close

Вход

Забыли?

вход по аккаунту

?

ErratumYeast 15 507-511 (1999). Heterologous URA3MX Cassettes for Gene Replacement inSaccharomyces cerevisiae. A. L. Goldstein X. Pan and J. H. McCusker

код для вставкиСкачать

Yeast 15, 1275–1285 (1999)
Deletion of Six Open Reading Frames from the Left
Arm of Chromosome IV of Saccharomyces cerevisiae
GABRIELE TULLER1†, BIRGIT PREIN1†, ANITA JANDROSITZ1, GU
} NTHER DAUM1* AND
1
SEPP D. KOHLWEIN
1
SFB Biomembrane Research Center and Institut für Biochemie und Lebensmittelchemie, Technische Universität
Graz, Austria
The construction of six deletion mutants of Saccharomyces cerevisiae and their basic phenotypic characterization are
described. Open reading frames YDL148c, YDL109c, YDL021w, YDL019c, YDL018c and YDL015c from the left
arm of chromosome IV were deleted using a polymerase chain reaction (PCR)-based disruption technique,
introducing the kanMX4 resistance marker into the respective genes. Gene replacement cassettes (pYORCs) for use
in other strain backgrounds were cloned by PCR using DNA templates from haploid or diploid deletion mutants,
and inserted into episomal plasmids. Cognate clones of all six ORFs were obtained by gap repair. Deletions were
carried out in diploid cells and, after sporulation, yielded four viable spores for clones disrupted in YDL109c,
YDL021w, YDL019c and YDL018c. Spores harbouring disruptions in ORFs YDL148c and YDL015c germinated
but underwent only a few divisions before ceasing growth, suggesting that the respective genes are essential for
vegetative growth on YPD complete media. The other deletion mutants grew like wild-type at different temperatures
and on different carbon sources. A brief computational analysis of the six ORFs studied in this work is presented.
Copyright 1999 John Wiley & Sons, Ltd.
  — Saccharomyces cerevisiae; functional genomics; chromosome VI; EUROFAN
INTRODUCTION
Since the genome of the yeast Saccharomyces
cerevisiae has been completely sequenced through
a world wide collaboration (Goffeau et al., 1996),
efforts of the yeast community are focused on the
functional analysis of unassigned open reading
frames (ORFs). On average, predicted proteincoding elements occupy 72% of the yeast genome
*Correspondence to: G. Daum, Institut für Biochemie und
Lebensmittelchemie, Technische Universität Graz, Petersgasse
12/2, A-8010 Graz, Austria. Tel: +43-316-873-6462; fax:
+43-316-873-6952; e-mail: f548daum@mbox.tu-graz.ac.at.
†G.T. and B.P. contributed equally to this study.
Contract/grant sponsor: EUROFAN project of the EC;
Contract/grant number: BIO4-CT95-0080.
Contract/grant sponsor: Austrian Ministry of Science and
Transportation; Contract/grant number: 950080.
Contract/grant sponsor: Fonds zur Förderung der wissenschaftlichen Forschung, Austria; Contract/grant number: F706.
CCC 0749–503X/99/121275–11$17.50
Copyright 1999 John Wiley & Sons, Ltd.
(Dujon, 1996). Approximately one-third of the
6000 genes are so-called orphans without known
function or structural homology to genes of known
function.
The work presented here is part of the European
Function Analysis Network (EUROFAN), which
is aimed at generating information on a large scale
about yeast genes of unknown function (Oliver,
1996). One of the general strategies of this program involves systematic construction and phenotypic analyses of mutants that are deleted of novel
ORFs of unknown function.
This ambitious effort requires efficient gene
replacement strategies. The short flanking
homology (SFH) method (Wach et al., 1994) is
based on PCR-generated DNA fragments for
transformation and chromosomal displacement,
which contain the marker gene flanked by short
Received 21 November 1998
Accepted 26 April 1999
1276
Table 1.
G. TULLER ET AL.
Characteristics of six ORFs on yeast chromosome IV.
ORF
GenBank Length
number
(aa)
MW
(Da)
YDL148c
YDL109c
1431233
1431156
810
647
YDL021w (GPM2)
1430992
311
94 301 0.21 7.19
—
72 858 0.13 8.38 Strong similarity to
hypothetical gene
products of YGL144c
and YDR444w
36 070 0.17 6.34 Strong similarity to
phosphoglycerate
mutase Gpm1p
YDL019c
1430988
1283
YDL018c
1430986
225
YDL015c
1430981
310
CAI
PI
Homology
145 782 0.15 6.60 Similarity to Swh1p
26 509 0.14 6.64 Similarity to gene
products of YAL007c
and YOR016c
36 782 0.24 9.66 Similarity to rat
synaptic glycoprotein
SC2
PROSITE Motifa
—
Lipase motif; serine
active site
Phosphoglycerate
mutase family;
phosphohistidine
signature
Oxysterol-binding
protein family signature
—
—
aa, amino acids; MW, molecular weight; CAI, codon adaptation index; PI, isoelectric point.
a
PROSITE; Bairoch et al., 1997.
homology regions of the target gene. Systematic
studies of the length of the flanking regions have
shown that 30 bp of homology 5 and 3 to the
marker are sufficient for successful targeting
(Manivasakam et al., 1995). This technique can be
used with several markers such as HIS3 (Baudin
et al., 1993), URA3 and ADE2 (Lorenz et al.,
1995), or with the dominant resistance marker
kanMX4, which allows selection of transformants
for geneticin (G418) resistance (Wach et al., 1994).
