????, 3?
???????: (499) 182-0992
?????? ????????? 1.02.2009 ?., ??????? ? ?????? 15.09.2009 ?.
84
?????? ???????? ??? ????? ? ????? ??????? ????????, ? ??????? ? ????? ? ??????????? ??????? ?????????? ????????
????? ????????? ?????????? ????? ?????????.
?????? ?? ??? ??? ? ???????????? ??????????????? ??????????? ??????????? ??????????? ???????? ??????, ? ????? ?
?? ??????????? ???????????, ? ?????????? ???? ??????? ???????????? ??????????? ???????? ????? ??????. ? ????????????
? ??????????? ??????????? ???????????? ?????? ????????????????? ??, ? 2006 ? 2007 ??. ???????????????? 62,5% ??? ?
??????????????? ?????????? ? ????? ?? 17 ??? [5]. ???????????????????? ????????? ?????????????? ??????????? ??? ?
?????? ??????? ? ??????????????? ? ??????????????? ????????? ??????? ???????????? ??????????? (?????? ????????????????, ???????????? ?????????? ????????, ?????????? ??????????? ??????? ?????????? ?????? ?????????? ???????????? ??? ? ??.), ?????????? ???? ???????? ??????? ???????
?????? ? ??????????? ? ??????? ???????????? ?????? [6].
? ??????????? ??????????? ??? ???????????? ???????? ???
???????????? ??????????? ???????? ?????? ?????????? ?????? ?? ??????? ?????????? ? ???????-?????????? ????? ? ?????????????? ??????????? ?????????????????? ???????. ????? ?????????????? ??????? ??????????? ????????????? ??????? ???? ??? ?????????? ???????? ???????? ??????????????? ????????? (????), ????? ? ?????? ?? ?????????? ?? ????
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????? ?????? ? ?????????????? ????????? ?????? ???????? ???????? ? ?????, ??????????????????? ? ????????? ?. ??????
?? ??????????? ?????????. ? ??????????? ?????????? ?????????? ??????????? ?? ????? ??????? ????????????? (??
70?80%) ?????????????? ??????????? ???, ??? ??????? ?
???????? ????????????? ???????????? ??????????? [7?9].
? ????????? ?????, ? ????? ? ????????? ? ??????? ???????????????? ??????? ?????? ???????????, ????? ????????? ????????? ???? ??????????????? ???????????? ??? ?
???????????? ???????????? ????? ???????, ????? ???????????? ? ???? [10?12].
????? ?????? ?????? ??????? ?????? ???? ????????? ??????? ? ?????????????? ????????? ??? ? ?????, ??????????????????? ? ?????????, ? ?????????????? ?????? ???????????? ?????? ??????? (???).
??????????? 997 ????? ? ???????? ?? 1 ??? ?? 14 ??? ? ????????? ╚?????? ???????? ????????╩, ???????????? ?? ???????????? ??????? ? ???????????? ????????? ??? ?5
?. ?????? ? ?????? ? ?????? 2006 ?. ?? ???? 2008 ?. ???? ???? ? ???????? ?? 1 ??? ?? 14 ???: ????? ? ???????? ?? 1 ????
???? 350 (35,1%); ?? 1 ???? ?? 3 ??? ? 402 (40,3%); ?? 3 ??
6 ??? ? 144 (14,4%); ?????? 6 ??? ? 101 (10,1%). ????? ???????, ??????????? (40,3%) ????? ???? ? ???????? ?? 1 ???? ??
3 ???. ??????? ??????? ????? ???????? ? ??????????? ?????????? ??????????? ?????????? (? ?????? 2?3 ??) ???
??????????? ????????? ? ????????? ?????????? ? ???????
??? ?20╟C. ?????????? ???????? ????????? ????????????
??? ?70╟?. ???????????? ????????? ????????? ?? ????? ???????? ????? ?????????? ???????????, ??? ??????????????
???? Shigella ? ???????????????? E.coli, Salmonella,
Campylobacter, ?????????? ?????? ?, ?????????? ???????? 2,
??????????? ? ???????????. ? ????-??????? ╚?????????
Shigella sp.╩ ??????????? ??????????? ????????? ?????????
??????????????? ???? ??????? ? ???????????????? E. coli.
??????????????? ????? ??????? ????????????? ??? ????
?? ??????????? ??-?? ???????????? ??????????? ??????????
?????????? ??? ??????????? ? ????????????? ??????? ???????????????. ????????? ????????? ???????? ??????? ????????? ???????????? ?? ???? ?????? ???????????? ??????????? ???????????? ??????????? ???? ╚???? ?????????????╩ ???????????????? (??????) ? ?????????????? ?????????? ????????? ???????????? ???? ╚???? ?????????????╩
???????????????? (???????? ? 99-04-000058).
??????? ???????? ???????????? ????????? ? ?????????????? ?????? ????????? ╚???????╩ ???????????? ???? ????????????? ?? ?? ?? ?????????? ???????????? ??????????. ???????????? ?? ??????? ? ?????? ????-, ????- ? ???????????? ????????? ? ????????????? ??? ? ??????????????
?????? ????????? ╚?????C???╩ (╚??????????????╩, ??????)
?? ????????????? ╚??????╩ (??? ╚???-??????????╩).
??? ????????? ??????????? ?????? ?? ??????? ?????????????? ????????? ????????? ╚????-????╩ ? ╚???-???? ?╩
?????????? ?????????????. ????????? ???????????????
??? ????????????? ? ?????????????? ????????? ?????????
╚???????-L╩.
????? ???????? ????????? ???????????? ???????????? ?
?????????????? ????????? ????????? ??? ?????????????? ???????????????-?????????????? ???????? ???????? ???????????????? ???????????? ??? ? ?????C???╝ ???-?????╩.
??? ?????????? ???????????? ??????? ??? ??????? ?????????? ????????? ??? ? 641 (64,2%) ??????? (???. 1). ??????-
?????? ??????? ? ????????? ??? ??????? ???????? ??????
(58,3% ????????????? ?????). ?????????? ???? ??????????
??????????, ??????? ???? ?????????? ? 322 (32,2%) ??????.
?????????? 1-? ? 2-? ????????? ??????????? ???? ?
? 168 (16,8%) ??????. ?????? ?????? ???? ???????? ? 92 (9,2%)
???????. ????????????? ?????? ? ????????? ??? ?????????
14,9%. ? 26,9% ?? ???? ?? ??????????? ????????? ??????? ??
???. ?? ??? ?? ????????? ??????? ? ??? ?????? ???????????????? ???????? (???), ???????-?????????? ???????? ? ??????,
????? ???????????????? ???????, ????????? ??????? ???.
?? ???? ????????? (???????-????????, ???????-?????????????, ????????????-?????????????) ???????? ? ????????? ?????????????? ??? ???????? 90 (14%) ???????.
????? ?????????? ???????? ???????? ????? ??????????
???????-???????? ????????? (60%). ??? ???? ??????????
???????? ????? ??????????? ? ????????? ? ???????????? ?
67,5%, ???? ? ? ??????? ????????? ???????? (16,2%), ????????????? (8,1%), ??????????????? (5,4%), ?????????
(2,7%) (???. 2). ??????? ????????, ??? ????? ???????????????????? ? ????????????-????????????? ????????? ????????????? ?????? ???????? ?????? ???????????. ?????????? ? ????????? ? ??????????????? ?????????? ? 7,7% ???????, ?????????????? + ??????????? ? ? 4,4%.
?????????????? ????????? ??? ? ?????? ?????????? ??????? ????? ???????????? ?? ??????? 3. ???????? ?????? ????????? ???????? ???? ??? ? ????? ?? 6 ??? ? ?????? 1/3 ?
? ????? ?????? 6 ??? (p < 0,001). ??? ???? ???????????? ???????? ?????????? ???? ?????????? ? ????? ?? 3 ??? ??
????????? ? ????? ???????? (115, 139 ?????? 41 ? 27, ??????????????) (p < 0,001), ? ???????????? ? ???? ???????????????? ? ???????? 1?3 ??? (74 ?????? 42, 40 ? 12, ??????????????) (p < 0,001). ?????? ?????? ???????????? ???????? ?
??????????
26,9%
32,2%
??????????
?????? ???????? ??????
14,9%
?????????????
9,2%
????
16,8%
???. 1. ?????????????? ????????? ? 997 ?????, ??????? ??????? ????????? ??????????????, ???????????????????? ?
??????? ???????????? ???????? ?5 ?. ??????, ????????????? ??????? ??? ? 2006?2008 ??.
5,4% 2,7%
?????????? + ??????????
8,1%
?????????? + ??. ??????
?????????? + ???????????
16,2%
67,5%
?????????? + ?????????????
?????????? + ???????
???. 2. ????????? ???????????? ?????-???????? ? ?????, ?????????? ??????? ??? (n = 37).
85
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.???????? ? ??. / ???????????? ???????, 2009, ?. 7, ?3, ?. 84?86
%
40
????? ???????, ? ??????? ?????? ??? ??????????????
????????? ??? ???? ???????????? ? 64,2% ?????. ???? ????????, ??? ??? ? ????? ???? ???? ??????????? ??????????
????????, ??? ????????????? ????????? ? ????????????? ????- ? ???????????. ???????? ?????? ?????????? ? ???????
?????? ????, ?? ???????????? ? ???????? ????? (?????????? ?
????? ? ??????, ? ?????????? ? ?????? ? ?????). ????????
?????? ???????? ????? ???????????????? ? ????? ?? 6 ??? (????- ? ? ????? ?? 1 ????, ? ???????????? ? ? ???????? 3?6 ??? ).
20
??????????
100
80
60
0
???? ?? 1 ????
?? 1 ?? 3 ???
?? 3 ?? 6 ???
?????? 6 ???
??????????
?????? ??????
??????????
??????? +
????????
??????????????
???????????
????
???. 3. ?????????????? ????????? ?????? ???????? ???????????? ? ????? ??????? ????????, ??????????????????? ? ????????? ? 2006?2008 ??.
140
??????? ?????????, ???.
120
100
80
60
40
20
0
?????
??????????
????
?????
????
??????? ????
??????????
?????? ???????? ??????
????????
???. 4. ?????????? ??? ?????? ????????? (2006?2008 ??.).
?????????? ???????? ? ????? ?? 1 ????, 1?3 ??? ? 3?6 ???
(28, 45, 15, ??????????????) ? ??????????? ???? ? ? ??????
????? ?????? 6 ??? (4) (p < 0,001).
???? ???? ? ????? ???????????? ? ????? ?? 1 ???? ??????? ????? ??????? ????? ???? ?????????? ????? ? ????????? 139 (39,7%) ???????. ????????, ??? ??????? ? ???, ??? ? ????? ??????? ???????? ?????? ????? ???? ??????? ???, ???????-??????????? ????????????????, ??????????????, ?
????? ??????? ?????????? ? ????????? ????? ??????????,
???????????? ?? ??????? ?????? ??????? ?? ???????????.
? ??????????? ?? ?????? ???? ?????????? ????????????
????????? ? ????????? ??? ? ????? (???. 4). ?????????? ?????????? ???? ???????? ? ????- ? ??????????? ? ????? ?? ??????????? ? ???????? (40 ? 39%, ??????????????) ? ??????
?????? (35 ? 46%, ??????????????). ??????, ??????? ???????????? ??????, ???????? ?????? ???????????????? ? ?????.
86
1. ??????? ?.?. ??????????? ??????? ? ?????????. ??????? ???????. ?????????? ?????? ????????? ???, ???????, ?????? ? ???????. ? http: //
picuBOOK.net. 2006?.
2. Szajeewska H., Mrukowicz J.Z. J Pediatr. Gastroenterol. Nutr. 2001; 33(Suppl. 2):
17?25.
3. ?????????? ?.?., ???????? ?.?., ???????? ?.?. ? ??. ???????? ?????? ? ?????: ??????????? ???????????? ??????? ? ??????? ???????. ??????? ???????? 2003; 3: 7?11.
4. ????????? ?.?., ?????? ?.?., ??????? ?.?. ? ??. ???????? ????????? ??????
???????? ???????? ? ?????, ??????????????????? ? ???????????? ????????? ??????????? ??????. ???????????? ??????? 2004; 2(4): 85?91.
