close

Вход

Забыли?

вход по аккаунту

?

Разработка и совершенствование методов молекулярно-генетической диагностики аденоматоза легких овец.

код для вставкиСкачать
На правах рукописи
Шобогоров Николай Михайлович
РАЗРАБОТКА И СОВЕРШЕНСТВОВАНИЕ МЕТОДОВ
МОЛЕКУЛЯРНО – ГЕНЕТИЧЕСКОЙ ДИАГНОСТИКИ АДЕНОМАТОЗА
ЛЕГКИХ ОВЕЦ
06.02.02 Ветеринарная микробиология, вирусология, эпизоотология,
микология с микотоксикологией и иммунология
Автореферат
диссертации на соискание ученой степени
кандидата ветеринарных наук
Покров-2013
2
Работа выполнена в Государственном научном учреждении Всероссийский
научно-исследовательский институт ветеринарной вирусологии и микробиологии
Россельхозакадемии (ГНУ ВНИИВВиМ Россельхозакадемии)
Научный руководитель:
доктор ветеринарных наук,
профессор, директор
ГНУ ВНИИВВиМ Россельхозакадемии
Колбасов Денис Владимирович
Официальные оппоненты:
доктор ветеринарных наук, профессор
кафедры нормальной, патологической
анатомии и ВСЭ
ФГБОУ ВПО Ивановская ГСХА
Кувшинов Вадим Леонидович
кандидат биологических наук,
зав. лаборатории Биофизики
ГНУ ВИЭВ Россельхозакадемии
Надточей Григорий Андреевич
Ведущая организация: Федеральное государственное бюджетное учреждение
Федеральный центр токсикологической, радиационной и биологической безопасности
(ФГБУ «ФЦТРБ-ВНИВИ»), г. Казань.
Защита диссертации состоится «17» октября 2013 г. в 1200 часов на заседании
диссертационного совета Д 006.003.01 при Государственном научном учреждении
Всероссийский научно-исследовательский институт ветеринарной вирусологии и
микробиологии Россельхозакадемии по адресу: 601120, Владимирская область, г.
Покров, ГНУ ВНИИВВиМ Россельхозакадемии. Тел./факс: 8 (49243) 6-21-25.
С диссертацией можно ознакомиться в библиотеке ГНУ ВНИИВВиМ
Россельхозакадемии.
Автореферат разослан «29» августа 2013 г. и размещен на официальном сайте ГНУ
ВНИИВВиМ Россельхозакадемии www.vniivvim.ru
и на официальном сайте ВАК
России www.vak2.ed.gov.ru
Ученый секретарь
диссертационного совета
ГНУ ВНИИВВиМ
Россельхозакадемии,
кандидат биологических наук
Балашова
Елена Алексеевна
3
1 ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ
1.1
Актуальность темы
Аденоматоз легких овец (АЛО) — медленно развивающаяся контагиозная
инфекционная болезнь, характеризующаяся длительным инкубационным периодом,
затяжным
течением
бронхиального
и
прогрессирующим
эпителия,
разрастанием
сопровождающимся
альвеолярного
образованием
в
и
легких
железистоподобных опухолей (аденом, аденокарцином) [1].
В естественных условиях АЛО регистрируют в виде энзоотий. Современный
ареал распространения АЛО охватывает 39 стран, в которых регистрировали болезнь
или подозревали ее наличие.
По данным Международного Эпизоотологического Бюро (МЭБ) на период с
1996 – 2004 гг. заболевание диагностировано у овец в государствах и странах Южной
Африки, Кении, Израиле, а также Индии, Турции, Чили, Бразилии, а из европейских
стран – в Германии, Великобритании, Испании, Греции, Португалии, Франции [15].
Комплексные исследования овцеводческих хозяйств нечерноземной зоны
Российской Федерации показали, что около 35 % из них являются неблагополучными
по АЛО [3].
Проведённые к настоящему времени вирусологические, иммунологические,
электронно–микроскопические
и
другие
исследования
свидетельствуют,
ретровирус - основной этиологический агент АЛО. Возбудителем АЛО
что
РНК–
содержащий вирус, относящийся к роду Betaretrovirus подсемейству Orthoretrovirinae
семейства Retroviridae (онковирусу типа А, В, С, и Д) [17].
В последние годы обнаружены эндогенные формы вирусов АЛО (enJSRV),
имеющие сходную структурную организацию генома с экзогенной формой вируса
АЛО [14]. У многих домашних пород овец и их диких предков – муфлона и снежного
барана, были выявлены эндогенные формы вирусных последовательностей, очень
сходные с геномом вируса АЛО (JSRV). Предполагают, что эти вирусы вошли в
состав генома представителей рода Ovis на заре его эволюции. Близкородственные
вирусы были
обнаружены у диких и домашних овец и коз, а также у ряда
представителей семейства Bovidae [7].
Анализ нуклеотидных последовательностей генома показал, что в хромосомах
овец содержится, по меньшей мере, 27 копий эндогенных бетаретровирусов
(enJSRV), близко родственных экзогенному и патогенному вирусу АЛО (JSRV) [6].
4
Эндогенные ретровирусы, после формирования вирусных частиц, могут
действовать как экзогенные ретровирусы[11].
В результате исследования, проведенного Bernardo Chessa, было установлено,
что
эндогенный
ретровирус
(ERVs)
можно
использовать
в
качестве
информационного маркера для изучения эволюции геномов как вируса, так и
хозяина. В своей работе автор показал, что изучение распространения эндогенного
вируса АЛО (enJSRVs) у разных пород домашних овец дало ценное понимание
истории одомашнивания овец [19].
В
настоящее
время
АЛО
диагностируют
на
основании
комплекса
эпизоотологических и клинических данных, результатов патологоанатомического
вскрытия животных, что не позволяет установить диагноз болезни в короткие сроки
[18].
В связи с отсутствием чувствительных клеточных систем для выделения
вируса АЛО прижизненная диагностика не разработана. Кроме того, вирус АЛО не
вызывает образования специфических антител в организме зараженных животных.
Механизм, лежащий в основе отсутствия адаптивной иммунной реакции к вирусу
АЛО, не известен, но наиболее вероятным объяснением является то, что овцы
иммунологически толерантны к антигенам этого вируса. Возможно, это происходит
из–за экспрессии близкородственных белков эндогенного вируса АЛО [13].