Sequence polymorphism in yeast, however, may
decrease or inhibit homologous recombination of
PCR-generated fragments with short homology
regions. Thus, as an alternative, a two-step PCR
procedure to synthesize a marker module flanked
by long homology regions (LFH) with more than
250 base pairs (bp) of homology to the target gene
can be used (Wach, 1996). This strategy also
results in an increased transformation and
recombination efficiency.
Within the EUROFAN program, deletion
mutants of six novel yeast genes from the left arm
of chromosome IV, comprising YDL148c,
YDL109c, YDL021w, YDL019c, YDL018c and
YDL015c, were constructed in our laboratory in
the background of the diploid wild-type strain
FY1679. We present a description of these ORFs
based on in silicio analysis (Table 1) and the
Copyright 1999 John Wiley & Sons, Ltd.
primary phenotypic characterization of the
respective deletion mutants. The construction of
the corresponding deletion cassettes (ORF
replacement cassettes, pYORCs) for disruption in
other strain backgrounds, and of cognate gene
clones (pYCGs), is described.
MATERIALS AND METHODS
Strains and media
The diploid wild-type strains S. cerevisiae
FY1679 (MATa/á ura3-52/ura3-52 leu2Ä1/LEU2
his3Ä200/HIS3
trp1Ä63/TRP1
GAL2/GAL2;
Winston et al., 1995) and W303D (MATa/á ura31/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1 his311,15/his3-11,15 ade2-1/ade2-1 can1-100/can1-100)
were used in this study. As a standard culture
medium, YPD containing 1% yeast extract, 2%
peptone and 2% glucose was used. Glycerol complete medium (YPG) contained 3% (v/v) glycerol
instead of glucose. Glucose minimal medium (SD)
contained 0·67% yeast nitrogen base supplemented
with all amino acids and 1% glucose. Mutant
strains harbouring the kanMX4 marker module
were grown on YPD plates containing 200 mg/l
G418 (geneticin, BRL Life Technologies). Media
plates contained 2% agar (Difco).
Yeast 15, 1275–1285 (1999)
DELETION OF SIX ORF FROM YEAST CHROMOSOME IV LEFT ARM
1277
Escherichia coli XL1-Blue served as host for
plasmids used in this study. XL1-Blue was grown
on 2YT (1% yeast extract, 1·4% tryptone, 0·5%
NaCl) containing 100 mg/l ampicillin (United
States Biochemicals) and/or 50 mg/l kanamycin
(Boehringer Mannheim), as indicated.
Construction of gene-specific deletion cassettes
Plasmid pFA6a (Wach et al., 1994) containing
the kanMX4 resistance marker was used as the
template for PCR reactions to amplify the replacement fragments. kanMX4 contains the kanr gene
of E. coli transposon Tn903, that codes for
aminoglycoside phosphotransferase (Oka et al.,
1981), which renders E. coli resistant to kanamycin
and S. cerevisiae resistant to geneticin (G418)
(Jimenez and Davies, 1980). Two PCR-based
methods were used to construct deletion strains,
making use of long flanking homology (LFH) or
short flanking homology (SFH) regions 5 and 3
to the target locus (Wach, 1996; Wach et al., 1994).
Deletion cassettes were designed to replace at least
80% of the target ORF. To avoid an interference
with adjacent ORFs the integration sites were
chosen to map at least 350 bp upstream of the start
codon and 250 bp downstream of the stop codon
of adjacent ORFs. All deletions in FY1679, with
the exception of YDL148c, were obtained using
the SFH method.
LFH method (Figure 1A)
In a first PCR-step, two fragments homologous
to the 5 and 3 sequences of YDL148c were amplified using 30–50 ng of FY1679 genomic DNA as
the template (taq polymerase; Promega). The
standard PCR mix contained the appropriate
buffer, 1·5 m MgCl2, 0·2 m dNTPs and 1 ì
primers L1–L4 (Table 2) in a total volume of 25 ìl.