5. ??????????? ?????? ?? ??????? ? ????? ?????? ???? ???????????? ? ???????????? ????????, ??????????? ????? ??????? ? ?????????????. ???????? ?? ???????????? ? ???????????? ???????????? (????? 1) ?? ????????????? 2007 ?. ?????????????. ???????????????????. ??????-???????????? ??????, ???-????, 2008; 3(40): 14?5.
6. ?????????? ?.?., ???????? ?.?., ?????????? ?.?. ???????????? ??????? ?
????? XX ???? ? ?????????-?????????????????? ????????? ? XXI ????. ?????? ????????????? 2002; 3: 16?23.
7. M. de Wif et al. Etiology of Gastroenteritis in Sentinel General Practices in the
Netherlands. Clin. Infect. Dis. 2001; 33: 280?8.
8. Inouye S. Surveillanse of viral gastroenteritis in Japan: pediatric cases and outbreak incidents. S.Inouye. K.Yamashita, S.Yamadera. JID 2000; 181(2): 270?4.
9. Mustafa H. Epidemiology of Astrovirus infection in young children hospitalized
with acute gastroenteritis in Melbourne. Australia over period of four consecutive
years 1995 to 1998. Ibid, - 2000; 38: 1058?62.
10. ?????? ?.?., ???????? ?.?. ???????-?????????????????? ??????????????
?????? ???????? ???????? ? ????? ??????? ????????. ?????? ?????????., ?????????. ? ???????. 2006; (1): 69?72.
11. ??????????? ?.?., ?????????? ?.?., ????????? ?.?., ? ??. ???????????? ???????? ? ????? ??????? ???????? ? ?. ????????????. ??????????????? ????????????? ????????. ????????????? ? ???????????? ??????? 2007; (3): 32?6.
12. ????????? ?.?., ?????? ?.?., ??????? ?.?. ? ??. ???????? ????????? ??????
???????? ???????? ? ?????, ??????????????????? ? ???????????? ????????? ??????????? ??????. ???????????? ??????? 2004; 2(4): 85?91.
?????????? ? ?????????:
?????? ?????? ?????????????, ???????? ???????????? ?????? ????????????
????????? ???????????? ??? ????????????? ????????????????
?????: 111123, ??????, ??. ??????????????, 3?
???????: (499) 182-0992
??????? ????????? ??????????, ?????? ??????????? ????, ?????????,
?????????? ??????????? ??????? ???????????? ?????????
???????????? ??? ????????????? ????????????????
?????: 111123, ??????, ??. ??????????????, 3?
???????: (499) 182-0992
????????? ????????? ?????????, ???????? ??????????? ????,
???????????? ??????????? ????????????? ???????? ????????
???????????? ??? ????????????? ????????????????
?????: 111123, ??????, ??. ??????????????, 3?
???????: (499) 672-1158
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
??????? ?????????
??????????????? ???????????? ?????????
?????? ???????? ? ? ??????? ? ??????????
????????? ?????????????
?.?.???????1, ?.?.??????2
1
2
???????? ??????????? ???????? ????????, ??????????? ???????;
??????????? ??? ????????????? ????????????????, ??????
? ?????? ???????????? ?????????? ???????? ??????????????? ????????? ? ???????? ?????? ???????? ? (HCV) ? ??????????? ?? ????? ?????????????. ??????????? ????????? ????? 88 ??????? ??????????? ????????? ? (???) ? ?????????? ?????? ?????????????. ???????????, ??? ??????? 1? ? 1b ???? ??????? ? ?????????????? HCV ???????
?????, ?????? 3? ? ? ??????????????? ?????? ? ????????? ????????????? ?????????? ? ??? ????????? ??????????,
??????? 2, ??? ? ?????? 1?, ???? ?????????? ? ??????? ? ??????????????? ???????? ?????????????, ??? ?????????
???????????? ??????, ????????, ???????????????? ???? ???????? HCV.
???????? ?????: ??????? ?, HCV, ???????
The distribution of variants genotypes of HCV
among patients with different ways of transmission
A.V.Baranov1, V.V.Maleev2
Kholmsk Central District Hospital, Sakhalin region;
Central Research Institute of Epidemiology, Federal Supervision Service for Consumer Rights
Protection and People?s Welfare, Moscow
1
2
The article presents the results of studying the incidence rate of the genotypes and subtype of hepatitis C virus (HCV)
depending on the ways of infection. Blood serum samples of 88 patients with chronic hepatitis C (CHC) with varied ways of
infection were studied. As has been found, the subtypes 1a and 1b are more often associated with sexual HCV infection, the
subtype 3a ? with artificial ways ? introduction of narcotic drugs and during tattooing, the genotype 2, like the subtype 1a,
is often detected in patients with an unspecified factor of infection, which permits to suspect other, probably non-artificial
ways of HCV transmission.
Key words: hepatitis C, HCV, genotype
?
???????????, ?????????? ??????????????? ????????? ?????????????? ????? ?????? ???????? ? (HCV) ?
?????????? ? ?????????? ????????? ?????????????, ?????????????? ? ??????????? ??????????, ????????????. ???,
?? ?????? ????? ????????????, ??????? HCV 1? ? 3? ????
????????????? ? ????????? ? ???????????? ????????????
?????????? (???), ? ?? ????? ??? ?????? 1b ?????? ? ?????????????????? ????? ???????? HCV-????????. ?? ?????? ?????? ???????, ???????? ?????????? ???? ??????? ?
?????????????? ????????? 3? ? 1b, ??? ???????????? 1?
??????? ???????? ??????? ???? ???????????????, ? ???????
2 ??????????? ??? ?????????????? ? ?????????-??????? ????????????? ?????????? ?????? [1?3]. ?????? ? ????????
????????? ? ????????????? ??????? ???????? ? ??????????
?????????? ?? ?????? ???????, ??? ??????????? ??????????
????? ???????????? [4, 5]. ??????????, ?? ???????????????
????????? ? ??????? ????? ?????? ???????? ????????? ? ????????? ????????????? ???????? ? ????? ???, ??? ? ??????
????? ? ???????? ??????? ???????? ????? ?????????????
HCV [1, 2]. ???????? ???????????? ?? ???????????????
HCV ??????? ? ???, ??? ????????? ???????????? ?????????????? ????????, ?????????? ? ??????? ? ?????????? ????????? ????? ????????????? HCV, ???????? ?????????? ???????????? ?????? ????? ??????????????????? ??????? [6].
????? ??????? ???????????? ???? ???????? ??????????????? ???????????? ????????? HCV ? ??????? ? ??????????
????????? ?????????????.
???????? ? ??????
??? ???????????????:
??????? ????????? ??????????, ???????? ??????????? ????, ??????????
???????????? ?????????? ???????? ??????????? ???????? ????????
?????: 694620, ??????????? ???????, ??????, ??. ?????????, 103
???????: (42433) 5-3412
?????? ????????? 09.01.2009 ?., ??????? ? ?????? 15.09.2009 ?.
??????????? 88 ??????? ??? (57 ?????? ? 31 ???????,
?????????????? 64,8 ? 35,2%); ??????? ??????? 33,4 ╠ 1,1 ????, ???????????? ?? ??????? ? ???????????? ?????????
???????? ??? ? 2003?2007 ??. ???? ????????????? ??????-
87
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?.?.???????, ?.?.?????? / ???????????? ???????, 2009, ?. 7, ?3, ?. 87?89
????????? ? ?????? ?????????? ????? ??????????????? ?????? ? ????? ????????? ???????? ?????????? ??????? ?????????. ????? ??? ?????? ??? ?????????? 17%, ???????, ?????????????? ??? ????????? ?????????? ? 11,4%, ??? ?????????? ??????????? ???????????, ? ??? ????? ??????????????? ? 9,1%, ????????????? ????????? ? 6,8%, ????????????????? ??????????? ? 6,8%, ????????? ? 5,7%, ?????????????? ??? ???????????????? ???????? ? 6,8%, ??????? ?
??????? ???????? ? 13,6 ? 2,3%, ??????????????. ??????
? ??????????????? ???????? ????????????? ?????????
18 (20,5%) ???????. ? ?????????? ????? ???? ??????? ????????????? ??????????? ????????? ? ???????? HCV ? ?????????????? ????-?????? ╚????????? ??? ????????????
???????? ???? ??? ?????????╩ (???? ╚????? ????????????????╩, ??????).
?????????? ???????????? ? ?? ??????????
????? ????????????? 88 ??????? ??? ???????? ????? ???????????? ??????? 3a ? 1b ? ? 27 (30,7%) ? 25 (28,4%),
??????????????, ??????????? ???? ? ??????? 1? ? 2 ?
? 12 (13,6%) ? 17 (19,3%) ???????, ??????????????. ????????? ???????? ???????? (1?+1b, 1?+3?, 1b+3?, 1?+2) ??????????? ? 7 (8%) ???????. ?????? 1? ???? ?????????? ? ??????
??????? ???, ?????????????? ??? ??????? ???????? ? ?
2 (16,6%) ???????, ??? ?????? ????? ????????????? ? ????????? ? ??????????? ??????????????, ?????????? ????????
????????????? ?????????????, ??? ???????????????? ???????? ? ???? ???????? ?? 1 (8,3%) ?????? ???????? ????? ??????? HCV. ????????????? ??????? 1b ???????? ?????? ????
? ???????, ??? ????????? ????????? ??? ??????? ????????
? ???????????? ???????? ????????????? ?????????? ?
? 5 (20%) ? 4 (16%) ???????, ??????????????. ????????? ????
???? ?????? HCV ??? ????????? ? ???????, ??? ????????????? ????????? ??? ?????????? ????????????? ? ????????????????? ???????????, ? ?????? ?? ??? ???? ???????? ??
3 (12%) ??????. ??????? ???????? ??? ??????? 1b ?????
???????, ?????????????? ??? ??????????????? ? 8%, ?
????????? ???????? ????????????? ????????????? ? 4%.
??????? 2 ? ????????????? ?????????? ????? ??? ????????? ? ?????????? ???????? ? ???????, ?????????????? ???
???????????????, ????????????? ? ????????????????? ????????????, ???????????????? ???????? ? ?? 2 ??????. ? ??????? ???????, ?????????????? ??? ????????? ??????????,
?????????, ??????? ? ??????? ?????????, ? ????? ? ??????
???, ??????? 2 ?????????? ? 1 ????????. ?????? 3? ???? ???
????????????? ? ??????? ??? ? ?????????????? ??? ????????? ?????????? ? ? 8 (29,6%) ? 7 (25,9%) ???????, ??????????????. ??????????? ???? ?????? 3? ??? ??????? ????????
??? ??? ?????????????, ????????? ? ??????????? ?????????????? ? ??????? ????????? ? ?? 3 (11,1%) ??????, ???
????, ??? ????????????? ??????????????, ????????? ? ??????? ???????? ? ? ?????? ?? ???? ????? ???? ???? ????????
?? 1 (3,7%) ??????.
??????? ????????????? ???????????? ?????????? ???????? HCV ?? ????? ?????????? ??????????? ? ??? ??? ????
?????? ???????, ????????? ? ??????????? ?? ???? ????????????? ? ??????????? ? ?????????? ????????: ?? 1 (14,2%)
?????? ? ???????, ?????????????? ??? ????????? ???????-
88
???, ????????????????? ????????????, ????????? ????????
????????????? ?????????????, ??????? ????????, ? ????? ?
???. ? ??????? ???????, ? ??????? ?? ??????? ??????????
???? ?????????, ?????????? ???????? ??? ???? ?????? 1?,
?? ????????? 50% (6 ???????). ??????? ???????? ??? ????? ?????????? ??????? (1?+1b, 1?+3?, 1b+3?, 1?+2) ? ??????? 2 ? 28,5% (2 ??????) ? 23,5% (4 ??????), ??????????????.
?????????? ???????? ??? ? ?????? ??????? ? ??????????????? ????? ????????????? ????? ??????? 1b ? 3? ? 12% ?
11,1% (?? 3 ??????), ??????????????.
? ?????????? ???????????? ??????????????? HCV ? ??????? ???????, ??????? ????????? ???? ?????????????, ??????????? ???????. ???, ?????? 1? ???? ??? ??????? ?
?????? ??????? ? ??????????????? ???????? ????????????? (50%), ???? ?? ??? ????????? ? ???????, ?????????????? ??? ??????? ???????? (16,6%), ?????????? ??????????? ??????????? ? ???????????????, ????????? ? ???????????????? ???????? (8,3%). ??? ?????? ?? ??????????? ? ???????????? ????? ??????????? ????????????, ? ??????? ????????, ??? ??? ??????? 1? ??????? ???????? ??????? ???? ??????????????? ??? ? ????????????, ???????????? ??? ???????? ?? ╚?????????╩ ????????? ? ???.