Длительный период бессимптомного течения болезни приводит к тому, что
животноводы
перемещают
клинически
здоровых, но
уже
инфицированных
животных, что в дальнейшем приводит к возникновению новых энзоотических
очагов. Это особенно актуально в современных условиях, когда предпринимаются
меры по восстановлению овцеводства в России, в связи с чем, происходит активное
перемещение животных между её регионами, а также импорт племенного поголовья
из зарубежных стран.
В связи с вышеизложенным, на сегодняшний день актуальной остается
проблема прижизненной диагностики вируса АЛО, в том числе для племенного
поголовья животных при экспорте и импорте. Проблема может быть решена с
помощью полимеразной цепной реакции в режиме реального времени, как наиболее
чувствительного и специфичного метода, способного выявить геном возбудителей
вирусных болезней в кратчайшие сроки.
5
1.2
Степень разработанности проблемы
2001 г. DeMartini с соавторами опубликовали данные о расшифровке первичных
нуклеотидных
последовательностей
и
получении
полноразмерных
последовательностей генома вируса аденоматоза легких овец, которые были
клонированы в плазмидный вектор[12].
В настоящее время зарубежными учеными разработаны различные варианты
ПЦР для выявления генома вируса АЛО [5], [8], [16].
В Российской Федерации диагноз на аденоматоз легких овец ставят на
основании клинических признаков, данных патологоанатомического вскрытия
животного и гистологических исследований [4].
Во ВНИИВВиМ Россельхозакадемии В.Г. Бурдинским (2009 г.) разработана
тест–система по выявлению генома вируса аденоматоза легких овец методом ПЦР с
электрофоретической детекцией.
В Российской Федерации не разработаны современные методы прижизненной
диагностики
АЛО,
импортированного
для
исследования
племенного
поголовья,
проб
что
от
экспортированного
явилось
и
основополагающим
аргументом при выборе темы диссертационной работы.
1.3
Цели и задачи исследования
В соответствии с вышеизложенным, основная цель данного исследования
заключалась в разработке и совершенствовании методов молекулярно–генетической
диагностики аденоматоза легких овец.
Для достижения поставленной цели необходимо было решить следующие
задачи:
1.
разработать
метод
ПЦР
с
электорофоретической
детекцией
для
выявления участка генома и идентификация экзогенной формы вируса аденоматоза
легких овец, позволяющего дифференцировать его от эндогенной формы вируса;
2.
разработать тест-систему на основе ПЦР-РВ для выявления участка
генома экзогенного вируса аденоматоза легких овец;
3.
определить эффективность разработанной тест-системы на основе ПЦР в
режиме реального времени по выявлению участка генома вируса аденоматоза легких
овец;
6
4.
провести
филогенетического
анализа
нуклеотидных
последовательностей экзогенного и эндогенного вируса аденоматоза легких овец,
выделенных в Российской Федерации.
1.4
Научная новизна результатов исследований
Впервые в Российской Федерации проведен сравнительный анализ генома
экзогенного и эндогенного вируса аденоматоза легких овец и подобраны
оригинальные
олигонуклеотидные
праймеры
для
постановки
ПЦР
с
электрофоретической детекцией.
Проведено
филогенетический
молекулярно-эпизоотологическое
анализ
нуклеотидной
исследование
последовательности
экзогенного
и
и
эндогенного вируса аденоматоза легких овец, выделенных в Российской Федерации.
Впервые разработана тест–система для выявления генома вируса аденоматоза
легких овец на основе метода ПЦР в режиме реального времени с аналитической
чувствительностью выявления 225 копий ДНК на реакцию.
1.5
Теоретическая и практическая значимость работы
Разработаны «Методические рекомендации по выявлению генома вируса АЛО
методом
полимеразной
цепной
реакции
в
режиме
реального
времени»,
утвержденные академиком-секретарем Отделения ветеринарной медицины РАСХН
А.М. Смирновым 12.04.2012 г.
Проведен филогенетический анализ нуклеотидных последовательностей
экзогенного и эндогенного вируса аденоматоза легких овец, выделенных в
Российской Федерации
1.6
Публикация результатов исследований
По материалам диссертационной работы опубликовано 6 научных работ, в том
числе 1 из них в журналах, рекомендованных ВАК Министерства образования и
науки Российской Федерации: «Веткорм» № 5, 2012 г.
1.7
Степень достоверности и апробация результатов
Степень достоверности результатов проведенных исследований подтверждена
комиссионными
испытаниями.
Акты
комиссионных
испытаний
утверждены
директором ГНУ ВНИИВВиМ Россельхозакадемии 13.12.2011 г. Статистическая
обработка включала расчеты средних арифметических значений, стандартных
отклонений результатов полимеразной цепной реакции в режиме реального времени,
вычисления эволюционных дистанций с помощью программы MEGA 3.1. Научные
7
положения, выводы
и
практические предложения диссертационной
работы
аргументированно отражают содержание диссертации.
Исследования по теме диссертационной работы представлены и обсуждены на
Международной научно-практической конференции молодых учёных “Достижения
молодых учёных в ветеринарную практику” (декабрь 2010г., г. Владимир), а также на
заседаниях ученого совета ГНУ ВНИВВиМ Россельхозакадемии в период с 2009 по
2012 гг.
1.8
Основные положения, выносимые на защиту
1.
Метод ПЦР с электорофоретической детекцией для выявления и
идентификации генома экзогенной формы вируса аденоматоза легких овец,
позволяющий дифференцировать его от эндогенной формы вируса.
2.
Тест-система на основе ПЦР в режиме реального времени для выявления
участка генома экзогенного вируса аденоматоза легких овец,
3.
Определение эффективности разработанной тест-системы на основе ПЦР
в режиме реального времени по выявлению участка генома вируса аденоматоза
легких овец.
4.
Результаты
филогенетического
анализа
нуклеотидных
последовательностей экзогенного и эндогенного вируса аденоматоза легких овец,
выделенных в Российской Федерации.