The second PCR step was performed in a standard
reaction mix containing approximately 50 ng of the
gel-purified NotI fragment of pFA6a–kanMX4
plasmid as template and 100 ng of each product
from the first PCR as primers. After a denaturation
step of 2 min at 94C, fragments were amplified
during 15 cycles of 30 s at 94C, 30 s at 53C, 150 s
at 72C and 15 cycles of 30 s at 94C, 30 s at 65C,
150 s at 72C, followed by a final elongation step of
5 min at 72C. About 150 ng of the resulting PCR
fragment were used for yeast transformation.
SFH method
For SFH gene disruption (Figure 1B), a pair
of oligonucleotide hybrid primers containing 70
Copyright 1999 John Wiley & Sons, Ltd.
Figure 1. Strategies for PCR-based gene deletion and generation of pYORCs and pYCGs (ORFs, fragments and primers not
drawn to scale). (A) LFH method. Four oligonucleotide primers
(L1–L4; Table 2) were designed such that fragments of several
hundred nucleotides homologous to the 5 and 3 region of
YDL148c were generated using genomic DNA as the template.
L2 and L3 are hybrid primers which also contain 25 nucleotides
homologous to the kanMX4 marker gene. The resulting PCR
fragments are primers for the second PCR step using kanMX4
plasmid as template. (B) SFH strategy. S1 and S2 (Table 2) are
hybrid primers containing 18–19 nucleotides homologous to the
pFA6a-MCS in addition to 70 nucleotides homologous to the
target locus. In a one-step PCR reaction the fragment containing
short flanking homologies to the target gene is generated using
kanMX4 plasmid DNA as the template. (C) pYORCs. Primers
A1 and A4 (Table 2) and genomic DNA from disruption mutants were used for PCR-based generation of fragments used for
cloning into pUG7, to generate pYORCs. (D) General strategy
for pYCG construction using gap repair. pYCGs, containing the
marker cassette flanked by several hundred nucleotides, were
digested with appropriate restriction enzymes (RE) to retain at
least 100 nucleotides homologous to the 5 and 3 region of the
desired ORF. The resulting vector fragment was purified and
used for yeast transformation to obtain pYCGs by gap repair.
nucleotides homologous to the target locus and
18–19 nucleotides homologous to the pFA6a–
kanMX4 multiple cloning site (MCS) were used
Yeast 15, 1275–1285 (1999)
Table 2.
Oligonucleotides used in this study.
Sequencea
ORF/Primer
YDL148c
L1
L2
L3
L4=A4
A1
A2
YDL109c
S1
S2
A1
A2
A4
YDL021w
S1
S2
A1
A2
A4
YDL019c
S1
S2
A1
A2
A4
YDL018c
S1
S2
A1
A2
A4
YDL015c
S1
S2
A1
A2
A4
Positionb
AAAAATGGTAGTGAGCCCAGC
GGGGATCCGTCGACCTGCAGCGTACTTTGACCTGTGAGTCCACGG
AACGAGCTCGAATTCATCGATGATACGTGGCGGAAAGAAATAACC
CGTCGGAAGATAAGGCAGAC
CATCTCTTGACATCTTTCTCTACG
CATCTCTCCTCTTATTCCTTGC
AAATATCAGTACAAAAAATGCTCACCTGACCTTATTCACCCAAAAACATCG
GGGAAACGGTAGTAATATGCGTACGCTGCAGGTCGAC
TGGACTTTCGTAGGTGTGGACAATAGTAAATTGCAAGTCAATCCCGGGATG
A CGTCAAGATAGACAGTCAATCGATGAATTCGAGCTCG
CAATGTGTTTTTTGAATCTACTTG
TCAGCGGGAATACTATCACC
TTCTGATACCGCCTGCTGAG
TACGAGGTTGTTCAATTTAAACCCAAGAATACATAAAAAAAATATAGATATA
TTAACTTAGTAAACAATGCGTACGCTGCAGGTCGAC
AATAAGTTTTCTATTGGTTTTCATTATACTTCGGAAAATACACAATTATATT
A TATACTTACCCCCCTTAATCGATGAATTCGAGCTCG
GCGTCCTAAGAAAATAAGGG
TCTTTACCTTTTTCGGTTAGC
CACGCTAAAAGGAAGATTGTC
TTTTAAATTTAACCTAGCATATTTCATCGATAATCATAAGCTTAAGCTCGCCA
ACTGAAAACTTCACAATATGCGTACGCTGCAGGTCGAC
ATTCAGTACAATAAAATACATTCAAAATACATACAAGTACCAGGAAAAAA
GCTCGCATAAAAAAGGCGTGTTAATCGATGAATTCGAGCTCG
TTTCTATCCTTGGCAAAGCC
GCTCGCCAACTGAAAACTT
AGGCACAGTTCTATCGCAGC
AGAAACTGGTAAGGCTCTTGATAGTTACCGTACTTGAAGGGACACTGTGAA
CTGACTAAAAAACTCCGTCATGCGTACGCTGCAGGTCGAC
TTTCCCCTATTAAATATGAAGAACATATATTCTCAAGTTGATAGAAAATGC
AGGAACAATACACAACTATTTAATCGATGAATTCGAGCTCG
TCATCTACACAAGCATTGCC
TTCAGTTCAAATGTCAACGG
TGGCACACTTGCTTATCACT
ATTCTATTTAGCTATCTAGAAACCAATTGAGCTATTTGAGAGAGATACATAT
TTTGAATTTAATTTGAAAATGCGTACGCTGCAGGTCGAC
TCAAAAGTATAGTTGGGAGCAACAAAAAGATTGAAAATACCTTGATTCAA
TGGGACACGGATCTTAGCGTTACATCGATGAATTCGAGCTCG
GGGCAACTTAGATTTATCCG
TAACCCTTTAGAGCGGCTTT
ATAGTGCCAAATACCAAAGG
kanMX4 module
K2
GGTTGTTTATGTTCGGATGTG
312
+64
+1590
+1836
350
+208
67
+1579
423
+122
+1830
67
+1578
435
+125
+1930
70
+1582
405
+3
+1869
70
+1582
385
+85
+1905
70
+1582
379
+35
+1859
21
a
The sequence complementary to the MCS of pFA6a–kanMX4 is underlined; primer sequences 5 to 3. b The first base of the target
gene (A of ATG) is designated as +1.
