close

Вход

Забыли?

вход по аккаунту

?

Accelerated prenatal diagnosis of fragile X syndrome by polymerase chain reaction restriction fragment detection

код для вставкиСкачать
American Journal of Medical Genetics 83:338–341 (1999)
Accelerated Prenatal Diagnosis of Fragile X
Syndrome by Polymerase Chain Reaction
Restriction Fragment Detection
Carl Dobkin,1* Xiao-hua Ding,1 Shu-yun Li,1,2 George Houck Jr.,1 Sarah L. Nolin,1 Anne Glicksman,1
Nan Zhong,1 Edmund C. Jenkins,2 and W. Ted Brown1
1
Department of Human Genetics, New York State Institute for Basic Research in Developmental Disabilities,
Staten Island, New York
2
Department of Cytogenetics, New York State Institute for Basic Research in Developmental Disabilities,
Staten Island, New York
Prenatal diagnosis of fragile X syndrome requires detection of the full FMR1 mutation
in chorionic villus or amniotic fluid cell
samples. Although analysis of genomic DNA
restriction fragment pattern is a highly reliable technique for identification of the full
FMR1 mutation, standard Southern blot determination of this pattern requires significantly more genomic DNA than is initially
available from a prenatal sample. To overcome this limitation we developed a method
that determines the diagnostic pattern of
genomic restriction fragments from a fraction of a prenatal specimen. The prenatal
DNA sample is first digested with EcoRI and
EagI, and after agarose gel electrophoresis,
the 2- to 10-kb region of the gel is serially
sectioned and amplified by polymerase
chain reaction. Analysis of prenatal samples
from an unaffected male and from a full mutation male showed that this approach generated a diagnostic pattern comparable
with a Southern blot of 100-fold more material. This innovation enables laboratories to
prenatally diagnose the full FMR1 mutation
sooner than standard techniques. Am. J.
Med. Genet. 83:338–341, 1999.
© 1999 Wiley-Liss, Inc.
KEY WORDS: fragile X syndrome; prenatal
diagnosis; mental retardation
Contract grant sponsor: the New York State Office of Mental
Retardation and Developmental Disabilities; Contract grant
sponsor: the Maternal and Child Health Program, Department of
Health and Human Services; Contract grant number:
MCJ360587.
*Correspondence to: Carl Dobkin, Ph.D., NYS Institute for Basic Research, 1050 Forest Hill Road, Staten Island, NY 10314.
Received 22 August 1997; Accepted 28 April 1998
© 1999 Wiley-Liss, Inc.
INTRODUCTION
The fragile X syndrome, with rare exception, is
caused by expansion of a CGG triplet repeat in the 5⬘
untranslated region of the FMR1 gene [Verkerk et al.,
1991; Fu et al., 1991; Eichler et al., 1993; Warren and
Nelson, 1994]. FMR1 triplet repeat alleles can be separated into three size classes based on stability. Alleles
with approximately 6 to 50 triplets (normal alleles) are
stable both in somatic development and heritable
transmission. Alleles with approximately 60 to 200
(premutation alleles) are functional and stable in somatic development but unstable upon transmission.
Borderline, ‘‘grey zone,’’ alleles with 50 to 60 triplets
are stable in somatic development, yet their stability in
transmission in unpredictable . Alleles with >200 triplets (full-mutation alleles) are highly unstable during
somatic development and in inheritance. Expansion to
>200 triplet repeats is associated with methylation of a
CpG island at the 5⬘ end of the FMR1 gene that prevents transcription and leads to the fragile X syndrome. Some individuals with the full mutation have a
premutation (60 to 200 repeat) allele in some of their
somatic cells, and they are considered ‘‘mosaics’’ [Rousseau et al., 1991].
