close

Вход

Забыли?

вход по аккаунту

?

Микробиология нозокомиальной синегнойной инфекции мониторинг распространенности биологические особенности возбудителя и новые подходы к диагностике

код для вставкиСкачать
На правах рукописи
Кузнецова Марина Валентиновна
МИКРОБИОЛОГИЯ НОЗОКОМИАЛЬНОЙ СИНЕГНОЙНОЙ
ИНФЕКЦИИ: МОНИТОРИНГ РАСПРОСТРАНЕННОСТИ,
БИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ ВОЗБУДИТЕЛЯ И НОВЫЕ
ПОДХОДЫ К ДИАГНОСТИКЕ
03.02.03. – микробиология
АВТОРЕФЕРАТ
диссертации на соискание ученой степени
доктора медицинских наук
Пермь – 2014
2
Работа выполнена в Государственном бюджетном образовательном учреждении
высшего профессионального образования «Пермская государственная медицинская академия
им. ак. Е.А. Вагнера» Министерства здравоохранения Российской Федерации и в
Федеральном государственном бюджетном учреждении науки Институте экологии и
генетики микроорганизмов Уральского отделения Российской академии наук, Пермь.
Научные консультанты
доктор биологических наук,
профессор Карпунина Тамара Исаковна
доктор медицинских наук, чл.-корр. РАН,
профессор Демаков Виталий Алексеевич
Официальные оппоненты:
доктор медицинских наук, чл.-корр. РАН, академик РАМН,
профессор, председатель Президиума Оренбургского
научного центра, главный научный сотрудник ФГБУН
Института клеточного и внутриклеточного симбиоза УрО
РАН Бухарин Олег Валерьевич
доктор медицинских наук, профессор, заведующий
кафедрой фундаментальной и прикладной микробиологии,
профессор кафедры лабораторной диагностики ГБОУ ВПО
«Башкирский государственный медицинский университет»
МЗ РФ Мавзютов Айрат Радикович
доктор медицинских наук, начальник отделения препаратов
бактериотерапии филиала ФГУП «НПО «Микроген» МЗ
РФ «Пермское НПО «Биомед»
Несчисляев Валерий Александрович
Ведущая организация: Государственное бюджетное образовательное учреждение высшего
профессионального образования Первый Московский государственный медицинский
университет имени И.М. Сеченова Министерства здравоохранения Российской Федерации
(Первый МГМУ им. И.М. Сеченова), 119991, г. Москва, ул. Трубецкая, д. 8 стр. 2.
Защита состоится «____» ___________ 2014 г. в __часов на заседании Диссертационного
совета ДМ 004.019.01 в Институте экологии и генетики микроорганизмов УрО РАН
по адресу: 614081, г. Пермь, ул. Голева, 13. Факс: (342) 280 92 11
Автореферат диссертации размещен на официальном сайте Министерства
образования и науки РФ (http://vak.ed.gov.ru) и сайте Института экологии и генетики
микроорганизмов УрО РАН (http://www.iegm.ru).
С диссертацией можно ознакомиться в библиотеке Института экологии и генетики
микроорганизмов УрО РАН и на сайте ИЭГМ УрО РАН (http://www.iegm.ru).
Автореферат разослан «____» ___________ 2014 года
Ученый секретарь диссертационного совета,
кандидат биологических наук
Максимова Юлия Геннадьевна
3
ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ
Актуальность
темы
исследования
и
степень
ее
разработанности.
Pseudomonas aeruginosa является хорошо известным возбудителем инфекций, связанных с
оказанием медицинской помощи. P. aeruginosa доминирует в этиологии поздних вентиляторассоциированных пневмоний, инфекций мочевых путей, раневых и катетер-ассоциированных
инфекций, бактериемии (Van Delden, Iglewski, 1998). Синегнойная палочка занимает особое
место в развитии гнойно-септических осложнений в отделениях реанимации и интенсивной
терапии (ОРИТ): по данным многоцентровых европейских и российских исследований ее доля
может составлять до 30% случаев внутрибольничного инфицирования (Зубков, 2003;
Сидоренко, 2003, 2005; Руднов, и др., 2005, 2011; Govan, et al., 2007; Решедько, и др., 2006,
2008; Vincent, et al., 2009; Kohlenberg, et al., 2010; Bertrand, Dowzicky, 2012; и др.).
Способность P. aeruginosa колонизировать практически любой орган или ткань и
вызывать разнообразные инфекционные процессы, в том числе с летальным исходом, связана
со значительным арсеналом факторов вирулентности. Часть из них ассоциирована с клеточной
стенкой, другие являются экстрацеллюлярными продуктами (Berka, Vasil, 1982; Frank , 1997;
Van Delden, Iglewski, 1998; Armstrong, et al., 2002; Davey, et al., 2003; Шагинян, Чернуха, 2005;
Filloux, 2011; Priyaja, et al., 2014; и др.). Высокая резистентность к различным классам
антимикробных препаратов является важным свойством P. aeruginosa, которое
обеспечивается, прежде всего, особенностями строения клеточной стенки, ферментативной
продукцией и системами активного выброса (Livermore, 2002; Сидоренко, 2003; Queenan,
Bush, 2007; Эйдельштейн, и др., 2012; и др.).
Популяции синегнойной палочки гетерогенны по способности к синтезу и секреции
различных метаболитов. Принято считать, что в условиях ЛПУ происходит накопление
эковаров, отличающихся повышенной вирулентностью. Однако остается до конца не
выясненным, связано ли это с расширением спектра экспрессируемых ими факторов
патогенности или увеличением активности тех из них, которые потенцируются в
специфических условиях внутрибольничной среды. Эффективность микробиологического
мониторинга в стационарах различного профиля в значительной степени зависит от
используемых при этом диагностических тестов. Идентификация синегнойной палочки в
практических бактериологических лабораториях осуществляется бактериологическим
методом согласно Приказу Минздрава СССР от 22.04.85 г. №535 и «Методическим
рекомендациям …» МЗ РСФСР от 03.06.1986 г. Из многочисленных свойств P. aeruginosa в
лабораторной практике в лучшем случае определяют пигментообразование, гемолитическую и
фосфолипазную активность при культивировании на соответствующих агаризованных средах,
учитывая лишь факт наличия того или иного признака. Такой подход не позволяет оценить
истинный уровень вирулентности изолята и делает невозможным сравнительный анализ
циркулирующих
штаммов.
Многочисленными
исследованиями
установлена
многофакторность процесса биопленкообразования у P. aeruginosa (O'Toole, Kolter, 1998;
Klausen, et al., 2003; Ghafoor, et al., 2011; Маянский, и др., 2012; и др.), но его значение в
контексте внутрибольничной природы изолятов до конца не определено.
Для идентификации P. aeruginosa с помощью полимеразной цепной реакции (ПЦР)
предложено использовать различные специфические гены: toxA, gyrB, cfX, algD, oprI и oprL
(Da Silva Filho, 1999; Khan, Cerniglia, 1994; Lavenir, et al., 2007; Motoshima, et al., 2007; и др.). В
целом проблема привлечения современных технологий для генотипической характеристики
нозокомиальных изолятов P. aeruginosa далека от своего решения: нет единого мнения и
регламентирующих
документов,
определяющих
обязательные
ДНК-мишени
и
соответствующие праймеры для идентификации и типирования P. aeruginosa.
При инфекциях полимикробной этиологии P. aeruginosa занимает различные позиции
во взаимоотношениях с другими грамотрицательными и грамположительными бактериями
или грибами (Tomlin, 2001; Bandara, et al., 2010; Yang, et al., 2011; Conway, et al., 2012).
Развитие
микст-инфекции
зачастую
определяется
возможностью
межвидового
взаимодействия и зависит, прежде всего, от антагонистической активности бактерий,
4
входящих в сообщество (Бухарин, и др., 2005, 2007). Одним из главных механизмов
межклеточной коммуникации, определяющих ее характер (синергизм, антагонизм), является
синтез экзопродуктов, в том числе вторичных метаболитов и антибактериальных веществ.
Полимикробные ассоциации широко изучаются в последние годы, но процессы,
происходящие в смешанной культуре, чаще всего рассматриваются либо только в планктоне,
либо только в биопленке (Chu, et al., 2012; Machado, et al., 2012). Единичные исследования
посвящены влиянию экзопродуктов в составе супернатантов P. aeruginosa на рост в планктоне
и биопленкообразование E. coli, и наоборот (Valle, et al., 2006; Lopes, et al., 2011). Пока
недостаточно данных, связанных с влиянием внеклеточных факторов P. aeruginosa на
зрелую/сформированную биопленку других видов бактерий (Irie, et al., 2005; Qin, et al., 2009).
В доступной литературе не обнаружено информации о смешанной культуре E. coli и
внутрибольничной P. aeruginosa с различной предоминантной формой существования
(«биопленочная» или «планктонная»), тогда как преимущественный фенотип может влиять на
физиологическую адаптацию микроорганизмов в многовидовых сообществах.
Для оценки антимикробных свойств экзометаболитов используют подход, основанный
на их способности ингибировать биолюминесценцию бактерий-мишеней (Simon, et al., 2001;
Zrimec, et al., 2004; Несчисляев, и др., 2002; Дерябин, 2009). Применение тест-штаммов E. coli
с полным люкс-опероном (Данилов, и др., 2002) позволяет оценивать по интенсивности
свечения метаболическую активность одного из членов ассоциации в смешанной культуре, но
до сих пор еще не продемонстрировано использование биолюминесценции как показателя
антагонистических взаимоотношений в многовидовых биопленках.
Использование клеточных моделей показывает, что уровень цитотоксичности
смешанных бактериальных культур возрастает по сравнению с их моновидовым действием. В
доступной литературе, в основном, представлены данные о влиянии «чистых» экзопродуктов
P. aeruginosa на клетки макроорганизма. Выявлено, что пиоцианин усиливает апоптоз
нейтрофилов in vitro (Usher, et al., 2002) и in vivo (Allen, et al., 2005). Можно полагать, что
присутствие в среде экзометаболитов микробного происхождения, синтез которых изменяется
в смешанных культурах, повлияет на функциональную активность нейтрофилов и других
эффекторов иммунитета.
Таким образом, высокая распространенность и атрибутивная летальность от
внутрибольничного инфицирования P. aeruginosa в сочетании с недостаточно информативной
лабораторной
оценкой
биологических
особенностей
нозокомиальных
изолятов,
необходимость внедрения новых технологий микробиологического анализа в диагностику
синегнойной инфекции, назревшая потребность в уточнении роли микробного фактора в
развитии инфекционного процесса послужили основанием для проведения настоящего
исследования.
Цель исследования: комплексная оценка фено- и генотипических особенностей
нозокомиальных штаммов P. aeruginosa с использованием традиционных и новых технологий
микробиологического анализа как основы совершенствования диагностики и мониторинга
госпитальной синегнойной инфекции.
1.
2.
Задачи исследования:
Оценить многолетнюю динамику распространенности P. aeruginosа, определить ее место
в общей таксономической структуре микроорганизмов, изолируемых в терапевтических,
хирургических и акушерских стационарах, а также определить значимость возбудителя
при развитии основных клинических форм инфекции. Проанализировать особенности
циркуляции P. aeruginosа в детской и взрослой клинике.
Оценить целесообразность молекулярно-генетических подходов при определении видовой
принадлежности, антибиотикоустойчивости, цитотоксичности изолятов в клинической
практике, а также оптимизировать методы их детекции/идентификации и
генотипирования для повышения эффективности мониторинга синегнойной инфекции.
5
3.
4.
5.
6.
Дать характеристику биологических свойств нозокомиальных штаммов P. aeruginosа в
зависимости от профилизации стационара и исследуемого клинического материала с
количественной оценкой продукции пиоцианина, пиовердина, гемолизинов, учитывая
влияние различных факторов и сроков хранения культур.
Оценить биопленкообразующую способность P. aeruginosа in vitro в зависимости от
функциональных особенностей штаммов и некоторых абиотических факторов.
Установить наиболее информативные показатели, характеризующие клиникоэпидемиологическую значимость изолятов, и предложить интегральный критерий для
оценки их потенциальной патогенности.
В экспериментальных условиях изучить характер симбиотических/антагонистических
взаимоотношений P. aeruginosа с клинически значимыми условно-патогенными
микроорганизмами (УПМ) в планктоне и биопленках. Оценить влияние супернатантов
смешанной культуры на апоптоз, некроз и окислительную активность нейтрофилов
человека in vitro.
Научная новизна работы. Впервые на основе комплексного ретроспективного
сравнительного анализа статистических данных охарактеризованы особенности циркуляции
штаммов P. aeruginosa в детской (акушерской и подростковой) и взрослой (терапевтической и
хирургической) клинике. Предложена принципиальная схема, определяющая значимость
эндогенного и экзогенного инфицирования пациентов разных возрастных групп в зависимости
от профиля стационара.
Дополнены данные по частоте встречаемости у штаммов P. aeruginosa генов,
кодирующих эффекторы секреторной системы третьего типа (TTSS), в зависимости от
характера и структуры лечебно-профилактических учреждений (ЛПУ), биологического
материала, присутствия металло-бета-лактамаз (МБЛ). Показана возможность использования
мультиплексной ПЦР для идентификации и одновременной детекции маркеров
антибиотикоустойчивости и цитотоксичности с целью определения эпидемиологической/
клинической значимости изолятов.
С использованием комплекса современных лабораторных тестов изучены
внутрибольничные штаммы P. aeruginosa и представлена сравнительная характеристика
данных о гемолитической активности, продукции пиоцианина и пиовердина, способности к
адгезии и биопленкообразованию, в том числе с оценкой корреляционных связей между
признаками. Обоснована необходимость использования количественных характеристик таких
показателей. Впервые проведена оценка вклада экзометаболитных и клеточноассоциированных факторов в гемолитическую активность клинических изолятов, предложен
термин «гемолитический профиль» культуры. Изучена взаимосвязь разных факторов,
определяющих пленкообразующую способность P. aeruginosa. Впервые на основе ряда
признаков с использованием рутинных и специальных методов, включающих атомносиловую, лазерную сканирующую конфокальную микроскопию и АТФ-метрию,
сформулирована гипотеза о предоминантной форме существования P. aeruginosa –
«планктонной» или «биопленочной». Показано, что определяемая в биопленках концентрация
внутриклеточного АТФ, характеризующая энергетический статус клеток в определенной фазе
формирования биопленки, является важнейшим критерием для отбора штаммов с
преимущественной «биопленочной» формой существования.
Предложены и апробированы оригинальные тесты и дополнительные критерии для
микробиологической характеристики этиопатогенов: 1) метод оценки потенциальной
патогенности изолятов P. aeruginosa, основанный на изменении свечения люминесцентного
тест-штамма при действии их экзометаболитов; 2) способ оценки характера межмикробных
взаимоотношений в смешанных культурах, основанный на сравнении полученной
экспериментально и теоретически рассчитанной биомассы многовидовой биопленки; 3)
способ контроля бактериальной обсемененности объектов окружающей среды в медицинских
учреждениях, основанный на молекулярно-генетическом анализе. Впервые предложено
6
использовать сравнение нуклеотидных последовательностей гена blaOXA-50-like (SLST) для
определения родства штаммов в локальных исследованиях.
Впервые проанализирован характер взаимодействия P. aeruginosa в смешанной
культуре с учетом ее предоминантной формы существования, которая определяется
значительной гетерогенностью, присущей внутрибольничным популяциям данного вида. При
этом выявлены однонаправленные эффекты у всех изученных штаммов P. aeruginosa при
росте в смешанной культуре, а именно снижение общего уровня пиоцианина и пиовердина,
подавление метаболизма E. coli, повышение биомассы биопленки в соответствии с
детерминированной формой существования. Установлено, что в смешанном биопленочном
сообществе биологическая активность ассоциантов подчиняется общим закономерностям,
описанным для монокультур. Впервые определен характер межвидовых взаимоотношений в
планктонных и пленочных культурах P. aeruginosa и E. coli с использованием
биолюминесцентного анализа. Показано, что антагонистическая активность P. aeruginosa в
отношении ассоцианта в планктоне сохраняется и в биопленке, способствуя выживанию
клеток синегнойной палочки. Более того, при любом типе взаимоотношений с участием
P. aeruginosa, последняя, как правило, занимает «выгодное» положение в различных
экологических нишах.
Впервые изучено модифицирующее влияние ассоциантов на повреждающее действие
(апоптоз и некроз нейтрофилов) культуральных супернатантов P. aeruginosa in vitro, что,
скорее всего, отражает эффекты при микст-инфекции in vivo.
Теоретическая значимость работы. Результаты проведенных исследований
позволили сформулировать концепцию, дополняющую существующую гипотезу о роли
микробного фактора в развитии инфекционного процесса, обусловленного P. aeruginosa.
Фенотипическое разнообразие, опосредованное гетерогенностью популяций P. aeruginosa,
благоприятствует колонизации различных биотопов макроорганизма, определяет
многообразие нозологических форм синегнойной инфекции, течение инфекционного процесса
– хроническое или острое, либо присутствие в микробиоте факультативных видов в качестве
комменсала. Характер межвидовых взаимоотношений с сопутствующей, как правило, также
условно-патогенной микрофлорой, детерминирован не только высокой антагонистической
активностью P. aeruginosa в отношении ассоциантов, но и различными стратегиями
выживания с учетом предоминантной формы существования, позволяющими бактериям
данного вида занимать наиболее «выгодное» положение в смешанных сообществах.
Многокомпонентные биопленки с участием P. aeruginosa отличаются массивностью и часто
превосходят совокупные параметры моновидовых биопленок ассоциантов. Однако в их
структуре жизнеспособность сохраняет преимущественно синегнойная палочка, используя
и/или уничтожая «сожителей» за счет ими же спровоцированной гиперпродукции входящих в
матрикс экзометаболитов, которые обеспечивают ее высокий антагонистический потенциал.
Можно полагать, что наиболее тяжелое течение и моно-, и микст-инфекций связано с
участием особых высоковирулентных клонов P. аeruginosa, которые могут формироваться в
ЛПУ, либо попадать в них извне. При этом возникновение смешанных инфекций связано с
присоединением P. аeruginosa к УПМ, первично инфицировавшим тот или иной биотоп, но не
наоборот. Поэтому, как правило, P. aeruginosa препятствует развитию других
микроорганизмов, однако легко входит в ассоциации и может присоединяться к текущему
инфекционному процессу. Это определяет и высокую долю полимикробных инфекций с ее
участием.
Практическая значимость работы. Получены данные, характеризующие
распространенность и особенности циркуляции штаммов P. aeruginosa в разных возрастных
группах. По результатам исследований создана электронная база основных фенотипов,
включая профили антибиотикорезистентности и генотипов P. aeruginosae, циркулирующих в
стационарах г. Перми, способствующая осуществлению эпиднадзора на территориальном
уровне. Определены основные механизмы устойчивости к бета-лактамным антибиотикам в
7
стационарах взрослой и детской медицинской сети. Предложены необходимые
бактериологические, биохимические и молекулярно-генетические тесты для комплексной
оценки патогенного потенциала Р. aeruginosa, оптимизированы подходы для типирования
(определения родства) штаммов и разработан алгоритм их использования в системе
эпиднадзора за госпитальными инфекциями на примере данного возбудителя. Предложен
способ оценки межмикробных взаимоотношений в смешанных биопленочных культурах,
который поможет прогнозировать характер развития инфекционного процесса при микстинфекциях. Использование подхода с применением молекулярно-генетического анализа для
контроля обсемененности внешней среды лечебных учреждений повысит его качество. С
учетом того, что в хирургических стационарах г. Перми циркулируют штаммы P. aeruginosa
генотипа exoU+/blaVIM2, предложена мультиплексная ПЦР для выявления эпидемически
значимых нозокомиальных изолятов. Для определения возможного развития микст-инфекции
целесообразно оценивать и прогнозировать характер взаимоотношений P. aeruginosa в
смешанных культурах in vitro с учетом изменения биолюминесценции тест-штамма,
отражающей энергетический статус ассоцианта.