Copyright 1999 John Wiley & Sons, Ltd.
Yeast 15, 1275–1285 (1999)
1279
DELETION OF SIX ORF FROM YEAST CHROMOSOME IV LEFT ARM
Table 3.
Characterization of deletion cassettes of six yeast ORFs in pYORCs
Plasmidsa
pYORC–YDL148c
pYORC–YDL109c
pYORC–YDL021w
pYORC–YDL019c
pYORC–YDL018c
pYORC–YDL015c
Size (bp)
5158
5222
5335
5241
5249
5205
Insertb
YDL148c (65-2415)::kanMX4
YDL109c (4-1941)::kanMX4
YDL021w (4-933)::kanMX4
YDL019c (4-3849)::kanMX4
YDL018c (4-674)::kanMX4
YDL015c (4-702)::kanMX4
bp, base pairs.
a
All pYORC plasmids were constructed in the pUG7 vector containing the ampr marker.
b
The start codon ATG is numbered 1–3.
(primers S1 and S2, Table 2). For each disruption,
PCR fragments of about 1·65 kb harbouring
the kanMX4 marker and flanking sequences
were generated, using approximately 50 ng of the
gel-purified NotI fragment of pFA6a–kanMX4
plasmid as the template. Parameters for PCR
amplification were as described above for the
second step of the LFH protocol, with the
exception that the elongation steps were reduced
to 105 s. PCR fragments were ethanol-precipitated
and 400–700 ng were used for yeast transformation.
Transformation of yeast cells
Diploid FY1679 and W303D yeast cells were
transformed using the high efficiency lithium
acetate transformation protocol (Gietz and
Schiestl, 1995). Transformed cells were grown in
YPD at 30C overnight and then spread on YPD
plates containing 200 mg/l G418. After incubation
for 2–3 days, large colonies were picked and
re-streaked onto fresh YPD-G418 plates. Only
those clones that yielded colonies on these plates
were considered as positive transformants. In
G418-resistant transformants, correct replacement
of the respective ORFs by the kanMX4 module
was verified by analytical PCR with whole yeast
cell extracts (Huxley et al., 1990). Control primers
were designed to bind outside the target locus
(primer A1, Table 2), within the target locus
(primer A2, Table 2) and within the marker
module (primer K2, Table 2). In the diploid yeast
transformants correct integration of the marker
resulted in the appearance of one PCR fragment
characteristic of the wild-type allele and one PCR
fragment characteristic of the mutated allele.
Copyright 1999 John Wiley & Sons, Ltd.
Construction of ORF replacement cassettes
(pYORCs)
pYORCs (Table 3) are required for systematic
gene inactivation in almost any strain background.
The kanMX4 module flanked by several hundred
base pairs homologous to the 5 and 3 genomic
region of the deleted ORF was amplified by PCR
(TaKaRaExtaq polymerase; TaKaRa Biomedicals) using genomic DNA from haploid or heterozygous diploid disruption strains as the template
(Figure 1C) and primers A1 and A4 (Table 2). The
resulting PCR products were gel-purified and
cloned into the EcoRV site of a pUG7 plasmid
(provided by J. H. Hegemann) and transformed
into E. coli. Transformants were selected on
2YT plates containing 100 mg/l ampicillin and
30 mg/l kanamycin. Correct ligation of the fulllength PCR products into the vector was verified
by restriction analysis. The functionality of the
replacement cassettes was tested in yeast wild-type
W303D, using 1 ìg plasmid DNA from pYORCs,
NotI digested for releasing the replacement
cassette. After transformation and selection for
G418-resistant colonies the correct replacement
at the respective genome locus was verified by
analytical PCR of whole cell extracts, as described
above.
