close

Вход

Забыли?

вход по аккаунту

?

14

код для вставкиСкачать
DEVELOPMENTAL DYNAMICS 218:94 –101 (2000)
Severe Peripheral Sensory Neuron Loss and Modest
Motor Neuron Reduction in Mice With Combined
Deficiency of Brain-Derived Neurotrophic Factor,
Neurotrophin 3 and Neurotrophin 4/5
XIN LIU1* AND RUDOLF JAENISCH2,3
1
Department of Pathology and Molecular Medicine, Department of Molecular and Medical Pharmacology, UCLA School of
Medicine, Los Angeles, California
2
Whitehead Institute for Biomedical Research, Cambridge, Massachusetts
3
Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts
ABSTRACT
Neurotrophins are a family of
structurally and functionally related proteins
that regulate neuronal survival during development. In the peripheral nervous system (PNS),
both in vitro and in vivo studies have shown that
neurotrophins are potent factors for the survival
of various sensory neurons and sympathetic neurons. However, it is not clear whether all PNS
neurons are neurotrophin-dependent. In the central nervous system (CNS), studies using injury
models show that neurotrophins promote the
survival of CNS neurons. But mice lacking individual neurotrophins or a combination of BDNF
and NT4 did not show significant CNS neuronal
loss. Here we derived mice lacking three neurotrophins, brain-derived growth factor (BDNF),
neurotrophin-3 (NT3), and neurotrophin-4 (NT4)
to study the effect of triple neurotrophin deficiency on peripheral and central neurons. These
triple-deficient mice did not nurse and died
within 12 hours after birth. Neuronal cell counts
showed that triple mutant pups lacked most of
their peripheral sensory neurons and had a statistically significant reduction of motor neurons
in several motor nuclei. Our results suggest that
neurotrophins are essential for the survival of
most peripheral sensory neurons and affect the
survival of a small portion of motor neurons during embryogenesis. Dev Dyn 2000;218:94 –101.
© 2000 Wiley-Liss, Inc.
Key words: PNS; CNS neuron neurotrophin dependence in embryogenesis
INTRODUCTION
In mammals, the neurotrophin family consists of
nerve growth factor (NGF), brain-derived growth factor
(BDNF), neurotrophin-3 (NT3), and neurotrophin-4
(NT4) (Berkemeier et al., 1991; Hohn et al., 1990;
Ibaanez 1994; Ip et al., 1992; Jones and Reichardt,
1990; Leibrock et al., 1989; Lewin and Barde, 1996;
Maisonpierre et al., 1990). The mature forms of NGF,
BDNF, NT3, and NT4 share a greater than 80% iden© 2000 WILEY-LISS, INC.
tity at the amino acid level. These neurotrophins bind
two types of receptors, the trks which belong to the
receptor tyrosine kinase superfamily, and p75, a member of the tumor necrosis factor (TNF) receptor family
(Barbacid, 1995; Bothwell, 1995; Chao, 1994). NGF is a
ligand of trkA (Cordon-Cardo et al., 1991) and BDNF is
a ligand of trkB (Klein et al., 1991; Soppet et al., 1991;
Squinto et al., 1991). NT3 in addition to being a ligand
of trkC (Lamballe et al., 1991), also binds trkA and
trkB and induces phosphorylation of these receptors
(Cordon-Cardo et al., 1991; Klein et al., 1991; Soppet et
al., 1991; Squinto et al., 1991; Tessarollo et al., 1997).
NT4 binds trkA and induces the phosphorylation of
trkA in addition to its function as a ligand of trkB
(Berkemeier et al., 1991; Ip et al., 1992). All neurotrophins bind with low affinity to the non-catalytic p75
receptor.
The expression of the neurotrophins and the receptors often overlaps, both in tissue and developmental
stage distribution (Eide et al., 1993; Korsching, 1993).
For example, in the CNS, while trkA expression is
restricted to only a few populations of neurons (Holtzman et al., 1992), trkB and trkC as well as their ligands
have very broad patterns of expression (Ernfors et al.,
1990; Escandon et al., 1994; Ip et al., 1992; Lamballe et
al., 1994; Tessarollo et al., 1993; Wetmore et al., 1990).
Since most CNS neurons appear to express trkB and
trkC, it is likely that many classes of neurons in the
CNS may respond to BDNF, NT3, and NT4.
Ample studies have shown that neurotrophins are
potent factors that promote the survival of peripheral
sensory neurons, sympathetic neurons and various
types of CNS neurons in cell culture and animal injury
models (Eide et al., 1993; Korsching, 1993). In recent
years, the in vivo functions of neurotrophins were under intense study using gene targeting approaches
Grant sponsor: NIH/NCI; Grant number: R35-CA 44339.
*Correspondence to Dr. Xin Liu, CHS 23-263, Department of Pathology and Molecular Medicine, Department of Molecular and Medical Pharmacology, UCLA School of Medicine, Los Angeles, California
90095-1735. E-mail: lxin@ucla.edu
Received 21 October 1999; Accepted 13 January 2000
95
PNS AND CNS NEUROTROPHIN DEPENDENCE IN DEVELOPMENT
TABLE 1. Genotypes of 250 Newborn Offspring of BDNFⴙ/ⴚ, NT3ⴙ/ⴚ, NT4ⴚ/ⴚ Mice
⫹/⫹
⫹/⫹
⫺/⫺
17
6.8
6.25
V
BDNF
NT3
NT4
Number of offspring
Actual %
Theoretical %
Adult viabilitya
⫹/⫹
⫹/⫺
⫺/⫺
36
14.4
12.5
V
⫹/⫹
⫺/⫺
⫺/⫺
16
6.4
6.25
NV
⫹/⫺
⫹/⫹
⫺/⫺
29
11.6
12.5
V
⫹/⫺
⫹/⫺
⫺/⫺
66
26.4
25
V
⫹/⫺
⫺/⫺
⫺/⫺
36
14.4
12.5
NV
⫺/⫺
⫹/⫹
⫺/⫺
11
4.4
6.25
NV
⫺/⫺
⫹/⫺
⫺/⫺
27
10.8
12.5
NV
⫺/⫺
⫺/⫺
⫺/⫺
12
4.8
6.25
NV
a
V, viable; NV, non-viable.