Основные положения, выносимые на защиту:
1.
Современной особенностью нозокомиальной синегнойной инфекции является
неравнозначность роли P. aeruginosa во взрослой и неонатальной клинике. Сохраняется
приоритет возбудителя в ИСМП в хирургических стационарах взрослой сети, с
доминированием в этиологии пневмоний, раневых, ожоговых и урологических инфекций, в
том числе в составе ассоциаций с K. pneumoniae, A. baumannii и E. coli. В учреждениях
родовспоможения P. aeruginosa не играет существенной роли ни в качестве колонизирующего
микроорганизма, ни в качестве этиопатогена у новорожденных.
Диагностическая чувствительность и специфичность культурального метода и
2.
молекулярно-генетических технологий для идентификации P. aeruginosa сопоставимы и
взаимозаменяемы в клинической практике. Методы молекулярной детекции маркеров
цитотоксичности TTSS exoS и exoU, антибиотикорезистентности blaVIM и intI, а также
генотипирования rep-ПЦР и SLST blaOXA-50 оптимальны для быстрой оценки локальной
эпидемиологической ситуации.
3.
Для характеристики гемолитической активности нозокомиальных штаммов
P. aeruginosa целесообразно анализировать «гемолитический профиль» культуры,
складывающийся из термолабильного и термостабильного экзометаболитных компонентов, а
также самостоятельно значимого клеточно-ассоциированного гемолиза. Штаммовые
фенотипические характеристики, основанные на спектрофотометрическом количественном
анализе факторов патогенности, коррелируют с предлагаемым индексом потенциальной
патогенности, определяемым по изменению биолюминесценции тест-культуры E. coli lux+.
4.
Массивность биопленки, жизнеспособность и энергетический статус входящих в нее
клеток, наряду с другими морфо-функциональными особенностями, в том числе адгезивной
активностью и гидрофобностью, а также их изменения в разных условиях обитания отражают
адаптационные возможности P. aeruginosa и являются важнейшим критерием для отбора
штаммов с преимущественной «планктонной» или «биопленочной» формой существования.
5.
Различные стратегии выживания P. aeruginosa, обусловленные значительной
гетерогенностью внутрибольничных популяций, зависят от ее антагонистической активности,
предоминантной формы существования и отражаются на характере взаимоотношений с
ассоциантами в планктонных и биопленочных смешанных культурах.
Личный вклад автора. Автору принадлежит формулирование проблемы, постановка
цели и задач исследования, планирование экспериментов и непосредственное участие в них,
анализ фактического материала и обобщение результатов, подготовка научных публикаций и
патентов.
Ряд экспериментальных исследований был выполнен на базе лабораторий ФГБУН
ИЭГМ УрО РАН. Автор благодарит за предоставленную возможность и содействие
8
сотрудников и заведующих лабораториями: д.м.н., профессора Ткаченко А.Г., д.м.н.,
профессора Ширшева С.В., чл.-корр., д.б.н., профессора Ившину И.Б., а также Авдееву Н.С.
(зав. референс-лабораторией, созданной на базе ГБУЗ ПК ГКБ №7 г. Перми, главного
бактериолога г. Перми) и Проворову С.В. (зав. лабораторией ООО «ПРО-МЕД») за
предоставленные данные по распространенности возбудителя и помощь в сборе культур
P. aeruginosa, к.б.н. Эйдельштейна М.В. (зав. лабораторией антибиотикорезистентности НИИ
антимикробной химиотерапии, ГБОУ ВПО «СГМА» МЗ РФ) за помощь в работе и ценные
советы по интерпретации результатов молекулярно-генетических исследований.
Степень достоверности. Апробация работы и публикации. Достоверность
результатов исследования подтверждается анализом многолетней медицинской
документации референс-лаборатории и других практических лабораторий города,
значительным объемом собственных исследований, выполненных с применением
современных, адекватных поставленным задачам бактериологических и молекулярногенетических методов, использованием референтных штаммов, полученных из различных
коллекций. Основные феномены, обнаруженные и изученные в ходе экспериментального
исследования, были воспроизведены в опытах с разными клиническими штаммами
P. aeruginosa. Полученные результаты обработаны с использованием лицензионных
программ и современных методов статистического анализа.
Диссертация апробировалась на заседании кафедры микробиологии и вирусологии с
циклом КЛД ГБОУ ВПО «ПГМА им. ак. Е.А. Вагнера» МЗ РФ 27 марта 2014 г. (протокол
№9), межкафедральном научном координационном совете по проблемам общественного
здоровья и санитарно-эпидемиологического обеспечения населения ГБОУ ВПО «ПГМА им.
ак. Е.А. Вагнера» МЗ РФ 11 апреля 2014 г. (протокол №1) и проблемной комиссии ФГБУН
ИЭГМ УрО РАН 25 апреля 2014 г. (протокол №3). Основные результаты диссертации
докладывались и обсуждались на научно-практической конференции «Современные
проблемы эпидемиологии» (Н.Новгород, 2007), Международной конференции «Генетика и
биотехнология XXI века. Фундаментальные и прикладные аспекты» (Минск, 2008), VII
Международной конференции «Загрязнение окружающей среды, адаптация, иммунитет»
(Пермь-Н.Новгород, 2008), VII Всероссийской конференции по проблеме «Персистенция
микроорганизмов» (Оренбург, 2009), Краевой конференции «Проблема синегнойной
инфекции в реанимационных отделениях ЛПУ» (Пермь, 2009), Российских выставках
«Медицина и здоровье» (Пермь, 2012, 2013), научно-практических конференциях по
медицинской микологии – XV и XVII Кашкинские чтения (Санкт-Петербург, 2012, 2014), а
также были представлены на X, XII и XIV Международных конгрессах по антимикробной
терапии МАКМАХ/ESCMID (Москва, 2008, 2010, 2012) и 4th Congress of European
Microbiologists (Geneva, 2011).
Оптимизированные методы идентификации и генотипирования изолятов
P. aeruginosa используются референс-лабораторией Пермского края на базе ГБУЗ ПК
«Городская клиническая больница №7», ГБУЗ «Ордена «Знак Почета» Пермская краевая
клиническая больница», МБУЗ «Городская больница №1 имени академика Вагнера Евгения
Антоновича» г. Березники. Результаты выполненных исследований используются в
лекционном курсе при обучении студентов и клинических интернов на кафедре
микробиологии и вирусологии с курсом КЛД ГБОУ ВПО «ПГМА им. ак. Е.А. Вагнера» МЗ
РФ.
Материалы диссертации отражены в 64 печатных работах, опубликованных в
международных и российских изданиях, в том числе в 3 обзорах, 22 экспериментальных
статьях в журналах, включенных в список ВАК, 6 из которых входят в международные базы
цитирования Web of Science/Scopus, а также в монографии и 4 Патентах РФ.
Связь работы с научными программами. Исследования выполнены при финансовой
поддержке Министерства образования и науки РФ (Государственный заказ № 01200709668 по
теме «Научные основы обеспечения и эпидемиологические механизмы профилактики
9
различных инфекционных заболеваний» на 2012-13 гг.). Работа поддержана Российским
фондом фундаментальных исследований (Грант №07-04-96093-р_урал_а «Исследование
детерминант устойчивости сапрофитных грамотрицательных бактерий почвенной среды и
факультативных комменсалов человека, с оценкой их перспективности для конструирования
векторов клонирования», Грант №14-04-01300 «Влияние экзопродуктов смешанных культур
Pseudomonas aeruginosa и Escherichia coli на функциональную активность нейтрофилов»).
Объем и структура диссертации. Работа изложена на 245 страницах машинописного
текста, содержит 58 рисунков и 43 таблицы, состоит из введения, обзора литературы,
описания объектов и методов, четырех глав результатов собственных исследований,
заключения, выводов, практических рекомендаций, списка литературы, включающего 483
наименования, в том числе 93 на русском и 390 на английском языках.
СОДЕРЖАНИЕ РАБОТЫ
Объекты и методы исследования
В соответствии с поставленными в работе задачами был разработан дизайн
исследования (рис. 1).
Дизайн исследования
Взрослая клиника Педиатрия Акушерство
ХИРУРГИЯ
ТЕРАПИЯ
(ОРИТ/«неОРИТ», ожоговое отделение)
- Инфицированность пациентов
-Доля в спектре микробных культур
-Участие в ассоциациях
-Антибиотикоустойчивость
ОЦЕНКА ОСОБЕННОСТЕЙ ЦИРКУЛЯЦИИ
Изучение биологических свойств
нозокомиальных штаммов P. aeruginosa
Гидрофобность Адгезивность
Биопленкообразующая способность
Гемолитическая активность
Пигментообразование
Фосфолипазная активность
Антагонистическая активность
Цитотоксичность
Динамика анализируемых
параметров при хранении и
изменении температурного
режима
Ретроспективный анализ данных учетноотчетной документации
бактериологической референслаборатории на базе МУЗ ГКБ №7 за
период 2006-12 гг.; бак. лаборатории ООО
«ПРО-МЕД» на базе ГКБ №4 за период с
2010-2012 гг., бак. лаборатории на базе
ГАУЗ ПК ГКБ №21 г. Перми за 2011-12 гг.
Характеристика симбиотических/
антагонистических взаимоотношений
P. aeruginosа и клинически значимых УПМ
в планктоне и биопленке
ОЦЕНКА ПАТОГЕННОГО ПОТЕНЦИАЛА
ПРИМЕНЕНИЕ МОЛЕКУЛЯРНЫХ МЕТОДОВ В:
Идентификации/детекции
Типировании Генотипической характеристике изолятов
- распространенность оксациллиназ с БЛРС-фенотипом
- rep-ПЦР
- поиск и изучение генов, кодирующих МБЛ
- SLST blaOXA50
- генетические профили цитотоксичности
ОЦЕНКА КЛИНИКО-ЭПИДЕМИОЛОГИЧЕСКОЙ ЗНАЧИМОСТИ
Рисунок 1. Дизайн исследования.
Анализ медицинской
документации. Изучены показатели
медицинской
документации бактериологической референс-лаборатории, созданной на базе МУЗ ГКБ №7
г. Перми, бактериологической лаборатории ООО «ПРО-МЕД» на базе МУЗ «Городская
клиническая больница №4», ожогового отделения, работающего на базе ГАУЗ ПК ГКБ №21
г. Перми. Всего обобщены результаты микробиологического анализа 1422578 проб
биологического материала за 2006-10 гг., а также 9130 проб (хирургические стационары), 9319
проб (акушерские стационары) и 208 проб (ожоговый центр) за 2010-12 гг.
Эпидемиологические показатели – среднемноголетний уровень инфицированности,
10
среднегодовой темп ее прироста и темп прироста за 5 лет вычисляли при помощи программы
EpiTrend v.1.4.1. Данные, отражающие структуру циркулирующей микрофлоры, и характер ее
чувствительности к антибиотикам проанализированы с помощью программ «Система
микробиологического мониторинга «Микроб-2» v.1.25, «Микроб-автомат» и WHONET v.5.3.
Бактериальные штаммы. Объектами для изучения служили клинические штаммы
P. aeruginosa, изолированные в период 2008-13 гг. из различных ЛПУ Пермского края,
г. Екатеринбурга и г. Москвы (n=370). Все штаммы, выделенные в стационарах, в
последующем обозначались как нозокомиальные или внутрибольничные. Референтные
штаммы P. aeruginosa АТСС®27853, Escherichia coli АТСС®25922, E. сoli АТСС®35218,
Klebsiella pneumonia АТСС®700603, Staphylococcus aureus АТСС®25923, Enterococcus faecalis
АТСС®29212 получены из Государственной коллекции патогенных микроорганизмов ГИСК
им Л.А. Тарасевича (сейчас ФГБУ «НЦЭСМП» Минздрава России, г. Москва). Штамм
P. aeruginosa 565 (blaVIM-2+) получен из коллекции НИИ антимикробной химиотерапии (г.
Смоленск). Рекомбинантный биолюминесцентный штамм E. coli K12 TG1 lux+ (с полным luxопероном Vibrio fischeri, pF1 lux+ Apr) получен из коллекции Московского государственного
университета им. М.В. Ломоносова (Данилов, и др., 2000).
Молекулярно-генетические методы исследования. Выделение тотальной ДНК
чистых культур осуществляли по методике, описанной Stone и соавт. (1994). Для выделения
ДНК из объектов окружающей среды использовали набор реагентов на магнитных частицах
«М-сорб-ООМ» («Синтол», г. Москва) в соответствии с инструкцией производителя.
Амплификацию осуществляли на термоциклере Termocycler T3 («Biometra», Германия) или
DNA Engine Dyad Thermal Cycler («Bio-Rad», США) с применением термостабильных ДНКполимераз (Taq- и Tth-полимеразы) («СибЭнзим» г. Новосибирск). Для обнаружения ПЦРпродуктов использовали электрофорез в горизонтальном агарозном геле при напряженности
электрического поля 6 В/см. Визуализацию полос и документирование данных осуществляли
с использованием системы гель-документации BioDocAnalyze («Biometra», Германия) или
Gel-Doc XR («Bio-Rad», США). Детекцию/идентификацию возбудителя, определение
детерминант цитотоксичности и антибиотикоустойчивости проводили путем ПЦР с
использованием праймеров, представленных в таблице 1 (синтезированы ООО «Синтол»,
г. Москва).
Протоколы
амплификации
соответствовали
рекомендациям
авторов,
предложивших данные последовательности. Секвенирование генов (16S рРНК, exoS, exoU,
blaOXA-10 и blaOXA-50) проводили с праймерами, используемыми в ПЦР, с применением набора
реактивов SEQ Dye Terminator Cycle Sequencing Kit на автоматическом секвенаторе 3500xL
Genetic Analyzer (Applied Biosystems, США). Температурный режим секвенирующей реакции:
95°С – 1мин; 95°С – 10 сек, 50°С – 10 сек, 60°С – 4 мин; 25 циклов. Полученные
последовательности идентифицировали с помощью программы BLAST и базы данных
GenBank/EMBL/DDBJ
(http://www.ncbi.nlm.nih.gov).
Далее
их
анализировали
с
использованием программ CLUSTAL X v.1.83 (Thompson, et al., 1994), TREECON version 1.3b
(Van de Peer, DeWachter, 1994). Анализ первичной структуры белков осуществляли с
помощью программы Vector NTI 10 (http://www.catalog.invitrogen.com). Поиск гомологичных
последовательностей выполняли с использованием программ BLAST. Выравнивание
аминокислотных последовательностей проведено с помощью программы CLUSTAL X v.1.83.
Генетическое типирование штаммов осуществляли посредством RAPD-ПЦР с праймером
М13 (5'-gagggtggcggttct), и rep-ПЦР с праймерами ERIC1R/ERIC2 (5'-cacttaggggtcctcgaatgta/5'aagtaagtgactggggtgagcg) и BOXA1R (5'-ctacggcaaggcgacgctgacg) (Huey, Hall, 1989; Versalovic, et
al., 1991; Wolska, et al., 2011). Дендрограммы филогенетического родства штаммов построены
с применением компьютерного обеспечения Quantity One (версия 4.6.1, Bio-Rad Laboratories,
США). Для численной оценки дискриминирующей способности методов типирования
использовали индекс разнообразия Симпсона (D) согласно Hunter и соавт. (1988):
где N – количество штаммов (выборка), s – количество геномогрупп,
nj – количество штаммов, отнесенных к j-той геномогруппе. Индекс
Симпсона (коэффициент дискриминации) основан на вероятности
11
того, что два неродственных штамма из выборки будут относиться к разным геномогруппам.
Таблица 1
Праймеры, используемые в ПЦР-анализе
Выявляемый вид,
последовательность
Pseudomonas spр.
Ps-for
Нуклеотидная
последовательность
5′-ggtctgagaggatgatcagt
Ps-rev
5′-ttagctccacctcgcggc
PA-SS-F
5′-gggggatcttcggacctca
PA-SS-R
5′-tccttagagtgcccacccg
515F
5′-gtgccagcmgccgcggtaa
1391R
5′-gacgggcggtgwgtrca
exoA2-F
5′-gacaacgccctcagcatcaccagc
exoA2-R
5′-cgctggcccattcgctccagcgct
ExoU-F
5′-gatcttatttcgctgctcga
ExoU-R
5′-ccttctggcgaaaagccac
ExoS-F
5′- tcaggtacccggcattcactacgcgg
ExoS-R
5′- tcactgcaggttcgtgacgtctttctttta
ExoS_s-F
5′-ggcccaggatcggcttgcaa
ExoS_s-R
5′-gatccgctgccgagccaaga
5’CS
5′-ggcatccaagcagcaag
3’CS
5′-aagcagacttgacctga
INT-F
5′-ctctcactagtgaggggc
INT-R
5′-atgaaaaccgccactgcg
VIMcons
(консервативная
область)
VIM-1F
5′-agtggtgagtatccgacag
VIM-1R
5′-atgaaagtgcgtggagac
VIM-2
VIM-2F
5′-atgttcaaacttttgagtagtaag
VIM-2R
5′-ctactcaacgactgagcg
IMPсons-F
5′-gctaaagatactgaaaaattagt
IMPсons-R
5′-tcatttgttaattcagatgcata
SPM-1F
5′-gcgttttgtttgttgctc
SPM-1R
5′-ttggggatgtgagactac
GIM-1F
5′-agaaccttgaccgaacgcag
GIM-1R
5′-actcatgactcctcacgagg
A
5′-aatccggcgctcatссatс
AS
5′-ggtсggcgaсtgaggсgg
P. aeruginosa
16S рРНК универс.
Экзотоксин A
ExoU
ExoS
ExoS_s
Интегрон
Интеграза
IMPcons
SPM-1
GIM-1
OXA-50
OXA-10
и
производные
Праймер
его ABD1
5′- tatcgcgtgtctttcgagta
ABD4
5′- ttagccaccaatgatgccc
Примечание: * – проводили секвенирование ПЦР-продукта.
Размер
фрагмента, п.н.
969
Лит.
источник
Widmer, et
al., 1998
956
Spilker, et al.,
2004
876*
Baker, et al.,
2003
396
Khan, Cernigli,
1994
1038*
Hauser, et al.,
1998
565
Feltman, et
al., 2001
1800
Dacheux, et al.,
2000
-*
Levesque, et
al., 1995
1010
Gutierrez,
et al., 2007
261*
Tsakris, et al.,
2000
801*
Poirel, et al.,
2000
587
Шевченко, и
др., 2007
196
Shibata, et al.,
2003
786
Castanheira, et
al., 2004
748
Girlich, et al.,
2004
869*
Danel, et al.,
1995
12
Фенотипические методы определения факторов патогенности. Гидрофобность
поверхности бактериальных клеток оценивали по их относительному распределению между
водной фазой и фазой органического растворителя гексадекана (Rosenberg, et al., 1980).
Определение уровня адгезии бактерий к эритроцитам (специфическая адгезия) осуществляли
согласно Брилис и соавт. (1986). Определение уровня неспецифической адгезии проводили в
стеклянных пенициллиновых флаконах (гидрофильная поверхность) и в полистироловых 96ти луночных плоскодонных планшетах («Медполимер», Россия) (гидрофобная поверхность).
Под величиной адгезии понимали количество клеток, прилипших на стенки
флакона/планшета, выраженное в % от их исходного количества согласно Николаеву (2000).
Биопленкообразующую способность (ПО) изучали согласно O`Toole и соавт. (2000).