Construction of cognate gene clones (pYCGs)
In order to clone the wild-type genes of the
respective ORFs by gap-repair (Orr-Weaver et al.,
1983) the fragments contained in pYORCs were
re-cloned into the yeast CEN plasmid pRS416
(Sikorski and Hieter, 1989). The ORF replacement
cassettes with flanking regions from the multiple
cloning site of plasmid pUG7 were amplified by
Yeast 15, 1275–1285 (1999)
1280
Copyright 1999 John Wiley & Sons, Ltd.
G. TULLER ET AL.
Yeast 15, 1275–1285 (1999)
1281
DELETION OF SIX ORF FROM YEAST CHROMOSOME IV LEFT ARM
PCR using plasmid DNA from pYORCs as template (TaKaRaExtaq polymerase). The fragments
were cut with XhoI and SacII after gel-purification,
ligated into XhoI/SacII digested pRS416 and
transformed into E. coli. Transformants were selected for ampicillin and kanamycin resistance as
described for pYORCs, and correct ligation was
verified by PCR and restriction analysis of isolated
plasmids.
50 ìg of pRS416 plasmids with the respective
replacement cassettes (pYCG) were digested with
appropriate restriction enzymes to retain at least
100 bp homologous to the 5 and 3 regions of the
desired ORF (Figure 1D). About 10 ìg of the
purified vector fragments were used to transform wild-type FY1679, and transformants were
selected on SD media lacking uracil. After incubation at 30C for 3 days, uracil-prototrophic
transformants were selected and analysed for the
presence of the gap-repaired plasmid by colony
PCR, using forward and reverse sequencing
primers which bind upstream or downstream of
the pRS416 MCS. Total DNA was isolated from
colonies which harboured a PCR fragment of the
expected size (Hoffmann and Winston, 1987), and
transformed into E. coli. Positive clones were
selected for ampicillin resistance, plasmids were
isolated and the presence of the target gene was
verified by restriction analysis. Correct sequence of
the flanking regions of pYORCs and pYCGs was
confirmed by DNA sequencing.
Tetrad analysis
Diploid yeast transformants were sporulated in
liquid medium containing 0·3% potassium acetate
and 0·02% raffinose for 3–5 days at room temperature. Tetrad dissection was performed on YPD
plates. At least nine tetrads were dissected for each
ORF and incubated at 30C for 2–3 days prior to
phenotypic analyses.
Phenotypic tests
Colonies of both mating types derived from the
tetrad dissection as well as heterozygous diploid
cells (in case of essential genes) and wild-type
cells were plated on YPD, YPG or SD plates at
dilutions of 1:102, 1:104 and 1:106. Cells were
incubated at 15C, 30C and 37C and growth
was correlated to wild-type under the respective
conditions.
RESULTS AND DISCUSSION
Construction of six deletion mutants lacking ORFs
of unknown function
Standardized methods described above were
used for directed deletion of six S. cerevisiae genes
of unassigned function from chromosome IV in
the FY1679 wild-type strain. YDL148c was disrupted using the LFH method. For deletion of
the other genes, YDL109c, YDL021w, YDL019c,
YDL018c and YDL015c, the SFH method was
employed. Use of primers overlapping the target
locus by only 40 nucleotides proved unsuccessful;
therefore, primers with up to 70 nucleotides of
homology to the gene locus of interest were
employed for the SFH protocol. Correct replacement of the respective ORFs by the deletion
module was tested in heterozygous diploid transformants by single colony PCR, using appropriate
primers and wild-type cells as a control (Figure 2).
In all cases the length of detected fragments
corresponded to the predicted fragment sizes.
In order to verify that the lethal phenotypes
were indeed caused by deletion of the respective
ORF and not by effects of the marker integration
on adjacent open reading frames, heterozygous
diploid deletion strains were transformed with
their respective cognate clones and, after sporulation, re-tested for growth. In all cases, wild-type
growth was restored by the cognate clone, confirming that the lethal phenotype was not the result
of an interference of the deletion with adjacent
(essential) reading frames.
ORF replacement cassettes (pYORCs) were
cloned with long flanking homology regions to the
target locus harbouring more than 350 bp of
the promoter region and more than 250 bp of the
terminator region. The cassettes were cloned into
pUG7 plasmid (provided by J. H. Hegemann),
yielding the respective pYORCs (Figure 1C,
Table 3). After digesting pYORCs with NotI the
resulting fragments could be transformed into
appropriate host strains and selected for geneticin
Figure 2. Verification of gene disruption in heterozygous diploid cells by PCR. ST, Standards (bp), A, D, E, F, öX174 RF DNA,
HaeIII digest; B, 100 bp ladder (Boehringer–Mannheim); C, ë DNA, EcoRI/HindIII digest. Lanes 1 and 2 show PCR products
of indicated size (left side in bp) using primers A1/A2 for the wild-type allele and A1/K2 for the mutant allele (see Table 2).