(Conover and Yancopoulos, 1997; Snider, 1994). Mice
carrying null mutations in individual neurotrophin or
neurotrophin receptor genes were derived (Conover et
al., 1995; Crowley et al., 1994; Ernfors et al., 1994a;
Ernfors et al., 1994b; Farianas et al., 1994; Jones et al.,
1994; Klein et al., 1994; Klein et al., 1993; Lee et al.,
1992; Liu et al., 1995; Smeyne et al., 1994; Tessarollo et
al., 1994). Consistent with previous studies in the PNS,
these mutant mice show various degrees of neuronal
reduction in the peripheral sensory ganglia and superior
cervical ganglion (SCG) during late embryogenesis.
These results support the hypothesis that neurotrophins
control peripheral nervous system development by selectively promoting survival of specific groups of neurons.
However, it is not entirely clear whether most of PNS
sensory and sympathetic neurons or just overlapping
subgroups of them depend on neurotrophins to survive
during development. In contrast to the PNS, studies
focused on the CNS of these mutant mice are not consistent with previous studies. In vitro studies have
shown that neurotrophins promote the survival of motor neurons, dopaminergic neurons and other types of
CNS neurons (Alderson et al., 1990; Hyman et al.,
1991; Hyman et al., 1994; Hynes et al., 1994; Oppenheim et al., 1992; Sendtner et al., 1992; Yan et al.,
1992). However, in mice carrying null mutations in
neurotrophin genes, no significant CNS neuron loss
was detected (Conover and Yancopoulos, 1997; Snider,
1994). In fact, removal of any single neurotrophic factor
alone, including glial cell line-derived neurotrophic factor (GDNF) and ciliary neurotrophic factor (CNTF), did
not result in significant reduction of CNS neurons during embryogenesis (Masu et al., 1993; Moore et al.,
1996; Pichel et al., 1996; Sanchez et al., 1996). These
results may imply that multiple, functionally redundant neurotrophins may deliver the signals for CNS
neurons to survive. To address these issues, we derived
triple mutant mice deficient for BDNF, NT3, and NT4.
RESULTS
Mutant mice were consecutively crossed to derive
offspring carrying different combinations of mutant alleles. We found that mice lacking NT4 and carrying
only one wild-type (wt) allele of the BDNF and NT3
genes survived to adulthood and were fertile. Also,
mice deficient in all three neurotrophin genes or any
combination of two of the three neurotrophin genes,
BDNF, NT3, or NT4, survived to birth (Table 1). However, none of the double- or triple-deficient pups survived for longer than 12 to 48 hours post delivery. Close
observation of triple-deficient mutant newborns, revealed: 1) difficulty with breathing but no gross anatomical abnormalities; 2) failure to nurse as none of the
animals had milk in their stomachs.
To examine whether neurons were lost in the mutant
animals, live newborns (within 12 hr from birth) were
collected. The head and spine of each animal were
processed as described in Experimental Procedures.
First inspection indicated that the peripheral sensory
ganglia of the triple-mutant mice were dramatically
reduced in size compared to those of wt animals. Figure
1 A to D shows that the dorsal root (B) and nodose
ganglia (D) of [BDNF⫺/⫺, NT3⫺/⫺, NT4⫺/⫺] mice
were significantly smaller than those (A and C) of wt
mice. To quantify the reduction of neurons in ganglia of
the triple mutant mice, neurons in peripheral sensory
ganglia and the superior cervical ganglion (SCG) were
counted. Setting the cell numbers from wt mice as
100%, we found that approximately 90% of the neurons
in nodose, trigeminal, and dorsal root ganglia were lost
in [BDNF⫺/⫺, NT3⫺/⫺, NT4⫺/⫺] mice, whereas
geniculate and vestibular neurons were completely absent (Table 2). These data provide strong evidence that
survival of most, if not all, PNS sensory neurons depends on the presence of neurotrophins during embryogenesis. In contrast to the sensory neurons, sympathetic neurons in the SCG of [BDNF⫺/⫺, NT3⫺/⫺,
NT4⫺/⫺] mice were reduced by 50%, a deficit which is
comparable to the reduction seen in mice lacking only
NT3 (Ernfors et al., 1994b; Jones et al., 1994). This
result is consistent with the previous conclusions that
losses of BDNF and NT4 have little or no effect on
sympathetic neuron survival (Conover et al., 1995; Liu
et al., 1995).
To study the role of neurotrophins in promoting CNS
neuronal survival during development, we examined
several motor nuclei in the brain stem and motor neurons in the spinal cord. We found a small (⬃20%) but
statistically significant reduction of motor neurons in
the hypoglossal, facial, and trigeminal nuclei of tripledeficient mutants (Table 2). The remaining motor neurons in these nuclei of mutant animals are often
smaller in size and stain darker compared to their
counterparts in wt animals (Fig. 1, E and F). To docu-
96
LIU AND JAENISCH
Fig. 1. Histochemistry and
immunohistochemistry of wt
and neurotrophin triple deficient (TD) mice. A–F: Cresyl
violet stained paraffin sections.