1.9
Объём и структура работы
Диссертация изложена на 102 страницах машинописного текста и состоит из
разделов: введение, обзор литературы, материалы, методы, результаты собственных
исследований,
обсуждение,
выводы,
практические
предложения,
список
использованной литературы, включающий 25 отечественных и 150 иностранных
источников; дополнена приложениями. Диссертация содержит 5 таблиц и 20
рисунков. В приложении представлены документы, подтверждающие достоверность
результатов работы, ее научную и практическую значимость.
1.10 Личный вклад соискателя
Основной
объём
исследований
проведён
автором
самостоятельно.
Консультативную и методическую помощь при выполнении отдельных этапов
работы оказывали следующие сотрудники института: к.б.н ., О.Н. Жигалева; к.в.н.,
микробиолог лаб. Биофизики А.Ю. Чичикин (эксперименты по заражению
животных); к.б.н., н.с. лаб. Молекулярной вирусологии Г.С. Бурмакина; к.б.н. Е.И.
8
Барышникова зав. Сектором по изучению ретравирусных инфекции животных
(освоение молекулярно-биологических методов исследования).
2
2.1
СОБСТВЕННЫЕ ИССЛЕДОВАНИЯ
Материалы
2.1.1 Вирусы
Образцы патологического материала содержащих геном вирус аденоматоза
легких овец, выделенных в ходе исследований хозяйств Удмуртской республики,
Тверской области в 2003 г. В качестве отрицательных контролей использовали
образцы органов и тканей клинически здоровых животных и образцы культуральных
материалов вируса ВМ и АЭК, полученные из лаборатории Музейных штаммов в
ГНУ ВНИИВВиМ.
В
качестве
референс-образца
генома
вируса
АЛО
использовали
рекомбиннантную плазмиду, содержащая полную копию генома вируса аденоматоза
легких овец JSRV S7, любезно предоставлена доктором Dusty Miller из научного
онкологического центра Фреда Хатчинсона, отдела биологии человека (США).
2.1.2 Животные
Для экспериментального воспроизведения болезни использовали ягнят
месячного и 1,5 месячного возраста романовской породы, полученные из чистого
вивария ГНУ ВНИИВВиМ Россельхозакадемии.
2.2
Методы
2.2.1 Подбор праймеров и зондов
Подбор праймеров и зондов проводили с помощью сравнительного анализа
полных нуклеотидных последовательностей и фрагментов различных генов изолятов
вируса АЛО, опубликованных в базе данных GenBank электронного ресурса NCBI с
помощью программы BioEdit 7.0.1 и Oligo 6.0.
2.2.2 Выделение и очистка нуклеиновых кислот
Для выделения генома вируса АЛО из проб крови, суспензии органов и
носовых смывов использовали фенол-хлороформную экстракцию, предложенную
Chomczynski, P. [10], и выделение с помощью коммерческого реагента Trizol LS
(Invitrogen, США). Для быстрой экстракции нуклеиновых кислот использовали
методику нуклеосорбции на силикагеле [9].
9
2.2.3 Проведение ПЦР с электрофоретической детекцией
Для
идентификации
генома
экзогенного
вируса
АЛО
использованы
олигонуклеотидные праймеры, фланкирующие участок U3 область LTR длиной 373
п.о., а для дифференциации эндогенной формы вируса АЛО использованы
олигонуклеотидные праймеры, на фланкирующие участок Env гена длиной 378 п.о.
При проведения ПЦР готовили реакционную смесь следующего состава:
праймеры по (10 pM) - 1,0 мкл, dNTP (10 mМ) – 0,3 мкл, , 5х буфер для ОТ
(«Амплисенс», Россия) – 7 мкл, Taq ДНК-полимераза - 0,1 мкл (1,0 ед.),
деионизованная вода - до 20 мкл, кДНК (исследуемый образец) – 5 мкл.
Для амплификации эндогенного вируса использовали такой же состав смеси.
2.2.4 Анализ ПЦР-продуктов
Анализ продуктов реакции осуществляли при помощи электрофореза в 1,5 –
2,0 % агарозном геле, содержащем 0,001 % бромистого этидия, при силе тока 50 мА
и напряжении 170 В. Электрофорез проводили в течение 30 минут.
2.2.5 ПЦР с детекцией продуктов амлификации в режиме реального
времени
Для ПЦР в режиме реального времени были подобранны высоконсервативные
олигонуклеотидные праймеры и флуоресцентный зонд на участок гена LTR длиной
86 п.о.
Амплификацию и детекцию флуоресценции проводили в термоциклере «RotorGene 6000» (CorbettResearch, Австралия) в пробирках емкостью 0,2 см3, в которые
вносили следующие компоненты в указанном порядке: 5x буфер для ОТ-ПЦР -5,0
мкл, dNTP (2,5 мМ) - 0,3 мкл, зонд (2 pМ) - 1 мкл, MgCl2 (25 мМ) - 0,5 мкл, смесь
праймеров (10 pМ каждого) - 1 мкл, Taq ДНК-полимераза – (1 ед.) -0,1 мкл,
деионизованная вода - до 20 мкл, матрица (исследуемый образец) - 5 мкл.
2.2.7 Нуклеотидное секвенирование
Выделение специфических продуктов амплификации из агарозного геля
осуществляли с помощью коммерческого набора «AxyPrep DNA Gel ExtractionKit»
(«Axygen», США).
Определение нуклеотидной последовательности фрагментов кДНК вируса
АЛО осуществляли с использованием набора «BigDye v. 3.1. Terminator» («Applied
Biosystems», США) на автоматическом секвенаторе Applied Biosystems Genetic
Analyzer 3130 («Applied Biosystems», США) согласно рекомендациям изготовителя.
10
2.2.8
Компьютерный
последовательностей
анализ
фрагментов
и
генома
сравнение
вируса
нуклеотидных
АЛО,
построение
филогенетических дендрограмм
Для выравнивания и анализа последовательностей использовали программы
BioEdit 7.0.1. Построение филогенетических деревьев проводили с помощью
алгоритма NJ (в том числе с добавлением метода численного ресэмплинга
«бутстреп») в реализации пакета MEGA, версия 3.1.
РЕЗУЛЬТАТЫ СОБСТВЕННЫХ ИССЛЕДОВАНИЙ
3
3.1
Разработка метода ПЦР с электорофоретической детекцией для
выявления и идентификации генома экзогенных форм вируса аденоматоза
легких овец, позволяющего дифференцировать его от эндогенной формы
вируса.