Массивность биопленки оценивали по уровню экстракции 0,1% раствора генцианвиолета 97°
этанолом, осуществляя измерения оптической плотности этанольных экстрактов при длине волны
580 нм на микропланшетном ридере Benchmark Plus (Bio-Rad, США). Экзопродукты
определяли в супернатантах, полученных стерильно путем центрифугирования 2,0 мл
ночной/суточной культуры P. aeruginosa при 13000 об./мин 10 мин на микроцентрифуге
«Эппендорф» (Германия) и фильтрования через мембранные фильтры Millex-MP (0,22 мкм,
Nihon
Millipore,
США).
Продукцию пиоцианина и пиовердина
определяли
спектрофотометрическим методом согласно Deziel и соавт. (2001). Количество пиоцианина
измеряли при 695 нм, пиовердина – по флуоресценции при длине волны возбуждающего
излучения 400 нм, детектируемого излучения 460 нм на микропланшетном ридере
Infiniti M200 (Tecan, Австрия). Гемолитическую активность супернатантов и клеточноассоциированный гемолиз изучали по Dacheux и соавт. (2001). Процент (%) лизиса
рассчитывали по формуле:
, где B – отрицательный контроль (базовый уровень, ОП540 раствора при
инкубации эритроцитов с 1,0 мл среды), T – положительный контроль (ОП540 раствора,
полученного при лизисе эритроцитов под действием 1,0 мл 0,1% додецилсульфат натрия,
обеспечивающего максимальный выход гемоглобина), X – ОП540 анализируемого образца.
Оценка интенсивности биолюминесценции. Интенсивность биолюминесценции
E. coli lux+ измеряли в планктонных и биопленочных культурах, используя
многофункциональный микропланшетный ридер Infinitе M200 (Tecan, Австрия). Удельную
люминесценцию (Iуд) в планктоне оценивали как Iуд=I/ОП600, в пленке Iуд=I/ОП580, где I –
интенсивность биолюминесценции, ОП600 – плотность суспензии при 600 нм, ОП580 –
биомасса пленки.
Экстракция АТФ из клеток в составе биопленок и определение концентрации
внутриклеточного АТФ. Концентрацию АТФ определяли, используя стандартный набор
реактивов ATP Bioluminescent Assay Kit (Sigma) с реагентом, содержащим люциферин и
люциферазу светляков. Измерение люминесценции проводили на микропланшетном ридере
Infinite M200 (Tecan, Австрия). Для определения количества АТФ в образце строили
калибровочный график, используя результаты люминесценции контрольных образцов,
содержащих известную концентрацию АТФ.
Оценка антагонистической активности супернатантов P. aeruginosa. Для
исследования антагонистических свойств штаммов бактерий использовали метод
отсроченного антагонизма согласно Muriana и Klaenhammer (1987) с модификацией (Бухарин,
и др., 2010). Антагонистическую активность штамма выражали как % прироста тест-культуры
(E. coli lux+) при её культивировании 3,5 и 5 ч с экзометаболитами P. aeruginosa, полученными
стерильно.
Оценка апоптоза/некроза нейтрофилов. Жизнеспособность, апоптоз, некроз
нейтрофилов оценивали путем окрашивания аннексином V (набор реагентов «ANNEXIN V
FITC», «Beckman Coulter», Франция) и пропидиум йодидом (PI). Фенотип лейкоцитов
определяли методом проточной цитометрии на цитометре FACSCalibur («Becton Dickinson»,
США). Количество живых нейтрофилов оценивали как AnV-/PI- клетки, с первичным
13
некрозом – AnV-/PI+ клетки, ранним апоптозом – AnV+/PI- клетки (Хайдуков, и др., 2011).
Продукцию внутриклеточных активных форм кислорода (АФК) нейтрофилов оценивали с
использованием 2’,7’-дигидродихлорфлуоресцеин ацетата в течение 90 мин (Loughmana, et al.,
2011).
Микроскопические методы оценки биопленок (атомно-силовая и лазерная
сканирующая конфокальная микроскопия). Изучение биопленок проводили с помощью
комбинированной системы микрокопирования, состоящей из лазерного конфокального
микроскопа Olympus FV1000 (Olympus Corporation, Япония) и атомно-силового микроскопа
Asylum MFP-3D (Asylum Research, США) в лаборатории атомно-силовой и конфокальной
микроскопии на базе Rhodococcus-центра Пермского государственного национального
исследовательского университета. Подсчет клеток и оценку их жизнеспособности выполняли на
основе полученных конфокальных лазерных сканирующих изображений после
предварительного их окрашивания красителем LIVE/DEAD® (Syto9/пропидиум йодид)
BacLightTM Bacterial Viability Kits (Invitrogen, США). Профили поверхности и толщину
биопленок изучали с помощью атомно-силовой микроскопии (АСМ). Сканирование
осуществляли в полуконтактном режиме на воздухе с использованием кремниевого кантилевера
AC240TS с резонансной частотой 50-90 кГц и ×константой жесткости 0,5-4,4 Н/м. Обработку
полученных изображений проводили с помощью программы Igor Pro 6.22A (WaveMetrics, США).
Статистическую обработку полученных данных проводили с использованием
стандартных пакетов компьютерных программ Microsoft Office XP Excel и Statistica 6.0.
РЕЗУЛЬТАТЫ И ИХ ОБСУЖДЕНИЕ
I. Мониторинг Pseudomonas aeruginosa в стационарах различного
профиля взрослой и педиатрической медицинской сети
В г. Перми за 2006-10 гг. (выборочные исследования) было обследовано 584814
госпитализированных пациентов, из клинического материала которых изолировано 504966
бактериальных и грибковых культур, в том числе 7922 (1,6%) P. aeruginosa.
Среднемноголетний
уровень
инфицированности
синегнойной
палочкой
среди
госпитализированных пациентов составил 13,6±1,9 на 1000 обследованных (табл. 2).
Выравнивание динамического ряда показателей инфицированности вывило общую тенденцию
к увеличению со среднегодовым темпом прироста 1,7%. За 5 лет темп прироста данного
показателя составил 6,9%.
Таблица 2
Показатели инфицированности P. aeruginosa разных категорий
госпитализированных пациентов в г. Перми за 2006-10 гг.
Категория
пациентов
Взрослые
ЛПУ Количество Количество Выделено
В том числе Среднемного- Темп прироста,
(n) обследов-х проб (абс.) культур (абс.) P. aeruginosa летний уровень
%
(n)
(абс./%)
инфицирован- Средне- За 5
ности (на 1000) годовой
лет
10
301310
769040
287507
4447/1,6
15,0±3,5
0,2
0,8
Дети
5
169981
358076
146855
2610/1,8
15,8±7,5
3,8
16,4
Новорожденные
Всего/итого
7
113523
295462
70604
865/1,2
7,9±5,8
-7,0
-21,4
22
584814
1422578
504966
7922/1,6
13,6±1,9
1,7
6,9
Распространенность P. aeruginosа в стационарах хирургического профиля. Если в
целом (включая общесоматические отделения) доля синегнойной палочки в спектре
нозокомиальных микробных культур, не превышала 2% (табл. 2), то в хирургических
стационарах взрослой сети (6 ЛПУ, 20 отделений) бактерии P. aeruginosa были выделены в
10,5% случаев гнойно-септических осложнений. В «неОРИТ» группе доля синегнойной
палочки в спектре всех возбудителей составила 6,7%. P. aeruginosa выделяли в большем
14
проценте случаев в отделениях экстренной и торакальной хирургии, в меньшем – в
эндоскопическом и нейрохирургических отделениях. Оценивая роль изучаемых
микроорганизмов в отделениях реанимации, следует отметить, что их доля в ОРИТ
существенно выше – 18,1%. Удельный вес P. aeruginosa различался в ОРИТ разных
стационаров: разброс данных составил от 11,1 до 26,7%. В структуре микроорганизмов,
выделенных из мокроты, доля P. aeruginosa составила 37,2%, в раневом отделяемом – 11,5%, в
моче – 8,3%.
Анализ антибиотикочувствительности изолятов, выделенных за период 2010-12 гг. в
ОРИТ и «неОРИТ» 6-ти хирургических стационаров, выявил сходное распределение штаммов
двух групп по чувствительности к анализируемому спектру антибактериальных препаратов.
Резистентность к ингибитор-защищенным пенициллинам, цефтазидиму, цефепиму,
карбапенемам не превышала 30%. Тем не менее, отмечен более высокий процент
«реанимационных» культур P. aeruginosa, устойчивых к гентамицину/амикацину и
ципрофлоксацину. Несмотря на стандартность схем при лечении синегнойной инфекции,
удельный вес культур, устойчивых к основным «антисинегнойным» антибиотикам, в ОРИТ
разных стационаров иногда существенно различался. Например, доля культур, устойчивых к
цефтазидиму, варьировала от 18,5% до почти 40%.
В исследовании по составу ассоциаций рассмотрены 666 случаев, при которых штаммы
P. aeruginosa были выделены из различного материала хирургических больных взрослой сети
(табл. 3). В целом, оказалось, что в монокультуре P. aeruginosa высевалась только в 30,3%
случаев, при этом из крови – в 71,4%, из мочи – в 51,3%, из раневого отделяемого – в 35,4%.
Из мокроты и бронхо-альвеолярного лаважа (БАЛЖ) как единственный микроорганизм
P. aeruginosa выделялась только в 17,7 и 14,6% соответственно. Почти в 70% случаев
P. aeruginosa инфицировала материал в составе ассоциаций: из них 63,2% –
двухкомпонентные, 25,6% – трехкомпонентные и 11,2% – четырехкомпонентные.
Таблица 3
Распределение по биоматериалу штаммов P. aeruginosa, выделенных в
монокультуре или в составе ассоциаций
Биоматериал
Количество Монокультура
В ассоциации (n/%)
культур (n)
(n/%)
2-х
3-х
4-х
Раневое отделяемое
Мокрота
БАЛЖ
Моча
Кровь
Аспират
Выпот из брюшной полости
Другое
Всего
246
232
41
76
7
39
10
15
666
87/35,4
41/17,7
6/14,6
39/51,3
5/71,4
15/38,5
1/10
8/53,3
202/30,3
106/43,1
109/47,0
21/51,2
29/38,2
1/14,3
17/43,6
7/70,0
3/20,0
293/44,0
39/15,9
52/22,4
11/26,8
4/5,3
1/14,3
7/17,9
2/20,0
3/20,0
119/17,9
14/5,7
30/12,9
3/7,3
4/5,3
0/0
0/0
0/0
1/6,7
52/7,8
Анализ видового состава ассоциаций выявил 152 их варианта. Наиболее
распространенными были ассоциации P. aeruginosa с грамотрицательными бактериями, в
которые чаще других входили Klebsiella pneumoniae (30,4%, n=141), Acinetobacter baumannii
(25,9%, n=120) и Escherichia coli (18,5%, n=86). Важно подчеркнуть, что 2-х компонентные
ассоциации с этими микроорганизмами также были преобладающими с K. pneumoniae 14,6%
(n=68), A. baumannii 11,8% (n=55) и E. coli 8,2% (n=38) случаев. Из грамположительных
бактерий среди ассоциантов достаточно часто обнаруживались стафилококки, в том числе
Staphylococcus aureus в 9,9% (n=46), коагулазоотрицательные виды в 3,7% (n=17). Число
вариантов ассоциаций и их компонентный состав изменялись в зависимости от исследуемого
материала. Количество сочетаний нарастало в ряду: моча (22 варианта) → рана (70) →
мокрота (95). В мокроте P. aeruginosa чаще всего встречалась в ассоциации с A. baumannii
15
(22,5%, n=43) и K. pneumoniae (21,9%, n=42), а в совокупности, в том числе с другими видами,
их доля составила 50% (n=96). В моче доминировали ассоциации P. aeruginosa с E. faecium,
E. coli и C. albicans, в раневом отделяемом – с K. pneumoniae, E. coli и S. aureus.
Полученные данные по частоте встречаемости P. aeruginosa в спектре микрофлоры
инфицированных ожоговых ран показали, что она по-прежнему является этиологически
значимым возбудителем среди данной категории ГСИ. За период 2011-12 гг. у 190 пациентов
из 208 обследованных (91,3%) изолировано 270 бактериальных культур. Доля P. aeruginosa
среди всех выделенных бактерий составила 18,52% (n=50). При поверхностных и глубоких
термических ранах P. aeruginosa встречалась с одинаковой частотой. Микробную
колонизацию ран бактериями P. aeruginosa регистрировали на 9±3,5 (I-II-IIIА степень) и
18,4±9,2 (IIIБ-IV степень) день. В монокультуре P. aeruginosa изолировали в 30 (60%) случаях
(7 – I-II-IIIА, 23 – IIIБ-IV), при этом не выявлено достоверных отличий по частоте
встречаемости этого вида в моно- или смешанной культуре при поверхностных и глубоких
ожогах. Ассоциации были 2-х и 3-х компонентными, преобладающее их большинство
зафиксировано с другим неферментирующим микроорганизмом A. baumannii. При контроле
инфицированности в последующих посевах P. aeruginosa выделяли в 13 случаях, из них 8 – во
втором, 4 – в третьем, и однократно – в четвертом. При этом только в двух пробах
синегнойную палочку не изолировали в первичном посеве.
Особенности циркуляции P. aeruginosa в акушерских стационарах. За
анализируемый 5-летний период (2006-10 гг.) изолировано 70 604 культуры УПМ. Доля
P. aeruginosа в спектре всех изолированных культур составила 1,23±0,04% (табл. 1).
Встречаемость P. aeruginosa при исследовании различных материалов/биотопов существенно
различалась: ее практически не высевали из смывов со слизистой оболочка полости рта (зева)
и носа, поверхности кожи, конъюнктивы (рис. 2).
1 – смыв со слизистой
оболочки полости рта
(зева) и носа
2 – смыв с поверхности
кожи и заушной складки
3 – мазок с конъюнктивы
4 – меконий
5 – отделяемое пупочной
ранки
6 – мокрота
7 – моча
8 – кровь
9 – ликвор
Рисунок 2. Доля культур P. aeruginosa (%) в спектре всех микроорганизмов,
изолированных из различного биоматериала.
Определенную настороженность вызывает высокая доля P. aeruginosa в спектре
микробных культур из мекония новорожденных. Хотя Borderon и соавт. (1990) не выявили
связи ГСИ с колонизацией этими микроорганизмами гастроинтестинального тракта
новорожденных, исследования последних лет с использованием молекулярных методов
анализа позволили установить такую связь для других видов бактерий. В случае ГСИ,
P. aeruginosa наиболее часто изолировали из мокроты, которая сохраняет свою приоритетную
значимость в контексте выделения этих бактерий. Удельный вес этих бактерий в ликворе
составил более 6%. При этом частота встречаемости P. aeruginosa в биопробах,
характеризующих раневые инфекции, инфекции мочевыделительной системы, септические
состояния оказалась значительно ниже.
Сравнение микробного пейзажа в парах «кожа»-«пупочная ранка» и «зев»-«мокрота»,
когда материал отбирали у здоровых младенцев (колонизация) и в случае забора материала
16
при подозрении на ГСИ (воспалительный процесс), выявило следующие особенности. Роль
P. aeruginosa не значима при воспалении пупочной ранки, хотя ее доля увеличивалась в три
раза (0,6±0,1 против 0,2±0,1), в то же время данные микроорганизмы изолировали почти в
пять раз чаще при ГСИ дыхательных путей, чем в зеве при носительстве (10,9±2,7 против
2,4±0,4).
Анализ антибиотикочувствительности штаммов, выделенных от новорожденных в
период 2006-10 гг. (без учета вспышки), выявил, что доля изолятов, устойчивых к
антибактериальным препаратам различных фармакологических групп, не превышала 20%, за
исключением цефоперазона (рис. 3-А). Изучение профиля антибиотикорезистентности во
время вспышки показало, что более 50% штаммов проявляли устойчивость к цефепиму, около
20% – к цефтазидиму (рис. 3-Б).
А
Б
В
Рисунок 3. Распределение штаммов P. aeruginosa, выделенных от новорожденных:
А – в 2006-10 гг.; Б – в период вспышки (май-август 2008 г.); В – в 2011-12 гг.
Наиболее активным в отношении данной группы штаммов оказался ципрофлоксацин, к
которому были чувствительны более 95% штаммов. Сравнение антибиотикограмм культур
P. aeruginosa, выделенных от новорожденных и с объектов госпитальной среды, выявило, что
80,7% штаммов имели сходные профили резистентности. По-видимому, ситуация
осложнилась формированием и распространением госпитального штамма P. aeruginosа, что и
нашло отражение в общей структуре антибиотикочувствительности культур в данный период.
В 2011-12 гг. устойчивость культур к антибиотикам в акушерских стационарах оставалась на
традиционно низком уровне (рис. 3-В). Такая благоприятная ситуация в учреждениях
родовспоможения
свидетельствует
о
стабильности
процессов,
обеспечивающих
биологическую безопасность медицинских услуг, что, как правило, предотвращает
возможность формирования и распространения госпитальных штаммов P. aeruginosa среди
новорожденных.
Таким образом, полученные нами результаты по целому ряду позиций совпадают с
общемировыми и российскими наблюдениями, характеризующими распространенность
P. aeruginosa в стационарах различного профиля. Вместе с тем показано, что
инфицированность синегнойной палочкой и ее доля в спектре микроорганизмов в различных
материалах зависит от профилизации стационара и возрастной категории пациентов.
Вследствие этого в отделениях ЛПУ, в том числе ОРИТ, формируется специфическая среда,
определяющая степень значимости эндогенного и экзогенного инфицирования, что связано, в
первую очередь, с особенностями контингента больных, набором лекарственных средств и
методов лечебного пособия.
II. Молекулярные методы в идентификации/детекции, типировании и
оценке клинической значимости нозокомиальных штаммов P. aeruginosa
Сравнительный анализ применения культурального и молекулярногенетического методов для определения видовой принадлежности P. aeruginosa. В работе
использовали 159 штаммов P. aeruginosa, выделенных в 2008-11 гг. от больных и из
больничной среды крупных хирургических стационаров. Первичная идентификация
проведена в бактериологических лабораториях ЛПУ. Реидентификация с использованием
17
«НефермТеста24» выявила, что 17 штаммов не являлись P. aeruginosa и по его результатам
были отнесены к видам Pseudomonas putida, Ochromobacter anthropi, Burkholderia
pseudomallei. В результате генетической идентификации с помощью родо- и
видоспецифичных праймеров (Ps-for/Ps-rev – 16S рРНКPs, PA-SS-F/PA-SS-R – 16S рРНКPA)
было установлено, что 145 (91,2%) штаммов соответствуют виду P. aeruginosa,
определенному в первичных бактериологических лабораториях, четырнадцать культур не
принадлежали к данному виду, из них одиннадцать (6,9%) – были псевдомонадами, и три
(1,9%) – не принадлежали к роду Pseudomonas. ДНК штаммов (n=14), с матрицы которых не
прошла специфическая амплификация с видоспецифичными праймерами, была использована
в ПЦР с универсальными праймерами к гену 16S рРНК (515F/1391R). BLAST-анализ
полученных нуклеотидных последовательностей подтвердил, что 11 штаммов являются
представителями рода Pseudomonas (рРНК группа I). На филогенетическом древе изоляты
попали в разные подгруппы псевдомонад: 6 штаммов имели максимальный уровень сходства с
P. aeruginosa, два штамма принадлежали к этой же «P. aeruginosa group» и определены как
Pseudomonas pseudoalcaligenes / Pseudomonas nitroreducens. У трех изолятов исследуемые
участки
ДНК
были
максимально
схожи
с
геном
16S рРНК
штамма
Pseudomonas plecoglossicida
FPC951.