1, wild-type allele; 2, mutant allele.
Copyright 1999 John Wiley & Sons, Ltd.
Yeast 15, 1275–1285 (1999)
1282
resistance, allowing systematic gene deletion in
almost any strain background. As a control,
deletion strains of all six ORFs were constructed in
the W303D background. Correct replacement at
the target locus was verified by analytical PCR
(data not shown).
Deletion
strains,
replacement
cassettes
(pYORCs) and cognate gene clones (pYCGs) were
deposited at the EUROFAN strain collection,
EUROSCARF
(K.-D.
Entian,
Frankfurt,
Germany).
Phenotypic analyses
Heterozygous diploid deletion strains were
sporulated and subjected to tetrad analysis, as
described in Methods. At least nine tetrads of each
deletion strain in the FY1679 background were
dissected on YPD plates, analysed for correct
segregation of auxotrophic markers, G418 resistance and mating type. Spores that were unable to
give raise to colonies were inspected microscopically after 2 days. G418-resistant deletion strains
of opposite mating type were tested for mating
efficiency, and sporulation tests of heterozygous
and homozygous diploid deletion mutants were
performed.
Characterization of six novel yeast genes on
chromosome IV
General features of the six ORFs as derived
from in silicio analyses are summarized in Table 1.
ORF YDL148c codes for a putative protein of
810 amino acids with an estimated molecular
weight of 94 301 Da, without known function or
homology to other proteins. Deletion of the gene
(LFH method) resulted in two G418-sensitive
wild-type spores and two spores that germinated
on YPD plates, but failed to develop colonies
(Figure 3). Cell growth ceased after one or two
divisions after spore germination. This phenotype
could be reversed by transformation of heterozygous diploid deletion strains with the centromeric cognate plasmid, prior to sporulation
(Figure 3). All resulting G418-resistant colonies
lacking the YDL148c gene were also uracilprototrophic due to the presence of the CEN
plasmid. Heterozygous diploid mutant strains
showed wild-type growth under all conditions
tested, and sporulation efficiency was comparable
to the wild-type strain.
ORF YDL109c codes for a putative protein of
647 amino acids with an estimated molecular
Copyright 1999 John Wiley & Sons, Ltd.
G. TULLER ET AL.
weight of 72 858 Da. The most remarkable feature
of this protein is the presence of a sequence
ISFIGHSLGG at position 268–277 of the amino
acid sequence, which matches the consensus
motif (LIV)-X-(LIVFY)-(LIVST)-G-(HYWV)-SX-G-(GSTAC) found in lipolytic enzymes that
hydrolyse ester bonds of triacylglycerols
(PROSITE; Bairoch et al., 1997). The conserved
region is centred around a serine (position 7 of the
consensus pattern) which has been shown to be the
nucleophilic residue essential for enzyme catalysis
(Saiz et al., 1996). The protein shows 30–50%
similarity to yeast proteins encoded by YGL144c
and YDR444w, which are of unknown function,
but also contain sequence motifs typical for lipases
with a serine active site.
Gene deletion of YDL109c did not result in
detectable germination and growth phenotypes on
YPD, YPG and SD plates at 15C, 30C and 37C.
Mating and sporulation efficiency of homozygous diploid disruption mutants was like the
wild-type.
ORF YDL021w codes for a putative protein of
311 amino acids with an estimated molecular
weight of 36 070 Da that is homologous to the
gene product of GPM1 (phosphoglycerate
mutase 1) and to a putative phosphoglycerate
mutase isoenzyme, Gpm3p. YDL021w was therefore designated GPM2 (Heinisch et al., 1998).
Gpm2p and Gpm3p are 65% identical to each
other and 43% homologous to Gpm1p. Gpm2p
and Gpm3p have a signature sequence characteristic of the phosphoglycerate mutase family, which
includes a histidine residue in the active centre that
forms a phosphohistidine intermediate (PROSITE;
Bairoch et al., 1997). GPM2 and GPM3, even
when present on multicopy vectors, do not complement a gpm1 null mutation, which causes a
growth defect on glucose, ethanol and glycerol
(Heinisch et al., 1998). Both Gpm2p and Gpm3p
are expressed at levels that are apparently too low
to contribute to a physiologically significant glycolytic flux and are thus believed to be pseudogenes
lacking functional promoters (Heinisch et al.,
1998).
Gene deletion of YDL021w did not result in
detectable germination and growth phenotypes on
YPD, YPG and SD plates incubated at 15C, 30C
and 37C. Mating efficiency was not affected,
but sporulation efficiency of homozygous diploid
deletion mutants was poor (below 10% of
wild-type), suggesting a possible expression/
function under starvation/sporulation conditions.