????????, ?????????? ???????? ??? ? ?????? ???????, ?????????????? ??? ??????? ????????, ???? ?????? 1b
(20%), ? ????????? ??????? ? ? ?????? ???????, ?????????????? ??????????????? ??? ???????????? ????????
????????????? ?????????? (16%), ??? ????? ?? ???????????
? ??????????????, ?????????????, ??? ?? ???? ??????????? ? ???????, ?????????????? ??? ?????????? ?????????????? (???????? ??? ??????? 1? ??? ???? ???? ????????????? ???????? 8%) ???, ??? ???????? ???? ??? ??????????????? ?????? ? ????????? ??????????. ? ??????????, ?? ??????? ????????, ???? ?????? ?????????? ? ??????? ???????, ?????????????? ??? ????????????????? ?
????????????? ??????????????, ? ????? ? ?????? ???????
? ??????????????? ???????? ???????? (?? 12%), ??????????? ???? ? ??? ????????? ???????? ????????????? ????????????? (4%). ??????? 2 HCV, ??? ? ?????? 1?, ????
??? ??????? ? ?????? ??????? ? ??????????????? ???????? ????????????? (50%), ??? ????? ????????? ?? ??????,
????????, ?????????????????? ???? ???????? HCV, ???????????? ???????????? ?? ?????? ????? ???????? ?????????????? ???????? HCV-????????. ????, ? ??????????
???????? ??????? 2 ?????????? ? ??????? ???????, ?????????????? ??? ?????????? ??????????????, ?????????????
? ????????????????? ???????????? ? ????????????????
???????? (?? 11,7%), ??? ?????????? ???????? ????????
????????????? ????????????? (5,9%) ?, ? ??? ???????
??????? ? ??? ????????????? ?????????? ???????????
????????????? ??????????, ????????? ??????????, ??????? ? ??????? ???????? ? ???????? ??? (5,9%). ?????? 3?
??????????? ?????????? ??? ??????? ? ??? ????????? ?
??? (29,6%) ? ???, ?????????????? HCV ??? ?????????
?????????? (25,9%). ??????????? ???? ?????? 3? ??????????? ? ??????? ? ??????????????? ???????? ????????????? ? ?????????????? ??? ?????????? ??????????????
? ??????? ???????? (11,1%), ??? ??????? ???????? ???
????? ??????? HCV ??? ? ?????? ????????????? ??????????? ???????? ????????, ????????????? ???????? ? ?????-
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
??????????????? ???????????? ????????? ?????? ???????? ? ? ??????? ? ?????????? ????????? ?????????????
??? ???????? ????????????? ????????????? (3,7%). ?????????? ?????? ??????????? ? ????? ???????????? ??????????????, ? ??????? ????????, ??? ?????? 3? ???? ????????????? ? ???????????? ? ???.
??????
1. ?????? 1?, ??? ? ??????? 2, ???? ?????????? ? ???????
? ??????????????? ????? ?????????????, ??? ????? ????????? ?? ??????, ????????, ???????????????? ???? ???????? HCV, ???????????? ???????????? ?? ?????? ????? ???????? ?????????????? ???????? HCV-????????.
2. ??????? 1? ? 1b ???? ??????? ? ?????????????? HCV
??????? ?????, ??? ????????? ?? ????????? ??????? ???
???????????????.
3. ?????? 3? ???? ???????????? ? ??????????????? ?????? ??????????????? HCV (??? ? ????, ??????????????
??? ????????? ??????????), ??? ??????????? ? ????? ???????????? ??????????????????? ?????????????? ?? ???????? ??????????????? ???????? HCV ? ??????? ???.
??????????
1. ????? ?.?. ???????? ???????? ? ??????????. ?????????, 2001; 197.
2. ???????? ?.?., ???????? ?.?., ??????? ?.?. ? ??. ???????? ??????? ?. ???????????? ????????????. ?????? ????????: ??????????????? ???????, 2007; 35.
3. ???????? ?.?., ???????? ?.?., ?????? ?.?. ? ??. ????????? ?????????????????? ?????????????? ????????????? ?????? ???????? ? ?? ?????????? ???????? ???????. ???? ??????? ? ?????? ? ??????????: ?????. 2 ??????. ????.
???., 1998; 94.
4. Memon M.I., Memon M.A. Hepatitis C: an epidemiological rewiew. J Viral.
Hepatology 2002; 9: 84?100.
5. Poynard T., Yuen M.F., Ratziu V., Lai C.L. Viral hepatitis C. The Lancet 2003; 362:
2095?100.
6. Van Doorn L.G., Kleter B., Pike I., Quint W. Analysis of hepatitis C virus isolates by
serotyping and genotyping. J Clin. Microbiology 1996; 34(7): 1784?7.
?????????? ? ????????:
?????? ?????? ??????????, ?????? ??????????? ????, ?????????,
???????? ????, ??????????? ????????? ?? ??????? ? ??????????? ??????
???????????? ??? ????????????? ????????????????
?????: 111123, ??????, ??. ??????????????, 3?
???????:(495) 672-1069
89
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
?????????
I ?????????? ?????????????? ?????????
?? ???????????? ????????
??????, 30 ??????1 ?????? 2009 ?.
??????? ??????? ??????
??????? ????????? ? ????????????????
?????? ?????????? ??????????????
????? ? ?????????????
? ???????????????? ???????????
?????? ? ??????? ????????????
?????????? ? ? ?
Ц?а??б?? д.К.
?????????? ??????????? ???????? ??. ?.?.????????
???? ??????: ??????? ???????????? ????????? (IFN-?,
IFN-?, TNF-?, IL-1?, IL-4, IL-6) ? ????????? ?????, ??????????
? ??????????????? NDV (????? ????????) ? ??? (?????????????????) ????????? ????????? ???? ? ??????????
???????????? ?????????? CD3, CD4, CD8, CD16, CD25,
HLADR, CD20, CD38 ? ?????????????? ????? ? ????????????? ? ????????????? ??????????????? ????????? ?????? ?
??????? ??? ? ???.
???????? ? ??????: ????????? ??????????? ???????????, ?????????????, ?????????????? ????????????
37 ??????? ? ???????????? ?????????? (13 ??????? ??? ?
24 ??????? ???) ? ?????????????????? ?????? ??? ??
HBV-???, HCV-???. ???? ??????? ???????????? ?????????? ? ? ? ????????? ????????????? ??????????? ??????? ?????? ?? ??????? ? ??????????? ??????????????? ????????????? ????????? ?????? ???????????? ??????? ?????????????????? ?????? ??????????????? ?????????? ? ??????? ?? R.Knodell, ?????????????? ? ????????? ? ? ? ????????? K.Ishak. ??? ??????? ??? ???????????
?? ????????? ???????? ???? ????????? ?? ?????? ?? ??????? ?????????? ???????? (?? ??????????? ?? ???????
??????????), ?? ??????? ???????????? ??????????????
???????? (0?5 ??????), ??????????????? ???????????
(1?4 ?????), ??????????? ?????????? (1?4 ?????) ? ??????? (0?3 ?????). ????? ?????? ??????????? ??????? ? ?????????? ????????? ??????? ? ??????? ???????????? ????????? ?????????? ? ? ? ? ????????????? ? ???????????????? ??????????? ??????.
??? ?????? ???????????? ??????? ? ??????? ???????????? ?????????? ? ? ? ??????? ???????????? ?????????
(IFN-?, IFN-?, TNF-?, IL-1?, IL-4, IL-6) ? ????????? ?????, ?
90
????? ?????????? ? ??????????????? NDV ? ??? ?????????
?????? ????????? ????. ??????????? ???????????? ????????? ????????????? ╚???????╩-??????? ?????????????
????????????????? ??????? (?????? ????????? IFN-?,
IFN-?, TNF-?, IL-1?, IL-6, IL-4 ??? ╚??????????? ??????╩
?-?????????). ???????? ????????? ??????? ? ??????? ??????????? ? ??????? ??????????? ?????????? ????????????? ???????? ?????????? CD3, CD4, CD8, CD16, CD25,
HLADR, CD20, CD38 ??? ?????? ?????????????? ???????
?????? ??????????????? ????????? (Caltag Laboratories,
???). ?????????? ????????? ??????? ????????? ???????????????? ?? ????????? ????????? FACScan (Becton
Dickinson, ???).
?????????? ??? ????????????? ??????? ?????? ??????????????? ????????? ?????????? ????????????-??????? ???
???????????????? ??????? ? ????????????? ?? ???-??????
??? ????????? ?????????????? ?????. ???????????????????? ???????????? ?? ?????????????? ???????, ?????????? ?? ??????, ? ????????????????????? ???????????? ??
?????????? ????????? ? ?????????????? ??????? ?????????????? ??????? ? ????????????? ???????? ??????????
(CD3/CD16CD56, CD4/CD25, CD8, CD20), ?????????? ??????
(CD1a) ? ?????????? (CD14). ?????????????? ??????? ??????????? ??????????, ???????? ????????????? ????????????? (PE) ? ????????????????????????? (FITC). ??? ???????????????? ???????????? ???? ???????????? ????? ??
?????????????? ?????????? ???????????????, ??????? ???????????? ?????-?????? ?? ????????????-????? ? ?? ????? ? ??????????? ?????????? ???-????. ???????? ??????????? ? ???????????????? ???????? ?????? ?????? ? ?????????? ?????? ????????? ? ??????? ????????????????
Axioplan 2 (????? Carl Zeiss, ????????).
????? ???????, ??????? ???????? ???? ?????????
?????? 40 ??????????? ???????????? ??? ??????? ???????????? ?????. ? ???????? ???????? ?? ???????????? ????
??????????? ???????????? ??????? ? ????????? ???????
?? ??????????? ?????? ???????? ??? ? ?????????? 10 ???????. ?????????????? ????????? ?????? ??????????? ??? ?????? ???????????? ?????? ???????? Statistica for Windows
(2000, ?????? 6.0) ????? Statsoft Inc. ? ????? ? ???????????? ?????????????? ????????? ?????? ???????? ?????????? ??????????? ??????????? ? ?????????????? ???????
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????????? I ?????????? ?????????????? ????????? ?? ???????????? ????????
(m), ???????????? ? ????????????? ????????. ??? ??????
????????????? ???????? ??????? ???????????? ????????
???????????. ??? ???????? ????????? ???????????? ???
???????? p < 0,01.
?????????? ? ??????????: ? ??????? ??? ? ??? ????????????? ???????? ??????? ?? ???????? ??????? ??????????? ?????? ? ????????? ??????????????? NDV ? ??? ????????? ????????? ????. ??????????? ???????? ?????????????? NDV ????????? IFN-? ??? ??? ??????????? ?????????? ??? ? ??? (m = 30, ?? 28 ?? 215 ??/??), ? ????? ??????????? ???????? ?????????????? NDV ????????? ??????
???? ?????????: IFN-? (m = 44, ?? 30 ?? 68 ??/??, ? ????????
m = 3100, ?? 1000 ?? 3500 ??/??), IFN-? (m = 8,7, ?? 0 ??
24 ??/??, ? ???????? m = 135, ?? 28 ?? 2100 ??/??), TNF-?
(m = 65, ?? 15 ?? 170 ??/??, ? ???????? m = 1600, ?? 1000 ??
2000 ??/??), IL-6 (m = 60, ?? 20 ?? 80 ??/??, ? ????????
m = 750, ?? 700 ?? 800 ??/??) ? ?????????????? ??? ????????? TNF-? (m = 86, ?? 10 ?? 90 ??/??, ? ???????? m = 704, ??
100 ?? 2000 ??/??) ? ??????? ? ??????? ??????????? ???????? ???????????? ???????? ? ??????????? ???????? ???????? ??? ?? ???????????????????????? ????????? ? ???????? ???????? ?????????????? ??????????? ???? ???????????? ???????? ? ????? ?? ???????? ????????. ????????????? ???????? ???????? ??????????????????? ??????? ? ??????? ? ??????? ??????????? ??? ? ??? (m = 1,2;
?? 0,9 ?? 1,2) ? ? ?????? ??????? ? ????????????? ?????????????? ???????? 5 ?????? (m = 1,1; ?? 0,7 ?? 1,2) ?? ????????? ? ??????? ???????? (m = 1,75; ?? 1,3 ?? 2,3) ???????????? ????????? ?????????????? ??? ?????? ?????????.