Один
изолят
принадлежал
к
виду
Stenotrophomonas maltophilia (рРНК группа V), у двух штаммов анализируемые нуклеотидные
фрагменты имели максимальное сходство с геном 16S рРНК штамма Comamonas sp. EB172
LMG 5323 (семейство Comamonodaceae, рРНК группа III). Таким образом, данное
исследование показало высокую достоверность видовой идентификации P. aeruginosa при
использовании культурального метода. Следует также подчеркнуть, что почти все штаммы,
отнесенные по 16S рРНК к другим видам, являются близкородственными, и подобные
лабораторные «ошибки» при использовании бактериологического метода исследования
существенного клинического значения не имеют. Исключение представляет единственный
случай «недодиагностики» инфекции, вызванной S. maltophilia, значимость которых в
качестве возбудителя нозокомиальных инфекций выросла в последнее время.
Диагностическая чувствительность и специфичность бактериологического метода
практически сопоставима с ПЦР и на сегодняшний день остается «золотым стандартом» в
диагностике инфекционных осложнений, вызванных P. aeruginosa. Привлекательность
молекулярно-генетических технологий очевидна в сложных, арбитражных случаях при
верификации морфологически нетипичных штаммов и мониторинге объектов окружающей
среды. При идентификации клинических штаммов P. aeruginosa специфические праймеры для
детекции exoA-гена, кодирующего экзотоксин А, и праймеры к участку гена 16S
рибосомальной РНК имеют практически равное значение. При проведении в ЛПУ контроля
обсемененности наряду с бактериологическим исследованием смывов с оборудования,
инструментария, объектов внешней среды и др. целесообразно дополнительно подвергать
пробы ПЦР-анализу для обнаружения видовых детерминант клинически значимых бактерий.
Генотипирование
нозокомиальных
культур
P. aeruginosa.
Генетическое
типирование штаммов осуществляли посредством ПЦР с праймерами М13 (RAPD-ПЦР),
ERIC1R/ERIC2 и BOXА1R (Rep-ПЦР). На первом этапе исследования проведена оценка ПЦРметодов для генотипирования штаммов P. aeruginosa. В анализ были взяты 17 эпидемически
не связанных клинических изолятов. Наибольшее количество амплифицированных
фрагментов у всей группы было получено в RAPD-ПЦР: на электрофореграммах выявлен 21
фрагмент различной длины (рис. 4, табл. 4). В то же время, максимальное и среднее число
фрагментов для одного штамма было сопоставимо при использовании праймеров М13 и
ERIC2. ДНК-профили исследуемых культур после BOX-амплификации оказались наименее
разнообразными.
Общепризнано, что сравнительный анализ данных RAPD-ПЦР, полученных в разных
лабораториях, затруднителен из-за чувствительности метода к изменениям условий реакции,
тем не менее, он позволяет выявлять индивидуальные особенности каждого отдельно взятого
штамма. Данное предположение подтверждено при вычислении коэффициента
18
дискриминации, который составил 0,993, 0,875 и 0,639 для RAPD-, ERIC- и ВОХ-ПЦР
соответственно. Согласно общепринятой практике, приемлемыми считаются методы
типирования (или их комбинации), имеющие значение индекса Симпсона (D) 0,9 и выше
(Hunter, et al.,1988).
М13
ERIC2
BOXA1R
Рисунок 4. Электрофореграмма продуктов RAPD и Rep-ПЦР: М – маркер
молекулярных масс 100 bp+1,5 Kb; 1-17 – клинические изоляты P. aeruginosa. Дендрограммы
филогенетического родства, построены на основе метода невзвешенного попарного
арифметического среднего UPGMA (Unweighted pair group method) с применением
компьютерного обеспечения Quantity One (версия 4.6.1, Bio-Rad Laboratories, США).
Праймер
М13
ERIC2
BOXA1R
Таблица 4
Количество и размер фрагментов, полученных в RAPD- и Rep-ПЦР
Количество фрагментов, n (всего/максимальное у одного
штамма/среднее у одного штамма)
≈ размер фрагмента, п.н.
21/ 9/ 4,75±2,2
150, 350, 380, 400, 450, 480, 500, 510, 550, 600, 700, 800, 850, 900, 950,
1000, 1100, 1200, 1400, 1500, 1700
13/ 9/ 4,25±1,6
200, 300, 350, 480, 500, 600, 700, 800, 900, 1000, 1100, 1500, 3000
13/ 6/ 3,65±0,9
200, 300, 420, 500, 550, 600, 700, 800, 900, 1100, 1300, 1500, 1600
Примечание: жирным шрифтом выделены фрагменты, встречающиеся в генетическом профиле пяти и более
штаммов.
Полученные результаты дополняют накопленный опыт подобных исследований и
показывают
неравнозначную
информативность
использованных
методик.
При
кратковременных и/или одномоментных исследованиях предпочтительнее применять RAPDПЦР, при длительном мониторинге – ERIC-ПЦР или обе реакции одновременно. Учитывая
перекрестные диапазоны оптимальной температуры отжига, можно использовать единый
протокол амплификации. BOX-ПЦР, ориентированная на внутриродовую дифференцировку
бактерий, при эпидемиологических исследованиях самостоятельного значения не имеет и
может служить лишь дополнительным диагностическим средством.
Основные геномоварианты штаммов P. aeruginosa, циркулирующих в ЛПУ
различного профиля. Для определения родства выделенных изолятов и отбора штаммов для
19
дальнейших исследований проведено их генетическое типирование методом RAPD-ПЦР.
Штаммы P. aeruginosa (n=296), выделенные в 2008-12 гг. из хирургических стационаров
взрослой (8 ЛПУ; n=145) и педиатрической (5 ЛПУ; n=151) сети, включая акушерский
стационар и неонатальные отделения детской клиники (3 ЛПУ; n=129), распределились в 24
геномогруппы, а 52 изолята имели индивидуальные RAPD-профили (рис. 5).
Рисунок 5. Распределение штаммов по трем группам стационаров (ЛПУ 1-13):
римскими цифрами обозначены геномогруппы (инд. – индивидуальные генотипы), арабскими
– количество изолятов, * – изоляты, полученные во время вспышки 2008 г.
Практически в каждом «взрослом» ЛПУ были зафиксированы близкородственные
штаммы, при этом нужно отметить, что чаще их изолировали от больных ОРИТ. В
многопрофильных стационарах обнаружены штаммы, выделенные из разных отделений, но
генотипически сходные. Большая часть изолятов от новорожденных относится к короткому
«вспышечному» периоду времени, при этом схожие геномоварианты штаммов P. aeruginosa
обнаружены в разных ЛПУ, что указывает на возможность циркуляции близкородственных
эковаров в замкнутом контуре «акушерский стационар – неонатальные отделения детской
клиники». В хирургическом педиатрическом стационаре ситуация аналогична таковой во
«взрослой хирургии», тогда как в терапевтических отделениях обеих возрастных групп
обнаружены штаммы только с индивидуальными RAPD-профилями.
Генетическое разнообразие blaOXA-50-like как основа выявления родства изолятов
P. aeruginosa. У ряда штаммов P. аeruginosa, выделенных от больных хирургических
стационаров взрослой сети г. Перми (ГКБ №4, ККБ, ЛКБ, МСЧ №9), г. Березники (БЦГБ) и
г. Чайковский (ЧЦКБ), проведено секвенирование blaOXA-50-ампликонов, полученных с
праймерами A/AS. Сравнение нуклеотидных последовательностей blaOXA-50 выявило, что
штаммы P. aeruginosa, выделенные в разных ЛПУ, имели сходные гены, например blaOXA-50glike (GenBank AM117127.1), и, наоборот, в одном ЛПУ могли циркулировать изоляты с
различными оксациллиназами (табл. 5). Следует отметить, что штаммы, отнесенные к одной
геномогруппе по результатам генотипирования в RAPD-ПЦР, содержали blaOXA-50последовательности с идентичными нуклеотидными заменами. По-видимому, обнаружение
одинаковых оксациллиназ у разных изолятов может служить дополнительным критерием их
родства. Такая возможность основана на двух известных фактах: продукция данных
20
ферментов может считаться видовым признаком P. aeruginosa, но существует большое число
различных OXA-50like бета-лактамаз (Girlich, et al., 2004).
Таблица 5
Анализ нуклеотидной последовательности фрагментов blaOXA-50-like нозокомиальных
изолятов P. aeruginosa
ЛПУ/ штамм
Размер фрагмента, п.н.
Сходство с наиболее близким
Нуклео(расположение на гене гомологичным геном P. aeruginosa из тидные
blaOXA-50, ген 789 п.н.)
GenBank, %
замены
ГКБ
116
641
c 149 по 789
blaOXA-50a
AY306130.1
99
T153C
3-4*
565
c 64 по 628
blaOXA-50g
AM117127.1
100
3-6*
555
c 97 по 651
3-7*
587
c 62 по 648
3-9*
682
c 35 по 716
7-1
660
c 130 по 789
blaOXA-50c
AY306132.1
100
Пр6** 547
c 75 по 621
blaOXA-50-like
AY306135.1
99
C145T
AY306134.1
G500A
HQ8330.038
99
Пр9** 688
c 23 по 710
ККБ
ОРИТ
197
198
203
ЛКБ
60
МСЧ №9 МПр1
ОРИТ
642
729
727
724
712
c 148 по 789
c 61 по 789
c 62 по 788
c 66 по 789
с 22 по 733
blaOXA-50c
blaOXA-50c
AY306132.1
99
100
blaOXA-50c
blaOXA-50a
AY306132.1
AY306130.1
99
98
МПр5
Б4
Ч2
725
777
608
c 6 по 730
С 12 по 789
c 78 по 685
blaOXA-50g
blaOXA-50g
blaOXA-50-like
100
100
99
Ч3
602
c 24 по 625
blapoxB
AM117127.1
AM117127.1
AY306135.1
AY306134.1
AY597444.1poxB
G222T
G67A
T153C
С327Т
А334G
С508А
А642G
G600A
99
C443T
БЦГБ
ЧЦГБ
Примечание: *ОРИТ, **ОССХ – кардиохирургическое отделение.
Молекулярные
механизмы
устойчивости
нозокомиальных
штаммов
P. aeruginosa к бета-лактамным антибиотикам. Исследовано 178 штаммов P. aeruginosa,
выделенных в 2008-09 гг. от больных крупных хирургических, детского и акушерского
стационаров г. Перми. Среди штаммов, обладающих фенотипическими признаками
продукции β-лактамаз класса В, методом ПЦР проведен скрининг на наличие в их геноме
нуклеотидных последовательностей blaVIM-2, blaIMP-2, blaSPM-1, blaGIM-1. Специфичная
амплификация с праймерами VIM-1F/R и VIM-2F/R была обнаружена у 34 (19,1%) штаммов,
изолированных из трех стационаров (ГКБ, ККБ, ЛКБ) (рис. 6-А). Определены нуклеотидные
последовательности фрагментов и полных генов МБЛ группы VIM, амплифицированные с
ДНК штаммов P. aeruginosa 3-16, 127, 2ПЛ, 31, 60, 198, являющихся представителями разных
геномогрупп. Исследуемые фрагменты ДНК размером 615-741 п.н. были на 99-100% сходны с
последовательностью blaVIM-2-гена известных штаммов (рис. 6-Б). Степень сходства с геном
blaVIM-2 референтного штамма P. aeruginosa COL-1 (GenBank AF191564.1) составила 99-100%.
Обнаружены точечные нуклеотидные замены в последовательностях исследуемого гена у 4
штаммов. На основании полученных данных установлены частичные аминокислотные
последовательности (193-246 а.о.) фермента. У штаммов P. aeruginosa 2ПЛ, 31 и 3-16
обнаружена точечная мутация blaVIM-2-гена в позиции 85, несущая замену серина на пролин,
21
которая характерна для генов, кодирующих ферменты подгруппы VIM-1 и VIM-7 (Lauretti, et
al., 1999; Toleman, et al., 2007). Учитывая, что эта область лидерного пептида, который
отщепляется при транслокации белка через мембрану и не содержится в «зрелом» энзиме,
данная замена не влияет на связывание фермента с субстратом – антибиотиком.
А
Б
Рисунок 6.
Электрофореграмма
продуктов
амплификации консервативных последовательностей
и полных генов blaVIM-2 (А), древо сходства
нуклеотидных последовательностей полных генов
металло-бета-лактамаз (группа VIM) бактерий рода
Pseudomonas, построенное методом UPGMA (Б). Жирным
шрифтом выделены штаммы, исследуемые в данной работе. В скобках
указаны номера последовательностей, депонированных в GenBank,
или обозначение штамма.
Таким образом, устойчивость к карбапенемам 34 (19,1%) культур P. aeruginosa,
изолированных из стационаров г. Перми и Пермского края, обусловлена продукцией ими МБЛ
группы VIM, и в частности – фермента VIM-2. Можно предположить, что в ЛПУ взрослой
сети Пермского края циркулируют преимущественно продуценты VIM-2-подобных
ферментов. Полученные результаты согласуются с данными литературы по
распространенности VIM-2-обусловленной карбапенеморезистентности внутрибольничных
штаммов P. aeruginosa в России (Эйдельштейн, и др., 2012).
Специфическая амплификация с праймерами ABD1/ABD4 к ферменту OXA-10 и его
производным была выявлена у 26 изолятов, также выделенных преимущественно в трех ЛПУ
«взрослой» медицинской сети. Определены нуклеотидные последовательности ампликонов, и
выявлено, что все они являются оксациллиназами OXA-14-like, которая характеризуется
БЛРС-фенотипом. Фермент отличается от OXA-10 аминокислотной заменой Gly157Asp (443445 п.н., GGC на GAC). Таким образом, у некоторых исследованных штаммов, фенотипически
устойчивых к одному или ряду бета-лактамных антибиотиков, эта устойчивость была связана,
в том числе, и с продукцией оксациллиназ.
Молекулярный скрининг ДНК штаммов P. aeruginosa, продуцирующих МБЛ, на
наличие интегронов 1 класса выявил данные последовательности во всех изолятах, что вполне
ожидаемо, учитывая интегрон-зависимую локализацию данной группы ферментов. Интегроны
были обнаружены и у ряда штаммов (1-6, 1-8, 1-12, №7, 9-6), продуцирующих оксациллиназы.
У 9-и штаммов (197, 198, 203, Н1, Н2, Н3, Н5, 619, 863) детектированы обе группы ферментов.
Размер основной части ампликонов был ≈1300 п.н., несколько ампликонов были большего
размера ≈1700 п.н. При определении нуклеотидных последовательностей полученных
ампликонов выявлено, что в их составе чаще всего присутствует ген aadA6, кодирующий
аминогликозид(3'')аденилилтрансферазу. Штамм P. aeruginosa 197, выделенный из ККБ, – ген
aac6'-Ib,
экспрессирующий
аминогликозид(6')ацетилтрансферазу.
Продукция
ацетилтрансферазы AAC(6')-I является наиболее частой причиной резистентности к
амикацину у псевдомонад (Решедько, 1999). Учитывая отсутствие blaVIM-2-генов в составе
22
данных последовательностей ампликонов, можно полагать, что большинство изолятов несут
сразу несколько интегронов 1 класса с разным набором генов антибиотикорезистентности.
Генетические профили цитотоксичности штаммов P. aeruginosa. В результате
скрининга внутри- и внебольничных штаммов коллекции (n=194) на присутствие генов,
кодирующих эффекторы TTSS, выявлено, что специфичная амплификация exoS и exoU была
положительной у 109 (56,19%) и 53 (27,32%) культур соответственно, в 32 (16,49%) случаях не
было обнаружено ни exoS, ни exoU. При сравнении двух групп: нозокомиальные изоляты
(n=164) и штаммы, выделенные от больных, обратившихся в поликлинику (n=30), оказалось,
что exoS и exoU присутствовали в геноме первой группы достоверно чаще, но связь была
очень слабая. Выявлено, что распространенность exoS была выше в «неОРИТ» группе
(φ=0,322; p=0,0000), и наоборот, штаммы с генотипом exoS-/exoU+ преобладали среди изолятов
ОРИТ (φ=0,466; p=0,0000) (табл. 6).
Таблица 6
Встречаемость exoS и exoU в геноме клинических изолятов P. aeruginosa
Группы
Ген-мишень, n/%
exoS
exoU
Мокрота/БАЛЖ (n=83)
47/56,63
33/39,76
Рана (n=46)
33/71,74
5/10,87
ОРИТ (n=95)
44/46,32
47/49,47
«неОРИТ» (n=69)
54/78,26
4/5,80
Продуценты МБЛ (n=40)
0/0
38/95
Не продуценты МБЛ (n=124)
98/79,03
13/10,48
Всего (n=164)
98/59,76
51/31,10
В геноме штаммов, изолированных из мокроты, гены exoS и exoU обнаружены в 56,63 и
39,76% случаев соответственно. В то же время в исследованиях Lanotte и соавт. (2004) и Wolska
и Szweda (2009) exoS детектирован более, чем в 80% «легочных» изолятов. Предположительно,
такая разница объясняется тем, что в первом случае авторы исследовали штаммы, полученные
только от пациентов с муковисцидозом, а во втором – маленькой выборкой (n=9). Важно
подчеркнуть, что в нашем исследовании из 83 штаммов из мокроты 65 были выделены от
пациентов ОРИТ, где могут концентрироваться высоковирулентные exoS-/exoU+-эковары. Доля
exoS+-штаммов, изолированных из мокроты «неОРИТ»-пациентов, составила 77,78%. В
изолятах из раневого отделяемого преобладал генотип exoS+/exoU-. Из семи изолятов,
полученных из перитонеальной жидкости, exoS встречался в двух, а exoU – в четырех случаях.
Ген exoS детектировали в пяти штаммах из семи, изолированных из фекалий, exoU в подобных
вариантах не обнаруживали. Однако достоверной связи между присутствием соответствующих
эффекторов и материалом выделения штаммов не выявлено.
Штаммы, не продуцирующие МБЛ, достоверно чаще содержали в геноме exoS (79,03%),
а не exoU (10,48%). В то время как у 38 (95%) продуцентов МБЛ выявлен exoU, у двух штаммов
не обнаружен ни один из исследуемых генов. Возможно, exoU достоверно чаще встречается у
МБЛ-продуцентов (φ=0,784; p=0,0000) в связи с эпидемическим распространением клона
P. aeruginosa ST235 VIM-2, циркуляция которого на всей территории России показана
Эйдельштейном и соавт. (2012). Факт ассоциации exoU с P. aeruginosa ST235 подтвержден
исследованиями последних лет (Maatallah, et al., 2011; Lee, et al., 2013). Обнаружена
статистически значимая умеренная связь между наличием в геноме blaVIM2 и выделением
штамма из ОРИТ (φ=0,369; p=0,0343).
Использование мультилокусной ПЦР-тест системы в оценке клиникоэпидемиологической значимости изолятов P. aeruginosa. Проведена оценка экспрессной
индикации P. aeruginosa на основе мультиплексной ПЦР, позволяющей одновременно
оценивать таксономическую принадлежность, определять наличие маркеров патогенности и
антибиотикоустойчивости. Маркерами для экспрессной индикации P. aeruginosa служили
23
полные нуклеотидные последовательности или фрагменты генов: exoA, exoS, exoU, blaVIM2,
экспрессирующих синтез экзотоксина А, эффекторные белки системы III типа секреции и
МБЛ подгруппы VIM2 соответственно (рис. 7).
Рисунок 7. Примеры
электрофореграмм
продуктов
амплификации
генов
exoA, exoS, exoU, blaVIM2
в
монои
микст
вариантах: М – маркер
молекулярных масс 700 bp
Plus DNA Ladder; М1 – маркер
молекулярных
масс
1
kb+2kb+3kb; 1 – E. coli,
2 – P. aeruginosa exoS-/exoU-;
3,4
–
P. aeruginosa
exoS+/blaVIM2-;
5,6
–
P. aeruginosa
exoU+/blaVIM2-;
7,8
–
P. aeruginosa
exoU+/blaVIM2+.