Yeast 15, 1275–1285 (1999)
DELETION OF SIX ORF FROM YEAST CHROMOSOME IV LEFT ARM
1283
Figure 3. Tetrad analysis of strain FY1679 YDL148cÄ. (A) Tetrad dissection and spore germination on YPD of the heterozygous
diploid FY1679 YDL148cÄ (upper panel) and the heterozygous diploid FY1679 YDL148cÄ transformed with the cognate
pYCG_YDL148c plasmid (lower panel). All non-disrupted spores are viable, whereas disrupted spores become only viable when
carrying the pYCG_YDL148c cognate clone. (B) Schematic documentation of tetrad analysis: non-disrupted spores are shown as
open circles (Kans), and disrupted spores rescued by transformation with the pYCG_YDL148c cognate clone (Kanr and Ura + ) are
shown as filled circles.
YDL019c codes for a putative protein of 1283
amino acids with an estimated molecular weight of
145 782 Da that has similarity to Osh1p (also
named Swh1p), which is a homologue of the
human oxysterol-binding protein, OSBP (Levanon
et al., 1990). Osh1p is a member of the Kes1p/
Hes1p/Osh1p/YKR003w/YHR073w/YHR001w
family of oxysterol-binding proteins in yeast.
Mutations in KES1, HES1 and OSH1 result in
pleiotropic sterol-related phenotypes. Double and
triple mutants are nystatin-resistant and show a
minor reduction of the ergosterol levels in cellular
membranes, suggesting a role in ergosterol biosynthesis (Jiang et al., 1994). The functions in vivo of
the seven oxysterol-binding protein homologues of
Copyright 1999 John Wiley & Sons, Ltd.
S. cerevisiae remain obscure. In mammalian cells,
oxysterols are potent inhibitors of cholesterol synthesis and uptake and regulators of cholesterol
metabolism, which is, in part, mediated through
the activity of OSBPs (Goldstein and Brown,
1990).
Deletion of YDL019c did not result in a detectable germination phenotype. Growth of cells lacking this gene was slightly reduced on YPD, YPG
and SD media plates at 30C and 37C as compared to wild-type, but no differences in growth
could be observed in liquid media. Mating efficiency was not affected, but sporulation efficiency
of homozygous diploid deletion mutants was
only 10–20% of wild-type, suggesting a possible
Yeast 15, 1275–1285 (1999)
1284
expression/function of this gene under starvation/
sporulation conditions.
YDL018c codes for a putative protein of 225
amino acids with an estimated molecular weight of
26 509 Da that is 24% homologous to YAL007c,
which codes for a putative type I integral membrane protein of unknown function. The YAL007c
gene product in turn is about 24% similar to
Emp24p, YOR016c and YHR110w. Emp24p is
also a type I membrane protein and a component
of the COPII coat of secretory vesicles derived
from the endoplasmic reticulum (Schimmöller
et al., 1995). YDL018c may thus be a member of
the p24 family of putative cargo receptors.
Deletion of YDL018c did not result in a detectable germination phenotype. Similar to the strain
deleted of YDL019c, growth of cells lacking
YDL018c was slightly reduced on YPD, YPG and
SD media plates at 15C, 30C and 37C, but not in
liquid media. Mating efficiency was not affected,
but sporulation efficiency of homozygous diploid
deletion mutants was reduced to 10% of wild-type,
suggesting a possible expression/function of this
gene under starvation/sporulation conditions.
ORF YDL015c codes for a putative basic protein of 310 amino acids with an estimated molecular weight of 36 782 Da that has similarity to the
rat synaptic glycoprotein SC2 of unknown function, but no significant homology to other proteins. Gene deletion resulted in two G418-sensitive
wild-type spores and two spores that germinated
on YPD plates, but failed to develop colonies. Cell
growth ceased after 3–4 divisions after germination
of spores. This phenotype was reversed by transformation of heterozygous diploid deletion strains
with the centromeric cognate plasmid, prior to
sporulation. All resulting G418-resistant colonies
harbouring the deleted YDL015c gene were also
uracil-prototrophic due to the presence of the
cognate CEN plasmid.
Heterozygous diploid mutant strains showed
growth like the wild-type under all conditions
tested. Sporulation efficiency was also like the
wild-type.
ACKNOWLEDGEMENTS
This work was supported by the EUROFAN
Project BIO4-CT95-0080, Project 950080 of the
Austrian Ministry of Science and Transportation
to G. D., and project F706 of the Fonds zur
Förderung der wissenschaftlichen Forschung in
sterreich to S.D.K.
Copyright 1999 John Wiley & Sons, Ltd.
G. TULLER ET AL.
REFERENCES
Bairoch, A., Bucher, P. and Hofmann, K. (1997). The
PROSITE database, its status in 1997. Nucleic Acids
Res. 25, 217–221.
Baudin, A., Ozier-Kalogeropoulos, O., Denouel, A.,
Lacroute, F. and Cullin, C. (1993). A simple
and efficient method for direct gene deletion in
Saccharomyces cerevisiae. Nucleic Acids Res. 21,
3329–3330.