A and B are cross sections of
lumbar spinal column 4 (L4)
from wt and TD neonates, respectively. Arrows point to
DRG on each side of the spinal
cord. Scale bar ⫽ 0.4 mm. C
and D are coronal sections of
nodose ganglia from wt and TD
neonates, respectively. Nodose ganglia are circled with
dashed lines. E and F are coronal sections of facial motor nuclei of wt and TD, respectively.
Arrows point to individual motor neurons. G and H are tyrosine hydroxylase immunohistochemistry
of
coronal
sections of the midbrain of wt
and TD neonates, respectively. Cytoplasm and neurite
are stained. Arrows point to
some neuronal cell bodies in
substantia nigra. Scale bars ⫽
0.12 mm for C–H.
ment this change, we compared the size of facial motor
neurons between wt and mutant mice. Figure 2 shows
that, in the facial motor nuclei of mutant mice, the
percentage of small neurons (⬍ 10 ␮m in diameter)
increased and the percentage of large neurons (⬎ 10
␮m in diameter) decreased compared to that of wt
animals. In the same section level, when the sizes of
neurons adjacent to the facial motor neurons are compared, there are no detectable changes. In addition to
motor nuclei, we also examined dopaminergic neurons
in the substantia nigra. Anti-tyrosine hydroxylase antibodies were used to identify these neurons. Staining
was detected in the cytoplasm (Fig. 1, G and H, arrows)
of dopaminergic neurons in the substantia nigra of
PNS AND CNS NEUROTROPHIN DEPENDENCE IN DEVELOPMENT
97
TABLE 2. Neuronal Cell Counts in Sensory and Sympathetic Ganglia and Motor
Nuclei of Wild-Type and Mutant Mice
Wild-type
Trigeminal ganglion
Vestibular ganglion
Superior cervical ganglion
Nodose-petrosal ganglia
Geniculate ganglion
Dorsal root (L4) ganglion
Facial motor neurons
Hypoglossal motor neurons
Trigeminal motor neurons
Spinal motor column
Mean number
of neuronsa
29,796 ⫾ 860
(n ⫽ 4)
3,061 ⫾ 169
(n ⫽ 3)
15,226 ⫾ 1122
(n ⫽ 4)
4,175 ⫾ 173
(n ⫽ 3)
912 ⫾ 8
(n ⫽ 3)
6,744 ⫾ 272
(n ⫽ 3)
3565 ⫾ 136
(n ⫽ 6)
1673 ⫾ 70
(n ⫽ 6)
839 ⫾ 37
(n ⫽ 6)
821 ⫾ 80
(n ⫽ 4)
% of
control
100 ⫾ 3
100 ⫾ 6
100 ⫾ 7
100 ⫾ 4
100 ⫾ 1
100 ⫾ 5
100 ⫾ 4
100 ⫾ 4
100 ⫾ 5
100 ⫾ 10
BDNF⫺/⫺/NT3⫺/⫺/NT4⫺/⫺
Mean
number of
neuronsa
% of control
3,623 ⫾ 376
12 ⫾ 1***
(n ⫽ 6)
0
0
(n ⫽ 6)
8,043 ⫾ 333
53 ⫾ 2***
(n ⫽ 6)
165 ⫾ 22
4 ⫾ 1***
(n ⫽ 6)
0
0
(n ⫽ 6)
558 ⫾ 24
8 ⫾ 1***
(n ⫽ 4)
2781 ⫾ 148
78 ⫾ 4*
(n ⫽ 8)
1362 ⫾ 42
81 ⫾ 2*
(n ⫽ 8)
682 ⫾ 19
81 ⫾ 2*
(n ⫽ 8)
664 ⫾ 28
80 ⫾ 4
(n ⫽ 2)
All are neuronal counts of newborn mice (P0). Counts are displayed as number ⫾ s.e.m.
*P ⬍ 0.05; ***P ⬍ 0.001 for student’s t-test (unpaired).
a
DISCUSSION
Fig. 2. Comparison of facial motor (fm) neuron sizes between wt and
neurotrophin triple deficient (TD) mice. There is higher percentage of
small fm neurons (⬍10 ␮m) in the TD mice (69%) than that (44%) in wt
mice (P ⫽ 0.0056). There is lower percentage of large fm neurons (10 –15
␮m) in the TD mice (31%) than that (54%) of wt mice (P ⫽ 0.0058). In wt
but not TD mice, there is also a small percentage (ⵒ2%) of fm neurons
that are larger than 15 ␮m in diameter. When the sizes of the neurons
located adjacent to fm neurons were compared between wt and TD mice,
no size difference was detected (⬍ 7.5 ␮m, P ⫽ 0.591; 7.5–10 ␮m, P ⫽
0.995; ⬎ 10 ␮m, P ⫽ 0.088).
both wt and [BDNF⫺/⫺, NT3⫺/⫺, NT4⫺/⫺] mice suggesting that development or survival of these neurons
was not substantially affected by the lack of neurotrophins.