???????? ?????????? ????????? ????????????????? ??????? ?????????? ?????????????? ????? ???????? ???
??????? ?????? ??????????????? ??????????, ????? ??????????? ?? ?????? ???????? ???????????? ??????????, ?????????? ?? ???????? ?????????? ????????? ?????? (CD3+,
CD4+, CD16+ ??????????) ? ??????????????????? ???????, ?? ? ???????? ?????????? ?????????? CD20+, ?????????? ?? ???????? ???????????? ??????????, ? ????? ????????? ?????????? ????????????? ??????? CD38+ ? ??????? ?????????? ??????????? HLADR+.
?????????? ??????? ??????? ???????? ??????? ? ??????? ???????????? ????????? ?????????? ??????????? ? ???? ??????????? ?????????? ????? ? ????????? ??????.
? ?????????? ??????????? ???? ???????????? ???????????,
??? ????????????? ??????????? ?????? ? ??????? ??? ?
??? ???????????? ??????????????? ??????????? ????????, ????? ??????? ??????? ????? ?????????????? ??????????. ???????????? ?????????? ???????????? ??????? ??
??????????????? ??????????. ?? ????????? ?????? ??????????? ?????????? ???????????? ?????????????? ????? ??????????? ? ??????? ?????????? ???????, ? ??? ????????? ?
??????? ?????????? ???????? ???????????? ???????????????? ?????? ?????????? ?????????? ?????. ? ??????? ??????????? ???????? ????????? ? ????????????? ???????????? ???????? ?????? ? ???????????????? ?????? ????? ???
?? ?????? ?????? ???????? ????????????? ???????? ??
????????? ? ???????? ???.
??? ???????? ???????? ?????? ????????????? ???????????? ?????? ??????? ???????????? ?????????? ? ? ? ???????
??????????????? ? ???????????????? ?????????? ???????-
????? ??????????, ???????????? ???????????????? ? ????????? ??????????????????? ???????????. ??? ?????? ???????????? ?????????????? ??????????, ?????????? ??????????? ??????????? (NK-?????? CD16+CD56+, NKT-??????
CD3+CD16+CD56+) ? ?????????????? (CTL CD8+) ??????????, ??? ????? ????????????????? ?? ??????? ??? ??????????????, ??? ? ???????????????? ??????? ?????????? ? ?????????? ??????????????????????? ?????? ??????. ?????? ?
???? ? ????????????? ???????????? ?? ??????? ???????,
?????????????? ????. ??????????? CD4/CD25. ??? ???????????? ?????????? ??????????? ? ????? ?? ?????????? ???????? IL-2, ????????? ???????????? ???????? ?? CTL ? NK.
????????, ? ????????????? ????. ?????????? ????? ????
??????? ????????? ?????????? ?????? ? ?????????? ??? ????????? ? ? ?. ? ?????, ????????????? ??????????? ??????
? ??????? ???????????? ?????????? ? ? ? ???????????? ??????????????? ?????????? ?????????????? ??????????:
?-????????? (CD3+), NKT-?????? (CD3+CD16+CD56+),
NK-?????? (CD16+CD56+), ? ???. ????????? (CD4+CD25+),
?????????????? ????????? (CD8+).
?????????????, ??? ?????????? ?????? ?????????? ????????????? ???????? ?????????? ????????? ???????????
???????????? ??????? ???????????? ?????????? ? ? ?,
?????????? ? ???? ??????????? ???????????? ?????????
?? ?????? ? ????????? ?????, ?? ? ???????? ??????????????? NDV ? ??? ????????? ????????? ????, ? ????? ?????????? ??????????? ??????????????????? ???????. ??? ??????????????? ???????????? ??????????????? ? ???????
???????????? ?????????? ? ? ? ?????????? ?????????? ??
?????? ??????????????? ?????????? ? ???????????? ???????, ?? ? ????????? ????????????, ?????????????????? ?
???????????????? ?????? ????????????? ???????????? ?????? ??? ?????? ???????? ??????? ??????????? ? ??????
??????? ???????.
?????????? ????????????????
?? ???????? ???-???????? ? ??????
?????? ???????? ?????? ? ???????
??? ?????? ????????? ?????????????
???????????????? ??????
Ц?рблмс Ю.г., есл???блмс Ю.Г.
????????? ??????????????? ??????????? ???????????,
?????????
? ??????, ?? ??????? ????????? ?????????, ?????????
?? 1 ?? 2 ??? ???-??????????????. ????????????? ????
???????, ??? ?????????? ???????????? ??? ? ?????? ?????? ??????????????? ???????? ???????? ?????????????
??????? ????? ???????. ?? ?????? ?????, 2007 ?.,
?????????? ?????? ?? ???????????? ???-???????? ????? ?????? 19% ????????? ????????? ??????. ?? ??????
??????????? (65%) ?? 332 ?????????? ? ???? ???????
??????? ??????? ??????, ????????? ???????? ????????? ?????????? ?? ??? ???????? ???????????? ? ???????????? ?????????????. ??????????? ????? ╚? ?????????????? ??????????????? ? ?????????? ????????? ???????????, ??????????? ??????? ?????????????? ????-
91
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????????? ???????, 2009, ?. 7, ?3, ?. 90?96
????╩ (?122-??), ?????????????? ???????????? ???????????????? ?? ???????? ???-???????? ?? ? ????? ????? ??
???. ?????? ???????????????? ?????????????? ??????
??? ?????? ????? ? ??????? ?? ???????????? ? ?????? ??
??????. ?????????? ????????? ?? ?????????? ??????
????????-??????????? ? ???????????????? ??????, ??????? ??????? ?????? ????? ? ??????????? ??????? ???????? ????????????.
?????????? ???????. ?????? ?????? ?????? ? ??????
????????????? ??????????????? ?? ???????? ???-???????? ? ??? ???????????????? ??????? ????? ??? ? ??????? ??????????????? (?????) ? ???????????? ??????-?????????? ??????? ????? ??????????? ? ??????? ??
? ?? ??. 13?17 ?????? ? 03?08 ?????? 2006 ?. ????? ??????????? ??????????????? ????????? ???????, ?????
???????? ???????? ?????????? ?????????????? ??? ???????? ???????????? ?????? ?????? ???????? ?????? ? ??????? ???????????????? ?? ???????? ???????????? ???.
????? ?????????? ?? ?????? ???????? ???? ???? ??????????? ??????????? ?????????, ?? ??????? ? ????? ??
???? 2007 ?. ??????? 120 ??????????? ???????????? 4 ╚????????╩ ?????????? ?????????????? ????, ? ??????
2008 ???? ? 15 ?????????????? ?????? ??????????-???????????, ???????????? ????????, ???????????? ? ??????????? ?? 7 ????? ?????? ???????????? ??????: ??????????? ???????????????? ???????????? ????????????, ?????????????? ???????????????? ???????????? ????????????, ?????????-??????????? ???????????????? ????????????, ?????????????? ??????????????? ??????????? ????????, ???????????? ??????????????? ??????????? ????????, ???????????? ??????????????? ??????????? ????????, ??????-?????????? ??????????????? ???????????
????????, ? ??????? 2008 ?. ? 20 ?????? ????????-??????????? ??????????? ???????. ????? ???????, ? 4 ????????
??????????? ?????????????? ???? ?? ???????? ???-???????? ???? ??????? 60% ?????????, ? ?????????? ?????????? ???? ???????? ? 7 ????? ???, ??? ? ????????
2008 ???? ????? ?????????? ???????? ?????? ???????????????? ?? ????? ????????. ???????????????? ????????
????? ?????????????? ??? ???????? ????????? ? ?????????? ??????? ???????. ???????????? ?????? ???????? ??,
??? ?????? ? ??????????? ???????????? ?? ????????? ???????? ???????? ╚?????????? ??????╩ ??????????? ?????????, ??? ???????? ????? ? ???????????? ????????. ???????? ??????? ???????? ? ??????? 2007 ???? ????? ????????? ????????? ????????? ? ?????????? ? ???????? ?
?????????? ????? ?? ?????????? ?????????? ??????. ??????? ????? ????? ?????? ? ????????, ??????? ? ????????????? ??????????? ????????? ? ??????? ? ???????????????? ?????? ? ???????? ?????????? ? ? ????? ???????
???????????????? ????????????. ?????? ? ?????????
???????????? ? ?????? ??????? ???? ?????????????? ????? ???????? ??????????? ?? ???????????? ? ???????
???????? ???-????????. ??? ???????? ??????? ??????????? ??????? ???????????? ???????? ? ?????????????
??? ? ??? ???? ? ???. ???????? ????. ???????? ?.?.,
??????????? ??????? ?.?. ? ?????????? ?.?. ? ???????????? ? ?????? ??????????? ??????????? ??? ?????? ╚????????? ??????????????? ???????? ??????, ??????? ?
92
???╩, ??????? ????????????? ????? ? 2009 ?. ?? ???????? ??? ?????????????? ? ????????-??????????? ?????????????? ???? 22.04.08 ?. ?????????? ???????????
╚???????????? ???-???????? ? ??????????? ??????
???????? ?????? ? ???????╩. ?? ???????? ?????????
╚???? ?????╩ ????????? ??????????????? ?????? ?????
??????????? ???????? ? ???????? ???????????? ?????????? ? ??????????? ??????????.
???????????. ???????? ???????? ????????? ????????????? ?????????? ?? ???????? ???????? ?????. ????????
????????? ?????? ? ??????? ????????? ???? ??????? ?????? ????, ??????? ????? ???? ??????? ???, ????????, ????????? ???????, ??? ??? ????????? ?????? ???????? ?????
??????????? ????????? ?????, ?????? ???? ╚????????????╩. ????? ???????? ???????? ???????????? ????????
?????. ??????? ??????? ???????? ????? ???????? ?????????
(????? ????) ? 70%, ? ?????? ??????? ??????? ?? ??? ?????
???? ????? ???????? ????? ??????? ????. ????????? ??????? ????? ? ????????, ??????? ? ???????? ????????, ????????? ??????? ?????????? ???????????? ??????, ???????? ????????? ? ????????. ?????? ?????? ????? ???????? ????????? ????????? ? ???????? ???-???????? (╚????? ???????????╩, ╚?????? ?? ???????╩) ? ????????? ??????? ?????? ?????? ??????. ????????, ??? ?????????? ???????, ? ?????? ???????, ? ????????????? ?????????????????? ?? ????????. ? ?????? ? ???????????? ??????????? ??????????
??????????? ??????? ?????????????? ??? ? ???????? ?????????? ?? ????? ????????????????? ?????, ?????? ? ??????? ??????????? ?????????? ???????? ? ???-??????????????? ??????????. ???? ?? ???? ?????????????? ? ????? ?????? ?? ????? ???????????. ?????, ? ????? ???????,
? ???????????????? ????, ? ??????, ????? ???????????? ?????????? ?????????? ????????????? ? ?????????? ?????????. ? ??? ????????? ? ????????????? ????? ╚??????╩ ?????????? ?????? ? ???? ??????????.
??? ??????? ???????????? ????? ??? ?????? ??????? ?
????? ???????????? ???????, ?????????? ?? ???????????????? ?????????? ??????????/???????/???, ???????????? ?? ???????? ???????????? ??????. ??????? ???????????? ???????????? ????????????? ??????????, ?????? ?
????? ??????? ?????????. ??? ? ?????-?? ???? ?? ????????, ? ????? ?????? ? ????? ???????? ?????????? ???
???????? ?????????. ????????? ? ???????? ??????? ?????????, ?????????????? ???????????? ??????, ?.?. ??????????????? ?????????, ????????? ?????????? ?? ???????? ?
?????? ????????? ? ????????. ??? ???????? ??????????
???????????? ?????????? ???????, ???????? ??????? ????
?????????? ?????? ????????? ?? ?????? ????????? 6?8 ??????? ?? ?????? ???????, ?????????? ???????????? ???????????????? ???????????, ?????????? ?????? ??????.
?????? ?????? ╚??????? ????╩, ? ?? ???? ╚????????╩.
?????? ????, ??????????? ?? ???????????? ?????, ? ?? ?????????? ?????, ?????? ???????????. ??????? ????????????? ????????? ?? ???????? ?? ? ????????? ???? ╚???????╩, ? ? ???????? ╚????????????╩ (?? ????. ╚???????????╩),
??? ???????????. ????????? ???????? ???? ?????????? ??