Предложенные на настоящий момент мультиплексные ПЦР чаще всего решают какуюто одну задачу в отношении P. aeruginosa – ее идентификация (Le Gall, et al., 2013),
определение цитотоксичности и/или вирулентности (Ajayi, et al., 2003; Shi, et al., 2012), а
также наличия детерминант антибиотикорезистентности (Шевченко, и др., 2007; Monteiro, et
al., 2012). Использование мультилокусной ПЦР-тест-системы для выявления целых или
внутренних фрагментов генов, детерминирующих синтез наиболее распространенного типа
МБЛ VIM2, маркера цитотоксичности ExoU с одновременным подтверждением видовой
принадлежности, позволяет получить экспрессную комплексную оценку свойств изолятов
P. aeruginosa в контексте их эпидемиологической и клинической значимости.
III. Характеристика биологических свойств нозокомиальных штаммов
P. aeruginosa
Разнообразие фенотипов клинических штаммов P. aeruginosa. При традиционном
определении факторов патогенности – пиоцианинообразования, гемолитической активности и
продукции фосфолипазы – подавляющее большинство изолятов всех ЛПУ проявляли эти
признаки, а фенотипические паттерны популяций синегнойной палочки достоверно не
различались в разнопрофильных отделениях хирургических стационаров. Учитывая, что
статистически значимой разницы между выделением изолята из ОРИТ и частотой
встречаемости признаков нет, можно предположить, что в большей мере разница в
распространенности штаммов, продуцирующих те или иные факторы патогенности, может
быть связана не со специализацией отделения, а с биотопом выделения изолята.
Качественный сравнительный анализ позволил обнаружить слабую достоверную связь между
продукцией фосфолипазы и «легочным» происхождением изолята.
При определении содержания пиоцианина и пиовердина в супернатантах суточных
культур P. aeruginosa методом спектрофотометрического анализа выявлено, что штаммы
значительно различались по уровню его продукции (более чем в 100 раз), как между двумя
группами (внебольничные/«поликлинические» и нозокомиальные изоляты), так и в пределах
своих групп (рис. 8). У нозокомиальных культур уровень пиоцианинообразования варьировал
от 0,065 до 0,910 ОЕ, медиана (квартили) составили 0,376 (0,195-0,587), тогда как у
внебольничных штаммов – 0,146 (0,033-0,189) (p=0,000001). Для продукции пиовердина
аналогичные показатели составили 4085,3 (2400,5-6280,3) и 393,5 (0-2045,8) усл. ед
соответственно (p=0,000110). Анализ продукции пигментов клиническими штаммами с
24
учетом материала выделения показал, что их уровень в двух группах (изоляты из мокроты и из
раны) статистически значимо не различался (M-W U-тест, p>0,05).
А
Б
Рисунок 8. Уровень продукции пиоцианина (А) и пиовердина (Б) в супернатантах
суточных культур P. aeruginosa, изолированных от пациентов поликлиник и
стационаров.
Комплексная оценка гемолитической активности P. aeruginosa. Учитывая
различные механизмы гемолиза у P. aeruginosa, было изучено влияние экзометаболитов (в
составе супернатантов) и бактериальных клеток на эритроциты. Воздействие нативных
супернатантов 9-и (69,2%) штаммов, включая референтный, давали уровень лизиса
эритроцитов более 50% (табл. 7). Термообработка супернатантов в большинстве случаев
приводила к достоверному снижению уровня гемолитической активности у 11-и штаммов, у 8и из них степень снижения составила 80% и более.
Таблица 7
Показатели гемолитической, фосфолипазной активности и продукции
пиоцианина штаммами P. aeruginosa
2
Штамм
КА
ГА, % лизиса эритроцитов после
Активность
Содержание
экспозиции в течение 1 ч, 37 ºC фосфолипазы, пиоцианина,
P. aeruginosa
k3
ОП695
супернатанты
супернатанты
нативные
после
термообработки
АТСС27853
1,8±0,4
58,07±13,40
8,91±2,52*
1,2±0,4
0,193±0,010
801
1,4±0,3
68,60±18,91
32,77±12,43*
1,1±0,3
0,226±0,024
5
1,5±0,4
56,56±23,12
2,15±1,5*
1,0±0,3
0,281±0,010
3-7
2,5±0,5
32,01±8,34
10,68±4,55*
1,2±0,4
0,294±0,020
24591
1,5±0,2
51,11±15,67
8,89±3,17*
1,0±0,2
0,253±0,005
63
2,4±0,3
22,51±7,32
0,46±0,24*
1,0±0,1
0,154±0,004
БАЛЖ1
2,8±0,3
91,90±23,34
72,87±13,23
1,7±0,4
0,245±0,016
1
Мокрота
3,0±0,5
58,88±13,45
31,15±12,65*
1,8±0,3
0,233±0,071
9-3
1,1±0,2
72,69±34,30
79,56±32,87
1,7±0,3
0,187±0,012
Дренаж1
2,1±0,3
68,88±12,35
1,18±0,62*
1,4±0,2
0,229±0,007
29а
1,0±0,2
28,87±6,35
0,73±0,34*
1,2±0.3
0,125±0,010
ИТТ1
1,8±0,4
67,30±14,65
8,92±3,76*
1,2±0,3
0,291±0,012
565
1,2±0,2
41,39±12,02
4,53±2,69*
1,0±0,2
0,202±0,070
Примечание: 1 – штаммы изолированы из мокроты или аспирата; 2 – коэффициент, определяемый как отношение
диаметра (в мм) зоны гемолиза к диаметру колонии на кровяном агаре, усл. ед; 3 – коэффициент, определяемый
как отношение диаметра зоны «радужного венчика» к диаметру колонии; * – различия статистически значимы
при сравнении с нативными супернатантами (p≤0,05).
Данный эффект связан с инактивацией фермента фосфолипазы. «Остаточный» гемолиз
мог свидетельствовать о работе рамнолипида, а возможно, и других экзометаболитов в составе
25
супернатантов. При использовании нативных супернатантов анализируемых культур
обнаружена умеренная положительная связь между проявлением фосфолипазной и
гемолитической активностей (R=0,634; p=0,019), которая ослабевала при воздействии
супернатантов после термообработки (R=0,569; p=0,042). Сравнение результатов, полученных
при высеве культур на кровяной агар и при 1- и 3-х часовой экспозиции их метаболитов и
взвеси эритроцитов, выявило умеренную положительную корреляцию зарегистрированных
при этом показателей при более длительной выдержке, но связь была недостоверной (R=0,488;
p=0,090). Слабая связь между показателями «терморезистентного» гемолиза и количеством
пигмента пиоцианина в супернатантах также была недостоверной (R=0,280; p=0,353).
При экспозиции с эритроцитами клеток большинства штаммов P. aeruginosa (37ºC)
выявлена их невысокая цитотоксическая активность: уровень гемолиза за счет контактзависимых гемолизинов не превышал 35% (табл. 8). Центрифугирование, способствующее
более тесному контакту между клетками, достоверно увеличивало процент лизиса
эритроцитов, который возрастал более чем в 2,5 раза.
Таблица 8
Показатели клеточно-ассоциированного гемолиза и адгезивной способности
клеток нозокомиальных штаммов P. aeruginosa
Штамм
% лизиса эритроцитов
ИАМ
при 37ºС
P. aeruginosa
без центрифугирования
после центрифугирования
АТСС27853
10,53±2,17
67,60±7,48*
4,45±1,51
801
12,72±3,78
74,81±23,24*
4,65±1,21
5
21,60±5,23
66,34±21,23*
8,52±1,41
3-7
25,31±4,08
72,62±19,98*
8,28±1,40
2459
20,04±3,16
54,07±18,51*
8,17±2,43
63
32,34±7,34
93,65±25,92*
8,09±1,92
БАЛЖ
23,62±2,72
68,99±17,39*
10,67±2,15
Мокрота
13,67±3,74
68,03±14,28*
4,29±1,49
9-3
11,18±1,95
97,02±26,08*
8,82±2,40
Дренаж
6,25±1,23
46,02±6,51*
5,7±1,86
29а
5,74±2,03
46,62±7,72*
3,83±1,47
ИТТ
13,48±4,20
62,22±12,54*
3,77±2,16
565
22,66±5,04
74,80±26,07*
5,67±1,56
Примечание: * – различия статистически значимы при сравнении с данными без центрифугирования (p≤0,05).
Гемолитическая активность при 25ºC, как правило, была ниже, чем при 37ºC (рис. 9).
Уровень гемолиза без центрифугирования и после него изменялся сходным образом.
Учитывая, что клеточно-ассоциированный гемолиз в естественных условиях возможен только
при непосредственном бактериально-клеточном контакте и в значительной степени зависит от
специфической адгезии штаммов P. aeruginosa, были проанализированы показатели ИАМ.
Индекс у большей части штаммов оказался выше 4,0, на основании чего культуры отнесены к
средне- и высокоадгезивным вариантам (данные при 37ºC). Заслуживает внимания тот факт,
что между значениями ИАМ (при 37ºC) и клеточно-опосредованного гемолиза без
центрифугирования установлена умеренная положительная связь (R=0,489; p=0,089), которая
ослабевает после центрифугирования (R=0,363; p=0,223). Очевидно, что данный тип гемолиза
без участия дополнительных факторов, способствующих контакту между эритроцитами и
прокариотическими клетками, зависит от адгезивных свойств штаммов.
Известно, что способность эффективно прикрепляться к поверхности эукариотических
клеток опосредована у P. aeruginosa пилями IV типа и флагеллами, функционирование
которых оптимально при 37ºC (O'Toole, Kolter, 1998). При сравнении адгезивных свойств при
37ºC и 25ºC не выявлено достоверного снижения ИАМ для изучаемой части штаммов (рис. 9),
однако при расширении выборки штаммов при температуре 37ºC средний показатель составил
8,04±0,39, при 25ºC – 6,87±0,41, и различая в группах были статистически значимыми
26
(р=0,0018). По-видимому, более низкие показатели клеточно-опосредованной гемолитической
активности в температурном режиме 25ºC определяются адгезивными свойствами культуры,
но в большей степени – функционированием эффекторов TTSS, активность которых выше при
температурах, оптимальных для роста культуры.
Рисунок 9. Показатели
клеточноассоциированного
гемолиза и ИАМ при
разных температурных
режимах ряда штаммов
P. aeruginosa. * – различия
статистически значимы при
сравнении с данными при 37ºC
(p≤0,05).
Связь между зоной просветления на агаре и показателями клеточно-ассоциированного
гемолиза была недостоверной (R=0,473, p=0,102 – без центрифугирования) или отсутствовала
(R= -0,005, p=0,986 – с центрифугированием). Корреляции между показателями клеточноопосредованной и секретируемой гемолитической активности также не выявлено (R= -0,319,
p=0,288 – без центрифугирования; R=0,033, p=0,915 – с центрифугированием).
Молекулярно-генетический анализ на наличие эффекторных белков III типа секреции
ExoS и ExoU выявил, что exoS-гены присутствовали в геноме 10-и штаммов P. aeruginosa
(АТСС 27853 – положительный контроль, 801, 5, 3-7, 2459, БАЛЖ, мокрота, 9-3, 29а, ИТТ),
exoU последовательность – только у P. aeruginosa 63 и 565. Высокий уровень клеточноопосредованного гемолиза обнаружен как у штаммов exoU+, так и у не несущих данный ген.
Считается, что ExoU и ExoS имеют тенденцию быть взаимоисключающими, а их наличие, в
совокупности с двумя другими эффекторными белками, определяет характер
взаимоотношений P. aeruginosa с эукариотическими клетками: инвазивный или
цитотоксический (Fleiszig, et al., 1997; Lin, et al., 2006). Dacheux и соавт. (2001) показали, что
гибель нейтрофилов и макрофагов, а также лизис эритроцитов опосредованы эффекторами
TTSS-системы и PcrV, PopB/PopD протеинами P. aeruginosa, но могут быть независимы от
ExoU. По-видимому, последний является важным, но не единственным фактором,
обеспечивающим клеточно-ассоциированную цитотоксичность у псевдомонад.
Таким образом, показана фенотипическая гетерогенность штаммов P. aeruginosa по
проявлению ими гемолитической активности, а степень выраженности, набор и соотношение
факторов, ее обусловливающих, является штаммовой характеристикой. В этой связи
предлагается ввести термин «гемолитический профиль» для ранжирования культур в
зависимости от участия различных гемолитических субстанций в проявлении этого свойства
клиническими изолятами P. aeruginosa: I тип – высокий уровень (более 50%) клеточноассоциированного и «супернатантного» гемолиза; II тип – высокий уровень клеточноассоциированного и низкий уровень (менее 50%) «супернатантного» гемолиза; III тип –
низкий уровень клеточно-ассоциированного и высокий уровень «супернатантного» гемолиза;
IV тип – низкий уровень клеточно-ассоциированного и «супернатантного» гемолиза. Повидимому, первый тип «гемолитического профиля» маркирует высоковирулентные штаммы,
встречающиеся в наиболее тяжелых случаях синегнойной инфекции, последний – изоляты при
транзиторном носительстве. Два других занимают промежуточное положение, обусловливая,
как правило, хроническое (II тип) или острое (III тип) течение инфекции.
Особенности
формирования
биопленок
нозокомиальными
штаммами
P. aeruginosa. Показатель гидрофобности клеточной поверхности (Г) свежевыделенных
штаммов P. aeruginosa (n=63) не превышал 30%, медиана составила 6,61%, а 75% (третья
квартиль) значений укладывались в диапазон 0-16,24% (рис. 10-А). После длительного
27
хранения (10 месяцев) клетки псевдомонад становились более гидрофобными (р=0,0091):
данный показатель варьировал от 0 до 81%, Ме (Q1-Q3) составили 25,11 (10,37-57,45)%. Для
всей выборки штаммов средний показатель адгезии (А) клеток к гидрофобной поверхности
составил 38,99 (22,37-57,22)%, а к гидрофильной – 17,03 (3,58-26,31)% (рис. 10-Б). После
длительного хранения оба показателя снижались и составили 28,57 (20,37-38,20)% и 0,00
(0,00-12,57)% соответственно, при этом для большей части штаммов это снижение было
статистически значимым. Достоверность отличий в группах, различающихся по срокам,
показана для значений адгезии как к гидрофильной (р=0,0089), так и к гидрофобной
(р=0,0031) поверхности.
А
Б
Рисунок 10. Диапазон показателя гидрофобности клеток свежевыделенных (Г_%) и
длительно хранившихся (Г_%_Х) штаммов P. aeruginosa (А) и показателя их адгезии к
гидрофобной (А_ГФОБ) и гидрофильной (А_ГФИЛ) поверхностям (Б).
Анализ биопленкообразующей способности штаммов P. aeruginosa (n=243) в лунках
полистиролового планшета показал, что степень проявления данного признака варьировала в
широких пределах: от 0,038 до 3,920 ед. ОП580, Ме (Q1-Q3) составили 0,342 (0,143-1,150) (рис.
11-А). После 1 пассажа и последующего длительного хранения культур (n=29) средний
показатель пленкообразующей способности снизился с 0,641 (0,392-0,832) до 0,264 (0,2000,556) ед. ОП580 (р=0,0064).
А
Б
Рисунок 11. Диапазон показателя биопленкообразующей способности штаммов
P. aeruginosa: А – всей коллекции (ПО_ВСЕ), свежевыделенных (ПО_1ПАСС) и после
длительного хранения (ПО_Х); Б – при разных температурных режимах свежевыделенных
штаммов.
В эксперименте по влиянию температурного режима на степень биопленкообразования
(n=40) выявлено статистически значимое увеличение данного показателя при 20°С (р=0,0003).
28
Определяющими факторами при этом может быть как синтез альгината, который
интенсифицируется при 20-25°С, что существенно ниже температурного оптимума роста
P. аeruginosa, так и увеличение показателя гидрофобности клеточной поверхности штаммов
P. aeruginosa (Leitao, et al., 1992; Zeraik, et al., 2012). Для проверки «альгинатной» гипотезы
увеличения биомассы биопленки проведен сравнительный анализ ее толщины и количества
бактериальных клеток в биопленках, полученных при разных температурных режимах с
помощью методов лазерной сканирующей конфокальной и атомно-силовой микроскопии
(табл. 9, рис. 12).
Таблица 9
Толщина и количество клеток в биопленках, образованных штаммами
P. аeruginosa АТСС 27853, БАЛЖ и 9-3
Штамм Т,°С
Толщина биопленки
Количество клеток на единицу площади2
АТСС
БАЛЖ
9-3
ОП580
мкм 1
37
0,378±0,051
22
4,04±1,2
Жизнеспособные
37,4±16,2
Нежизнеспособные
0
Всего
37,4±16,2
0,663±0,083*
3,73±0,6
22,6±4,5
17,6±2,3*
40,2±3,5
37
1,842±0,105
3,70±0,5
81,2±10,8
3,4±1,1
84,6±11,5
22
2,887±0,205*
9,39±1,7*
без счета*
37,4±4,3*
без счета*
37
0,981±0,023
3,81±0,6
0,8±0,8
35,4±6,9
36,2±7,7
22
0,903±0,116
4,32±0,9
1,2±0,8
2,2±1,1*
3,4±0,7*
1
Примечание: – определяли путем послойного сканирования слоев биопленки, предварительно окрашенной с
помощью флюоресцирующей метки Live/Deаd®, 2 – подсчитывали не менее, чем в пяти полях, после нанесения
сетки на образец, * – различия статистически значимы при сравнении с данными при температуре 37°С (р≤0,05).
Толщина биопленки, определенная методом послойного сканирования (3,70±0,5 против
9,39±1,7 мкм), и путем построения профиля поверхности на основе АСМ-изображения (8,42
против 14,65 мкм) была достоверно выше при 22°С только для клинического штамма
P. аeruginosa БАЛЖ, обладающего высокой пленкообразующей способностью (табл. 9,
рис. 12-Б). Подсчет клеток в срединном слое биопленки показал, что, по сравнению с другими
штаммами, их число было выше при 37°С, и достоверно увеличивалось при 22°С. При этом в
биопленках, образованных при разных температурах, выявлено значительное число
жизнеспособных клеток. Толщина биопленки референтного штамма P. aeruginosa АТСС
27853, полученная путем сканирования слоев клеток, не отличалась при разных температурах,
тогда как АСМ-изображение выявило ее увеличение со 164,71 нм до 11,67 мкм (рис. 12-А),
что совпадает с данными рутинного метода (с помощью экстракции 0,1% генцианвиолета).
Подсчет клеток в срединном слое биопленки показал, что массивность «клеточной»
составляющей биопленки при разных температурных режимах достоверно не изменялась,
тогда как доля живых и поврежденных клеток, наоборот, существенно различалась. Показано,
что в 20-часовой биопленке, образованной референтным штаммом, при 22°С почти половину
клеток составляли нежизнеспособные, тогда как при 37°С их не было вообще. Для штамма
P. aeruginosa 9-3 толщина биопленки, полученная всеми способами (сканирование слоев,
АСМ-профиль, экстракция генцианвиолета), либо не изменялась, либо снижалась при 22°С.
Необходимо подчеркнуть, что клетки с поврежденной мембраной присутствовали в большом
количестве в биопленке, образованной при разных температурах, но со значительным
снижением общего числа клеток при 22°С.
По-видимому, увеличение биомассы биопленки при более низкой температуре роста,
выявленное методом окраски генцианвиолетом, для некоторой части штаммов действительно
связно с продукцией полисахаридного матрикса (например, P. aeruginosa АТСС), при этом
другие изоляты (например, P. aeruginosa БАЛЖ) увеличивают биопленку в большей степени
за счет клеточного компонента. Можно предположить, что штаммы P. aeruginosa могут иметь
29
разные предоминантные формы существования: «планктонную» и «биопленочную». В
последнем случае вне макроорганизма, когда отсутствует необходимость в синтезе факторов
вирулентности, смена условий, включая изменения температурного режима, позволяет
бактериям сохранять свой патогенный потенциал в состоянии малоактивной биопленочной
формы.