For reasons not yet understood the full mutation is
only inherited in maternal transmissions. Thus, prenatal fragile X syndrome diagnosis is only appropriate for
female carriers of the pre- or full mutation. The diagnostic hallmarks of a full mutation are: 1) >200 repeats; 2) the presence of a heterogeneous array of repeat alleles in somatic cells; and 3) methylation of the
5⬘ CpG island including sites for methylation-sensitive
restriction endonucleases such as EagI, BssHII, and
NruI. This methylation occurs in very early development but the methylation in extra-embryonic tissue
(e.g., chorionic villi) is significantly delayed [Sanford et
al., 1985] and is often incomplete at the time of prenatal sampling.
Diagnosis of fragile X syndrome depends primarily
on the determination of the triplet repeat length in
FMR1. Polymerase chain reaction (PCR) analysis of
Accelerated Prenatal Fragile X Diagnosis
339
allele size is effective, accurate, and reliable for most
FMR1 alleles [Brown et al., 1993]. However, some alleles with very large repeats and mosaics are difficult
to characterize by PCR because of limitations intrinsic
to this technique. Analysis of genomic DNA restriction
fragments generated by digestion with a pair of endonucleases that includes one sensitive to methylation
[Rousseau et al., 1991] reliably resolves these ambiguities. For example, digestion of genomic DNA with
EcoRI (insensitive) and EagI (sensitive) generates a
2.8-kb EcoRI-EagI fragment from a normal unmethylated allele and a 5.2-kb EcoRI fragment from a normal
methylated allele (representing an inactive X chromosome). Premutation alleles are detected as 3.0- to 3.4kb EcoRI-EagI fragments, whereas full-mutation alleles, which are consistently methylated and thus, not
cleaved by EagI, are detected as EcoRI fragments >6 kb
in size. Diagnostic analysis of genomic restriction fragments is currently done by Southern blotting.
Unlike PCR, reliable genomic Southern blotting generally requires DNA from 艌106 cells. In early prenatal
diagnosis, however, the initial tissue sample is usually
too small to provide sufficient DNA for Southern blot
analysis. Thus, in those cases in which PCR analysis is
not conclusive, there is often a delay of 2–4 weeks while
the prenatal sample is expanded in culture to supply
adequate DNA for genomic Southern analysis.
To circumvent this delay we have developed a 5- to
6-day procedure that uses PCR to detect the genomic
restriction fragment pattern in the DNA from 艋50,000
cells. This number of cells is usually available for study
within a few days of either amniocentesis or chorionic
villus sampling.
A total of 92 ␮l was added to each tube for a final
PCR volume of approximately 100 ␮l containing 10 mM
Tris-HCl, pH 8.3, 50 mM KCl, 200 ␮M each dNTP, 2.5
U of Amplitaq polymerase (Perkin Elmer, Foster City,
CA), 4 mM MgCl2, 1 ␮M 144F (CGCTAGCAGGGCTGAAGAGAAGATG), and 1 ␮M 632R (CTCCTCCACAACTACCCACACGAC). The primers defined a 489bp segment that began 244 nucleotides ‘‘downstream’’
from the transcription start site [Fu et al., 1991] and
did not include the CGG repeat. The PCR conditions
were: 94°C for 2 min; 23 cycles of 94°C for 1 min, 60°C
for 1 min, 72°C for 2 min; and 72°C for 10 min. These
conditions had been adjusted for the presence of the
agarose gel section by increasing the Mg2+ to 4 mM.
PCR products (15 ␮l) were electrophoresed on a 2%
(Nusieve 3:1, FMC) agarose gel in TAE and fractionated at 23 V/cm for 2 to 3 hr in an 11 × 14-cm horizontal
gel apparatus (Gibco BRL Life Technologies, Grand Island, NY). The gel was blotted to Zeta-Probe GT membrane with 0.5 N of NaOH according to the directions of
the manufacturer (BioRad), hybridized in 3× SSC at
65°C overnight with a 144F-632R PCR-probe amplified
from a cloned template, pE5.1 [Fu et al., 1991], and
␣dCTP labeled with and oligolabeling kit (Amersham
Pharmacia, Biotech, Piscataway, NJ). Blots were
washed at 0.1× SSC at 60°C and autoradiographed for
3 to 18 hr. The DNA used as probe was synthesized as
described above except that the MgCl2 was 2.5 mM,
and the PCR amplification was for 30 cycles.