3 ??? ?????? ?? 7 ? ? ????.
?????? ???? ??????????????? ???????????? ????????
????????? ????? ???????. ????????? ????? ? ??????? ???-
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????????? I ?????????? ?????????????? ????????? ?? ???????????? ????????
????? ????????? ????????? ??? ??????????? ??????????,
??? ??? ?????? ? ????????? ?? ???????? ??? ??????????
??????? ??????????????? ???????, ?????? ?? ?????????? ?
???????????????? ? ????????? ??????????? ???????????????? ??????, ???????? ? ??????????? ?????, ? ?????????,
?? ????. ?????? ?????????? ?????????????????? ?????????????????? ? ??????????? ????????, ? ????? ????????????? ?????????? ?????????? ???????? ??????? ? ??????
? ????? ???????????? ????????????.
???????? ???????????? ??????????. ??????????????? ?? ? ????? ??? ????? ???????? ??????????? ??????
??? ???????? ??????????????? ????? ??????????? ?????????? ? ?????????? ?????? ???????? ??? ?? ????????
???????. ????? ??????? 461 ??????????. ?? ???????????
??????, 97% ?????? ? ????????? ???????? ??? ?????????
??????????????? ?? ??????? ? ???????????? ???-????????, 100% ??????? ?? ????????????? ?????????? ???????????????? ?? ? ????? ????? ?? ??? ???? ??? ????????????? ?????????? ?????. ?????????? ????????? ??????????
???????????? ?? ??? ???????? ?????????? ????? ???????? ?????? ???????????? ?? ??? ?? ???? ??????, ?????????? ???????????? ?? ???????? ??? ???????? ? ???????? ???. ??????? ????? ????? ????????????????? ????????? ??????????? ?????: 100% ?????? ???? ????????????? ???????? ? ??????? ??? ???????????; 10 ?? 12 ?????????? ???-?????????????? ?????? ???????? ???????????? ????????? ? ???? ?? ??????? ???????????? ????????? ? ?????? ??? ???????, ??? ????? ???? ???????????
? ??? ?? ????? ??????. ??????? ????????????? ???????????? ????????????? ? ????????? ???-??????????????
? ??????????? ??????????: 76% ?????? ? 71% ?????????
???????, ??? ?? ???????? ?? ?????? ????????? ? ????????, ???? ?? ??????, ??? ? ???? ????????? ???. ??? ?????????, ????? ?????????? ??????????? ??????? ????????
?????? 35% ????????????.
???????. ?? ????, ???? ╚??????????╩ ? ??? ?????? ???????? ?????? ? ??????. ????????????? ????????, ? ?????????, ???????? ???? ???????????????? ??????????????, ?
? 1990 ?. ????????????? ???-???????? ? ?? ??????????
????????????? ?????? ?? ?????? ?? ????. ????? ?????
?????????????? ╚????╩ ? ╚?? ????╩ ???????????. ???????
????? ?????????? ????? ? ╚???????╩ ? ? ??????? ???????? ? ╚????????????????╩. ??????? ? ??????????? ???????? ???????? ?????? ???? ???????? ??????????????? ????????????, ??????? ???? ? ??.
??????????? ??????? ???????????????
??????? ???????????? ???????? ?
Гкмкзкл? К.и.
???????? ??????????????? ??????????? ??. ?.?.????????
???????? ??????? ? ?????? ????????????? ? ?????????
??????? ????. ?? ??????????? ???? ???????? 500 ??? ????????? ??V, ?? ???? 10% ???? ????????? ????????????.
? ?????????? ???? (??????) ?????????????? ???????????
????????? ? ???????? ?? ??????? ??????. ?? 2005?2007 ??.
? ???? ???? ???????????????? 393 ??????? ???. ? ????-
???? ?????????? ??????? ????????????? ???????????? ????? ?? ?????? ??????? ? ?????? ? ??????????? ????????? ?
???????? ?????????????????? (???-???????). ?????????
????? ??????? ???????? ?????????? ?????? ???????? ?
(??V) ? ?????????? ??????????? ????????????????? ??????,
??????? ??????????????? ??????????? ??? HCV ? ????????? (?? ?????? ???) ????? 24 ??? ????? ?????????? ???????. ??????? ??????????? ????????????????? ?????? ??????????? ???????? ?? ????????? ??????????? ????????? ?????????? ????? ???? ???????, ??????? ??????? ?? ??????????? ???????????? ? ??????????????? ??????? ???????????? ? ???????????, ??? ???????????? ???????????????? ????? ????? ??? ? ???????? ??????? (?? 70%).
? 2003 ???? ????????? ????????????? ???????? ML 16709
╚?????????????? ???????? ????????? ?? ???????? ???????????? ? ????????????? ??????????????? ??????? ???????????? ?????-2? ? ??????????? ??????? ??? ?? ????????????? ?????-2? (40 ???) ( ???????) ? ??????????? ?
??????? ? ??????????? ????????? ?╩. ??????? ??????????
??????? ???????? ???????+?????????.
???? ??????: ??????? ????????????? ???????????????
??????????????? ??????? (??????????+?????????) ???????????? ???????? ?.
???????? ? ??????: ??? ??????????? ?????????
61 ???????. ????????????? ????????? ?? ???? ???????, ???
??????? ????????? 48,4%, ??????? ? 51,6%. ?? ??????????? ???????? ??? ? ???????? ?? 18?30 ??? ???? ? 30%; ??
31?40 ??? ? 28,3%; ?? 41 ? ?????? ? 41,7%. ? ?????? ??????????? ????????? ? ??? ?????????? 1? ??????? ? 59%;
2? ??????? ??????????????? ? 18,3%; 3? ??????? ? 16,7%. ????? ??????? ??????????????? ??????? ??????? ?????????????? ?? 3 ??????:
I ??????: ???????-? 3 ??? ?? 3 ???? ? ???. + ?????????
800?1000 ?? ????????? ? 17 ???. (27,8%).
II ??????: ???????-? 3 ??? ?? 3 ???? ? ???. + ?????????
800?1000 ??, ? ??????????? ??????? ??? ?? ??????? 180 ???
1 ??? ? ???. ? 20 ???. (32,7%).
III ??????: ??????? + ????????? ? 24 ???. (39,3%).
?????????? ? ??????????: ?????? ????????????????
????? (??? ?????????? ??? ?? ??? ?CV ?? 12-? ??????
???????) ??? ??????? ? 51 ???????? (83,6%). ? I ??????
?????? ???????????????? ????? ??? ???????????????
? 13 ???. (21,3%), ?? II ?????? ? 18 ???. (29,5%) ? ? III ?????? ? 20 ???. (32,7%)
?????????? ???????????????? ????? (?????????? ?????V ?? 24-? ?????? ????? ????????? ???????) ??? ??????????????? ? 44 ?????????, ?? ??? ? I ?????? ??????? ? 9 ???.
(14,7%), ?? II ?????? ? 17 ???. (27,8%); III ?????? ? 18 ???.
(29,5%). ? ???? ??????? ?????????? ?CV ???????????? ?
9 ???. (14,7%)
?????: ??????????? ?????? ??????? ???????? ??????????????? ??????????????? ??????? ????????? ? ???????????, ??? ?????????? ?????? ???????????????? ????? ?
32,7%. ?????????? ???????????????? ????? ??????????? ?
III ?????? ????????? (29,5%), ??????????? ??????? ? ?????????. ? ?????? ??????????? ????????? ?????????? 1? ??????? ?? ? 59%, 2? ??????? ? 18,3%, 3? ??????? ? 16,7%. ?????????? ?? ???????????? ? ???? ??????? ? 14,7% ???????
? 1? ????????? ??? ? ? ?????????? ╚??????╩ ???????.
93
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????????? ???????, 2009, ?. 7, ?3, ?. 90?96
??????? ????????????? ? ?????????????
???????? ?? ???????????? ??????????
? ?????? ???????? ? ?????????
????????????? ???????
Йс?ш╞кл? Г.Ц.
???????? ??????????????? ??????????? ???????????
???????????? ????????? ?? ???????????????
? ??????????? ????????, ???????????
??????? ?????????? ?????????????? ????????? ? ?????????? ? ????????????? ??????? ??? ???????? ???????? ?????????? ???????????? ???????? ?????????? ???????? ? ?????? ?????????????? ?????????????????? ?????????? ? ?????? ??????????? ????????. ?? ?????? ?????????? ???????????????? ?? ????????????? ???????, ?
2007 ???????? ?????????? ?????????????? ????????? ?
3,2 ???? ? ????????? ? 2006 ????? ? ?????????? ??????????????? ?????????? ? 3,8 ???? ? ??????????? ? ????????????? ??????? ?????????? ? ????????? ?????????.
???????? ????????? ? ??????????? ?????????, ????????
??????? ?????? ? ??? ???????? ???????????????????.
?????????? ???????? ????????????? ??????????? ?
?????????? ????????? ?????? ? ????? ??????????????
??? ???????? ?? ??????? ?????????????? ? ????????
94,3?99,7%. ? ?? ?? ????? ??????????? ????????? ??????? ?? ?????? ? ????????? ?????????? ?????????, ?? ? ? ????????????????? ????????????? ?????, ???, ? 5?10% ??????????????? ? 5% ????????????????? ?? ???????????
??????????? ?????? ?????? ????????.
???? ????????????: ??????? ?????????? ?????????????? ???????????? ?????????? ? ?????????? ???????? ?????
??????????? ???????? ??????????? ? ????????????? ???????????.
???????? ? ??????: ????????? ???????-????????????
???????????? ? ?????? ?????? ??????????? ????????, ??????? ?????????? ?????????????? ???????????? ??????????
? ?????? ???????? ? 500 ?????? ?? 15 ?? 39 ???, ???????
??????? ??????? ???????? 21,8 ╠ 0,2 ???. ????????????? ??????????????? ?????? G ? ?????? ???????? ?????????? ??????? ????????????? ????????????????? ??????? ?????????????? ????-????????? ??? ╚??????-????╩: D-2552 ╚????????????-IgG-?????╩. ????????? ?????? ??????????? ?
?????????????? ?????? ?????????????? ???????? SPSS for
Windows ?????? 17.0.
?????????? ? ??????????: ??????????? ??????? ??????????????? ???????? ?? 25 ???, ?? ???? ?????????
84,2% ?? ?????? ????? ?????????????. ???? ???????????? ???????? ? ???????? ??????? 134 (26,8%) ???????????. ??????? ??????? ???????????? ???????? ????????
6,5 ╠ 0,4 (95% ?l 5,6-7,3) ???. ?? ??????????? ????????????????? ??????? ????????????? IgG ? ?????? ????????
???? ?????????? ? 464 (92,8%, 95% ?l 90,2-94,9) ???????.
?????? ???????? ???? ????????????? 78 (15,6%), ?? ???,
???????? ?? ??????????? ???????????, ?????????????
???????? ????????????? ? 4 (5,1%, 95% ?l 1,4-12,6) ??????.
? ?????? ????????????, ????????? ?? ???????????? ????????, 6 (4,5%, 95% Cl 1,6-9,4) ?? 134 ???? ????????????? ? ?????? ????????. ???????? ?? ???? ???????? ????-
94
??? IgG ? ?????? ???????? ? 276 (92,6%, 95% Cl 89,0-95,3)
?? 298 ??????, ?? ???????? ????? ????????? ? ?? ??????????????? ?????? ???, ??? ????? ???? ??????????? ???????????? ????????? ?????? ?????????? ???????? ???
???????? ???????????? ?? ???????? ? ????. ??? ??????? ? ????????? ?????? ????????????????? ??????? ????
????????? ?? ??? ??????: ??????????????? ? ??????????
????????. ? ?????? ??????????????? ??????? ???????? ?????? ??????? ? ?????? ???????? ???? ???? ? ?????????
216,9 ╠ 13,6 ??/?? (95% Cl 189,8?243,9) (? < 0,05), ? ????????? ? ?????????, ???????? ????????????????
????????????????? ????????? ? 187,6 ╠ 6,4 ??/??
(95% Cl 174,9?200,2). ???????? ??, ??? ???????????? ?????????????? ????????? ?????? ????????????? ?????????????????? ?????????? ?? ???????????, ??????? ?????
????????????? ??????? ???? ??????? ??? ?????? ?? 15 ??