In this study we have generated mutant mice that
carry deletions in all or in different combinations of the
genes coding for the three neurotrophins, BDNF, NT-3,
and NT-4. The [BDNF⫹/⫺, NT3⫹/⫺, NT4⫺/⫺] mice
are viable and fertile suggesting that a substantial
reduction of neurotrophin dose does not hamper the
overall development. The [BDNF⫺/⫺, NT3⫺/⫺,
NT4⫺/⫺] embryos survived to term but the pups died
within 12 hrs: that is the earliest of all known neurotrophin mutants (Conover and Yancopoulos, 1997;
Snider, 1994). When compared to wild-type pups, no
gross anatomical differences were detected in the mutants. However, the mutant pups appeared to have
difficulties breathing and it is possible that the dysfunction of the respiratory system may contribute to
the death of these animals. Consistent with this possibility, a recent study showed that BDNF⫺/⫺ mice have
a deficit in neurons that control breathing (Erickson et
al., 1996). We speculate that additional loss of neurotrophins may exasperate deficits in neurons that
control breathing, and therefore results in the early
postnatal death of the triple neurotrophin deficient
mutants.
Our histological analyses revealed a profound deficit
of sensory neurons with not more than 5–10% neurons
present in the various ganglia of the peripheral nervous system of triple mutants. In addition, about 50%
of the SCG neurons were absent. The phenotypes of
animals deficient for a single neurotrophin, for BDNF
and NT-3, for BDNF and NT-4, and for trkB and trkC
98
LIU AND JAENISCH
TABLE 3. Summary of the Percent of Neuronal Loss in the Various Ganglia of Neurotrophin and trk Mutants
Compared to Wild-Type Mice
NGF⫺/⫺
Trigeminal
Vestibular
SCG
Nodose
Geniculate
DRG
Motor (Facial)
Spiral
82b
70b
BDNF⫺/⫺
44d/27e
82d/87e
⫹14*d
66d/43e
40e
30d/34e
3*d
NT3⫺/⫺
64d/61c
34d/23*c
53d/48c
47d/30c
25c
55d/78c
2*f
NT4⫺/⫺
2*f/5*a
21*f
⫹12*f
59f/56a
50f
14*f
8*f
BDNF⫺/⫺
NT3⫺/⫺
99d
66h
100d
BDNF⫺/⫺
NT4⫺/⫺
30f/34a
82f
4*f
90f/79a
94f
11*f
trkB/C⫺/⫺
58g/100i
95i
98i
41g,i
5i
BDNF⫺/⫺
NT3⫺/⫺
NT4⫺/⫺
88
100
47
96
100
92
20
*Not statistically significant.
Previously published results, aConover et al., bCrowley et al., cFarianas et al., dErnfors et al., 1994a,b, 1995, eJones et al., fLiu
et al., 1995, gMinichiello et al., h ElShamy and Ernfors, and iSilos-Santiago et al.
⫹ Shows an increase instead of loss.
double-mutants have been described previously
(Conover et al., 1995; Ernfors et al., 1994a; Ernfors et
al., 1994b; Ernfors et al., 1995; Farianas et al., 1994;
Jones et al., 1994; Liu et al., 1995; Minichiello et al.,
1995; Silos-Santiago et al., 1997). The neuronal deficits
of these mutants and our results are summarized in
Table 3. Our results are consistent with the notion
that, in addition to neurons in the vestibular and spiral
ganglia (Ernfors et al., 1995), almost all the neurons in
every PNS sensory ganglion that we examined depend
on neurotrophin to survive during embryogenesis. It is
possible that, if the triple mutant animals live long
enough, we may observe the complete PNS sensory
neuron loss.
How do these neurotrophins cooperate to regulate
the neuronal survival in each ganglion? Comparing our
results with previous data (see Table 3), it seems that
there are three major patterns. In vestibular, and
geniculate ganglia, the extent of PNS neuronal loss in
animals with multiple neurotrophin mutations is additive reflecting the combined deficits caused by each
individual neurotrophin mutation. This pattern favors
the hypothesis that each type of neurotrophin is required by largely non-overlapping subpopulations of
neurons in a ganglion. In the nodose ganglion, deficiency in either BDNF, NT3, or NT4 lead to about 50%
of neuron reduction. In DRG, deficiency in NGF leads
to 70% neuronal reduction whereas our triple mutants
suffered a 92% neuronal reduction. This second pattern
suggests that there are subpopulations of neurons in
these ganglia, which require more than one type of
neurotrophin to survive. Indeed, Pinon and colleagues
have shown that trigeminal neurons may require
BDNF in early stage and later shift to NGF (Pinon et
al., 1996). ElShamy and Ernfors have shown that
BDNF and NT3 may be required sequentially for the
same group of nodose neurons (ElShamy and Ernfors,
1997). The last pattern is seen in the SCG where the
neuronal loss in triple mutants is similar to that in
NT3 single mutants (Table 3). Taken together, we suggest that, during embryogenesis, neurotrophins regu-
late the survival of most PNS sensory neurons, that
subpopulations of PNS neurons require more than one
type of neurotrophin to survive, and that BDNF and
NT4 are not required for SCG neuronal survival.