Standard EcoRI-EagI Southern blot analyses were
done with approximately 12 ␮g of genomic DNA using
previously described methods [Rousseau et al., 1991;
Nolin et al., 1994].
MATERIALS AND METHODS
RESULTS
After amniotic fluid or chorionic villus cells were
briefly cultured (2–4 days), cells from a sparsely colonized T25 flask were counted and 25,000 to 50,000 cells
(approximately 20%) were harvested. DNA was isolated with a Puregene kit (Gentra Systems, Minneapolis, MN) with 300 ␮l of lysis buffer, precipitated with
freshly prepared spermine [Hoopes and McClure,
1981], redissolved in 40 ␮l of H2O to a concentration of
approximately 4 ng/␮l, and digested with 100 U of
EcoRI and 50 U of EagI according to the directions of
the supplier (New England Biolabs, Beverly, MA) in a
total volume of 300 ␮l for 18 hr at 37°C [Rousseau et
al., 1991].
Digested DNA was fractionated on a 2-mm thick 1%
low-gelling temperature agarose gel (NuSieve, FMC,
Rockland, ME) in 40 mM Tris-acetate, 1 mM EDTA
(TAE) [Sambrook et al., 1989] at 0.6 V/cm for 20 hr with
500 ng ␭-HindIII size marker in flanking lanes. The gel
was photographed, and 16–21 serial sections of the 2to 9-kb region were excised with coffee stirrer straws
(approximately 3 mm in diameter) and placed into 200
␮l thin-walled PCR ‘‘strip’’ tubes. ‘‘Negative control’’
sections of the gel were excised outside the sample
lanes and analyzed in parallel. ‘‘Positive control’’
samples were identical to negative controls except that
they were spiked with an additional 100 ng of genomic
DNA from an unaffected male.
The procedure we developed to accelerate analysis of
fragile X syndrome is shown schematically in Fig. 1.
The product of 23 cycles of PCR was detected in the
analytical gel by Southern blotting. The serial sections
that contained the diagnostic restriction fragments
yielded a PCR product and thus the PCR results indicated the pattern of the otherwise undetectable EcoRIEagI genomic fragments in the original gel. The PCR
product did not include the CGG repeat and thus
avoided the difficulties inherent in amplifying that region.
Fig. 2 shows the application of this procedure to a
prenatal sample of 艋5 × 104 cells from an unaffected
male fetus as compared with standard Southern blot
analysis of DNA derived from >2 × 106 cells expanded
from the same sample. The normal 2.8-kb EcoRI-EagI
fragment was detected similarly in both the PCR
analysis and the standard Southern blot. In this particular 23-cycle PCR analysis the 2.8-kb fragment was
detected primarily in serial section 18, although a
small amount was also found in sections 15–17 and
19–21. Increased number of PCR amplification cycles,
however, yielded a uniform amount of PCR product
from all serial sections tested, whereas sections from
regions outside of the sample lane did not yield a product (data not shown).
This procedure was applied to an amniocentesis
340
Dobkin et al.
Fig. 1. PCR detection procedure. The location of FMR1 restriction fragments in the preparative gel is indicated by the serial sections that yield a
PCR product. In the box on the right, the lines representing the diagnostic
restriction fragments show the positions of the EcoRI and EagI sites, the
CGG repeat (filled circles), and the PCR primers (horizontal arrows). The
PCR product does not include the CGG repeat.
sample of 艋5 × 104 cells from a full mutation male
fetus. Figure 3 compares the PCR analysis to a standard Southern blot analysis of DNA derived from >2 ×
106 cells expanded from the same sample. The fullmutation allele (approximately 8 kb) was detected primarily in section 3 and a small amount was also found
in sections 1 and 2. The standard Southern blot also
showed a majority of the fragments as a full mutation
band of approximately 8 kb. In addition the standard
Southern blot showed a minor full mutation band at
approximately 6 kb and a premutation band at approximately 3 kb. These minor bands were not seen in
the PCR detection analysis.