50 ??/??, ?? 51 ?? 100 ??/?? ? ??? ??????????????????,
?? 101 ?? 150 ??/?? ??? ?????????????, ?? 151 ??/?? ?
???? ? ??? ???????. ? ?????? ?????????? ???????? ?
175 (53,2%) ? ? 45 (69,2%) ??????????????? ?????? ???????? ????????????? IgG ???? ?? ??????? ??????, ????????
284,0 ╠ 5,3 ??/?? (95% Cl 273,6?294,5) ? 277,4 ╠ 10,2 ??/??
(95% Cl 256,8?297,9) ??????????????. ???? ?????? ? ?????? ??????? ????????????????? ??????? ? ?????? ?????????? ??????????? ????????? 7,3% ??? ??????? ?????????? ????? ??????? 35,2 ╠ 2,2 ??/?? (95% Cl 30,7?39,8).
? ?????? ?????????? ???????????????? ?????? ?????
????????????? ??????? ???????? ? 9,2%, ??????? ???? ??????? ??? 43,5 ╠ 1,9 ??/?? (95% Cl 38,6?48,4). ?????????????? ?????? ??????? ?????? ?????????????? ?????
(r = 0,27, ? < 0,05, n = 34) ????? ?????????, ? ??????? ???? ???????????????? ???????????, ? ???????????? ?????
????????????? ????????????????? ???????.
????? ???????, ? ????????????? ??????? 7,2% ??????
??????????? ???????? ????????????? ?? ????????? ? ?????? ????????. ????? ??????????? ??????????? 95% ??????
????????? ????????????? ??????. ????????????? ?????????????? ???????????? ?????????? ???? ? ??????????????? ??????.
??????????? ???????????? ??????????
??????????????? ??????? ???????????
? ?????
К??кл? Е.г.
??? ??????? ???????? ????????????
??????-?????????????? ?????????, ?????-?????????
????????? ??????? ????????? ??????? ??????? ??? ??????????? ? ????? ? ??????????? ??????? ??????????? ? ?????? ????? ???????? ??????? ??? ?????????? ????????????? ????????? ?????? ??????? ??? ???????? ??????? ?????????? ??????????????? ?????????. ? ????? ? ???, ?????????? ????? ??????? ??????????? ??? ??????????? ???????? ??????????.
???? ????????????: ??????????? ??????????????? ????
?????? ????????? ??????????? ????? (??) ??? ??????????? ? ????? ??? ????????????? ??????? ??????????? ???????
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????????? I ?????????? ?????????????? ????????? ?? ???????????? ????????
????????? ??????????????? ????????? ???????? ?????????
?????, ? ????? ?????????? ???????????? ???????????? ??????? ??????????????? ??????? ??????????? ? ?????, ??????????? ?? ????????????? ?? ?????.
???????? ? ??????: ??????? ??????????????? ????????? ??????????? (????) ?? ?????????? ???????????????
????? ? ???? ??????????? 72 ??????? ? ???????? ??????????? ????????? ????????? ? ?????? 3 ??? ??????????? ? ?
???????? ?? 7-? ????, ????? 3 ??????, 3 ? 6 ???. ??? ??????? ???? ??????????? ?????????? ???????????? ???????????? ?????????? ? ????????? ????????? ??????????. ????
????????? ?????????? ???????-??????????????? ?????????? ? ?????????? ? ?????? ??????? ?????????? ? ????????-??????????? ?????????? (???) ????????? ?????.
?????????? ? ??????????: ??????????? ??????? ??????????????? ??????????? ?? ? ????????? ??????????????
????????? ??????? ??? (? 53%), ? 40% ??????? ?????? ??
??????????????? ??????????????? ??????????? ? ?????? ?
7% ?????????? ????????? ?? ????????????? ??? ???????
??????????? ????????????. ????????, ??? ??? ???????????
? ???????? ??????? ?????????? ?????????? ??????????
???????? ????????? ????????? ?????????? ???? (p < 0,05).
??? ????????????? ??????????? ? ????????????????????
??????????? ???????? ????????????? ??????????? ??????????? ????? ???????? ?????????? ? ??????????? ????????? ????????? ?????????? ? ?????? ??? ???????????
(r = ?0,1; p = 0,05), ? ????? ????????? ???? ?? 7-? ???? ??????????? (r = 0,2; p = 0,001).
?????????? ???? ??? ?????? ???????????? ? ? ???????? ?????? ? ??????????? ??????? ???????-???????????????
?????????, ?????????????????? ???????? ????????? ????? ?? ?????? ???, ???????? ??????? ???? ???????? ? ????????????? ??????????? ? ?????????????? ???????? ?????? ??????????????? ??????? ??????????, ??????????
??????? ???????????????? ???????. ????????????? ??????????? ??????? ??????????????? ? ?????? ?????? ????
????????? 83,8% ? ????????????????? ??????? ? ??????????????? ??????????????? ??????? ?????????? 60%, ???
????????? ?????? ???????????????, ?????????? ?????? ??
??????? ???????-??????????????? ????????? ? ???, ??
??? ????? ???????????????????? ??????????? (???????????????? ?? 45%).
??????: ????????????? ??????????????? ?????????
??????????? ??? ???????? ?????????? ????????? ???????
??????? ? ?????????????????? ????????? ??????? ???.
??????????? ?????? ? ?????? ?????? ????????? ?????????? ? ?????? ???????-??????????????? ?????????, ????????
???????, ?????????????????? ???????? ????????? ????? ??
??? ? ?????????????? ???????? ????, ???????????? ????? ??????? ??????????????? ??????? ???????????, ??? ????????? ????????? ????????????? ????????? ?????? ? ????????????????? ??????????????????? ???????.
? ????????????????? ????????
???????? ????????? ??????
? ????????? ????
Сбоб?кр И.Ш.
?????????? ??????????? ???????? ???????????????
???????????, ??????
??????? ???? (??) ? ???????? ???????????????? ??????????? ?? ?????? ??? ?????????? ???????? ??????????, ??????????? ? ?????????????? ?????????????. ??????? ?? ?
????? ????????? 1:40 000, ?????? ?????????? ??????????????? ??? ??????????? ???????? ????? ??????-????????
(???????? ?? ????????? ??????), ? ??????? ??????? ????????????? ??????? ???? ???????? ????? ??????? ? ?????????? ?? 1 ?? 450 ???????.
??????????? ?? ? ?????????? ???????? ???????????
???????? ??????????????????, ??? ???????? ? ?????????? ???????????????? ? ??????????. ??????? ?-D-??????????? ????????? ?????? ??????? ? ???????? ?? ??????
??????? ? ???????? ?? ????????????????, ??? ???????
???????? ????????????? ? ??????????? ?????????????????? ? ??????????? ??????????? ????????? ???????. ?????
????????? ??????????? ?????? ? ???????????? ????????
?????? ?????, ?????????? ??????? ?????????? ??????????????????, ? ????????? ?????????? ? ?????? ???????? ??????????? ????????????? ???????????????. ??? ╚???????????╩ ???????? ?????? ? ?????????? ???????? ????. ?????? ???? ????????????? ? ?????? ??????? ? ?????????, ??????? ????? ? ??????, ? ??????? ??????? ? ????????? ???????. ??? ?????????????? ???????? ??? ???????????? ?????? ???????????????? ? ????????? ??????? ?
??????. ???, ? ????????? ???????????? ??????????? ?????
????????????? ?? 10?1000 ??? ?? ????????? ? ??????,
????? ????? ?? ?????????? ??????????? ? ?????? ? ??????? ?????.
??????? ???? ??????????? ?? ?????????-????????????
????. ??? ?-?????????????????? ?????????? ?? ?????????
(1q21). ??????? ????? 200 ????????? ???????, ??????????
? ??????? ???????? ? ???????? ??? ???????????? ??? ??????????.
? ??????????? ?? ??????? ??? ?????????? ??????????????? ??????????, ?? ??????? ?? ??? ???????? ?????? ? ??????????????? (??? 2 ? 3) ? ??-??????????????? (??? 1). ??????????????? ?????????? ??? ??????? ???? ????? ?????????? ? ?????????? ?????????, ???????? ?????, ??????, ????? ?
?????????-????????? ?????? ?, ? ?????????, ??????.
????????? ?????? ??? ??????? ???? ???????????? ? ????? ????? ????????? ??? ?????? ????? ???????????, ??? ???????? ? ??????? ????????? ????????? (? ??? ????? ????????),
?????????????? ??????? ? ????????? ???????????????.
????? ???????, ??????????? ? ????????? ??????????? ?,
??? ???????? ?????, ???????????????? ??????????? ?????
???????????? ???? ????? ?????????????, ????? ??? ?????? ?????????? ? ?????-?????????????, ?????????????????? ?? ???????? ??????. ? ??????????? ? ?????????????? ???????? ? ???????? ???? ????? ???? ?????????? ?? ?????
????????????? ????????. ??? ???????? ?????????? ?????????????, ??????????????, ????????????? ? ?????????-
95
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????????? ???????, 2009, ?. 7, ?3, ?. 90?96
??? ?????????????? ??????????? ?????????? ????????????????, ????????, ? ???????????? ?????????????, ???
????? ??????? ???????????????? ?????????? ???????????????? ? ?????? ???????? ?????????. ??? ???????? ?????????? ??????????? ? ?? ?????????? (?????, ????????????
?? ???????????????????? ??? ????????) ?????????? ????????? ??????? ????????????? ????????? (????????, ???????????? ? ??.).
?????????? ??? ??????? ????? ???????????? ????????
???????? ?? ?????? ????????, ??????? ???????? ??????? ???????????, ? ????? ??????????? ??????? ??????? ????. ???
?????????? ???????????????? ??????????? ????? ????????? ???????????? ???????????, ??????? ??? ??????????
?????? ????????????, ????????? ??????? ?? ?????????????? ???????? ?????????, ????????? ?????????? ??????,
??????? ???????????????? ? ??????????????????, ??????? ? ???????????? ?????????????, ?????? ??? ???????
??????? ???????, ????.
?????? ? ??????? ????????? ??????????, ???????? ?
???????? ???? ????? ?????????? ??????? ? ????????, ??????? ? ???? ? ?????? ??????????, ???????, ??????? ? ?????? ?????. ?? ???? ? ???????? ? ? ????????? ? ???????? ????, ? ??????? ?? ??????? ????????? ??????????, ?? ??????
????? ??????? ??? ?????????? ╚??????? ?????╩ ? ???????? ?????????? ????? ? ??????, ????????? ? ??????? ?????????? ??????? ?????, ??????????????? ??????????, ? ??
?????, ??? ??????? ???????? ?? ????????, ??? ??????? ??
?????? ????.
????? ??????? ???????? ???????? ?? ???????? ? ??????
???????? ??????? (??? ??????? ???? ??? ????? ?????????
???????????, ??? ?????? ???????? ?? ????????????? ??????
???????) ? ???????? ??????? ???????????.
????????? ?????????-????????? ?????? ??? ???????
???? ????? ??????????? ??????????????, ???????? ??????, ?????????? ????????????, ??????? ? ????????????? ??
????????? ??????????? ??? ????????. ??????????????
?????????? ?????? ??????????? ? ???????????? ??????????? ?????????; ????? ?????????? ?????????????, ????? ?????? ????????? ??????? ????? ??????? ???????,
??????????? ???? ? ????????? ?? ????????????? ? ????????. ??? ???????????? ?????????? ?????? ?????? ?????
???? ??????? ???????? ? ?????? ??????????. ??? ??????????? ???????????? ?????????? ??????????? ?????? ?
??????, ??????? ?????, ???????? ??????? ?????????????? ??? ?????????.
????????? ????????? ?????? ?????????? ?????????
(?? 5?10 ????) ??????????? ? 30?50% ?????????, ????? ???
96
??? ?????? ???????? ???????? ??? ???????? ????? ????????? ??????????? ?????????? ?? ????????? ? ??????. ????
??? ??????? ???? ?????????? ?? ??????????? ? ??????? ?
??????? ?????? ??????????? ?? ?????????? ??????, ? ?????????? ???? ?????????? ?????????? ???????? ??????,
??? ?? ??????????? ? ??????? ????????? ??????????. ?????
? ??????? ?? ?? ?????????? ????????????, ????????? ? ???????????????? ???????? ??????????? ????? ? ?????? ?????????? ??????? ??????. ??????, ? ????????? ???????