Рисунок 12. Профили поверхности биопленок штаммов P. aeruginosa АТСС 27853
(А), БАЛЖ (Б) и 9-3 (В), сделанные на основе АСМ-изображения: протяженность (Xa) и
высота (Ya) биопленки. На вставке вверху – пример проекции (красная линия) профиля.
Другим механизмом, обеспечивающим интенсификацию биопленкообразования при
более низких температурах, может быть увеличение гидрофобности клеточной стенки.
Показано, что гидрофобность штаммов P. aeruginosa была выше при выращивании культур
при 22°С, чем при 37°С (Wolska, et al., 2002). Представлялось важным оценить, определяет ли
показатель гидрофобности клеточной поверхности P. aeruginosa адсорбционную
иммобилизацию
микроорганизмов,
и
есть
ли
связь
между
показателями
неспецифического/специфического
взаимодействия
и
конечным
результатом
–
эффективностью формирования биопленок разными штаммами. Как гидрофильные по BATHтесту штаммы P. aeruginosa (в фазу гексадекана экстрагировалось не более 5-8% клеток), так и
более гидрофобные псевдомонады (экстрагировалось до 30%) проявляли высокую
пленкообразующую способность, т.е. in vitro не было обнаружено четкого взаимного
соответствия между гидрофильно-гидрофобными свойствами клеточной стенки бактерий и
степенью пленкообразования. Более того, практически все клинические штаммы с Мморфотипом колоний и низким коэффициентом гидрофобности были отнесены к
30
пленкообразующим. Корреляционный анализ показал слабую связь между показателями
гидрофобности клеточной поверхности и биопленкообразованием штаммов (R=0,269,
p=0,062). Связь между показателями, характеризующими неспецифическую адгезию к
гидрофобной и гидрофильной поверхности, оказалась недостоверной. Заслуживает внимания
выявленная умеренная положительная связь между показателем адгезии к гидрофобной
поверхности и биомассой биопленки у штаммов с Г≥10% (n=20) (R=0,533, p=0,015).
Определение концентрации внутриклеточного АТФ в биопленках, образованных
P. aeruginosa. Метод АТФ-метрии успешно используют для анализа численности и
биологической активности бактерий в планктонной культуре и биопленках (Takenaka, 1994;
Ефременко, 2010; Sánchez, et al., 2013). Мониторинг концентрации внутриклеточного АТФ в
клетках биопленок, образованных различными штаммами P. aeruginosa, показал, что в разные
фазы роста биопленки клетки характеризовались определенным энергетическим статусом
(рис. 13).
*
*
*
1
Рисунок 13. Биомасса, число КОЕ и внутриклеточная концентрация АТФ биопленок,
образованных штаммами P. aeruginosa, в разные сроки экспозиции.
1
– число КОЕ×105/лунку; * – достоверные отличая между сроками (р≤0,05).
Корреляционный анализ показателей биомассы биопленки, числа КОЕ и количества
АТФ в разные сроки (в ряду штаммов P. aeruginosa АТСС, БАЛЖ, 9-3) выявил умеренную
положительную связь между биомассой биопленки и [АТФ] или количеством КОЕ на 6 ч
(r=0,353 и r=0,403; p=0,05 соответственно), которая усиливалась к 12 часам (r=0,706 и r=0,797).
Как и следовало ожидать, зависимость между АТФ/КОЕ (на 12 часов) была линейной
(r=0,990), что свидетельствовало об увеличении биомассы биопленки за счет жизнеспособных
клеток на этом этапе ее формирования. Для изолята P. aeruginosa БАЛЖ (в ряду данных на
6/12/24 часа) показана сильная корреляция между биомассой биопленки, числом КОЕ и
количеством АТФ: биомасса/АТФ (r=0,948), биомасса/КОЕ (r=0,916), АТФ/КОЕ (r=0,742).
Биопленка представлена в основном «клеточным компонентом», и большинство клеток в ее
составе сохраняли жизнеспособность. Для штаммов P. aeruginosa АТСС и 9-3 зафиксировано
снижение количества АТФ в биопленке уже к 12 часам, при этом число КОЕ нарастало вместе
с биомассой биопленки, в связи с чем для этих культур можно предполагать значительное
снижение метаболической активности клеток без их гибели. К 24 часам большая часть клеток
становилась нежизнеспособной, и связи между [АТФ] и числом КОЕ в динамике (6/12/24 часа)
31
не выявлено (r=0,027 и r=0,151 соответственно). Оценка энергетического статуса клеток в
биопленке для трех штаммов P. aeruginosa еще раз подтвердила гипотезу о преимущественной
«планктонной» или «биопленочной» форме существования для популяций данного вида
бактерий.
Оценка потенциальной патогенности клинических штаммов P. aeruginosa
биолюминесцентным методом. Для оценки потенциальной патогенности P. aeruginosa был
апробирован способ, основанный на изменении биолюминесценции тест-штамма под
влиянием супернатантов ростовой культуры синегнойной палочки. Поскольку подавление
люминесценции E. coli lux+ рассматривалось как средство оценки потенциальной
патогенности P. aeruginosa, для анализа ингибирующего эффекта был предложен индекс
потенциальной патогенности (ИПП), вычисляемый по формуле ИПП=(Ik-Io)/Ik×100%, где Ik –
интенсивность люминесценции контрольной пробы (E. coli lux+ + LB), Io – интенсивность
биолюминесценции опытной пробы (E. coli lux+ + экзометаболиты). На основе сравнительного
анализа ряда клинических и референтного штаммов P. aeruginosa по уровню влияния их
экзометаболитов на свечение E. coli lux+, изолированные культуры были распределены
согласно ИПП по группам: I группа ИПП<30% – штаммы с низкой степенью, II группа
30%≤ИПП≤70% – с умеренной степенью, III группа ИПП>70% – с высокой степенью
ингибирования люминесценции.
Сопоставление клинических изолятов P. aeruginosa с учетом принадлежности к группе
по проявлению ими традиционно учитываемых в практике факторов патогенности показало,
что ИПП умеренно коррелирует с уровнем продукции пиоцианина во II группе (r=0,398;
р≤0,05) и в значительно большей степени – в III группе (r=0,612), а наиболее сильная
положительная связь между этими показателями отмечена для всей совокупности изолятов
(r=0,808). Умеренная и сильная (для III группы) положительная связь выявлена между ИПП и
продукцией пиовердина. Кроме того, показана положительная корреляция ИПП штаммов III
группы с уровнем гемолитической активности (r=0,480) и пленкообразующей способностью
(r=0,868). При оценке антагонистической активности выявлена сильная отрицательная связь
между показателями, характеризующими степень прироста количества КОЕ E. coli lux+ и
степень ингибирования биолюминесценции при учете воздействия метаболитов всех штаммов
(r= -0,806).
Предполагая, что показатель ИПП, определенный в контексте антагонистической
активности между микроорганизмами, может свидетельствовать о силе действия
экзометаболитов и на клетки млекопитающих/макроорганизма, проведено исследование по
влиянию супернатантов суточных культур P. aeruginosa на жизнеспособность и
интенсивность апоптоза/некроза нейтрофилов. Установлено, что при их воздействии в течение
60 мин доля жизнеспособных клеток (AnV-/PI-) существенно варьировала – от 39,40 до
90,81%. Интенсивность апоптоза нейтрофилов (число клеток, находящихся в ранней и поздней
стадии апоптоза в %) статистически значимо увеличивалась при их экспозиции с большей
частью бактериальных супернатантов (рис. 14). При этом обнаружена умеренная
отрицательная корреляция между показателями ИПП и количеством жизнеспособных
нейтрофилов (r= -0,536), что может быть связано с действием пиоцианина в составе
супернатантов. Действительно, между уровнем пиоцианина и количеством жизнеспособных
клеток выявлена еще более сильная отрицательная связь (r= -0,724), а также умеренная
положительная связь между пигментом и количеством нейтрофилов в стадии «раннего»
апоптоза (r=0,649), которая несколько ослабевала в стадии «позднего» апоптоза (r=0,456).
Необходимо отметить, что доля клеток AnV-/PI+ (входят нейтрофилы, поврежденные
посредством прямого цитолитического действия) превышала контроль: значения варьировали
от 3,54 до 35,22%. Но связь в паре ИПП/«неапоптотический» некроз не обнаружена.
32
Рисунок 14. Показатели
интенсивности
апоптоза нейтрофилов,
количества
пиоцианина
в
супернатантах и ИПП
клинических штаммов
P. aeruginosa:
1
–
контроль (LB-бульон), 27
–
клинические
штаммы. * – различая
достоверны по сравнению с
контролем (р≤0,05).
IV. Характеристика симбиотических/антагонистических взаимоотношений
P. aeruginosа и клинически значимых УПМ в планктоне и биопленке
(in vitro)
Влияние экзопродуктов УПМ на биопленкообразующую способность P. aeruginosa
и наоборот. В экспериментах по влиянию экзометаболитов бактериальных культур,
принадлежащих к различным таксонам, на формирование биопленок P. aeruginosa показано,
что в большинстве случаев интенсивность биопленкообразования не зависела от их
присутствия. При анализе данных по влиянию супернатантов клинически значимых УПМ на
сформированные 24-часовые пленки P. aeruginosa, показано, что 2-х-часовое воздействие не
приводило к достоверному снижению биомассы пленки. Зафиксированное в ряде случаев
увеличение связано в основном с пассивной адгезией к поверхности биопленки различных
белковых комплексов, способствующих удержанию красителя.
Воздействие экзометаболитов P. aeruginosa на биопленкообразование ряда УПМ,
наоборот, в большом проценте случаев снижало пленкообразующую способность
представителей как грамположительных, так и грамотрицательных таксонов. Рост и
биопленкообразование S. aureus АТСС 6538 подавляли супернатанты трех исследованных
штаммов P. aeruginosa. Учитывая, что синегнойная палочка в дополнение к 2-гептил-3гидрокси-4-хинолону,
являющимся
медиатором
PQS,
продуцирует
более
55
хинолон/хинолиновых производных, обладающих антибиотической активностью против
грамположительных бактерий (Pesci, et al., 1999; Deziel, et al., 2004), такие результаты были
вполне ожидаемы. Разнонаправленное влияние обнаружено при воздействии супернатантов на
биопленкообразование E. сoli АТСС 35218 и 25922. По-видимому, зафиксированное снижение
биопленкообразования у УПМ связано, в первую очередь, с бактерицидным действием
экзопродуктов P. aeruginosa на планктонные культуры.
Формирование смешанных биопленок P. aeruginosa с представителями других
таксонов УПМ. В исследовании при совместном культивировании различных по
грампринадлежности микроорганизмов референтных и нозокомиальных штаммов с
культурами P. aeruginosa были выявлены индифферентный, стимулирующий и
ингибирующий эффекты взаимодействия. Пленкообразующая способность отражает
метаболическую активность бактерий, формирующих полимикробные структурированные
сообщества. Типы взаимодействия – антагонизм, синергизм и нейтрализм – в бактериальных
ассоциациях складываются под влиянием различных факторов, в том числе синтеза
бактерицидных веществ, других продуктов обмена и компонентов самих клеток, которые
могут оказывать не только сходное, но и разнонаправленное действие на уровень
пленкообразования. Поэтому, показатель, характеризующий биомассу смешанной биопленки,
наряду с другими, может быть использован для оценки характера межмикробных
33
взаимоотношений. Такой подход послужил основой предлагаемого метода, суть которого
заключается в сравнительном анализе массивности сформированных моновидовых и
смешанных биопленок на основе регистрации интенсивности поглощения ими красителя по
стандартной методике. Если наблюдается аддитивный (суммарный) эффект, т.е. показатель
смешанной биопленки (ОПmix) достоверно не отличается от суммы показателей каждого
тестируемого штамма (ОП1 + ОП2) – регистрируют нейтральный характер в межмикробном
взаимодействии; если показатель ОПmix > ОП1 + ОП2 – регистрируют синергический характер
взаимодействия; если показатель ОПmix < ОП1 + ОП2 – регистрируют антагонистический
характер взаимодействия. Установленный тип взаимодействия микроорганизмов,
изолируемых одновременно из материала больного, позволяет оценить характер микробной
колонизации и прогнозировать развитие микст-инфекции.
Влияние экзометаболитов P. aeruginosa на планктонные и пленочные культуры
E. coli. В эксперименте использовали референтный штамм P. aeruginosa АТСС 27853 и два
нозокомиальных изолята: P. aeruginosa БАЛЖ и 9-3, а также рекомбинантный
биолюминесцентный штамм E. coli K12 TG1 lux+. При росте кишечной палочки в присутствии
экзометаболитов клинических штаммов P. aeruginosa происходило увеличение длительности
лаг-фазы без снижения скорости экспоненциального роста E. сoli (табл. 11). При этом
наблюдается прямая зависимость удлинения лаг-фазы E. сoli от содержания пиоцианина
(r=0,767; р=0,05) и пиовердина (r=0,372) в супернатантах псевдомонад. Установлено, что в
присутствии экзометаболитов всех штаммов P. aeruginosa достоверно снижалось удельное
свечение E. сoli (от контроля) уже через 10 мин экспозиции в 1,2; 2,1 и 2,3 раза соответственно
(табл. 10). Через 1,5 часа снижение люминесценции E. сoli отмечено только в присутствии
экзометаболитов клинических штаммов P. aeruginosa. Показана обратная зависимость между
интенсивностью удельной люминесценции E. сoli и содержанием пиоцианина (r= -0,994) и
пиовердина (r= -0,459) в супернатантах псевдомонад.
Таблица 10
Ростовые показатели и интенсивность свечения планктонных культур E. сoli в
присутствии экзометаболитов P. aeruginosa
Параметры
Вариант опыта, экзометаболиты P. aeruginosa
LB (контроль)
АТСС
БАЛЖ
9-3
0,70±0,20
0,78±0,13
1,06±0,11*
1,72±0,28*
0,27±0,01
0,22±0,01*
0,26±0,01
0,25±0,02
2,68±0,25
0,63±0,18*
1,18±0,25*
1,45±0,78*
12 ч
6,68±0,46
10,60±2,70*
12,20±0,90*
6,25±1,80
10 мин
1,02±0,05
0,84±0,04*
0,49±0,05*
0,45±0,12*
1,5 ч
4,15±0,48
4,06±0,39
2,96±0,21*
2,16±0,16*
6ч
20,35±3,27
45,57±7,53*
33,85±5,44*
25,64±2,36
12 ч
36,64±3,66
45,51±4,42*
29,85±4,20
28,56±6,39
Длительность
лаг-фазы (Tl), ч
Удельная скорость
роста (µ), ч-1
КОЕ/мл ×108 6 ч
Iуд ×105
Примечание: * – различая достоверны по сравнению с контролем (р≤0,05).
При росте E. сoli с супернатантами всех штаммов P. aeruginosa образуется менее
выраженная биопленка, чем в контроле на 6, 12 и 24 часов. Предположение о том, что в
присутствии супернатантов с высоким содержанием бактерицидных факторов, влияющих на
рост и плотность культуры в планктоне, формируется также и менее массивная биопленка, не
подтвердилось в полной мере. Наибольшая биомасса биопленки E. coli, полученная в
присутствии супернатанта P. aeruginosa БАЛЖ в более поздние сроки, может
свидетельствовать о том, что в этих условиях происходит и более быстрый «уход» культуры в
34
пленку, а также о том, что на формирование биопленки могут влиять не только определяемые
нами факторы вирулентности псевдомонад, но другие метаболиты, присутствующие в
супернатантах, например экзополисахариды. С другой стороны, оценка общей биомассы
пленки может не отражать истинного влияния экзометаболитов на ее формирование. Расчет
удельного биопленкообразования (отношение биомассы биопленки (ОП580) к плотности
культуры (ОП600) показал, что экзометаболиты клинических штаммов достоверно
стимулируют биопленкообразование E. coli на ранних сроках культивирования, но тесной
связи между уровнем стимуляции и содержанием пиоцианина в супернатантах не обнаружено.
При анализе данных, связанных с влиянием супернатантов P. aeruginosa на
сформированные 24-часовые пленки E. coli, показано, что 3-х часовое воздействие приводило
к достоверному снижению биомассы пленки, что подтверждалось и уровнем ее
биолюминесценции. По-видимому, разрушение пленок не связано с продукцией пиоцианина и
пиовердина: наибольшее снижение показателя пленкообразования (ОП580) было отмечено при
воздействии супернатанта P. aeruginosa АТСС, который содержал меньшее количество
пигментов.
Анализ свечения биопленки E. coli, образованной в присутствии и отсутствие
супернатантов P. aeruginosa, после удаления планктона выявил достоверное ингибирование
люминесценции на 6 часов во всех вариантах с супернатантами (рис. 15). При расчете
удельной люминесценции биопленки, образованной E. coli к 6 часам роста, показана
стимуляция ее свечения в присутствии супернатантов клинических штаммов P. aeruginosa
БАЛЖ и 9-3 в 1,5 и 1,3 раза соответственно (от контроля). Такой же эффект отмечен в этом
сроке и для планктонной культуры (табл. 11). После экспозиции 12 часов также
зафиксировано повышение уровня удельного свечения пленок, образованных при росте
культуры с супернатантами P. aeruginosa АТСС в 2,6 раз, БАЛЖ – в 1,6, 9-3 в 3,2 раза. Такая
стимуляция может свидетельствовать о большей «чувствительности» клеток, которые
подвергались воздействию экзопродуктами, к притоку кислорода при отмывке, в том числе и
из-за менее массивной пленки, образованной в этих условиях.
*
*
*
*
А
*
Б
Рисунок 15. Показатель общей (А) и удельной (Б) люминесценции клеток
биопленки, образованной E. coli при культивировании в присутствии супернатантов
P. aeruginosa: 1 – контроль (LB), 2 – АТСС 27853; 3 – БАЛЖ; 4 – 9-3. * – достоверное отличие
от контроля (p≤0,05).
Характер
взаимоотношений
P. aeruginosa
и
E. coli
при
совместном
культивировании в планктоне и биопленке. Преимущественный фенотип одного из
ассоциантов может влиять на физиологическую адаптацию микроорганизмов в природных
многовидовых сообществах. В этом контексте исследована смешанная культура в планктоне и
биопленке, сформированная E. coli и внутрибольничными изолятами P. aeruginosa с
различной предоминантной формой существования. Показано, что количество клеток E. coli и
P. aeruginosa в смешанном планктоне и биопленке уменьшается сходным образом по
сравнению с моновидовыми культурами после 6 часов культивирования, что возможно
связано с адаптацией к присутствию другого вида (рис. 16).
35
Рисунок 16. Количество жизнеспособных клеток P. aeruginosa и E. coli в планктоне
и биопленке при росте в моно- и микст вариантах: A, Г – P. aeruginosa 27853; Б, Д –
P. aeruginosa БАЛЖ; В, Е – P. aeruginosa 9-3. * – достоверное отличие между моно- и микст
вариантом (p≤0,05).