The most surprising result of our study is the modest
but statistically significant neuronal reduction in several motor nuclei of the triple mutants. We do not know
whether the severe loss of PNS sensory neurons can
affect the differentiation and survival of motor neurons
and cause the reduction that we detect. In previous
studies, we and others have observed between a 2 to
11% loss of facial motor neurons, that is not statistically significant, in single neurotrophin mutants and
BDNF and NT4 double mutants (Ernfors et al., 1994a;
Ernfors et al., 1994b; Liu et al., 1995). It is possible that
the accumulation of the small but additive reductions
of motor neurons in single and double neurotrophin
mutants made the motor neuron loss in triple mutants
detectable. Alternatively, any one of these three neurotrophins, BDNF, NT3, or NT4 may deliver the signal
for a small but distinct group of cells in these motor
nuclei to survive. This later possibility is in agreement
with a recent study showing that [trkB⫹/⫺, trkC⫺/⫺]
or [trkB⫺/⫺, trkC⫹/⫺] mice have similar hippocampal
and cerebellar granule neuron reduction suggesting
that CNS neurons are capable of using more than one
neurotrophin/trk receptor signal transduction pathway
for survival (Minichiello and Klein, 1996). In this
study, Minichiello and colleagues did not detect motor
neuron loss in trkB and trkC double-mutant mice
(Minichiello and Klein, 1996). We speculate that lack of
BDNF, NT3, and NT4 may lead to a more severe phenotype than that of [trkB⫺/⫺, trkC⫹/⫺] and [trkB⫹/⫺,
trkC⫺/⫺] mice because these receptor mutant mice are
not deficient for both trkB and trkC receptors. Moreover, the truncated form of trkB may exist in these
mice (Klein et al., 1993). It has been demonstrated that
truncated forms of trkB are capable of mediating
BDNF-induced signal transduction (Baxter et al.,
1997). These speculations may also explain the excessive neuronal loss in vestibular ganglia and DRG (see
PNS AND CNS NEUROTROPHIN DEPENDENCE IN DEVELOPMENT
99
Fig. 3. Genotyping of mutant
mice. A: PCR analysis of BDNF and
NT3 wt and knockout (KO) alleles.
B: Southern analysis of NT4 wt and
KO alleles. For details, please see
Experimental Procedures.
Table 3) of the triple mutants compared to that of
[trkB⫺/⫺, trkC⫺/⫺] mice (Minichiello et al., 1995; Silos-Santiago et al., 1997). Alternatively, NT3 and NT4
may signal through trkA in the DRG neurons of
[trkB⫺/⫺, trkC⫺/⫺] mice. It is not known that trkA is
expressed in facial or trigeminal motor neurons. We
also observed the neuronal size reduction in the remaining motor neurons of the triple mutants suggesting a substantial percentage of motor neurons are affected by neurotrophin deficiency. However, we do not
know the precise nature of changes that take place in
these neurons. In our study, we have not observed
gross change in the hippocampus or cerebellum of triple mutants. Since Minichiello and colleagues’ results
were from postnatal day 14 animals, it could be that
neurotrophins are required for the survival of these
granule neurons in postnatal development and there is
no detectable deficit of these cells in P0 mutant mice. It
would be interesting to examine if there are reductions
in the granule neurons of viable [BDNF⫹/⫺, NT3⫹/⫺,
NT4⫺/⫺] mice.
EXPERIMENTAL PROCEDURES
Mouse Mutants
The generation of mice carrying targeted null mutations in BDNF, NT3, or NT4 genes has been described
previously (Ernfors et al., 1994a; Ernfors et al., 1994b;
Liu et al., 1995). Triple mutant mice [BDNF⫺/⫺,
NT3⫺/⫺, NT4⫺/⫺] were derived by several steps of
breeding. BDNF or NT3 heterozygous mutant mice
were bred with NT4 homozygous mutant mice to obtain
[BDNF⫹/⫺, NT4⫹/⫺] and [NT3⫹/⫺, NT4⫹/⫺] mice.
Then, [BDNF⫹/⫺, NT4⫹/⫺] mice were bred with
[NT3⫹/⫺, NT4⫹/⫺] mice to obtain [BDNF⫹/⫺,
NT3⫹/⫺, NT4⫺/⫺] mice. Finally, the triple-deficient
[BDNF⫺/⫺, NT3⫺/⫺, NT4⫺/⫺] mice were obtained
from breeding of [BDNF⫹/⫺, NT3⫹/⫺, NT4⫺/⫺] mice.
To identify the genotypes of these mice, a small amount
of skin from each animal was taken to harvest DNA.
Polymerase chain reaction (PCR) was used to genotype
BDNF and NT3 mutants (Fig. 3A). The primers used
for BDNF are BL-1: ATGAAAGAAGTAAACGTCCAC,
BL-2: CCAGCAGAAAGAGTAGAGGAG, and PGK:
GGGAACTTCCTGACTAGGGG. The primers used for
NT3 are NT3-3: CCTGGCTTCTTTACATCTCG,
NT3-4: TGGAGGATTATGTGGGCAAC, and PGK as
described above. PCR using primers BL-1 and BL-2 or
primers NT3-3 and NT3-4 amplify DNA fragments
only from the wt allele of BDNF and NT3, respectively.
PCR using BL-1 and PGK or NT3-3 and PGK amplify
DNA fragments only from the targeted allele of BDNF
and NT3, respectively. Southern blot analysis was used
to genotype NT4 mutants (Fig. 3B) as described previously (Liu, et al., 1995).
Cresyl Violet Staining and Neuron Counting
Heads and lumbar spinal column 3 (L3) to lumbar
spinal column 5 (L5) from newborn mice were collected.
Skulls of each head were carefully removed to expose
the brain. These tissues were fixed in formalin for 24
hr, embedded in paraffin, sectioned at 5 ␮m thickness,
and stained with cresyl violet. Neurons with cytoplasm, clear nucleus, and nucleoli were counted in every fourth section as previously described (Ernfors et
al., 1994b).
