close

Вход

Забыли?

вход по аккаунту

?

Методы анализа метилирования ДНК.

код для вставкиСкачать
БИОХИМИЯ
© КОЛЛЕКТИВ АВТОРОВ, 2012
УДК 616-006.04-092:612.6.05]-074
Ю. В. Филина, А. Г. Габдулхакова, М. И. Арлеевская
МЕТОДЫ АНАЛИЗА МЕТИЛИРОВАНИЯ ДНК
ЦНИЛ Казанской государственной медицинской академии
Статья посвящена обзору методов анализа метилирования ДНК – одного из ключевых механизмов регуляции экспрессии
генов. Сайты аберрантного метилирования являются потенциальными маркерами неопластической трансформации. В настоящее время активно ведется разработка клинических тестов на основе анализа метилирования для прогнозирования и
диагностики раковых заболеваний, детекции микрометастазов и пренатальной диагностики некоторых наследственных
синдромов. В обзоре проведен сравнительный анализ методов, которые используются в клинической практике и для проведения фундаментальных исследований.
К л ю ч е в ы е с л о в а : метилирование, CpG, рестрикционный анализ, бисульфитная конверсия, ПЦР, иммунопреципитация, секвенирование
Yu.V. Filina, A.G. Gabdulkhakova, M.I. Arleyevskaya
THE METHODS OF ANALYSIS OF DNA METHYLATION
The article deals with the review of methods of analysis of DNA methylation as one of key mechanisms of regulation of gene expression.
The sites of aberrant methylation are potential markers of neoplastic transformation. At the present time, the development of clinical
tests is in the process on basis of analysis of methyla-tion to make prognosis and to diagnose oncologic diseases, micro metastases
de-tection and prenatal diagnostics of certain hereditary syndromes. The comparative analysis of methods applied in clinical practice
and in carrying out fundamental studies was made.
K e y w o r d s : methylation, CpG, restriction enzyme digests analysis, bisulfite con-version, polymerase chain reaction,
immune precipitation, sequenation
Введение. Метилирование – единственная ковалентная модификация ДНК – осуществляется путем переноса метильной
группы с S-аденозил метионина в 5-ю позицию пиримидинового кольца цитозина (рис. 1) [1, 11].
Метилирование ДНК является ключевым механизмом,
регулирующим эмбриональное развитие, транскрипцию генов, структурную организацию хроматина, инактивацию
Х-хромосомы, хромосомную стабильность и геномный импринтинг. В настоящее время появляется все больше данных
о роли аберрантного метилирования ДНК в развитии различных патологий: онкологических заболеваний, импринтных
расстройств, различных воспалительных процессов [3, 11, 12].
Сайты аберрантного метилирования могут использоваться как маркер неопластической трансформации даже очень
малого количества клеток. В настоящее время анализ метилирования предлагают использовать для детекции микрометастазов у пациентов с гастроинтестинальным раком и раком
легких, прогнозирования развития рака груди, диагностики
рака простаты [14] и ранней карциномы [13], пренатальной
диагностики [4, 8, 13]. Причем для анализа метилирования
необязательно исследование образцов ткани, достаточно и
небольшого количества опухолевой ДНК из крови, плазмы и
других биологических жидкостей.
Методы анализа метилирования. Большинство методов
определения метилирования ДНК основаны на одном из следующих принципов (рис. 2):
1) использование метилчувствительных рестрикционных
эндонуклеаз с последующим анализом полученных фрагментов,
2) специфическая детекция 5-метилцитозина или продуктов его превращения (бисульфитная конверсия) [6, 7].
Д л я ко р р е с п о н д е н ц и и :
Филина Юлия Викторовна, мл. науч. сотр.
Адрес: 420012, Казань, ул. Муштари, 11
Телефон: yulifil@rambler.ru
1. Рестрикционный анализ – классический метод анализа метилирования, основанный на неспособности некоторых рестрикционных ферментов разрезать метилированные
последовательности ДНК. Пара ферментов HpaII–MspI распознает последовательность CCGG, но рестриктаза HpaII
не способна разрезать ДНК, в которой метилирован внутренний С, что позволяет использовать эти ферменты для
быстрого определения метилированных участков. Рестрикционный метод имеет несколько недостатков. Главный – не
все CG расположены в последовательностях CCGG, что
может привести к появлению ложноотрицательных результатов. Для проведения рестрикции и последующего анализа
необходимо не менее 0,5–1 мкг ДНК [26].