DISCUSSION
Standard Southern blot analysis of the FMR1 mutation is an extremely reliable technique that is particularly effective as a secondary screen subordinate to
PCR analysis for fragile X syndrome diagnosis. However, it is often inappropriate for prenatal analysis
where the tissue sample is limited and the speed of the
analysis is critical. To accelerate the analysis of the
genomic restriction fragment pattern we have developed a procedure that applies PCR amplification of isolated restriction fragments to increase sensitivity of
FMR1 mutation detection at least 100-fold compared
with standard Southern analysis. PCR amplification of
the diagnostic EcoRI-EagI restriction fragments in the
agarose gel reveals their location and provides a sen-
Fig. 2. Unaffected male. Detection of 2.8-kb EcoRI-EagI restriction
fragment from DNA extracted from a chorionic villus sample. (a) Standard
Southern blot detection (艌2 × 106 cells, 12 ␮g DNA) with probe StB12.3
[Rousseau et al., 1991]. (b) PCR detection (艋5 × 104 cells, 艋0.3 ␮g DNA).
Twenty-one serial sections of the preparative gel were amplified by PCR
with primers 3⬘ to the CGG repeat. The 489-bp 144F-632R PCR product
was detected after agarose gel fractionation and Southern blotting. Positive control (+) shows product from 0.1 ␮g of added genomic DNA template.
Negative control (−) shows product from a ‘‘control’’ agarose section taken
from another region of the gel. The positions of ␭-HindIII DNA size markers, 9.4, 6.5, 4.3, and 2.2 kb are indicated.
sitive representation of the restriction fragment pattern seen in a standard Southern blot. The PCR amplification was directed to a specific sequence within
the diagnostic fragments that reflects the methylation
pattern of the DNA and did not include the CGG triplet
repeat. When 艌30 cycles of PCR amplification were
used, however, we detected this specific sequence in all
of the serial gel sections (data not shown). This indicated a low level of this specific sequence in all of the
serial gel sections presumably originating from partial
digestion products, degraded DNA, diffusion, and interactions with the gel matrix. To avoid this problem,
the PCR amplification was limited to the exponential
phase where it was semiquantitative and only detected
amplification from the most abundant restriction fragments. In practice this limited the number of PCR amplification cycles that could be used for the serial sections. The procedure was also sensitive to the sample
size and yielded consistent results only when the num-
Accelerated Prenatal Fragile X Diagnosis
341
blot probably exaggerated the level of the premutation
allele.
The described procedure can significantly accelerate
the resolution of prenatal diagnoses that are ambiguous by PCR allele size determination. It is particularly
useful for amniocentesis samples because of the time
constraints placed on these analyses. We have incorporated this procedure into our prenatal analysis protocol. Although it is more costly and technically demanding than a standard Southern blot, this method can
reduce the time required for complete prenatal FMR1
mutation analysis to as short as 1 week.
ACKNOWLEDGMENTS
We thank the families who participated in this study.
This study was supported in part by funds from the
New York State Office of Mental Retardation and Developmental Disabilities and in part by grant
MCJ360587 (to E.C. Jenkins) from the Maternal and
Child Health Program, Department of Health and Human Services.
REFERENCES
Fig. 3. Full-mutation male. Detection of 7- to 9-kb EcoRI-EagI restriction fragments from amniocyte DNA. (a) Standard Southern blot detection
(艌2 × 106 cells, 12 ␮g) with probe StB12.3 [Rousseau et al., 1991]. (b) PCR
detection (5 × 104 cells, 艋0.3 ␮g). Sixteen serial section of the preparative
gel were amplified by PCR and analyzed by Southern blotting (as in Fig. 2).
The positions of ␭-HindIII DNA size markers are indicated.
ber of cells analyzed was 20 to 50,000. It is likely that
a much smaller sample (5 × 103 cells) would be effective
for diagnosis if the number of amplification cycles were
increased to 25 or 26. However, a smaller amount of
DNA template would increase the risks posed by contamination and might not specifically represent the fetus. It is also possible that a fraction (<0.5 mg) of the
original sample could be used directly but we have not
attempted this because of the difficulty in determining
the exact cell number in an original tissue sample.