The sizes of neurons are measured by using a grid
inserted in one side of the ocular lens. Based on the
sizes, the facial motor neurons are divided into three
groups, ⬍ 10, 10 –15, and ⬎ 15 ␮m in diameter and
counted. The neurons adjacent to facial motor neurons
100
LIU AND JAENISCH
are defined as neurons located in a 250 ␮m diameter
circular area between the motor nuclei and the midline of the brain. These neurons are also divided into
three groups, ⬍ 7.5, 7.5–10, and ⬎ 10 ␮m in diameter
and counted. If the neuron has an oval shape, the
smaller of the two diameters is used to classify the
neuron. Facial motor neurons and neurons adjacent to
facial motor neurons in every eighth section of the
serial brain sections are measured and counted. Serial
brain sections from three wt and four triple-deficient
mice are used in the measuring and counting. The
student’s t-test is used for the statistical analysis of the
data.
Tyrosine Hydroxylase Immunohistochemistry
Brains from newborn mice were dissected, fixed in
4% paraformaldehyde, equilibrated with 30% sucrose,
and sectioned at 10 ␮m thickness. Sections were preincubated in dilution buffer (0.1 M NaCl, 0.01 M phosphate buffer, pH 7.4, 3% bovine serum albumin and
0.3% Triton X-100) for 1 hr followed by overnight incubation with rabbit anti-tyrosine hydroxylase antiserum
(Peel-Freeze) diluted at 1:200 in dilution buffer containing 5% goat serum at 4°C. After 4 washes in PBS,
sections were incubated with biotinylated anti rabbit
IgG secondary antibody and avidin-peroxidase (Vectastain ABC kit, Vector Laboratories) as well as with
3,3⬘-diaminobenzidine (DAB, Sigma Chemical Company, St. Louis, MO) as previously described (Liu, et
al., 1991).
ACKNOWLEDGMENTS
This work is supported by NIH/NCI grant R35-CA
44339 to RJ and Beatrice Kolliner Fellow award to XL.
We thank Hong Wu, Samson Chow, Inbal Israely, and
Brian Bates for reviewing the manuscript.
REFERENCES
Alderson RF, Alterman AL, Barde YA, Lindsay RM. 1990. Brainderived neurotrophic factor increases survival and differentiated
functions of rat septal cholinergic neurons in culture. Neuron
5:297–306.
Barbacid M. 1995. Neurotrophic factors and their receptors. Curr
Opin Cell Biol 7:148 –155.
Baxter GT, Radeke MJ, Kuo RC, Makrides V, Hinkle B, Hoang R,
Medina-Selby A, Coit D, Valenzuela P, Feinstein SC. 1997. Signal
transduction mediated by the truncated trkB receptor isoforms,
trkB.T1 and trkB.T2. J Neurosci 17:2683–2690.
Berkemeier LR, Winslow JW, Kaplan DR, Nikolics K, Goeddel DV,
Rosenthal A. 1991. Neurotrophin-5: a novel neurotrophic factor that
activates trk and trkB. Neuron 7:857– 866.
Bothwell M. 1995. Functional interactions of neurotrophins and neurotrophin receptors. Annu Rev Neurosci 18:223–253.
Chao MV. 1994. The p75 neurotrophin receptor. J Neurobiol 25:1373–
1385.
Conover JC, Yancopoulos GD. 1997. Neurotrophin regulation of the
developing nervous system: analyses of knockout mice. Rev Neurosci 8:13–27.
Conover JC, Erickson JT, Katz DM, Bianchi LM, Poueymirou WT,
McClain J, Pan L, Helgren M, Ip NY, Boland P, et al. 1995. Neuronal deficits, not involving motor neurons, in mice lacking BDNF
and/or NT4. Nature 375:235–238.
Cordon-Cardo C, Tapley P, Jing SQ, Nanduri V, O’Rourke E, Lamballe F, Kovary K, Klein R, Jones KR, Reichardt LF, et al. 1991. The
trk tyrosine protein kinase mediates the mitogenic properties of
nerve growth factor and neurotrophin-3. Cell 66:173–183.
Crowley C, Spencer SD, Nishimura MC, Chen KS, Pitts-Meek S,
Armanini MP, Ling LH, MacMahon SB, Shelton DL, Levinson AD,
et al. 1994. Mice lacking nerve growth factor display perinatal loss
of sensory and sympathetic neurons yet develop basal forebrain
cholinergic neurons. Cell 76:1001–1011.
Eide FF, Lowenstein DH, Reichardt LF. 1993. Neurotrophins and
their receptors— current concepts and implications for neurologic
disease. Exp Neurol 121:200 –214.
ElShamy WM, Ernfors P. 1997. Brain-derived neurotrophic factor,
neurotrophin-3, and neurotrophin-4 complement and cooperate
with each other sequentially during visceral neuron development.
J Neurosci 17:8667– 8675.
Erickson JT, Conover JC, Borday V, Champagnat J, Barbacid M,
Yancopoulos G, Katz DM. 1996. Mice lacking brain-derived neurotrophic factor exhibit visceral sensory neuron losses distinct from
mice lacking NT4 and display a severe developmental deficit in
control of breathing. J Neurosci 16:5361–5371.
Ernfors P, Wetmore C, Olson L, Persson H. 1990. Identification of
cells in rat brain and peripheral tissues expressing mRNA for
members of the nerve growth factor family. Neuron 5:511–526.
Ernfors P, Lee KF, Jaenisch R. 1994a. Mice lacking brain-derived
neurotrophic factor develop with sensory deficits. Nature 368:147–
150.