Полученные после рестрикции фрагменты можно анализировать несколькими способами: масс-спектрометрический
анализ, саузерн-блотт, лигирование с мечеными нуклеотидами, полимеразно-цепная реакция (ПЦР) и др.
1.1. Масс-спектрометрический анализ. Для анализа метилирования ДНК обычно используют специфическую ре-
Рис. 1. Структура цитозина (а) и 5-метилцитозина (б).
15
КЛИНИЧЕСКАЯ ЛАБОРАТОРНАЯ ДИАГНОСТИКА, № 8, 2012
гиона, сочетает реакцию рестрикции и
ПЦР. После рестрикции проводят ПЦР с
праймерами, фланкирующими рестрикционные сайты, амплификация происходит только в том случае, если ДНК
была метилирована и не подверглась
разрезанию. Так же как и Саузерн-блотт,
этот метод может определить метилирование только в сайтах рестрикции метилчувствительных ферментов. Более
того, при полной рестрикции неметилированной ДНК ПЦР не происходит, что
может привести к ложноположительноРис. 2. Методы анализа метилирования ДНК (по [10] с изменениями).
му результату. Неполная рестрикция и
присутствие малого количества метилированных аллелей дают сходные резульстрикцию совместно с MALDI-TOF-масс-спектрометрией
таты, и этот метод нельзя использовать для определения, наили электроспрей-ионизацией. Основным требованием для
пример, гиперметилирования онкосупрессоров, когда клетки
осуществления масс-спектрометрического анализа являетс метилированными аллелями составляют лишь небольшую
ся высокая химическая чистота исследуемого соединения.
фракцию в популяции [18].
Особенности анализатора налагают ограничение на раз2. Бисульфитная модификация ДНК. В одноцепочечной
мер исследуемых молекул ДНК: средний предел измерений
ДНК бисульфит натрия преимущественно деаминирует циоколо 30 кДа (100 bp), нижняя граница не менее 600 Да [2].
тозин до урацила (и очень медленно деаминирует 5-метилМасс-спектрометрический анализ не удобен для применения
цитозин в тимин) (Shapiro et al., 1973). В 1992 г. Frommer и
в клинической практике, но в сочетании с рестрикционным
др. предложили использовать различие в реакционности бианализом, гибридизацией и другими методами лег в основу
сульфита для геномного секвенирования 5-метилцитозиновысокопроизводительных систем для сканирования метиливых остатков. Проводят полную денатурацию геномной ДНК
рования геномной ДНК [16].
и обработку бисульфитом в условиях, при которых цитозин
1.2. Полимеразное лигирование с мечеными нуклеотидастехиометрически конвертируется в урацил (рис. 4), но 5-меми. Меченые нуклеотиды (радиоактивные 3H-dCTP/-dGTP,
тилцитозин не подвергается изменениям. Результатом би32
P-dCTP/-dGTP или флюоресцентно-меченые dCTP/dGTP)
сульфитной реакции становятся цепи ДНК, которые больше
присоединяют по липким концам фрагментов, которые обне комплементарны [18, 19].
разуются после рестрикции (рис. 3). Метод позволяет опреБисульфитная конверсия – очень мощный метод, который
делить количество 5mC в образце ДНК. Долю метилированиспользуют для определения метилирования ДНК не только
ного цитозина (в норме 80–90%) рассчитывают по формуле:
простым секвенированием, но и в сочетании с ПЦР, SnuPE,
MethyLight, олигонуклеотидными микроматрицами, HPLC,
[MspI] - [HpaII]
––––––––––––– %,
пиросеквенированием и др. [10].
[MspI]
2.1. Бисульфитная ПЦР. При ПЦР-амплификации регде [MspI] и [HpaII] – радиоактивность/флюоресценция обгиона интереса в бисульфитобработанной ДНК весь ураразца после рестрикции соответствующей рестриктазой.