В связи с отсутствием методов прижизненной диагностики вируса АЛО, на
первоначальном этапе нашего исследования была разработка метода ПЦР с
электрофоретической детекций.
Анализ
нуклеотидных
последовательностей
генов
вируса
АЛО,
представленных в базе данных GenBank (NCBI), показал, что существует
возможность выделения двух разных форм вируса АЛО: эндогенного и экзогенного.
По зарубежным литературным данным обнаружены основные различия
нуклеотидного состава экзогенной от эндогенной формы вируса АЛО в участке U3
области LTR.
Исходя из этого, были подобраны специфические олигонуклеотидные
праймеры для экзогенного вируса АЛО на участок U3 области LTR, которые
участвуют в процессе рекомбинации и содержат элементы стимуляции усиления
гена, регулирующего экспрессию вируса АЛО. Эта область имеет наименьшую
идентичность
с
эндогенными
последовательностями
вируса
АЛО.
Для
дифференциации эндогенной формы нами были выбраны вырожденные праймеры на
участок гена Env гликопротеина эндогенных ретровирусов с целью выявления
максимального числа изолятов вируса.
Последовательности подобранных праймеров и размер амплифицируемых
фрагментов представлены в таблице 1.
11
Таблица 1 - Олигонуклеотидные праймеры для постановки ПЦР
№
1
2
Код
Длина
фрагмента
5`-3` последовательность
Праймеры для экзогенного вируса АЛО (JSRV)
Sh-F
5`-gtg aag ggt taa gtc ttg gga g-3`
Sh-R
5'- ccagcacaagcaagagtggc - 3'
Праймеры для эндогенного вируса АЛО (enJSRV)
ENV-F
5`-ttt cta act ttc cta gcc ttc att c -3`
ENV-R
5`- cyw tyt yct atg aar tgt tgc cgr a-3`
Рассчитанные
олигонуклеотидные
праймеры
для
373 п.о.
378 п.о.
выявления
геномов
эндогенного и экзогенного вируса АЛО имели схожую температуру отжига (60 – 63
°С). Данный температурный интервал получен с учетом размера и GC-состава
праймеров, а также температур отжига, вычисленных с помощью программы Oligo.
Это позволило нам использовать одинаковые температурные режимы для
амплификации
ПЦР-фрагментов,
что
не
повлияло
на
специфичность
и
чувствительность реакции (рисунок 1).
Рисунок 1 - Электрофореграмма продуктов ПЦР с праймерами для эндогенного и экзогенного
вируса АЛО: 1, 2 – образцы эндогенной формы вируса АЛО; 3, 4, 5 – образцы экзогенной формы
вируса АЛО; 6, 7 – отрицательный контроль; М-маркер молекулярного веса на 1000п.о.
Специфичность выявления экзогенного и эндогенного вируса АЛО оценивали
на панели биологического и патологического материалов, содержащих гомологичные
и гетерологичные вирусы, пробы органов и крови клинически здоровых животных.
Всего использовали 10 проб, из которых 3 были заведомо положительными. Эти
образцы получены от овец с патологоанатомическими признаками АЛО из Тверской
и Удмуртской области, а также плазмида, содержащая полную копию генома вируса
АЛО, любезно представленная доктором Dusty Miller из научного онкологического
12
центра Фреда Хатчинсона, отдела биологии человека (США) и 6 - заведомо
отрицательными. Результаты опыта представлены в рисунке 2 и таблице 2.
Б
А
Рисунок 2 - А) Электрофореграмма результатов выявления генома экзогенного вируса АЛО: 1,
2, 3, 4, 5, 8 – биологических проб от клинически здоровых животных; 6, 7 - 10 % суспензии легкого
овцы с патологоанатомическими признаками АЛО; 9 –плазмида, содержащая полную копию генома
вируса аденоматоза легких овец JSRV 45 копий/мкл; 10 –отрицательный контроль; М – маркер
молекулярного веса на 1000 п.о.
Б) Электрофореграмма результатов выявления генома эндогенного вируса АЛО: 1 носоглоточный смыв от клинически здоровых овец; 2 –кровь от клинически здоровой овцы; 3, 4, 5, 9 –
гетерологичные вирусы; 6, 7 - 10 % суспензии легкого овцы с патологоанатомическими признаками
АЛО; 8 – кровь клинически здоровой козы; 10 –отрицательного контроля; М – маркер молекулярного
веса на 1000 п.о.
Использование метод ПЦР позволяет идентифицировать и дифференцировать
экзогенные и эндогенные формы вируса АЛО, при отсутствии взаимодействия
праймеров с гетерологичными образцами. Показано, что эндогенную форму вируса
АЛО можно выявить как у здоровых, так и у зараженных вирусом АЛО.
Ложноположительных и ложноотрицательных результатов при постановке реакции
не выявлено.
13
Таблица 2 - Перечень материалов, использованных для оценки специфичности
метода ПЦР
Результаты ПЦР
Экзогенная
Эндогенная
форма АЛО форма АЛО
№
Наименование биопрепарата
проб
1
2
3
4
5
6
7
8
9
Носоглоточные смывы клинически здоровой
+
овцы
Кровь клинически здоровой овцы
+
Культура клеток ПЯ, зараженная вирусом ВМ,
штамм К-796 4,5 lg ТЦД50/см3.
Культура клеток СМЯ, зараженная вирусом ВМ,
штамм М-88 3,5 lg ТЦД50/см3.
Культура клеток СМК, зараженная вирусом АЭК,
штамм Тверской 5,0 lg ТЦД50/см3.
10 % суспензия легкого овцы
патологоанатомическими признаками АЛО № 12
+
+
(Пермь)
10 % суспензия легкого овцы с
патологоанатомическими признаками АЛО № 2
+
+
(Ижевск)
Кровь от клинически здоровой козы
+
Плазмида JSRV содержащая полную копию
генома вируса аденоматоза легких овец (45
+
копий/мкл).