Однако в более поздний срок (на 12 часов) численность обеих культур в планктоне при
смешанном росте варьирует и не соответствует количеству КОЕ биопленок, что, повидимому, связано с конкуренцией за питание или с влиянием бактериоцинов, кворум-сенсинг
регуляторов и других вторичных продуктов, которые выделяются в среду при достижении
определенной плотности культур. Не исключен также выход клеток из биопленки после 6
часов. Взаимовлияние и межклеточное взаимодействие в смешанной популяции E. coliP. aeruginosa может быть обусловлено и высокой фенотипической гетерогенностью
последней. Если для E. coli выявленные количественные эффекты практически не меняли
направленность, то для P. aeruginosa соотношение клеток в планктоне и биопленке
существенно отличалось для разных штаммов в соответствии с их предоминантной формой
36
существования: количество КОЕ P. aeruginosa АТСС 27853 увеличилось в тринадцать раз,
КОЕ «планктонного» штамма P. aeruginosa 9-3 не изменилось, КОЕ «биопленочного» штамма
P. aeruginosa БАЛЖ снизилось в восемнадцать раз по сравнению с их ростом в монокультуре.
Недавно Machado и соавт. (2012) сообщили, что биомасса биопленки, образованной при
совместном росте E. coli и P. aeruginosa, не увеличивалась, что, вероятно, связано с
длительным сроком культивирования. В данном исследовании было показано увеличение
биомассы всех смешанных биопленок (на 6-24 часа) по сравнению с моновидовыми пленками,
что подтверждает однонаправленность изменений фенотипически разных штаммов
P. aeruginosa в присутствии ассоцианта. Более того, поскольку смешанная биопленка была
массивнее у «сессильного» штамма, чем у «планктонного» изолята P. aeruginosa, то
подтверждается тезис, что при взаимодействии с E.coli клинические штаммы не меняют
предоминантную
форму
существования.
Интересно,
что
смешанная
культура
P. aeruginosa 27853-E. coli показала более высокую биомассу биопленки, чем теоретически
рассчитанная (OП580mix > OП580E.coli + OП580PA27853). В других случаях теоретические и
практические значения биомассы биопленки были сопоставимыми.
Во всех смешанных культурах общее количество пиоцианина и пиовердина было
достоверно ниже, чем у собственных монокультур P. aeruginosa (табл. 11). Несмотря на это,
клинические изоляты P. aeruginosa синтезировали большее количество экзометаболитов, чем
референтный штамм, в течение всего срока наблюдения, вследствие либо увеличения их
удельной продукции (БАЛЖ), либо экстенсивного роста культуры (9-3), что определялось
исходной предоминантной формой существования культур. Поэтому, клинические изоляты
P. aeruginosa снижали биолюминесценцию E. coli в смешанной планктонной культуре более
существенно (в 20-100 раз), чем референтный штамм, что связано с токсическим воздействием
пиоцианина и других продуктов. Действительно, интенсивность биолюминесценции E. сoli
отрицательно коррелировала с общим уровнем пиоцианина в смешанных культурах с
P. aeruginosa 27853 (г = -0,68, р≤0,05), БАЛЖ (r = -0,70), и 9-3 (r = -0,77) в течение 6-24 часов.
Кроме того, на 12 часов отрицательная связь между общим уровнем пиоцианина и пиовердина
в смешанных культурах с различными штаммами P. aeruginosa и биолюминесценцией E. сoli
была очень сильной: г = -0,96 и -0,98 соответственно.
Таблица 11
Изменение удельной продукции экзометаболитов штаммами P. aeruginosa в
смешанной культуре с E. coli
Экзометаболит
Время, ч
P. aeruginosa
АТСС 27853
«Biofilm» штамм
«Planktonic»
БАЛЖ
штамм 9-3
Пиоцианин
6
но
+2,2
+3,7
-1
-9
α
(Пцн×КОЕ ×10 )
12
-13,4 *
+4,8*
-3,6*
24
-4,6*
+6,3*
-26,0*
Пиовердин
6
но
+2,9*
+3,7*
(Пвд×КОЕ-1×10-5)
12
-12,8*
+17,9*
-1,7*
24
-6,5*
+7,6*
-8,4*
Примечание: но – не определяли. α – число, показывающее во сколько раз увеличился («+») или снизился («-»)
показатель удельной продукции Пцн и Пвд в смешанной культуре по сравнению с монокультурой P. aeruginosa;
* – достоверные отличая между моновидовой и смешанной культурой (p≤0,05).
Однако общее количество пиоцианина в супернатантах и низкий энергетический статус
клеток E. coli не влияли на их интеграцию в смешанную биопленку на 12 часов. Тем не менее,
сниженная метаболическая активность E. coli, согласно биолюминесценции, дает возможность
предположить о снижении синтеза ауторегуляторов и вторичных метаболитов ассоцианта,
которые могут в дальнейшем оказывать или не оказывать влияние на проявление вирулентных
свойств P. aeruginosa. Обнаруженный эффект снижения биолюминесценции E. coli в
смешанной биопленке показал, что антагонистическая активность P. aeruginosa против
ассоцианта сохранялась и в этом случае. Вероятно, это может приводить к гибели ассоцианта
37
особенно в составе смешанной биопленки с клиническими штаммами P. aeruginosa.
Поскольку биомасса смешанной биопленки превышает моновидовую пленку, ее
формирование будет способствовать выживанию P. aeruginosa в условиях стрессовой
нагрузки в природных и внутрибольничных условиях. Кроме того, известно, что пиоцианин
при субтоксических концентрациях проявляет регуляторный эффект (Ramos, et al., 2010;
Morales, et al., 2013) и, по-видимому, может способствовать образованию смешанных
биопленок P. aeruginosa с другими видами бактерий. Действительно, более высокая биомасса
смешанной биопленки показана для штамма P. aeruginosa АТСС 27853, у которого в
супернатантах был самый низкий общий уровень пиоцианина и пиовердина. Причем в ранние
сроки это может быть обусловлено числом клеток P. aeruginosa и E. coli в составе биопленки,
в более поздние сроки – количеством внеклеточного матрикса P. aeruginosa
(экзополисахариды) и E. coli (колановая кислота) (Danese, et al., 2000; Allison, 2003). Повидимому, штаммы P. aeruginosa с низким уровнем продукции экзометаболитов могут дольше
существовать в смешанной биопленке.
Сравнительный анализ удельной концентрации внутриклеточного АТФ в клетках
моновидовых и смешанных биопленок показал, что метаболическая активность клеток и в том
и другом случае снижалась по мере «созревания»/«разрушения» биопленки (табл. 12). То есть,
в смешанном биопленочном сообществе биологическая активность ассоциантов подчиняется
общим закономерностям, описанным для моновидовых сообществ микроорганизмов. Для
более корректной оценки антагонистической активности в биопленке было проведено
сравнение показателей «практической» и «теоретической» [АТФ], характеризующей
энергетический статус клеток разных видов без влияния ассоцианта. Оказалось, что уровень
антагонистических отношений с ассоциантом, выявленный для всех культур P. aeruginosa в 6ти часовой биопленке, нивелировался в процессе ее созревания, за исключением P. aeruginosa
БАЛЖ.
Таблица 12
Удельная концентрация внутриклеточного АТФ в моновидовых и смешанных
культурах P. aeruginosa и E. coli
Вариант опыта
Удельная [АТФ], пикоМ/биомасса биопленки, ОП580
6ч
12 ч
24 ч
1
E. coli
75,5±7,2
13,3±2,5
3,3±2,11,2
АТСС 27853
9,7±6,6
3,7±0,8
1,7±1,31
E. coli+АТСС27853
27,2±3,4
8,7±7,61
3,4±2,61
БАЛЖ
11,4±3,2
8,9±2,7
4,8±3,41
E. coli+БАЛЖ
18,3±5,2
9,8±1,71
0,9±0,61,2
9-3
18,7±1,5
8,8±2,51
2,0±1,61,2
E. coli+9-3
38,5±12,3
9,2±1,81
3,1±3,01,2
Примечание: различия статистически значимы при сравнении с данными на 6 ч1 и 12 ч2 (p≤0,05).
Таким образом, выявлены однонаправленные эффекты у всех P. aeruginosa при росте в
смешанной культуре, а именно снижение общего уровня пиоцианина и пиовердина,
подавление метаболического обмена E. coli, повышение биомассы биопленки в соответствии с
детерминированной формой существования. На примере разных штаммов P. aeruginosa
показано, что определяемая в биопленках концентрация внутриклеточного АТФ
характеризует энергетический статус клеток в соответствующей фазе роста биопленки и
является важнейшим критерием для отбора штаммов с преимущественной «биопленочной»
формой существования. Установлено, что в смешанном биопленочном сообществе
биологическая активность ассоциантов подчиняется общим закономерностям, описанным для
моновидовых сообществ микроорганизмов. Показано, что конкурентные межвидовые
взаимоотношения сохраняются у бактерий и в прикрепленном состоянии, а их уровень
коррелирует с жизнеспособностью клеток, входящих в биопленку. В целом результаты
38
показывают, что рост бактерий в полимикробном сообществе сопровождается конкуренцией
и/или сотрудничеством между его членами. Однако для P. aeruginosa любой из видов
межклеточных взаимоотношений в смешанном сообществе является «выгодным» при
выживании, в том числе и при неблагоприятных условиях окружающей среды.
Влияние супернатантов смешанной культуры P. aeruginosa и E. coli на апоптоз,
некроз и окислительную активность нейтрофилов in vitro. Установлено, что супернатанты
культур P. aeruginosa и E. coli статистически значимо снижали количество жизнеспособных
нейтрофилов (AnV-/PI-). При воздействии супернатантов, полученных при совместном росте
P. aeruginosa и E. coli, число AnV-/PI- нейтрофилов не изменялось по сравнению с контролем
(раствор Хенкса и LB-среда), но было достоверно выше по отношению к клеткам, которые
инкубировались с супернатантами моновидовых культур. Для оценки механизмов,
приводящих к снижению жизнеспособности нейтрофилов, было изучено влияние
супернатантов на процессы первичного некроза и апоптоза. Оказалось, что доля клеток,
подвергшихся цитолитическому действию (AnV-/PI+ клетки), была достоверно выше только
при воздействии супернатантов P. aeruginosa. Некроз нейтрофилов в данном случае может
быть обусловлен мембраноповреждающим действием дирамнолипида в комплексе с
фосфолипазой (Jensen, et al., 2007), а также пиоцианина (Priyaja, et al., 2014). Подобное
предположение подтверждается тем, что в составе супернатантов, полученных при
совместном росте штаммов, детектирован более низкий уровень пиоцианина, который связан
с рамнолипидом кворум-зависимым механизмом. Количество нейтрофилов в стадии с раннего
апоптоза (AnV+/PI- клетки) после 30-минутного воздействия супернатантов во всех вариантах
достоверно не отличалось от контроля. Отсутствие проапоптотического влияния пиоцианина,
возможно, связано с его отсроченным действием на морфологические перестройки
нейтрофилов. Тем более, что интенсивность апоптоза нейтрофилов статистически значимо
увеличивалась при их 60-минутной экспозиции с супернатантами большей части клинических
культур P. aeruginosa.
При оценке действия супернатантов на внутриклеточный уровень АФК нейтрофилов
установлено, что он существенно возрастает во всех вариантах, но ниже индуцированного
ФМА (4-форбол-12-миристат-13-ацетат). Супернатанты смешанной культуры стимулировали
окислительную активность сильнее, чем бесклеточные фильтраты P. aeruginosa, но не E. coli,
что, по-видимому, связано с более высоким количеством жизнеспособных нейтрофилов. Так,
при расчете удельной продукции АФК нейтрофилов, варианты с моновидовой и смешанной
культурами P. aeruginosa не отличались по этому показателю (0,42±0,22 против 0,44±0,12 усл.
ед; р≥0,05; 30 мин). Выявленная обратная зависимость между удельным уровнем АФК и
содержанием экзополисахаридов, подавляющих функциональную активность нейтрофилов
(Bylund, et al., 2006), отчасти объясняет отсутствие дозозависимого стимулирующего эффекта
пиоцианина в составе супернатантов на продукцию АФК нейтрофилами (Usher, et al., 2002).
Таким образом, краткосрочное воздействие супернатантов монокультуры P. aeruginosa
приводило к увеличению числа некротических клеток, тогда как выраженного влияния на
жизнеспособность нейтрофилов супернатантов, полученных в смешанной культуре, не
выявлено, что проявилось в большей продукции АФК нейтрофилов, оказывающих
бактерицидное действие. Полученные данные позволяют предположить, что при развитии
инфекционного процесса, вызванного ассоциацией двух видов микроорганизмов,
P. aeruginosa и E. coli, повреждающее действие на ткани в очаге воспаления будет меньшим
вследствие низкого уровня продукции бактериальных экзометаболитов и высвобождения
цитотоксических белков нейтрофилов. Баланс между программированной гибелью
нейтрофилов – апоптозом и некрозом является важным моментом для исхода воспаления и
степени повреждения тканей при элиминации патогена. Одним из перспективных
направлений дальнейших исследований может быть комплексная оценка влияния
супернатантов смешанных культур с участием P. aeruginosa на иммунные клетки
макроорганизма.
39
ВЫВОДЫ
1.
Установлено, что инфицированность пациентов P. aeruginosa и ее доля в спектре
микроорганизмов в различных биологических материалах зависит от профиля стационара и
возрастной категории пациентов. P. aeruginosa остается одним из ведущих возбудителей
госпитальных нозологий – пневмоний, раневых инфекций и инфекций мочевыводящих путей
во взрослой клинике. Частота выделения штаммов P. aeruginosa от хирургических больных
взрослой сети оказалась наиболее высокой, составив 10,5% в общих и 18,1% в
реанимационных отделениях. До 70% случаев культуры P. aeruginosa выделяют из
биоматериала в составе ассоциаций, в которых чаще всего присутствуют другие
грамотрицательные бактерии: K. pneumoniae, A. baumannii и E. coli.
2.
Показано, что P. aeruginosa не играет существенной роли ни в качестве
колонизирующего микроорганизма, ни в качестве этиопатогена у новорожденных. Наиболее
значимой P. aeruginosa может быть только в случае ГСИ дыхательных путей, при всех других
воспалительных процессах ее доля меньше 10%.
3.
На этапе идентификации возбудителя диагностическая значимость культурального
метода сопоставима с ПЦР-анализом. Учитывая ограниченную дискриминирующую
способность фенотипических методов при микробиологическом мониторинге P. aeruginosa,
как по биологическим свойствам, так и по признаку резистентности к антибактериальным
препаратам, предпочтительнее использовать молекулярные методы, эффективность которых
повышает применение мультиплексной ПЦР с одновременной детекцией микроорганизмов и
оценкой их патогенного потенциала. При локальных исследованиях для определения родства
изолятов оптимальными тестами являются RAPD-ПЦР и ERIC-ПЦР.
Выявлено, что продуценты МБЛ VIM2-типа широко распространены на территории
4.
Пермского края в хирургических ЛПУ взрослой медицинской сети. Гены карбапенемаз
сцеплены с другими детерминантами антибиотикорезистентности и включены в состав
интегронов I класса. Обнаружена статистически значимая сильная связь между наличием в
геноме blaVIM2 и присутствием exoU, умеренная – между blaVIM2 и выделением штамма из
ОРИТ. Достоверных отличий по распространению эффекторов TTSS exoU и exoS в различных
патологических материалах не выявлено.
5.
Показано, что фенотипические паттерны популяций P. aeruginosa существенно не
различаются в разнопрофильных отделениях стационаров, но могут зависеть от
материала/биотопа. Клинические изоляты гетерогенны по уровню продукции пиоцианина и
пиовердина, биопленкообразующей способности. Выявлена сильная связь между
биопленкообразованием и гемолитической активностью для культур, изолированных из
раневого отделяемого и из мокроты, у последних прослежена связь между
биопленкообразованием и фосфолипазной активностью. При выращивании P. aeruginosa на
искусственных питательных средах наблюдается разнонаправленное изменение активности
изучаемых факторов в зависимости от условий и состава среды, числа пассажей и времени
хранения, что характеризует адаптационные возможности штаммов.
6.
Установлено, что предлагаемый для определения «гемолитический профиль» является
основополагающей штаммовой характеристикой и складывается из термолабильного и
термостабильного экзометаболитных компонентов, а также самостоятельно значимого
клеточно-ассоциированного гемолиза.
7.
Показано, что среди высокопленкообразующих штаммов P. aeruginosa встречаются как
гидрофильные, так и более гидрофобные по BATH-тесту варианты. Все штаммы отнесены к
адгезивным или высокоадгезивным в отношении эритроцитов, что отражает
«специфическую» адгезию, определяющую колонизацию в биотопах макроорганизма. При
низких температурах увеличивается биомасса пленки большей части штаммов P. aeruginosa,
что обусловлено либо увеличением продукции полисахаридного матрикса, либо «клеточным
компонентом», в зависимости от предоминантной формы существования псевдомонад –
«планктонной» или «биопленочной». Определяемая в биопленках концентрация
внутриклеточного АТФ, характеризует энергетический статус клеток в соответствующей фазе
40
формирования биопленки, и является важнейшим критерием для отбора штаммов с
преимущественной «биопленочной» формой существования.
8.
Экспериментально обоснована целесообразность использования биолюминесцентного
метода для интегральной оценки патогенного потенциала нозокомиальных штаммов
P. aeruginosa. Сильная положительная связь установлена между предложенным индексом
потенциальной патогенности и показателями, характеризующими уровень продукции
пиоцианина, гемолитическую активность, биопленкообразующую способность. При этом
показана обратная корреляция ИПП с % прироста E. coli lux+ и количеством жизнеспособных
нейтрофилов.
9.
Выявлены однонаправленные эффекты при росте P. aeruginosa в смешанной культуре,
а именно снижение общей продукции синегнойной палочкой пиоцианина и пиовердина,
подавление метаболизма E. coli, повышение биомассы биопленки. При этом, характер
взаимоотношений с E. coli и в планктоне, и в биопленке определяется уровнем
антагонистической активности и предоминантной формой существования P. aeruginosa.
Биолюминесценция E. coli K12 TG1, отражающая энергетический статус клетки, дает
возможность оценивать и прогнозировать тип совместного существования микроорганизмов.
ПРАКТИЧЕСКИЕ РЕКОМЕНДАЦИИ
1. При проведении санитарно-бактериологического контроля (планового и, особенно, по
эпидемическим показаниям) в лечебных учреждениях, наряду с прямыми посевами смывов
с оборудования, инструментария, объектов внешней среды и др., на специальные среды,
образцы необходимо дополнительно подвергать молекулярно-генетическому анализу (на
основе ПЦР с видоспецифичными праймерами) для прямой детекции P. aeruginosa.
Включение в схему эпидемиологического надзора ПЦР-метода в качестве дополнительного
теста при мониторинге P. aeruginosa повысит ее выявляемость и эффективность борьбы с
синегнойной инфекцией в условиях стационара.
2. В ходе эпидемиологических исследований для внутривидового типирования изолятов
P. aeruginosa предложено использовать RAPD-ПЦР и ERIC-ПЦР, как наиболее доступные с
методической и экономической точки зрения реакции, позволяющие адекватно решать
поставленные задачи при определении родства штаммов.
3. Предложен оптимальный набор тестов бактериологического анализа для оценки
патогенного потенциала нозокомиальных штаммов P. aeruginosa, включающий
количественное определение трех параметров: гемолитическую активность, продукцию
пигментов (пиоцианина, пиовердина) и биопленкообразование. При проведении
мониторинговых исследований целесообразно выявлять «гемолитический профиль»
культуры, позволяющий оценивать участие различных субстанций в проявлении
гемолитической активности и прогнозировать характер течения инфекционного процесса.
4. При оценке клинической и эпидемиологической значимости изолятов целесообразно
определять маркеры вирулентности/цитотоксичности (exoS и exoU) и детерминанты
антибиотикорезистентности (blaVIM, int1) в мультиплексной ПЦР.
СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ
Публикации в изданиях, рекомендованных ВАК Минобрнауки РФ
1. Кузнецова, М.В. Динамическое изучение микробиоты ротоглотки пациентов инфекционного
стационара / М.В. Кузнецова, Т.И. Карпунина, А.О. Чарушин, Г.А. Вахрушева, В.А. Демаков //
Пермский медицинский журнал. – 2008. – Т. 25, №2. – С. 63-70.
2. Карпунина, Т.И. Изучение фено- и генотипов штаммов Pseudomonas aeruginosa, циркулирующих в
отделении реанимации и интенсивной терапии новорожденных / Т.И. Карпунина, М.В. Кузнецова,
Н.И. Маркович, Н.С. Авдеева, В.И. Сергевнин // Вестник РУДН. Серия Медицина. – 2008. – №6. –
С. 268-271.