цил, ранее бывший цитозином, и тимин амплифицируются
и считываются так же, как тимин, а 5-метилцитозин – как
1.3. Саузерн-блотт позволяет определить общий статус
цитозин. После бисульфитной ПЦР ДНК можно клонирометилирования CpG-островков интересующего региона,
вать и секвенировать – процесс длительный и технически
но требует довольно большого количества (не менее 5 мкг)
довольно сложный. Без клонирования ПЦР-продуктов мегеномной ДНК и не обладает большой чувствительностью.
тод даже менее чувствителен, чем Саузерн-блотт (должно
Количество гибридизованных фрагментов может быть добыть метилировано не менее 25% аллелей) [15].
вольно высоким. Для CG-богатых последовательностей,
Метод бисульфитной ПЦР используют также в коммергде рестрикционные фрагменты имеют длину 100–500 bp,
ческих наборах для определения метилирования. Quantative
для фореза применяют 1,2% агарозный гель, который доMethyLight (Epigenomics): детекцию метилированных и невольно сложно использовать для блотта [9]. В то же время
метилированных участков производят при помощи динуклеоклеточные линии и особенно ткани поликлональны и содертидов CG и TG, меченных разными флюорофорами (рис. 5,
жат смешанные паттерны метилирования, поэтому анализ
а) [5, 27]. В наборе HeavyMethyl (Epigenomics) специфический блокатор препятствует амплификации бисульфитмобандов довольно сложен. Тем не менее этот метод гораздо
дифицированной ДНК, и амплификация происходит только
проще и быстрее, чем бисульфитная модификация [17].
при отсутствии метилирования. Детекция осуществляется по
1.4. ПЦР-анализ – более чувствительный метод, позволяприсоединению флюоресцентно-меченого CG рис. 5, б) [27].
ющий определить статус метилирования определенного ре2.2. Метилспецифичная ПЦР (MSP) позволяет определить статус метилирования интересующей последовательности вне зависимости от количества метилированных CpG
и не требует клонирования и использования метилчувствительных рестриктаз. После обработки ДНК бисульфитом
проводят амплификацию с праймерами, специфичными для
Подбор праймеров для MSP
Показатель
Рис. 3. Полимеразное лигирование с мечеными нуклеотидами.
16
Исходный праймер
Метилспецифичный праймер
Метилнеспецифичный праймер
Праймер смысловой цепи (left)
CAGAGGGTGGGGCGCACCGC
TAGAGGGTGGGGCGCATCGT
TAGAGGGTGGGGTGCACTGT
БИОХИМИЯ
Рис. 4. Бисульфитная конверсия цитозина в урацил [17].
Рис. 5. Принцип работы наборов Quantative MethyLight (а) и HeavyMethyl (б).
метилированных и неметилированных участков ДНК. ПЦРпраймеры в этом случае нужно подобрать таким образом,
чтобы они специфически связывались с только бисульфитмодифицированной цепью. Праймеры для каждой цепи будут
отличаться в той позиции, где были CG оригинальной последовательности (см. таблицу).
Метод требует небольшого количества геномной ДНК.
Отличается высокой чувствительностью (0,1% метилированных аллелей), поэтому представляется весьма удобным для
анализа клинических образцов [20].
2.3. Single Nucleotide Primer Extension (SnuPE) – метод,
который можно использовать для точного анализа метилирования в определенной позиции ДНК. После бисульфитной
обработки ДНК проводят отжиг праймеров, которые заканчиваются непосредственно перед анализируемым сайтом.
Затем осуществляют две реакции удлинения цепи – с радиоактивным dCTP и радиоактивным dTTP (рис. 6). В этих реакциях только один нуклеотид добавляется к праймерам. После
окончания реакции продукты разгоняются в акриламидном
геле, и анализируется радиоактивность меченых праймеров.
Для этого метода также можно использовать флюоресцентномеченые нуклеотиды [21].