Примечание: «+»- положительный результат, « - » - отрицательный результат
3.2
Разработка тест-системы на основе ПЦР-РВ для выявления генома
вируса АЛО
Преимуществом ПЦР-РВ является экспрессность и возможность проведения
количественного анализа накопления продуктов полимеразной цепной реакции, а
также автоматическая регистрация и интерпретация полученных результатов,
которая снижает трудозатратность и повышает чувствительность и специфичность
системы,
пришедшей
на
смену
визуальной
оценки
результатов
ПЦР
с
электрофоретической детекцией.
С этой целью нами была выбрана технология гибридизационных зондов
TagMan, контролирующая кинетику ПЦР непосредственно в ходе амплификации с
использованием резонансного тушения флуоресценции.
Основным
компонентом
для
тест-систем
являются
оригинальные
олигонуклеотидные праймеры и флуоресцентный зонд, которые нами были
подобранны на участок U3 области LTR экзогенного вируса АЛО длиной 86 п.о.. Для
14
детекции кДНК вируса АЛО использовали зонд, содержащий на 5ʼ конце
флуороформ FAM, на 3ʼ конце гаситель BHQ1, а результаты учитывали по каналу
Green (таблица 3).
Таблица 3 - Олигонуклеотидные праймеры и зонд для постановки ПЦР-РВ
Название
Длина
5`-3` последовательность
олигонуклеотида
фрагмента
JS-F
5'- aaa gcc aaa gcc tag gac aa -3'
86 п.о.
JS-R
5'- agc aaa cat ccg agc ctt aa -3'
JS-R
FAM- 5'- tac cta agc tcc ctg tcc cgc c -3' -RTQ-1
Для определения качества разработанной тест-системы одним из основных
показателей
является
аналитическая
чувствительность,
которую
возможно
определить при данном заболевании с помощью рекомбинантной плазмиды, так как
отсутствуют чувствительные клеточные системы для выделения вируса АЛО.
Величину
оптической
плотности
очищенного
препарата
плазмидной
ДНК
определяли спектрофотометрически. Подсчёт концентрации плазмидных копий в 1
см3 определяли по формуле:
N = концентрация плазмиды (г/см3) х число Авогадро (молекул/моль)
молярная масса плазмиды (г/моль)
Из исходного препарата плазмиды готовили серию десятикратных разведений
с концентрацией ДНК от 797,65 мкг/см3 до 0,079765 пг/см3, что соответствует
концентрации плазмиды от 4,5×1015 до 4,5×104 молекул/см3. Предельное разведение
плазмиды, при котором в ПЦР-РВ регистрировали положительный сигнал,
содержало 45000 копий плазмиды/см3 (45 копий плазмиды/мм3) (рисунок 3).
Учитывая, что в реакцию брали по 5 мкл раствора разведенной плазмиды, в ПЦР-РВ
была можно выявить 225 копии ДНК на реакцию.
15
Рисунок 3 - Кривые накопления флуоресцентного сигнала специфического участка ДНК
плазмиды, содержащей полную копию генома вируса АЛО, по каналу FAM/Green
Для более точной характеристики тест-системы использовали не только
эффективность реакции и коэффициент корреляции, но и количественный анализ.
Эффективность реакции и коэффициент корреляции были определены по
наклону кривой с использованием программного обеспечения прибора «RotorGene
6000» («Corbett Research», Австралия). Эффективность реакции составила 100 %, а
коэффициент корреляции 0,99 (рисунок 4). Полученное значение свидетельствует о
том, что данные максимально совпадают с линией наибольшего соответствия и,
следовательно, о ее высокой зависимости между двумя переменными (∆Ct и
количеством циклов).
10-4
10-4
10-11
10-11
Рисунок 4 - Результаты определения эффективности реакции и коэффициента корреляции
разработанной тест-системы. Кривые накопления продуктов амплификации при использовании в
качестве матрицы от 10-4 до 10-11 разведенной плазмиды
Полученные препараты разведённой плазмидной ДНК использованы в
качестве стандартов для количественной оценки генома вируса АЛО в образцах
патологического материала легких овец, выделенных в Российской Федерации, с
16
помощью ПЦР в режиме реального времени. Результаты представлены на рисунке 5
и в таблице 4.
1
3
4,5×1011
2
1
2
3
4,5×106
Рисунок 5 - Количественная оценка накопления участка U3 области LTR вируса АЛО при
использовании образцов, выделенных в Российской Федерации, относительно плазмидных
стандартов с разведением от 10-6 до 10-11
Таблица 4 – Концентрация геномных копий/см3 образцов, выделенных в
Российской Федерации.
№ Название образца
1
2
3
Концентрация геномных копий/см3
1,65×108
8,71×107
1,37×108
Пермь 12
Ижевск 2
Пермь 9
В
ходе
исследований
определяли
аналитическую
специфичность
разработанной тест-системы на панели 3 образцов патологического материала легких
овец пораженных вирусом АЛО и рекомбинантной плазмиды. Кроме того, в работе
использовали пробы органов и кровь клинически здоровых животных, а также
патологический материал, содержащий гомологичне и гетерологичные вирусы. Для
этого использовали 15 проб, из которых 5 проб были заведомо положительными и 10
- заведомо отрицательными. Результаты исследования представлены таблице 5 и на
рисунке 6.
17
Таблица 5 - Перечень материалов, использованных для валидации тест-системы
Результат
№
ПЦР-РВ
Наименование материалов
пробы
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
Кровь от клинически здоровой овцы
Кровь от клинически здоровой козы
Носовые смывы от клинически здоровой овцы
Носовые смывы от клинически здоровой козы
10% суспензия легкого от клинически здорового ягненка.
Культура клеток СМК, зараженная вирусом АЭК, шт.
«Тверской» 5,0 lg ТЦД50/см3.
Культура клеток почки ягненка (ПЯ), зараженная вирусом
Висна, шт. К-796 4,5-5,0 lg ТЦД50/см3.
Культура клеток синовиальной мембраны ягненка (СМЯ),
зараженная вирусом Маеди, шт. М-88 3,5 lg ТЦД50/см3.
Кровь от клинически здоровой овцы, искусственно
контаминированная вирусом болезни Маеди разведении 1:10
шт.М-88.
Кровь от клинически здоровой козы, искусственно
контаминированная вирусом болезни АЭК шт. 75G-63в
разведении 1:10.