???????? ???????? ?????? ?????????? ???????????????,
??????? ? ??????.
? ?????????? ?????? ?????? ????????? ?????? ? ????????? ?? ????????????? ? ???????? ? ?????????? ???????
?????????. ? ?????? ?????? ??? ????????? ??????? ?????? (?????????? ??????? ??????????? ? ?????? ????????
???????????, ????????????? ?????), ?????????? ??????
??????????, ????????? ????????? ??????????? ? ????
???????? ????????? ?????? ?????? ? ????????? ?????????? ??????????? ? ????????? ?????????-???????? ????????????, ? ?????????? ???? ???? ??????? ??????? ? ?????????????? ??????.
?? ????????? ? ????? ??????? ????? ? ??????? ???????? ???? ??????? ???????? ?????? ? ???????????????,
????????? ? ?????????? ?????????????.
????????????? ????????? ????? ?????????? ? ??? ?????????? ?????????????? ???????????? ?????? ? ????? ??? ?
??????? ? ????????? ??????????? ?????? ?? ?????????
??????? ?? ??????? ????????????? ???????, ??? ???????
???? ?????????? ????????????? ?????????????? ???????? ? ????? ?????????? ??????? ?????.
???????? ????? ???????? ????? ??? ?????????? ??????????? ??????? ? ??? ???????? ???????? ? ????? ?????? ????? ?????????? ?????????????? ?????????, ??? ??????? ?
?????? ????????? ??????? ????????????, ? ??? ??????? ???? ???????? ??? ??????? ??????????? ?????? ???? ? ??????????? ???????? ? ???????????? ????????????? ????? ?
?????????? ??????????? ???????????.
????? ???????, ??? ????????????? ????????? ???????
???????????? ? ????????? ????? ????????, ??????? ???????? ??????? ??????????? ? ???????????, ????? ??????????? ??????? ???? ? ??? ?????????? ?????? ????????
????????? ??????, ????????? ???????? ?? ????????????
??????????? ??? ?????????? ??????????? ? ???????. ????????????? ?????? ??????????? ??????? ???? ??????
????? ??? ????????, ???????? ??????? ??????????? ???
?????????? ????????????? ??????? ? ???????? ????????
????? ????????.
?, TNF-?, IL-1?, IL-4, IL-6) ? ????????? ?????, ?
90
????? ?????????? ? ??????????????? NDV ? ??? ?????????
?????? ????????? ????. ??????????? ???????????? ????????? ????????????? ╚???????╩-??????? ?????????????
????????????????? ??????? (?????? ????????? IFN-?,
IFN-?, TNF-?, IL-1?, IL-6, IL-4 ??? ╚??????????? ??????╩
?-?????????). ???????? ????????? ??????? ? ??????? ??????????? ? ??????? ??????????? ?????????? ????????????? ???????? ?????????? CD3, CD4, CD8, CD16, CD25,
HLADR, CD20, CD38 ??? ?????? ?????????????? ???????
?????? ??????????????? ????????? (Caltag Laboratories,
???). ?????????? ????????? ??????? ????????? ???????????????? ?? ????????? ????????? FACScan (Becton
Dickinson, ???).
?????????? ??? ????????????? ??????? ?????? ??????????????? ????????? ?????????? ????????????-??????? ???
???????????????? ??????? ? ????????????? ?? ???-??????
??? ????????? ?????????????? ?????. ???????????????????? ???????????? ?? ?????????????? ???????, ?????????? ?? ??????, ? ????????????????????? ???????????? ??
?????????? ????????? ? ?????????????? ??????? ?????????????? ??????? ? ????????????? ???????? ??????????
(CD3/CD16CD56, CD4/CD25, CD8, CD20), ?????????? ??????
(CD1a) ? ?????????? (CD14). ?????????????? ??????? ??????????? ??????????, ???????? ????????????? ????????????? (PE) ? ????????????????????????? (FITC). ??? ???????????????? ???????????? ???? ???????????? ????? ??
?????????????? ?????????? ???????????????, ??????? ???????????? ?????-?????? ?? ????????????-????? ? ?? ????? ? ??????????? ?????????? ???-????. ???????? ??????????? ? ???????????????? ???????? ?????? ?????? ? ?????????? ?????? ????????? ? ??????? ????????????????
Axioplan 2 (????? Carl Zeiss, ????????).
????? ???????, ??????? ???????? ???? ?????????
?????? 40 ??????????? ???????????? ??? ??????? ???????????? ?????. ? ???????? ???????? ?? ???????????? ????
??????????? ???????????? ??????? ? ????????? ???????
?? ??????????? ?????? ???????? ??? ? ?????????? 10 ???????. ?????????????? ????????? ?????? ??????????? ??? ?????? ???????????? ?????? ???????? Statistica for Windows
(2000, ?????? 6.0) ????? Statsoft Inc. ? ????? ? ???????????? ?????????????? ????????? ?????? ???????? ?????????? ??????????? ??????????? ? ?????????????? ???????
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????????? I ?????????? ?????????????? ????????? ?? ???????????? ????????
(m), ???????????? ? ????????????? ????????. ??? ??????
????????????? ???????? ??????? ???????????? ????????
???????????. ??? ???????? ????????? ???????????? ???
???????? p < 0,01.
?????????? ? ??????????: ? ??????? ??? ? ??? ????????????? ???????? ??????? ?? ???????? ??????? ??????????? ?????? ? ????????? ??????????????? NDV ? ??? ????????? ????????? ????. ??????????? ???????? ?????????????? NDV ????????? IFN-? ??? ??? ??????????? ?????????? ??? ? ??? (m = 30, ?? 28 ?? 215 ??/??), ? ????? ??????????? ???????? ?????????????? NDV ????????? ??????
???? ?????????: IFN-? (m = 44, ?? 30 ?? 68 ??/??, ? ????????
m = 3100, ?? 1000 ?? 3500 ??/??), IFN-? (m = 8,7, ?? 0 ??
24 ??/??, ? ???????? m = 135, ?? 28 ?? 2100 ??/??), TNF-?
(m = 65, ?? 15 ?? 170 ??/??, ? ???????? m = 1600, ?? 1000 ??
2000 ??/??), IL-6 (m = 60, ?? 20 ?? 80 ??/??, ? ????????
m = 750, ?? 700 ?? 800 ??/??) ? ?????????????? ??? ????????? TNF-? (m = 86, ?? 10 ?? 90 ??/??, ? ???????? m = 704, ??
100 ?? 2000 ??/??) ? ??????? ? ??????? ??????????? ???????? ???????????? ???????? ? ??????????? ???????? ???????? ??? ?? ???????????????????????? ????????? ? ???????? ???????? ?????????????? ??????????? ???? ???????????? ???????? ? ????? ?? ???????? ????????. ????????????? ???????? ???????? ??????????????????? ??????? ? ??????? ? ??????? ??????????? ??? ? ??? (m = 1,2;
?? 0,9 ?? 1,2) ? ? ?????? ??????? ? ????????????? ?????????????? ???????? 5 ?????? (m = 1,1; ?? 0,7 ?? 1,2) ?? ????????? ? ??????? ???????? (m = 1,75; ?? 1,3 ?? 2,3) ???????????? ????????? ?????????????? ??? ?????? ?????????.
???????? ?????????? ????????? ????????????????? ??????? ?????????? ?????????????? ????? ???????? ???
??????? ?????? ??????????????? ??????????, ????? ??????????? ?? ?????? ???????? ???????????? ??????????, ?????????? ?? ???????? ?????????? ????????? ?????? (CD3+,
CD4+, CD16+ ??????????) ? ??????????????????? ???????, ?? ? ???????? ?????????? ?????????? CD20+, ?????????? ?? ???????? ???????????? ??????????, ? ????? ????????? ?????????? ????????????? ??????? CD38+ ? ??????? ?????????? ??????????? HLADR+.
?????????? ??????? ??????? ???????? ??????? ? ??????? ???????????? ????????? ?????????? ??????????? ? ???? ??????????? ?????????? ????? ? ????????? ??????.
? ?????????? ??????????? ???? ???????????? ???????????,
??? ????????????? ??????????? ?????? ? ??????? ??? ?
??? ???????????? ??????????????? ??????????? ????????, ????? ??????? ??????? ????? ?????????????? ??????????. ???????????? ?????????? ???????????? ??????? ??
??????????????? ??????????. ?? ????????? ?????? ??????????? ?????????? ???????????? ?????????????? ????? ??????????? ? ??????? ?????????? ???????, ? ??? ????????? ?
??????? ?????????? ???????? ???????????? ???????????????? ?????? ?????????? ?????????? ?????. ? ??????? ??????????? ???????? ????????? ? ????????????? ???????????? ???????? ?????? ? ???????????????? ?????? ????? ???
?? ?????? ?????? ???????? ????????????? ???????? ??
????????? ? ???????? ???.
??? ???????? ???????? ?????? ????????????? ???????????? ?????? ??????? ???????????? ?????????? ? ? ? ???????
??????????????? ? ???????????????? ?????????? ???????-
????? ??????????, ???????????? ???????????????? ? ????????? ??????????????????? ???????????. ??? ?????? ???????????? ?????????????? ??????????, ?????????? ??????????? ??????????? (NK-?????? CD16+CD56+, NKT-??????
CD3+CD16+CD56+) ? ?????????????? (CTL CD8+) ??????????, ??? ????? ????????????????? ?? ??????? ??? ??????????????, ??? ? ???????????????? ??????? ?????????? ? ?????????? ??????????????????????? ?????? ??????. ?????? ?
???? ? ????????????? ???????????? ?? ??????? ???????,
?????????????? ????. ??????????? CD4/CD25. ??? ???????????? ?????????? ??????????? ? ????? ?? ?????????? ???????? IL-2, ????????? ???????????? ???????? ?? CTL ? NK.
????????, ? ????????????? ????. ?????????? ????? ????
??????? ????????? ?????????? ?????? ? ?????????? ??? ????????? ? ? ?. ? ?????, ????????????? ??????????? ??????
? ??????? ???????????? ?????????? ? ? ? ???????????? ??????????????? ?????????? ?????????????? ??????????:
?-????????? (CD3+), NKT-?????? (CD3+CD16+CD56+),
NK-?????? (CD16+CD56+), ? ???. ????????? (CD4+CD25+),
?????????????? ????????? (CD8+).
?????????????, ??? ?????????? ?????? ?????????? ????????????? ???????? ?????????? ????????? ???????????
???????????? ??????? ???????????? ?????????? ? ? ?,
?????????? ? ???? ??????????? ???????????? ?????????
?? ?????? ? ????????? ?????, ?? ? ???????? ??????????????? NDV ? ??? ????????? ????????? ????, ? ????? ?????????? ??????????? ??????????????????? ???????. ??? ??????????????? ???????????? ??????????????? ? ???????
???????????? ?????????? ? ? ? ?????????? ?????????? ??
?????? ??????????????? ?????????? ? ???????????? ???????, ?? ? ????????? ????????????, ?????????????????? ?
???????????????? ?????? ????????????? ???????????? ?????? ??? ?????? ???????? ??????? ??????????? ? ??????
??????? ???????.
?????????? ????????????????
?? ???????? ???-???????? ? ??????
?????? ???????? ?????? ? ???????
??? ?????? ????????? ?????????????
???????????????? ??????
Ц?рблмс Ю.г., есл???блмс Ю.Г.
????????? ??????????????? ??????????? ???????????,
?????????
? ??????, ?? ??????? ????????? ?????????, ?????????
?? 1 ?? 2 ??? ???-??????????????. ????????????? ????
???????, ??? ?????????? ???????????? ??? ? ?????? ?????? ??????????????? ???????? ???????? ?????????????
??????? ????? ???????. ?? ?????? ?????, 2007 ?.,
?????????? ?????? ?? ???????????? ???-???????? ????? ?????? 19% ????????? ????????? ??????. ?? ??????
??????????? (65%) ?? 332 ?????????? ? ???? ???????
??????? ??????? ??????, ????????? ???????? ????????? ?????????? ?? ??? ???????? ???????????? ? ???????????? ?????????????. ??????????? ????? ╚? ?????????????? ??????????????? ? ?????????? ????????? ???????????, ??????????? ??????? ?????????????? ????-
91
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
???????????? ???????, 2009, ?. 7, ?3, ?. 90?96
????╩ (?122-??), ?????????????? ???????????? ???????????????? ?? ???????? ???-???????? ?? ? ????? ????? ??