3. Иммунопреципитация ДНК. В этом методе используют специфические антитела к белкам, способным селективно связывать метилцитозин, – таким как MeCP2
и MBD2 [6]. Метод относительно чувствительный и не
требует рестрикции геномной ДНК или бисульфитной
обработки. Данные, полученные методом иммунопреципитации, проще анализировать и интерпретировать, чем,
например, после бисульфитной конверсии. В то же время
иммунопреципитация позволяет получить данные только
об общем метилировании и не применима к изучению конкретного гена.
4. Микроматричный анализ метилирования ДНК. Конструирование микроматриц (micro-array) для анализа метилирования ДНК основывается на трех методах: рестрикции,
аффинной очистке и бисульфитной конверсии. Микрома-
тричная методология позволяет проводить сканирование
всей геномной ДНК.
Коммерческие микроматрицы NimbleGen ("Roche") выпускают в нескольких вариантах, что позволяет проводить
анализ метилирования отдельных хромосом человека.
Микроматрицы NimbleGen включают все классифицированные CpG-островки, в том числе и редко встречающиеся
[22]. Affymetrix (Santa Clara) – несколько типов платформ
для анализа метилирования. Они требуют очень малого
количества (не более 100 нг) ДНК, что дает возможность
использовать эти платформы для анализа метилирования в эмбриогенезе и проводить анализ малых образцов
[23]. Микроматрицы Agilent (Santa Clara, CA, США) используют для полногеномного сканирования и поиска
генов, метилированных при гематологических и эпите-
Рис. 6. Схема метода SnuPE.
17
КЛИНИЧЕСКАЯ ЛАБОРАТОРНАЯ ДИАГНОСТИКА, № 8, 2012
лиальных опухолях. Платформа позволяет анализировать
более 25 000 CpG-островков [24]. Illumina (San Diego)
BeadArrays представляют собой один из наиболее совершенных инструментов для полногеномного анализа и анализа метилирования определенных участков ДНК. Позволяет детектировать метилирование 2,5% CpG-нуклеотидов
и требует около 200 нг ДНК для анализа [25].
Микроматричный анализ отличается от секвенирования большей простотой и доступностью. Данные, полученные этим методом, легче интерпретировать. В то же
время микроматричные анализаторы имеют и ряд недостатков: более низкое разрешение, метилирование обнаруживается только в повторяющихся последовательностях
генома млекопитающих, так как метод основан на гибридизации и, таким образом, не дает полного представления
о геномном метилировании. Тем не менее на сегодняшний
день это наиболее удобный метод для использования в
клинической практике [6].
Л И Т Е РА Т У РА
1. Ванюшин Б. Ф. ,, Химия и жизнь. – 2004. – № 2. – С. 32–37.
2. Сидоров Л. Н. // Химия. – 2000. – № 4. – С. 24–30.
3. Allis C. D., Jenuwein T., Reinberg D. Epigenetic. – Cold Spring
Harbor; New York, 2007. – P. 23–61.
4. Buchholz T., Jackson J., Robson L., Smith A. // Hum. Genet. – 1998.
– Vol. 103, N 5. – P. 535–539.
5. Eads S., Danenberg D. K., Kawakami K. et al. // Nucl. Acids Res. –
2000. – N 8. – C. 1–8.
6. Gupta R., Nagarajan A., Wajapeyee N. // Bio. Techniques. – 2010.
N 4. – P. 3–11.
7. Kaur H., Halliwel B. // Biochem. J. – 1996. – Vol. 318. – P. 21–23.
8. Kubota T., Aradhya S., Macha M. et al. // J. Med. Genet. – 1996. –
Vol. 33. – P. 1011–1014.
9. Maniatis T., Fritsch E. E., Sambrook J. Molecular cloning. A
laboratory manual. – Cold Spring Harbor; New York, 1982.
10. Pappas J. J., Toulouse A., Bradley W. E. C. // Biol. Procedures
Online. – 2009. – N 1. – C. 99–112.
11. Robertson K. D. // Nat. Rev. Genet. – 2005. – N 4. – P. 597–610.
12. Song F., Smith J. F., Kimura M. T. et al. // Proc. Natl. Acad. Sci.
USA. – 2205. – N 9. – C. 3336–3341.