Плазмида JSRV, содержащая полную копию генома вируса
+
аденоматоза легких овец 45 копий/мкл .
10 % суспензия легкого овцы с патологоанатомическими
+
признаками АЛО, проба № 2 (Ижевск)
10 % суспензия легкого овцы с патологоанатомическими
+
признаками АЛО проба №12 (Пермь)
10 % суспензия легкого овцы с патологоанатомическими
+
признаками АЛО№ 14 проба (Пермь)
10 % суспензия легкого овцы с патологоанатомическими
+
признаками АЛО № 9 проба (Пермь)
Примечание: «+»- положительный результат, «-» - отрицательный результат.
18
JSRV
1
2
3
4
Рисунок 6 - Результаты выявления участка генома вируса АЛО в шифрованных образцах
патологического материала легких овец с помощью метода ПЦР в режиме реального времени: 1 –
Пермь 12; 2 - Пермь 9; 3 – Ижевск 2; 4 – Пермь 14; Плазмида JSRV, содержащая полную копию генома
вируса АЛО
Применение испытуемой тест-системы позволило выявить 5 из 5 заведомо
положительных образцов. Ложноположительные результаты при исследовании 10
заведомо отрицательных образцов отсутствовали. Аналитическая специфичность
тест-системы составила 100 %.
Все рассчитанные показатели свидетельствуют о возможности использования
данной тест-системы для лабораторной диагностики вируса АЛО.
3.3
Создание положительного контроля для тест-системы на основе
ПЦР в режиме реального времени.
При разработке диагностических тест–систем, основанных на ПЦР, для
выявления генома вируса АЛО разработан положительный контрольный образец
(ПКО). В качестве положительного контроля для разработанной тест–системы
сконструирована рекомбинантная плазмида, несущая последовательность участка
генома U3-области LTR экзогенного вируса АЛО.
Предварительно накоплен и выделен из агарозного геля ПЦР-продукт участка
U3 области LTR размером 373 п.о. Универсальный ТА–вектор представляет собой
линеаризованную
плазмиду
pGEM-T
Easy,
что
обеспечивает
эффективное
клонирование продукта ПЦР без использования рестрикции. Лигирование проводили
с использованием набора «pGEM-T Easy Vector System» («Promega», США).
Компетентные клетки E. coli Top 10 трансформировали неочищенной реакционной
смесью после лигирования методом электропорации. Наличие специфического
19
фрагмента определяли методом ПЦР с последующим секвенированием продуктов
реакции (рисунок. 6).
373 п.о.
А
Б
Рисунок 7 - Схема рекомбинантной плазмиды (А – Бактериальный вектор pGEM-T Easy
vector; Б –ПЦР-фрагмент вируса АЛО, выделенного в Российской Федерации, для встройки в вектор.
В результате проведенной работы была получена рекомбинантная плазмида,
несущая встройку экзогенного вируса АЛО, которая успешно применяется в качестве
положительного
стабильностью
контрольного
при
хранении
образца
и
для
ПЦР
использовании,
–
РВ.
Она
переносит
отличается
многократное
замораживание-оттаивание, что было показано в ходе исследований. Кроме того,
приготовление такого контроля безопасно, т.к. исключена работа с вирусным
агентом.
3.4
Изучение филогенетического родства вируса АЛО.
Определение филогенетического родства генома вируса АЛО, выделенных в
хозяйствах Российской Федерации, являлось необходимым аспектом в изучении
молекулярной эпизоотологии эндогенного и экзогенного вирусов АЛО.
C целью определения различий в геномах вируса АЛО выбраны наиболее
информативная для экзогенной формы вируса U3 область LTR, тогда как для
эндогенной формы вируса – Env ген. Для изучения нуклеотидных последовательных
генома вируса АЛО выделенных в патологическом материале легких овец на
территории
Российской
Федерации,
использовали
следующие
образцы
патологического материала легких овец: 1 - Пермь 12; 2 - Пермь 9; 3 -Ижевск 2.
Из данных органов была приготовлена 10 %-суспензия, выделена суммарная
кДНК и использована в качестве матрицы для ПЦР с последующим секвенированием
продуктов реакции.
20
Филогенетический анализ и построение дендограмм, характеризующих
степень гомологии исследованных участков генома, проводили с использованием
программы
«MEGA
3.1»
и
«BioEdit
6.0».
Для
сравнения
использованы
опубликованные в базе данных GenBank последовательности полноразмерных
геномов и участков U3 области LTR и Env гена.
В результате проведенных исследовании установлено, что по первичной
структуре участка U3 области LTR выявленные нами геном вируса АЛО на
территории Российской Федерации, входил в один кластер с изолятами из США
(рисунок-8).
Рисунок 8 - Дендрограмма, построенная на основании данных гомологии нуклеотидных
последовательностей фрагмента U3 области LTR изолятов экзогенного вируса АЛО, выделенных на
территории Российской федерации с 2003 г.: 1JSRV Russia - Пермь12; 2JSRV Russia - Пермь 9; 3JSRV
Russia - Ижевск 2
Филогенетическое взаимоотношение генома эндогенной формы вируса АЛО
представлено на рисунке-9. Из дендрограммы видно, что геном эндогенного вируса
АЛО циркулирующий на территории Российской Федерации формируют отдельный
кластер от других известных изолятов вируса АЛО.
21
Рисунок 9 - Дендрограмма, построенная на основании данных гомологии нуклеотидных
последовательностей фрагмента Env гена изолятов эндогенного вируса АЛО, выделенных на
территории России с 2003 г.: enJSRV 1) Russia1 - Пермь12; 2) enJSRV Russia 2 - Пермь 9;3)enJSRV
Russia 3 - Ижевск 2
Филогенетическое родство генома экзогенного вируса АЛО выделенных на
территории Российской Федерации с изолятами из зарубежных стран, может быть
связано с активным импортом племенных животных в овцеводческие хозяйства
нашей страны.
Нуклеотидные последовательности генома эндогенной формы вируса АЛО,
выделенных в Российской Федерации, свидетельствует об отсутствии взаимосвязи с
изолятами выделенных в зарубежных странах и циркуляции его только в нашей
стране.
22
4 ВЫВОДЫ
1.