Ernfors P, Lee KF, Kucera J, Jaenisch R. 1994b. Lack of neurotrophin-3 leads to deficiencies in the peripheral nervous system and
loss of limb proprioceptive afferents. Cell 77:503–512.
Ernfors P, Van De Water T, Loring J, Jaenisch R. 1995. Complementary roles of BDNF and NT-3 in vestibular and auditory development. Neuron 14:1153–1164.
Escandon E, Soppet D, Rosenthal A, Mendoza-Ramairez JL, Szeonyi
E, Burton LE, Henderson CE, Parada LF, Nikolics K. 1994. Regulation of neurotrophin receptor expression during embryonic and
postnatal development. J Neurosci 14:2054 –2068.
Farianas I, Jones KR, Backus C, Wang XY, Reichardt LF. 1994.
Severe sensory and sympathetic deficits in mice lacking neurotrophin-3. Nature 369:658 – 661.
Hohn A, Leibrock J, Bailey K, Barde YA. 1990. Identification and
characterization of a novel member of the nerve growth factor/
brain-derived neurotrophic factor family. Nature 344:339 –341.
Holtzman DM, Li Y, Parada LF, Kinsman S, Chen CK, Valletta JS,
Zhou J, Long JB, Mobley WC. 1992. p140trk mRNA marks NGFresponsive forebrain neurons: evidence that trk gene expression is
induced by NGF. Neuron 9:465– 478.
Hyman C, Hofer M, Barde YA, Juhasz M, Yancopoulos GD, Squinto
SP, Lindsay RM. 1991. BDNF is a neurotrophic factor for dopaminergic neurons of the substantia nigra. Nature 350:230 –232.
Hyman C, Juhasz M, Jackson C, Wright P, Ip NY, Lindsay RM. 1994.
Overlapping and distinct actions of the neurotrophins BDNF, NT-3,
and NT-4/5 on cultured dopaminergic and GABAergic neurons of
the ventral mesencephalon. J Neurosci 14:335–347.
Hynes MA, Poulsen K, Armanini M, Berkemeier L, Phillips H,
Rosenthal A. 1994. Neurotrophin-4/5 is a survival factor for embryonic midbrain dopaminergic neurons in enriched cultures. J Neurosci Res 37:144 –154.
Ibaanez CF. 1994. Structure-function relationships in the neurotrophin family. J Neurobiol 25:1349 –1361.
Ip NY, Ibaaanez CF, Nye SH, McClain J, Jones PF, Gies DR, Belluscio
L, Le Beau MM, Espinosa Rd, Squinto SP, et al. 1992. Mammalian
neurotrophin-4: structure, chromosomal localization, tissue distribution, and receptor specificity. Proc Natl Acad Sci USA 89:3060 –
3064.
Jones KR, Reichardt LF. 1990. Molecular cloning of a human gene
that is a member of the nerve growth factor family. Proc Natl Acad
Sci USA 87:8060 – 8064.
Jones KR, Farianas I, Backus C, Reichardt LF. 1994. Targeted disruption of the BDNF gene perturbs brain and sensory neuron development but not motor neuron development. Cell 76:989 –999.
Klein R, Nanduri V, Jing SA, Lamballe F, Tapley P, Bryant S, CordonCardo C, Jones KR, Reichardt LF, Barbacid M. 1991. The trkB
PNS AND CNS NEUROTROPHIN DEPENDENCE IN DEVELOPMENT
tyrosine protein kinase is a receptor for brain-derived neurotrophic
factor and neurotrophin-3. Cell 66:395– 403.
Klein R, Smeyne RJ, Wurst W, Long LK, Auerbach BA, Joyner AL,
Barbacid M. 1993. Targeted disruption of the trkB neurotrophin
receptor gene results in nervous system lesions and neonatal death.
Cell 75:113–122.
Klein R, Silos-Santiago I, Smeyne RJ, Lira SA, Brambilla R, Bryant S,
Zhang L, Snider WD, Barbacid M. 1994. Disruption of the neurotrophin-3 receptor gene trkC eliminates la muscle afferents and results in
abnormal movements [see comments]. Nature 368:249–251.
Korsching S. 1993. The neurotrophic factor concept: a reexamination.
J Neurosci 13:2739 –2748.
Lamballe F, Klein R, Barbacid M. 1991. trkC, a new member of the trk
family of tyrosine protein kinases, is a receptor for neurotrophin-3.
Cell 66:967–979.
Lamballe F, Smeyne RJ, Barbacid M. 1994. Developmental expression of trkC, the neurotrophin-3 receptor, in the mammalian nervous system. J Neurosci 14:14 –28.
Lee KF, Li E, Huber LJ, Landis SC, Sharpe AH, Chao MV, Jaenisch
R. 1992. Targeted mutation of the gene encoding the low affinity
NGF receptor p75 leads to deficits in the peripheral sensory nervous
system. Cell 69:737–749.
Leibrock J, Lottspeich F, Hohn A, Hofer M, Hengerer B, Masiakowski
P, Thoenen H, Barde YA. 1989. Molecular cloning and expression of
brain-derived neurotrophic factor. Nature 341:149 –152.
Lewin GR, Barde YA. 1996. Physiology of the neurotrophins. Annu
Rev Neurosci 19:289 –317.
Liu X, Yu QA, Huang ZS, Zwiebel LJ, Hall JC, Rosbash M. 1991. The
strength and periodicity of D. melanogaster circadian rhythms are
differentially affected by alterations in period gene expression. Neuron 6:753–766.