13. Tsou J. A., Hagen J. A., Carpenter C. L. et al // Oncogene. – 2002. –
Vol. 21. – P. 5450–5461.
14. Vanaja D. K., Ehrich M., Van den Boom D. et al. // Cancer Invest. –
2009. – Vol. 27, N 5. – P. 549–560.
15. epigenome-noe.net/researchtools/protocol.php
16. http://www.sequenom.com/Home/Products–-Services/GeneticAnalysis/MassARRAY-Analyzer-4
17. http://www.methods.info/Methods/DNA_methylation/Restriction_
analysis.html
18. http://www.epigeneticstation.com/sodium-bisulfite-dna-sequencind/
19. http:/www.methods.info/Methods/DNA_methylation/Bisulphite_s
equencing.html
20. http://www.epigeneticstation.com/methylation-specific-pcr/
21. http://www.methods.info/Methods/DNA_methylation/SNuPE.html
22. http://www.nimblegen.com/products/lit/epigenetics_brochure_201
0_02_23.pdf
23. http://www.affymetrix.com/estore/browse/brand/affymetrixMicroa
rraySolutions/brandAffymetrixMicroarraySolutions-overview.jsp
24. http://www.genomics.agilent.com/Human CpG Island Microarrays
25. http://www.illumina.com/applications.ilmn#custom_low_to_mid_
plex_methylation_analysis
Поступила 05.04.11
© К. В. ЗОЛОТАРЕВ, 2012
УДК 616-074/-078
К. В. Золотарев
АНАЛИТИЧЕСКИЙ ПОДБОР ЧАСТОТЫ ВРАЩЕНИЯ РОТОРА ЦЕНТРИФУГИ И ВРЕМЕНИ
ЦЕНТРИФУГИРОВАНИЯ В ХИМИЧЕСКОЙ, БИОХИМИЧЕСКОЙ И МИКРОБИОЛОГИЧЕСКОЙ
ПРАКТИКЕ
Учреждение РАМН Научно-исследовательский институт биомедицинской химии им. В. Н. Ореховича РАМН, Москва
В химической, биохимической и микробиологической практике часто приходится сталкиваться с суспензиями. Суспензиями
называют дисперсные системы с твердой дисперсной фазой и жидкой дисперсионной средой, в которых размер частиц дисперсной фазы составляет более 100 нм (10-7 м). Часто возникает необходимость отделить твердые частицы от жидкости.
Если для этого использовать осаждение в гравитационном поле, то процесс осаждения может протекать слишком долго.
Эффективным способом является осаждение в поле центробежных сил – центрифугирование. Частоту вращения ротора
центрифуги и время центрифугирования можно подобрать аналитически, используя закономерности общей динамики и гидродинамики. Для этого необходимо написать и преобразовать объединенное уравнение первого и второго законов Ньютона
для частицы суспензии, находящейся в поле центробежных сил и сил сопротивления жидкости и стенки сосуда. Сила сопротивления жидкости зависит от режима движения частицы в жидкости. Для определения режима следует использовать
численные безразмерные критерии Архимеда и Рейнольдса. В настоящей статье эти преобразования проведены и получена
аналитическая обратно пропорциональная зависимость времени центрифугирования от частоты вращения. Рассчитав
серию данных "частота–время", можно выбрать оптимальную пару данных, исходя из возможностей центрифуги и практической целесообразности. Результаты расчетов подтверждаются реальными опытными данными, поэтому полученный
физико-математический аппарат может считаться эффективным.
Поскольку ход подбора зависит от параметра (критерий Рейнольдса), а также то, что необходимо для подбора рассчитать серию данных, удобнее всего этот расчет запрограммировать. Предлагается проводить его с помощью программы
Microsoft Excel и программирования на языке VBA в приложении к ней. Для удобного и быстрого решения задачи предлагается возможность скачивания готового файла из Интернета и использования его.
К л ю ч е в ы е с л о в а : центрифугирование, частота вращения ротора, время центрифугирования, седиментация
18
Документ
Категория
Без категории
Просмотров
65
Размер файла
412 Кб
Теги
анализа, метилирования, метод, днк
1/--страниц
Пожаловаться на содержимое документа