41
3. Кузнецова, М.В. Генотипирование в клинико-эпидемиологическом анализе госпитального сепсиса,
ассоциированного с Pseudomonas aeruginosa, в инфекционном стационаре / М.В. Кузнецова,
Т.И. Карпунина, А.Ю. Максимов, В.А. Демаков, С.Б. Ляпустин // Пермский медицинский журнал. –
2009. – Т. 26, №1. – С. 64-69.
4. Кузнецова, М.В.
Фенотипические
характеристики
штаммов
Pseudomonas
aeruginosa,
изолированных в стационарах хирургического профиля / М.В. Кузнецова, Т.И. Карпунина,
Н.В. Николаева, А.В. Касатов // Уральский медицинский журнал. – 2009. – №9(63). – С. 103-107.
5. Карпунина, Т.И. Эпидемиологические аспекты нозокомиальной синегнойной инфекции в
многопрофильном хирургическом стационаре / Т.И. Карпунина, М.В. Кузнецова, Н.В. Николаева,
В.А. Демаков // Сибирский медицинский журнал. – 2009. – Т. 24. №4(1). – С. 70-73.
6. Карпунина, Т.И. Сравнительный анализ фенотипов Pseudomonas aeruginosa, изолированных в
многопрофильном хирургическом стационаре / Т.И. Карпунина, Н.В. Николаева, М.В. Кузнецова,
В.А. Демаков // Вестник РУДН. Серия Медицина. – 2009. – №4. – С. 489-492.
7. Кузнецова, М.В. Видовое разнообразие и антибиотикочувствительность грамотрицательных
бактерий, изолированных в птицеводческом хозяйстве / М.В. Кузнецова, Т.И. Карпунина,
С.В. Поспелова, Е.В. Афанасьевская, Э.С. Горовиц, В.А. Демаков // Вестник Новосибирского
государственного университета. Серия: Биология, клиническая медицина. – 2010. – Т. 8, Вып. 3. –
С. 70-77.
8. Маркович, Н.И. Вспышка синегнойной инфекции среди новорожденных в отделении реанимации и
интенсивной терапии / Н.И. Маркович, В.И. Сергевнин, Е.В. Сармометов, М.В. Кузнецова [и
соавт.] // Эпидемиология и вакцинопрофилактика. – 2010. – №3. – С. 5-10.
9. Кузнецова, М.В. Молекулярно-генетические исследования в лабораторной диагностике и
мониторинге возбудителей госпитальных инфекций (обзор) / М.В. Кузнецова, Е.Г. Плотникова,
Т.И. Карпунина, Э.С. Горовиц, В.А. Демаков // Пермский медицинский журнал. – 2010. – Т. 27, №6.
– С. 129-138.
10. Кузнецова, М.В. Карбапенемоустойчивые штаммы Pseudomonas aeruginosa в стационарах г. Перми
/ М.В. Кузнецова, Т.И. Карпунина, Д.О. Егорова, Е.Г. Плотникова, В.А. Демаков // Клиническая
микробиология и антимикробная химиотерапия. – 2010. – Т. 12, №3. – С. 246-251.
11. Кузнецова, М.В. Формирование биопленок нозокомиальными штаммами Pseudomonas aeruginosa /
М.В. Кузнецова, Н.В. Николаева, С.М. Розанова, Т.И. Карпунина // Журнал микробиологии,
эпидемиологии и иммунобиологии. – 2011. – №4. – С. 8-14.
12. Козюкова, К.В. Продукция OXA-бета-лактамаз нозокомиальными штаммами Pseudomonas
aeruginosa и Acinetobacter baumannii / К.В. Козюкова, М.В. Кузнецова, Т.И. Карпунина // Вестник
уральской медицинской академической науки. – 2011. – №4/1 (38). – С. 34.
13. Кузнецова, М.В. Мониторинг колонизации условно патогенной микрофлорой новорожденных в
период пребывания в лечебных учреждениях / М.В. Кузнецова, Н.С. Авдеева, Т.И. Карпунина //
Медицинский альманах. – 2011. – №6(19). – С. 156-159.
14. Кузнецова, М.В. Этиология внутрибольничных гнойно-септических инфекций новорожденных
(обзор) / М.В. Кузнецова, Т.И. Карпунина, Н.И. Маркович, В.И. Сергевнин, Э.С. Горовиц //
Электронный журнал «Здоровье семьи – 21 век». – 2011. – №4 (4). http://fh-21.perm.ru.
15. Кузнецова, М.В. Оценка потенциальной патогенности клинических штаммов Pseudomonas
aeruginosa биолюминесцентным методом / М.В. Кузнецова, И.Л. Масленникова, Т.И. Карпунина,
Н.В. Николаева // Бюллетень сибирской медицины. – 2012. – №4. – С. 44-51.
16. Кузнецова, М.В. Влияние экзометаболитов Pseudomonas aeruginosa на планктонные и пленочные
культуры Escherichia coli / М.В. Кузнецова, Т.И. Карпунина, И.Л. Масленникова, Л.Ю. Нестерова,
В.А. Демаков // Журнал микробиологии, эпидемиологии и иммунобиологии. – 2012. – №6. – С. 1722.
17. Кузнецова, М.В. Pseudomonas aeruginosa в спектре микробных культур, изолируемых от пациентов
различных стационаров / М.В. Кузнецова, Т.И. Карпунина, Н.В. Николаева, И.М. Чепурная,
Н.С. Авдеева, С.В. Проворова // Альманах клинической медицины. – 2012. – №27. – С. 50-57.
18. Самарцев, В.А. Результаты комплексного лечения глубоких ожогов / В.А. Самарцев,
Т.И. Карпунина, М.В. Кузнецова, Ю.А. Еньчева, Н.М. Дронов, В.М. Грихутик // Пермский
медицинский журнал. – 2013. – Т. 30, №1. – С. 15-19.
19. Кузнецова, М.В. Опыт использования методов молекулярной генетики при идентификации
клинических штаммов Pseudomonas aeruginosa / М.В. Кузнецова, Ю.А. Павлова, Т.И. Карпунина,
В.А. Демаков // Клиническая лабораторная диагностика. – 2013. – №3. – С. 34-37.
42
20. Kuznetsova, M.V. Interactions of Pseudomonas aeruginosa in predominant biofilm or planktonic forms of
existence in mixed culture with Escherichia coli in vitro / M.V. Kuznetsova, I.L. Maslennikova,
T.I. Karpunina, L.Y. Nesterova, V.A. Demakov // Can. J. Microbiol. – 2013. – V. 59(9). – P. 604-610.
21. Кузнецова, М.В. Микробиологический мониторинг Pseudomonas aeruginosa в акушерских
стационарах / М.В. Кузнецова, Т.И. Карпунина, Э.С. Горовиц, В.А. Демаков // Акушерство и
гинекология. – 2013. – №9. – С. 59-63.
22. Кузнецова, М.В. Характеристика биологических свойств нозокомиальных штаммов Pseudomonas
aeruginosa / М.В. Кузнецова // Пермский медицинский журнал. – 2014. – Т. 31, №3. – С. 59-64.
23. Кузнецова, М.В. Распространенность возбудителя и разнообразие нозологических форм
синегнойной инфекции (обзор) / М.В. Кузнецова // Электронный журнал «Здоровье семьи – 21 век».
– 2014. – №2. http://fh-21.perm.ru.
24. Самарцев, В.А. Особенности инфицирования ожоговых ран / В.А. Самарцев, Ю.А. Еньчева,
М.В. Кузнецова, Т.И. Карпунина // Новости хирургии. – 2014. – Т. 22, №2. – С. 199-206.
25. Кузнецова, М.В. Влияние бактериальных супернатантов Pseudomonas aeruginosa и Escherichia coli
на фагоцитоз нейтрофилов человека / М.В. Кузнецова, И.Л. Масленникова, В.А. Демаков //
Российский иммунологический журнал. – 2014. – Т. 8(17), №3. – С. 815-817.
Публикации в других в рецензируемых журналах
26. Кузнецова, М.В. Биологические свойства энтеробактерий, изолированных от пациентов
многопрофильного ЛПУ / М.В. Кузнецова, Е.В. Афанасьевская, Т.И. Карпунина // Медицинский
альманах. – 2009. – №2 (7). – С. 87-90.
27. Демаков, В.А. Гидрофобные свойства и пленкообразующая способность штаммов рода
Pseudomonas, изолированных из разных экологических ниш / В.А. Демаков, М.В. Кузнецова,
Т.И. Карпунина, Н.В. Николаева // Вестник Пермского университета. Серия: Биология – 2010. –
Вып. 1(1). – С. 55-58.
28. Кузнецова, М.В. Поиск и изучение генов, кодирующих металло-бета-лактамазы, у госпитальных
штаммов Pseudomonas aeruginosa / М.В. Кузнецова, Д.О. Егорова, Т.И. Карпунина // Вестник
Пермского университета. Серия: Биология. – 2011. – Вып. 3-4. – С. 39-44.
29. Кузнецова, М.В. Проблемы синегнойной инфекции: от научных исследований к медицинской
практике / М.В. Кузнецова, Т.И. Карпунина // Вестник Пермского научного центра. – 2012. – №1. –
С. 10-16.
30. Кузнецова, М.В. Изучение биологических свойств клинических штаммов Pseudomonas aeruginosa
при многократных пересевах и хранении / М.В. Кузнецова, Т.И. Карпунина, Ю.К. Щербакова,
Л.Н. Сторчеус, Е.В. Афанасьевская // Журнал Медиаль. – 2013. – №1(6). С. 12-15.
Монография
31. Сергевнин В.И., Горовиц Э.С., Маркович Н.И., Кузнецова М.В.,
Внутрибольничные
гнойно-септические
инфекции
новорожденных
(микробиологические и эпидемиологические аспекты). – Пермь, 2010. – 288 с.
Карпунина Т.И.
и
родильниц
Патенты РФ
32. Карпунина Т.И., Кузнецова М.В., Маркович Н.И. Способ выявления обсемененности объектов
внешней среды грамотрицательными бактериями рода Pseudomonas и Acinetobacter // Патент РФ
№2372406 от 10.11.2009. Опубликовано 10.11.2009 в БИПМ (Бюллетень «Изобретения полезные
модели»). – № 31.
33. Карпунина Т.И., Кузнецова М.В., Николаева Н.В., Самарцев В.А., Еремеева М.И., Осокин А.С.,
Кирилова Т.А. Способ оценки антибактериального действия озонированного физиологического
раствора // Патент РФ №2425888 от 11.08.2011. Опубликовано 10.08.2011 в БИПМ. – № 22.
34. Карпунина Т.И., Кузнецова М.В., Николаева Н.В., Дробкова В.А., Ширева Ю.В. Способ оценки
характера межмикробных взаимодействий // Патент РФ №2448161 от 20.04.2012. Опубликовано
20.04.2012 в БИПМ. – № 11.
35. Карпунина Т.И., Кузнецова М.В., Масленникова И.Л., Николаева Н.В. Способ оценки
потенциальной патогенности Pseudomonas aeruginosa // Патент РФ №2452772 от 10.06.2012.
Опубликовано 10.06.2012 в БИПМ. – № 16.
43
Материалы конференций и публикации в сборниках
36. Кузнецова, М.В. Видовой состав и чувствительность к антибиотикам возбудителей
внутрибольничной
инфекции
у
новорожденных
/
М.В. Кузнецова,
С.В. Поспелова,
Е.В. Афанасьевская, Н.С. Авдеева, Т.И. Карпунина // Матер. междунар. конгресса «Стратегия и
тактика борьбы с внутрибольничными инфекциями на современном этапе развития медицины».
Москва. – 2006. – С. 109-110.
37. Карпунина, Т.И. Генотипирование и плазмидный анализ полирезистентных штаммов Pseudomonas
aeruginosa / Т.И. Карпунина, М.В. Кузнецова, Ю.Ю. Люлина, А.Ю. Максимов, В.А. Демаков //
Матер. IX съезда Всеросс. науч.-практич. общества эпидемиол., микробиол. и паразитол. Москва. –
2007. – С. 252-253.
38. Демаков, В.А. Молекулярно-генетические методы исследования в совершенствовании
микробиологического мониторинга внутрибольничной инфекции / В.А. Демаков, Т.И. Карпунина,
М.В. Кузнецова // Матер. науч.-практич. конф. ФМБА России «Высокие технологии в
промышленном здравоохранении». Пермь. – 2007. – С.118-121.
39. Кузнецова, М.В. Распространенность генов бета-лактамаз у грамотрицательных бактерий,
выделенных в клиниках г. Перми / М.В. Кузнецова, А.Ю. Максимов, В.А. Демаков, Т.И. Карпунина
// Матер. науч.-практич. конф. «Современные проблемы эпидемиологии». Нижний Новгород. –
2007. – С. 118-125.
40. Карпунина, Т.И. Изучение фено- и генотипов штаммов Рseudomonas aeruginosa при
микробиологическом мониторинге в акушерском стационаре / Т.И. Карпунина, М.В. Кузнецова,
Н.И. Маркович, Н.С. Авдеева // Матер. III Междунар. конф. «Микробное разнообразие: состояние,
стратегия сохранения, биотехнологический потенциал». Пермь-Н.Новгород. – 2008. – С.49-50.
41. Николаева, Н.В. Антибиотикорезистентность штаммов Pseudomonas aeruginosa и Acinetobacter
baumannii, изолированных в многопрофильном стационаре / Н.В. Николаева, М.В. Кузнецова,
О.Е. Ямлиханова, Т.И. Карпунина // Сборник науч. трудов «Современные проблемы инфекционной
патологии человека». Минск. – 2009. – Вып. 2. – С. 362-364.
42. Карпунина, Т.И. Распространенность карбапенемоустойчивых штаммов Pseudomonas aeruginosa в
стационарах Перми / Т.И. Карпунина, М.В. Кузнецова, Н.В. Николаева, В.А. Демаков / Матер. XII
Междунар. конгресса по антимикробной терапии МАКМАХ/ESCMID. Москва. – КМАХ. – 2010. –
Т. 12, №2, Прил. 1. – С. 32.
43. Николаева, Н.В. Изучение межмикробных взаимодействий нозокомиальных штаммов в биопленках
in vitro / Н.В. Николаева, В.А. Дробкова, М.В. Кузнецова, Т.И. Карпунина // Сборник. науч. трудов
«Современные проблемы инфекционной патологии человека». Минск. – 2010. – Вып. 3. – С. 213218.
44. Кузнецова, М.В. Устойчивость к карбапенемам штаммов Pseudomonas aeruginosa, циркулирующих
в хирургических стационарах Перми и Екатеринбурга / М.В. Кузнецова, Т.И. Карпунина,
Н.В. Николаева, С.М. Розанова, В.П. Панюшов, В.А. Демаков / Матер. XIII Междунар. конгресса по
антимикробной терапии МАКМАХ/ESCMID. Москва. – КМАХ. – 2011. – Т. 13, №2, Прил. 1. – С.
22-23.
45. Karpunina, T.I. Evaluation of antagonistic activity of nosocomial strains Pseudomonas aeruginosa by
bioluminescent technique / T.I. Karpunina, M.V. Kuznetsova, I.L. Maslennikova, N.V. Nikolaeva,
L.Ju. Nesterova // FEMS, the 4th Congress of European Microbiologists. Geneva, Switzerland. – 2011. –
Abstract №2196.
46. Карпунина, Т.И. Биологические особенности госпитальных штаммов Pseudomonas aeruginosa /
Т.И. Карпунина, М.В. Кузнецова, Н.В. Николаева, И.Л. Масленникова, В.А. Демаков // Матер. II
Междунар. конгресса по внутрибольничным инфекциям. Москва. – Инфекционные болезни. – 2011.
– Т. 9, Прил. 3. – С. 49.
47. Nikolaeva, N.V. Oxidative stress and biofilm formation of Pseudomonas aeruginosa nosocomial strains /
N.V. Nikolaeva, T.I. Karpunina, M.V. Kuznetsova // Internatinal Union of Microbiological Societies
Congress. Sapporo, Japan. – 2011. – Аbstract P-BA19-8.
48. Кузнецова, М.В.
Продукция
OXA-бета-лактамаз
штаммов
Pseudomonas
aeruginosa,
циркулирующих в детских стационарах / М.В. Кузнецова, Т.И. Карпунина, В.А. Демаков // Матер.
XIV Междунар. конгресса по антимикробной терапии МАКМАХ/ESCMID. Москва. – КМАХ. –
2012. – Т. 14, №2, Прил. 1. – С. 31-32.
49. Николаева, Н.В. О гемолитической активности нозокомиальных штаммов Pseudomonas aeruginosa /
Н.В. Николаева, М.В. Кузнецова, Т.И. Карпунина // Матер. Х съезда Всеросс. научно-
44
практического общества эпидемиологов, микробиологов и паразитологов. С.-Петербург. –
Инфекция и иммунитет. – 2012. – Т. 2, №1-2. – С. 489.
50. Карпунина, Т.И. Проблемы синегнойной инфекции: от научных исследований к медицинской
практике / Т.И. Карпунина, М.В. Кузнецова // Матер. научн.-практич. конф. по медицинской
микологии (XV Кашкинские чтения). С.-Петербург. – Проблемы медицинской микологии. – 2012. –
Т. 14, №2. – С. 91-92.
51. Кузнецова, М.В. Мультилокусная ПЦР в оценке клинико-эпидемиологической значимости
штаммов Pseudomonas aeruginosa / М.В. Кузнецова, Т.И. Карпунина, Ю.А. Павлова, В.А. Демаков //
Матер. XV Междунар. конгресса по антимикробной терапии МАКМАХ/ESCMID. Москва. –
КМАХ. – 2013. – Т. 15, №2, Прил. 1. – С. 26.
52. Кузнецова, М.В. Микробиота инфицированных ожоговых ран / М.В. Кузнецова, В.А. Самарцев,
Ю.А. Еньчева, А.В. Максимова // Матер. научн.-практич. конф. по медицинской микологии (XVI
Кашкинские чтения). С.-Петербург. – Проблемы медицинской микологии. – 2013. – Т. 15, №2. – С.
93.
53. Кузнецова, М.В. Новые акценты в изучении биологических особенностей нозокомиальных
штаммов Pseudomonas aeruginosa / М.В. Кузнецова, Т.И. Карпунина // Матер. научн.-практич. конф.
по медицинской микологии (XVII Кашкинские чтения). С.-Петербург. – Проблемы медицинской
микологии. – 2014. – Т. 16, №2. – С. 93.
54. Кузнецова, М.В. Оценка жизнеспособности нейтрофилов при действии супернатантов
нозокомиальных штаммов P. aeruginosa / М.В. Кузнецова, И.Л. Масленникова, И.В. Некрасова //
Матер. юбилейной научн.-практич. конф. «40 лет институту особо чистых препаратов». С.Петербург. – Цитокины и воспаление. – 2014. – Т. 13, №1. – С. 104.
АФК
ДНК
КОЕ
ЛПУ
МБЛ
ОП
ОРИТ
Пвд
Пцн
ПЦР
рРНК
УПМ
BOX-ПЦР
RAPD-ПЦР
TTSS
–
–
–
–
–
–
–
–
–
–
–
–
–
–
–
СПИСОК СОКРАЩЕНИЙ
активные формы кислорода
дезоксирибонуклеиновая кислота
колониеобразующая единица
лечебно-профилактическое учреждение
металло-бета-лактамаза
оптическая плотность
отделение реанимации и интенсивной терапии
пиовердин
пиоцианин
полимеразная цепная реакция
рибосомная рибонуклеиновая кислота
условно-патогенные микроорганизмы
ПЦР повторяющихся BOX-последовательностей
ПЦР со случайной амплификацией полиморфной ДНК
система секреции III типа
1/--страниц
Пожаловаться на содержимое документа