There were differences between the patterns of
EcoRI-EagI restriction fragments detected by PCR and
the standard Southern blot analyses. For example, the
premutation band apparent in the Southern blot in Fig.
3a was not detected in the PCR analysis as shown in
Fig. 3b. Analyses of standard Southern blots [Dobkin et
al., 1996] suggested that premutation alleles in mosaics were over represented, presumably because the
transfer of large, full mutation fragments was relatively inefficient. In contrast the size of the fragment in
an agarose gel section should not affect PCR amplification of an internal sequence. Thus, although mosaicism was apparent in the Southern blot (Fig. 3a), the
pattern in Fig. 3b suggests that the standard Southern
Brown WT, Houck Jr GE, Jeziorowska A, Levinson F, Ding X-H, Dobkin C,
Zhong N, Henderson J, Sklower-Brooks S, Jenkins EC. 1993. Rapid
fragile X carrier screening and prenatal diagnosis using a nonradioactive PCR test. JAMA 270:1569–1575.
Dobkin C, Nolin SL, Cohen I, Sudhalter V, Bialer MG, Ding H, Jenkins EC,
Zhong N, Brown WT. 1996. Tissue differences in fragile X mosaics:
Mosaicism in blood cells may differ greatly from skin. Am J Med Genet
58:641–642.
Eichler EE, Richards S, Gibbs RA, Nelson DL. 1993. Fine structure of the
human FMR-1 gene. Hum Mol Genet 2:1147–1153.
Fu Y-H, Kuhl DPA, Pizzuti A, Pieretti M, Sutcliffe JS, Richards S, Verkerk
AJMH, Holden JJA, Fenwick RG Jr, Warren ST, Oostra BA, Nelson
DL, Caskey CT. 1991. Variation of the CGG repeat at the fragile X site
results in genetic instability: Resolution of the Sherman Paradox. Cell
67:1047–1058.
Hoopes BC, McClure WR. 1981. Studies on the selectivity of DNA precipitation by spermine. Nucleic Acid Res 9:5493–5504.
Nolin SL, Glicksman A, Houck Jr GE, Brown WT, Dobkin CS. 1994. Mosaicism in fragile X affected males. Am J Med Genet 51:509–512.
Rousseau F, Heitz D, Biancalana V, Blumenfield S, Kretz C, Boué J, Tommerup N, van der Hagen C, DeLozier-Blanchet C, Croquette M-F,
Gilgenkrantz S, Jalbert P, Voelckel M-A, Oberlé I, Mandel J-L. 1991.
Direct diagnosis by DNA analysis of the fragile X syndrome of mental
retardation. N Engl J Med 325:1673–1681.
Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular Cloning. A Laboratory Manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor
Laboratory Press.
Sanford J, Chapman V, Rossant J. 1985. DNA methylation in extraembryonic lineages of mammals. Trends Genet. 1:89–93.
Verkerk AJMH, Pieretti M, Sutcliffe JS, Fu Y-H, Kuhl DPA, Pizzuti A,
Reiner O, Richards S, Victoria MF, Zhang F, Eussen BE, van Ommen
G-J B, Blonden LAJ, Riggins GJ, Chastain JL, Kunst CB, Galjaard H,
Caskey CT, Nelson DL, Oostra BA, Warren ST. 1991. Identification of
a gene (FMR-1) containing a CGG repeat coincident with a breakpoint
cluster region exhibiting length variation in fragile X syndrome. Cell
65:905–914.
Warren ST, Nelson DL. 1994. Advances in molecular analysis of fragile X
syndrome. JAMA 271:536–542.
Документ
Категория
Без категории
Просмотров
2
Размер файла
157 Кб
Теги
reaction, chains, restrictions, detection, syndrome, prenatal, accelerated, fragmenty, fragile, polymerase, diagnosis
1/--страниц
Пожаловаться на содержимое документа