Разработан и усовершенствован метод ПЦР с электорофоретической
детекцией для выявления и идентификации генома вируса аденоматоза легких овец,
позволяющий дифференцировать его от эндогенной формы вируса.
2.
Разработана «Тест-система для выявления участка генома вируса
аденоматоза легких овец метода ПЦР в режиме реального времени» с аналитической
чувствительностью выявления 225 копии ДНК на реакцию.
3.
Для контроля за прохождением реакции амплификации разработан
универсальный положительный контроль для тест-системы на основе ПЦР в режиме
реального времени, предстваляющей собой рекомбинантную плазмиду, несущая
последовательность участка области U3 LTR размером 373 п.о.
4.
На основе данных нуклеотидного секвенирования фрагмента U3 области
LTR экзогенной формы вируса аденоматоза легких овец выделенных на территории
Российской Федерации и филогенетического анализа выявлено их родство с
изолятами, выделенными на территории США.
5.
В результате сравнения нуклеотидных последовательностей фрагмента
гена Env эндогенной формы вируса аденоматоза легких овец, выделенных в
Российской Федерации, и филогенетического анализа установлено, что они
формируют отдельную группу и отличаются от последовательностей зарубежных
изолятов, заложенных в GenBank.
5
ПРАКТИЧЕСКИЕ ПРЕДЛОЖЕНИЯ
Подобранные специфичные праймеры предлагаются для идентификации и
дифференциации экзогенной и эндогенной форм вируса аденоматоза легких овец, а
также в целях изучения нуклеотидного состава фрагмента U3 области LTR и участка
Env гена указанного вируса.
Подобранные
оригинальные
олигонуклеотидные
праймеры
и
зонд
предлагаются для использования в целях выявления фрагмента генома экзогенной
формы вируса аденоматоза легких овец.
Разработанная тест – система, основанная на ПЦР в режиме реального
времени, рекомендуется для обнаружения участка генома вируса аденоматоза легких
овец с аналитической чувствительностью выявления 225 копии ДНК на реакцию.
В
качестве
руководства
по
применению
разработанной
тест-системы
предлагаются «Методические положения по выявлению генома вируса АЛО методом
23
полимеразной цепной реакции в режиме реального времени», утвержденные
академиком-секретарем
Смирновым
Отделения
12.04.2012
г.,
ветеринарной
рекомендуются
для
медицины
РАСХН
использования
в
А.М.
научно-
исследовательских институтах и ветеринарной практике.
6
1.
СПИСОК ИСПОЛЬЗОВАННОЙ ЛИТЕРАТУРЫ
Архипов, Н. И. Патологоанатомическая диагностика вирусных болезней
животных/ Н.И. Архипов, С.Ф. Чевелёв, Г.И. Брагин .- М.: Колос,1984. - С. 101 –
103.
2.
Ассоциированное течение медленных инфекций овец /В.А. Шубин, В.С.
Суворов, В.Л. Кувшинов, Р.Д. Поздеева // Бюллетень ВИЭВ. Прионные и ретровирусные
инфекции животных. – М., 1996. – Вып. 77.- С. 28.
3.
Кувшинов, В. Л. Дифференциальная патоморфологическая диагностика и
клинико-эпизоотологические особенности медленных инфекций овец:
диссертация
докторара ветеринарных наук: 16.00.02/ Кувшинов В.Л. – Иваново, 2007 – С. 248.
4.
Медленные
инфекции
по
данным
клинико
-
эпизоотологического,
патоморфологического и серологического исследований/ В.А. Шубин, В. С. Суворов, С. П.
Ханхасыков, Р. Д. Поздеева, В. В. Исаев, А. К. Моругин, Т. В. Баринова, В. Л. Кувшинов //
Диагностика, патогенез, патоморфология и профилактика болезней сельскохозяйственных
животных: материалы Всероссийской научно – методической конференции по
патологической анатомии сельскохозяйственных животных. – Воронеж, 1993. – С. 12 – 13.
5.
Analysis of integration sites of jaagsiekte sheep retrovirus in ovine pulmonary
adenocarcinoma / C. Cousens [et al.] // J. Virol. -2004. -Vol. 78. -P.8506-8512.
6.
Arnaud, F. Coevolution of endogenous betaretroviruses of sheep and their host / F.
Arnaud, M. Varela, T.E. Spencer and M. Palmarini // Cell Mol Life Sci. – 2008 –Vol. 65. – P. 34223432.
7.
Arnaud, F.Aparadigm for virus-host coevolution: sequential counter-adaptations
between endogenous and exogenous retroviruses / Arnaud, F., Caporale, M., Varela, M., Biek, R.,
Chessa, B., Alberti, A., Golder, M., Mura, M., Zhang, Y.P., Yu, L., Pereira, F., Demartini, J.C.,
Leymaster, K., Spencer, T.E. and Palmarini M. // Veter. Pathog - 2007a - N 3. - P. 170.
8.
Bai, J. Sequence comparison of JSRV with endogenous proviruses: envelope
genotypes and a novel ORF with similarity to a G-protein-coupled receptor / J. Bai, J. V.Bishop, J.
O. Carlson, J. O. J. C. DeMartini // J. Virol – 1999 – Vol. 258 – P. 333-343.
24
9.
Boom, R. Rapid and simple method for purification of nucleic acids / R. Boom [et
al.] // J. of Cl. Microbiology. – 1990. – Vol. 28, № 3. – Р. 495 – 503.
10.
Chomczynski, P. Single-step method of RNA isolation by acid guanidinium
thiocyanate-phenol-chloroform extraction / P. Chomczynski, Sacchi // Anal. Biochem. – 1987. –
Vol. 162, № 1. – P. 156 – 159.
11.
DeMartini J.C. Endogenous retroviruses related to jaagsiekte sheep retrovirus.
/ DeMartini JC, Carlson JO, Leroux C, et al. // Curr Top Microbiol Immunol – 2002 – Vol.
275 – P. 118-137.
12.
DeMartini, J. C., Jaagsiekte sheep retrovirus proviralclone JSRV(JS7), derived from
the JS7 lung tumor cell line, induces ovine pulmonary carcinoma and is integratedinto the
surfactant protein A gene / J. C. DeMartini, J. V. Bishop, T. E. Allen, F. A. Jassim, J. M., Sharp, et
al.// J. Virol. - 2001 - Vol. 75 – P. 4239 - 4246.