Liu X, Ernfors P, Wu H, Jaenisch R. 1995. Sensory but not motor
neuron deficits in mice lacking NT4 and BDNF. Nature 375:238 –
241.
Maisonpierre PC, Belluscio L, Squinto S, Ip NY, Furth ME, Lindsay
RM, Yancopoulos GD. 1990. Neurotrophin-3: a neurotrophic factor
related to NGF and BDNF. Science 247:1446 –1451.
Masu Y, Wolf E, Holtmann B, Sendtner M, Brem G, Thoenen H. 1993.
Disruption of the CNTF gene results in motor neuron degeneration.
Nature 365:27–32.
Minichiello L, Klein R. 1996. TrkB and TrkC neurotrophin receptors
cooperate in promoting survival of hippocampal and cerebellar
granule neurons. Genes Dev 10:2849 –2858.
Minichiello L, Piehl F, Vazquez ES, T., Hokfelt T, Represa J, Klein R.
1995. Differential effects of combined trk receptor mutations on
dorsal root ganglion and inner ear sensory neurons. Development
121:4067– 4075.
Moore MW, Klein RD, Farianas I, Sauer H, Armanini M, Phillips H,
Reichardt LF, Ryan AM, Carver-Moore K, Rosenthal A. 1996. Renal
and neuronal abnormalities in mice lacking GDNF. Nature 382:76 –
79.
Oppenheim RW, Yin QW, Prevette D, Yan Q. 1992. Brain-derived
neurotrophic factor rescues developing avian motoneurons from cell
death. Nature 360:755–757.
101
Pichel JG, Shen L, Sheng HZ, Granholm AC, Drago J, Grinberg A, Lee
EJ, Huang SP, Saarma M, Hoffer BJ, Sariola H, Westphal H. 1996.
Defects in enteric innervation and kidney development in mice
lacking GDNF. Nature 382:73–76.
Pinon LG, Minichiello L, Klein R, Davies AM. 1996. Timing of neuronal death in trkA, trkB and trkC mutant embryos reveals developmental changes in sensory neuron dependence on Trk signalling.
Development 122:3255–3261.
Sanchez MP, Silos-Santiago I, Frisaen J, He B, Lira SA, Barbacid M.
1996. Renal agenesis and the absence of enteric neurons in mice
lacking GDNF. Nature 382:70 –73.
Sendtner M, Holtmann B, Kolbeck R, Thoenen H, Barde YA. 1992.
Brain-derived neurotrophic factor prevents the death of motoneurons in newborn rats after nerve section. Nature 360:757–759.
Silos-Santiago I, Fagan AM, Garber M, Fritzsch B, Barbacid M. 1997.
Severe sensory deficits but normal CNS development in newborn
mice lack TrkB and TrkC tyrosine protein kinase receptors. Euro J
Neurosci 9:2045–2056.
Smeyne RJ, Klein R, Schnapp A, Long LK, Bryant S, Lewin A, Lira
SA, Barbacid M. 1994. Severe sensory and sympathetic neuropathies in mice carrying a disrupted Trk/NGF receptor gene [see
comments]. Nature 368:246 –249.
Snider WD. 1994. Functions of the neurotrophins during nervous
system development: what the knockouts are teaching us. Cell
77:627– 638.
Soppet D, Escandon E, Maragos J, Middlemas DS, Reid SW, Blair J,
Burton LE, Stanton BR, Kaplan DR, Hunter T, et al. 1991. The
neurotrophic factors brain-derived neurotrophic factor and neurotrophin-3 are ligands for the trkB tyrosine kinase receptor. Cell
65:895–903.
Squinto SP, Stitt TN, Aldrich TH, Davis S, Bianco SM, Radziejewski
C, Glass DJ, Masiakowski P, Furth ME, Valenzuela DM, et al. 1991.
trkB encodes a functional receptor for brain-derived neurotrophic
factor and neurotrophin-3 but not nerve growth factor. Cell 65:885–
893.
Tessarollo L, Tsoulfas P, Martin-Zanca D, Gilbert DJ, Jenkins NA,
Copeland NG, Parada LF. 1993. trkC, a receptor for neurotrophin-3,
is widely expressed in the developing nervous system and in nonneuronal tissues [published erratum appears in Development 1993
Aug; 118: following 1384]. Development 118:463– 475.
Tessarollo L, Vogel KS, Palko ME, Reid SW, Parada LF. 1994. Targeted mutation in the neurotrophin-3 gene results in loss of muscle
sensory neurons. Proc Natl Acad Sci USA 91:11844 –11848.
Tessarollo L, Tsoulfas P, Donovan MJ, Palko ME, Blair-Flynn J,
Hempstead BL, Parada LF. 1997. Targeted deletion of all isoforms
of the trkC gene suggests the use of alternate receptors by its ligand
neurotrophin-3 in neuronal development and implicates trkC in
normal cardiogenesis. Proc Natl Acad Sci USA 94:14776 –14781.
Wetmore C, Ernfors P, Persson H, Olson L. 1990. Localization of
brain-derived neurotrophic factor mRNA to neurons in the brain by
in situ hybridization. Exp Neurol 109:141–152.
Yan Q, Elliott J, Snider WD. 1992. Brain-derived neurotrophic factor
rescues spinal motor neurons from axotomy-induced cell death.
Nature 360:753–755.
Документ
Категория
Без категории
Просмотров
6
Размер файла
500 Кб
Теги
1/--страниц
Пожаловаться на содержимое документа