Dujon, B. (1996). The yeast genome project: what did we
learn? Trends Genet. 12, 263–270.
Gietz, R. D. and Schiestl, R. H. (1995). Transforming yeast with DNA. Methods Mol. Cell. Biol. 5,
255–269.
Goffeau, A. et al. (1996). Life with 6000 genes. Science
274, 546–567.
Goldstein, J. L. and Brown, M. S. (1990). Regulation of
the mevalonate pathway. Nature 343, 425–430.
Heinisch, J. J., Müller, S., Schlüter, E., Jacoby, J. and
Rodicio, R. (1998). Investigation of two yeast genes
encoding putative isoenzymes of phosphoglycerate
mutase. Yeast 14, 203–213.
Hoffmann, C. S. and Winston, F. (1987). A tenminute DNA preparation from yeast efficiently
releases autonomous plasmids for transformation of
Escherichia coli. Gene 57, 267–272.
Huxley, C., Green, E. D. and Dunham, I. (1990). Rapid
assessment of S. cerevisiae mating type by PCR.
Trends Genet. 6, 236.
Jiang, B., Brown, J. L., Sheraton, J., Fortin, N.
and Bussey, H. (1994). A new family of yeast
genes implicated in ergosterol synthesis is related
to the human oxysterol binding protein. Yeast 10,
341–353.
Jimenez, A. and Davies, J. (1980). Expression of transposable antibiotic resistance elements in Saccharomyces. Nature 287, 869–871.
Levanon, D., Hsieh, C.-L., Francke, U., Dawson, P. A.,
Ridgway, N. D., Brown, M. S. and Goldstein, J. L.
(1990). cDNA cloning of human oxysterol-binding
protein and localization of the gene to human chromosome 11 and mouse chromosome 19. Genomics 7,
65–74.
Lorenz, M. L., Muir, R. S., Lim, E., McElver, J., Weber,
S. C. and Heitman, J. (1995). Gene disruption with
PCR products in Saccharomyces cerevisiae. Gene 158,
113–117.
Manivasakam, P., Weber, S. C., McElver, J. and
Schiestl, R. H. (1995). Micro-homology mediated
PCR-targeting in Saccharomyces cerevisiae. Nucleic
Acids Res. 23, 2799–2800.
Oka, A., Sugisaki, H. and Takanami, M. (1981).
Nucleotide sequence of the kanamycin resistance
transposon Tn903. J. Mol. Biol. 147, 217–226.
Oliver, S. G. (1996). A network approach to the systematic analysis of yeast gene function. Trends Genet.
12, 241–242.
Yeast 15, 1275–1285 (1999)
DELETION OF SIX ORF FROM YEAST CHROMOSOME IV LEFT ARM
Orr-Weaver, T. L., Szostak, J. W. and Rothstein, R. J.
(1983). Genetic applications of yeast transformation
with linear and gapped plasmids. Methods Enzymol.
101, 228–245.
Saiz, J. E., Buitrago, M. J., Garcia, R., Revuelta, J. L.
and Del Rey, F. (1996). The sequence of a 20.3 kb
DNA fragment from the left arm of Saccharomyces
cerevisiae chromosome IV contains the KIN28,
MSS2, PHO2, POL3 and DUN1 genes, and six new
open reading frames. Yeast 12, 1077–1084.
Schimmöller, F., Singer-Krüger, B., Schröder, S.,
Krüger, U., Barlowe, C. and Riezman, H. (1995). The
absence of Emp24p, a component of ER-derived
COPII-coated vesicles, causes a defect in transport
of selected proteins to the Golgi. EMBO J. 14,
1329–1339.
Copyright 1999 John Wiley & Sons, Ltd.
1285
Sikorski, R. S. and Hieter, P. (1989). A system of shuttle
vectors and yeast host strains designed for efficient
manipulation of DNA in Saccharomyces cerevisiae.
Genetics 122, 19–27.
Wach, A. (1996). PCR synthesis of marker cassettes with
long flanking homology regions for gene disruption in
S. cerevisiae. Yeast 12, 259–265.
Wach, A., Brachat, A., Pohlmann, R. and Phillipsen, P.
(1994). New heterologous modules for classical or
PCR-based gene disruptions in Saccharomyces
cerevisiae. Yeast 10, 1793–1808.
Winston, F., Dollard, C. and Ricupero-Hovasse, S. L.
(1995). Construction of a set of convenient Saccharomyces cerevisiae strains that are isogenic to S288C.
Yeast 11, 53–55.
Yeast 15, 1275–1285 (1999)
Документ
Категория
Без категории
Просмотров
2
Размер файла
336 Кб
Теги
pan, ura3mx, insaccharomyces, cerevisiae, 1999, cassette, heterologous, erratumyeast, mccusker, 507, goldstein, 511, genes, replacement
1/--страниц
Пожаловаться на содержимое документа