13.
DeMartini, J.C. Sheep pulmonary adenomatosis in Peru: epidemiologic, pathologic
and ultrastructural studies / J. C. DeMartini, S. P. Snyder Slow Virus Diseases in Sheep. Luxembourg: CEC Report EUR 8076 EN, 1985. -P. 333 – 343
14.
Denner, J. Endogenous retroviruses. Retroviruses / R. Kurth and N. Bannert. //
Nopen reading frameolk, Caister Academic - 2010 - P. 35 - 70.
15.
Manual of Diagnostic Tests and Vaccines for Terrestrial Animals
Сетевойресурс.- http://www.oie.int/eng/norms/mmanual/A_summry.htm.
16.
Palmarini, M. The long terminal repeat of Jaagsiekte sheep retrovirus is preferentially
active in differentiated epithelial cells of the lungs / M. Palmarini, S. Datta, R. Omid, C. Murgia
and H. Fan // J. Virol. - 2000a - Vol. 74 – P. 5776 - 5787.
17.
Platt J. A. Alveolar type II cells expressing jaagsiekte sheep retrovirus capsid
protein and surfactant proteins are the predominant neoplastic cell type in ovine pulmonary
adenocarcinoma / J. A. Platt, N. Kraipowich, F. Villafane, J. C. DeMartini // Veter. Pathol 2002. – Vol. 39. – N 3. – P. 341 – 352.
18.
Sharp J.M. and DeMartini J.C. Natural history of JSRV in sheep. In: H Fan,
ed. Jaagsiekte Sheep Retrovirus and Lung Cancer. Current Topics in Microbiology and
Immunology. Berlin: Springer, 2002; 275:55-116.
19.
Revealing the history of sheep domestication using retrovirus integrations / B.
Chessa, F. Pereira, F. Arnaud, A. Amorim, F. Goyache, I. Mainland, R.R. Kao, J.M.
Pemberton, D. Beraldi, M.J. Stear, A. Alberti, M. Pittau, L. Iannuzzi, M.H. Banabazi, R.R.
Kazwala, Y.P. Zhang, J.J. Arranz, B.A. Ali, Z. Wang, M. Uzun, M.M. Dione, I. Olsaker,
25
L.E. Holm, U. Saarma, S. Ahmad, N. Marzanov, E. Eythorsdottir, M.J. Holland, P.AjmoneMarsan, M.W. Bruford, J. Kantanen, T.E. Spencer, M. Palmarini. // Science.- 2009. - N
324. – P. 532-536.
7
СПИСОК НАУЧНЫХ РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ
ДИССЕРТАЦИИ
1.
Н.М. Шобогоров. Разработка метода ПЦР в режиме реальном времени для
выявления генома вируса АЛО // С.Ж. Цыбанов, Д.В. Колбасов, Н.М. Шобогоров//
Веткорм. – 2012. - № 5. – С. 53 – 54.
2.
Н.М. Шобогоров. Структурная организация генома вируса АЛО / Н.М.
Шобогоров // Научные основы производства и обеспечения качества биологических
препаратов для АПК: материалы Междунар. Научной. – практической конференции –
Щелково. 2012. – 99 – 106.
3.
Выявление и дифференциации онкогенного ретровируса овец методом ПЦР /
Н.М. Шобогоров, О.Н. Жигалева, А.Ю. Чичикин, С.Ж. Цыбанов // Молекулярная
биология. – 2010. Сборник трудов 7 – й Всероссийской научно – практической
конференции с международным участием под редакции В.И. Покровского: ООО
«ИнтерЛабСервис». – Т. II. – М., 2010. – С 197 – 199.
4.
Применение ПЦР – РВ для обнаружения вируса АЛО / Н.М. Шобогоров, О.Н.
Жигалева, С.Ж. Цыбанов, Д.В. Колбасов // Молекулярная диагностики. – 2010. Сборник
трудов 7 – й Всероссийской научно – практической конференции с международным
участие под редакции В.И. Покровского: ООО «ИнтерЛабСервис». – Т. II. – М., 2010.
5.
Shobogorov, N.M. Application of the real – time PCR for the diagnosis of ovine
pulmonary adenocarcinoma / N.M. Shobogorov, S.J. Tsybanov, D.V. Kolbasov // 16 – th
International Symposium of the World Association of Veterinary Laboratory Diagnosticians
(WAVLD): 10 – th OIE Seminar. 32 – nd Symposium of AVID, June – 5 – 8, 2013 Berlin,
Germeny. – Giessen, 2013. – P. 355.
6.
D 23: Genetic Diagnostics of ovine pulmonary adenomatosis / N. Shobogorov, O.
ZhiGALEVA, STSYBANOV, D. Kolbasov // Epizone. 5 – th Annual Meeting, 11 – 14 aprill 2011/
- The Netherlands, 2011.
26
8 СПИСОК СОКРАЩЕНИЙ
АЛО – аденоматоз легких овец;
ВВМ – вирус вистна – маэди;
АЭК – артрит энцефалит коз;
ГТЦ – гуанидинтиоционат;
ДНК – дезоксирибонуклеиновая кислота;
dNTPs – дезоксирибонуклеотидтрифосфаты;
кДНК – комплементарная ДНК;
МЭБ - Международное Эпизоотологическое Бюро;
МКТВ – Международный комитет по таксономии вирусов;
ПЦР – полимеразная цепная реакция;
н.о. - нуклеотидное основание;
п.о. - пар оснований;
ПЦР-РВ - полимеразная цепная реакция в реальном времени;
тыс.п.о. - тысяч пар оснований;
ТЕ - трис-ЭДТАбуфер;
Трис - трис (гидроксиметил) аминометан:
JSRV – экзогенная форма вируса АЛО;
enJSRV – эндогенная форма вируса АЛО;
27
Отпечатано в типографии ГНУ ВНИИВВиМ Россельхозакадемии,
г. Покров Владимирской области
Тираж 80 экз.
Документ
Категория
Без категории
Просмотров
12
Размер файла
982 Кб
Теги
молекулярная, методов, разработка, генетический, аденоматоза, диагностика, легких, совершенствование, овец
1/--страниц
Пожаловаться на содержимое документа