???. ?????? ???????????????? ?????????????? ??????
??? ?????? ????? ? ??????? ?? ???????????? ? ?????? ??
??????. ?????????? ????????? ?? ?????????? ??????
????????-??????????? ? ???????????????? ??????, ??????? ??????? ?????? ????? ? ??????????? ??????? ???????? ????????????.
?????????? ???????. ?????? ?????? ?????? ? ??????
????????????? ??????????????? ?? ???????? ???-???????? ? ??? ???????????????? ??????? ????? ??? ? ??????? ??????????????? (?????) ? ???????????? ??????-?????????? ??????? ????? ??????????? ? ??????? ??
? ?? ??. 13?17 ?????? ? 03?08 ?????? 2006 ?. ????? ??????????? ??????????????? ????????? ???????, ?????
???????? ???????? ?????????? ?????????????? ??? ???????? ???????????? ?????? ?????? ???????? ?????? ? ??????? ???????????????? ?? ???????? ???????????? ???.
????? ?????????? ?? ?????? ???????? ???? ???? ??????????? ??????????? ?????????, ?? ??????? ? ????? ??
???? 2007 ?. ??????? 120 ??????????? ???????????? 4 ╚????????╩ ?????????? ?????????????? ????, ? ??????
2008 ???? ? 15 ?????????????? ?????? ??????????-???????????, ???????????? ????????, ???????????? ? ??????????? ?? 7 ????? ?????? ???????????? ??????: ??????????? ???????????????? ???????????? ????????????, ?????????????? ???????????????? ???????????? ????????????, ?????????-??????????? ???????????????? ????????????, ?????????????? ??????????????? ??????????? ????????, ???????????? ??????????????? ??????????? ????????, ???????????? ??????????????? ??????????? ????????, ??????-?????????? ??????????????? ???????????
????????, ? ??????? 2008 ?. ? 20 ?????? ????????-??????????? ??????????? ???????. ????? ???????, ? 4 ????????
??????????? ?????????????? ???? ?? ???????? ???-???????? ???? ??????? 60% ?????????, ? ?????????? ?????????? ???? ???????? ? 7 ????? ???, ??? ? ????????
2008 ???? ????? ?????????? ???????? ?????? ???????????????? ?? ????? ????????. ???????????????? ????????
????? ?????????????? ??? ???????? ????????? ? ?????????? ??????? ???????. ???????????? ?????? ???????? ??,
??? ?????? ? ??????????? ???????????? ?? ????????? ???????? ???????? ╚?????????? ??????╩ ??????????? ?????????, ??? ???????? ????? ? ???????????? ????????. ???????? ??????? ???????? ? ??????? 2007 ???? ????? ????????? ????????? ????????? ? ?????????? ? ???????? ?
?????????? ????? ?? ?????????? ?????????? ??????. ??????? ????? ????? ?????? ? ????????, ??????? ? ????????????? ??????????? ????????? ? ??????? ? ???????????????? ?????? ? ???????? ?????????? ? ? ????? ???????
???????????????? ????????????. ?????? ? ?????????
???????????? ? ?????? ??????? ???? ?????????????? ????? ???????? ??????????? ?? ???????????? ? ???????
???????? ???-????????. ??? ???????? ??????? ??????????? ??????? ???????????? ???????? ? ?????????????
??? ? ??? ???? ? ???. ???????? ????. ???????? ?.?.,
??????????? ??????? ?.?. ? ?????????? ?.?. ? ???????????? ? ?????? ??????????? ??????????? ??? ?????? ╚????????? ??????????????? ???????? ??????, ??????? ?
92
???╩, ??????? ????????????? ????? ? 2009 ?. ?? ???????? ??? ?????????????? ? ????????-??????????? ?????????????? ???? 22.04.08 ?. ?????????? ???????????
╚???????????? ???-???????? ? ??????????? ??????
???????? ?????? ? ???????╩. ?? ???????? ?????????
╚???? ?????╩ ????????? ??????????????? ?????? ?????
??????????? ???????? ? ???????? ???????????? ?????????? ? ??????????? ??????????.
???????????. ???????? ???????? ????????? ????????????? ?????????? ?? ???????? ???????? ?????. ????????
????????? ?????? ? ??????? ????????? ???? ??????? ?????? ????, ??????? ????? ???? ??????? ???, ????????, ????????? ???????, ??? ??? ????????? ?????? ???????? ?????
??????????? ????????? ?????, ?????? ???? ╚????????????╩. ????? ???????? ???????? ???????????? ????????
?????. ??????? ??????? ???????? ????? ???????? ?????????
(????? ????) ? 70%, ? ?????? ??????? ??????? ?? ??? ?????
???? ????? ???????? ????? ??????? ????. ????????? ??????? ????? ? ????????, ??????? ? ???????? ????????, ????????? ??????? ?????????? ???????????? ??????, ???????? ????????? ? ????????. ?????? ?????? ????? ???????? ????????? ????????? ? ???????? ???-???????? (╚????? ???????????╩, ╚?????? ?? ???????╩) ? ????????? ??????? ?????? ?????? ??????. ????????, ??? ?????????? ???????, ? ?????? ???????, ? ????????????? ?????????????????? ?? ????????. ? ?????? ? ???????????? ??????????? ??????????
??????????? ??????? ?????????????? ??? ? ???????? ?????????? ?? ????? ????????????????? ?????, ?????? ? ??????? ??????????? ?????????? ???????? ? ???-??????????????? ??????????. ???? ?? ???? ?????????????? ? ????? ?????? ?? ????? ???????????. ?????, ? ????? ???????,
? ???????????????? ????, ? ??????, ????? ???????????? ?????????? ?????????? ????????????? ? ?????????? ?????????. ? ??? ????????? ? ????????????? ????? ╚??????╩ ?????????? ?????? ? ???? ??????????.
??? ??????? ???????????? ????? ??? ?????? ??????? ?
????? ???????????? ???????, ?????????? ?? ???????????????? ?????????? ??????????/???????/???, ???????????? ?? ???????? ???????????? ??????. ??????? ???????????? ???????????? ????????????? ??????????, ?????? ?
????? ??????? ?????????. ??? ? ?????-?? ???? ?? ????????, ? ????? ?????? ? ????? ???????? ?????????? ???
???????? ?????????. ????????? ? ???????? ??????? ?????????, ?????????????? ???????????? ??????, ?.?. ??????????????? ?????????, ????????? ?????????? ?? ???????? ?
?????? ????????? ? ????????. ??? ???????? ??????????
???????????? ?????????? ???????, ???????? ??????? ????
?????????? ?????? ????????? ?? ?????? ????????? 6?8 ??????? ?? ?????? ???????, ?????????? ???????????? ???????????????? ???????????, ?????????? ?????? ??????.
?????? ?????? ╚??????? ????╩, ? ?? ???? ╚????????╩.
?????? ????, ??????????? ?? ???????????? ?????, ? ?? ?????????? ?????, ?????? ???????????. ??????? ????????????? ????????? ?? ???????? ?? ? ????????? ???? ╚???????╩, ? ? ???????? ╚????????????╩ (?? ????. ╚???????????╩),
??? ???????????. ????????? ???????? ???? ?????????? ??
3 ??? ?????? ?? 7 ? ? ????.
?????? ???? ??????????????? ???????????? ????????
????????? ????? ???????. ????????? ????? ? ??????? ???-
Copyright ??? ╚??? ╚??????╩ & ??? ╚A???????? K????-C?????╩
????????? I ?????????? ?????????????? ????????? ?? ???????????? ????????
????? ????????? ????????? ??? ??????????? ??????????,
??? ??? ?????? ? ????????? ?? ???????? ??? ??????????
??????? ??????????????? ???????, ?????? ?? ?????????? ?
???????????????? ? ????????? ??????????? ???????????????? ??????, ???????? ? ??????????? ?????, ? ?????????,
?? ????. ?????? ?????????? ?????????????????? ?????????????????? ? ??????????? ????????, ? ????? ????????????? ?????????? ?????????? ???????? ??????? ? ??????
? ????? ???????????? ????????????.
???????? ???????????? ??????????. ??????????????? ?? ? ????? ??? ????? ???????? ??????????? ??????
??? ???????? ??????????????? ????? ??????????? ?????????? ? ?????????? ?????? ???????? ??? ?? ????????
???????. ????? ??????? 461 ??????????. ?? ???????????
??????, 97% ?????? ? ????????? ???????? ??? ?????????
??????????????? ?? ??????? ? ???????????? ???-????????, 100% ??????? ?? ????????????? ?????????? ???????????????? ?? ? ????? ????? ?? ??? ???? ??? ????????????? ?????????? ?????. ?????????? ????????? ??????????
???????????? ?? ??? ???????? ?????????? ????? ???????? ?????? ???????????? ?? ??? ?? ???? ??????, ?????????? ???????????? ?? ???????? ??? ???????? ? ???????? ???. ??????? ????? ????? ????????????????? ????????? ??????????? ?????: 100% ?????? ???? ????????????? ???????? ? ??????? ??? ???????????; 10 ?? 12 ?????????? ???-?????????????? ?????? ???????? ???????????? ????????? ? ???? ?? ??????? ???????????? ????????? ? ?????? ??? ???????, ??? ????? ???? ???????????
? ??? ?? ????? ??????. ??????? ????????????? ???????????? ????????????? ? ????????? ???-??????????????
? ??????????? ??????????: 76% ?????? ? 71% ?????????
???????, ??? ?? ???????? ?? ?????? ????????? ? ????????, ???? ?? ??????, ??? ? ???? ????????? ???. ??? ?????????, ????? ?????????? ??????????? ??????? ????????
?????? 35% ????????????.
???????. ?? ????, ???? ╚??????????╩ ? ??? ?????? ???????? ?????? ? ??????. ????????????? ????????, ? ?????????, ???????? ???? ???????????????? ??????????????, ?
? 1990 ?. ????????????? ???-???????? ? ?? ??????????
????????????? ?????? ?? ?????? ?? ????. ????? ?????
?????????????? ╚????╩ ? ╚?? ????╩ ???????????. ???????
????? ?????????? ????? ? ╚???????╩ ? ? ??????? ???????? ? ╚????????????????╩. ??????? ? ??????????? ???????? ???????? ?????? ???? ???????? ??????????????? ????????????, ??????? ???? ? ??.
??????????? ??????? ???????????????
??????? ???????????? ???????? ?
Гкмкзкл? К.и.
???????? ??????????????? ??????????? ??. ?.?.????????
???????? ??????? ? ?????? ????????????? ? ?????????
??????? ????. ?? ??????????? ???? ???????? 500 ??? ????????? ??V, ?? ???? 10% ???? ????????? ????????????.
? ?????????? ???? (??????) ?????????????? ???????????
????????? ? ???????? ?? ??????? ??????. ?? 2005?2007 ??.
? ???? ???? ???????????????? 393 ??????? ???. ? ????-
???? ?????????? ??????? ????????????? ???????????? ????? ?? ?????? ??????? ? ?????? ? ??????????? ????????? ?
???????? ?????????????????? (???-???????). ?????????
????? ??????? ???????? ?????????? ?????? ???????? ?
(??V) ? ?????????? ??????????? ????????????????? ??????,
??????? ??????????????? ??????????? ??? HCV ? ????????? (?? ?????? ???) ????? 24 ??? ????? ?????????? ???????. ??????? ??????????? ????????????????? ?????? ??????????? ???????? ?? ????????? ??????????? ????????? ?????????? ????? ???? ???????, ??????? ??????? ?? ??????????? ???????????? ? ??????????????? ??????? ???????????? ? ???????????, ??? ???????????? ???????????????? ????? ????? ??? ? ???????? ??????? (?? 70%).
? 2003 ???? ????????? ????????????? ???????? ML 16709
╚?????????????? ???????? ????????? ?? ???????? ???????????? ? ????????????? ??????????????? ??????? ???????????? ?????-2? ? ??????????? ??????? ??? ?? ????????????? ?????-2? (40 ???) ( ???????) ? ??????????? ?
??????? ? ??????????? ????????? ?╩. ??????? ??????????
??????? ???????? ???????+?????????.
???? ??????: ??????? ????????????? ???????????????
??????????????? ??????? (??????????+?????????) ???????????? ???????? ?.
????????
Документ
Категория
Без категории
Просмотров
15
Размер файла
1 024 Кб
Теги
139
1/--страниц
Пожаловаться на содержимое документа