close

Вход

Забыли?

вход по аккаунту

?

Haploinsufficiency of the LIM domain containing preferred translocation partner in lipoma (LPP) gene in patients with tetralogy of Fallot and VACTERL association.

код для вставкиСкачать
RESEARCH LETTER
Haploinsufficiency of the LIM Domain Containing
Preferred Translocation Partner in Lipoma (LPP) Gene
in Patients With Tetralogy of Fallot and VACTERL
Association
Cammon B. Arrington,1 Ankita Patel,2 Carlos A. Bacino,2 and Neil E. Bowles1*
1
Division of Cardiology, Department of Pediatrics, University of Utah School of Medicine, Salt Lake City, Utah
Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas
2
Received 19 May 2010; Accepted 26 July 2010
TO THE EDITOR:
VATER syndrome or VACTERL association (OMIM #192350) is a
non-random association of birth defects. VACTERL is a pattern of
malformation characterized by anomalies of the bony vertebral
column (V), anal atresia (A), congenital cardiac defects (C),
tracheoesophageal defects (TE), renal and urinary tract anomalies
(R), and limb defects (L) [Czeizel and Ludanyi, 1985; Botto et al.,
1997]. It has an estimated incidence of 16 cases per 100,000 live
births. The most common cardiac anomalies seen in VACTERL
association are ventricular septal defects, atrial septal defects, and
tetralogy of Fallot (TOF).
A 6-month-old Caucasian male diagnosed with VACTERL
association was found to have TOF with a right aortic arch and
left superior vena cava draining to the coronary sinus. Additional
congenital malformations included rib anomalies, hypospadias,
small kidneys, and esophageal atresia with a tracheoesophageal
fistula. A sample of blood was collected from the patient and DNA
was analyzed by chromosomal microarray analysis (CMA) using a
105 K custom oligo array designed for constitutional syndromes/
diseases (Agilent Technologies, Santa Clara, CA) at the Baylor
College of Medicine Medical Genetics Laboratory. This analysis
revealed an approximate 451 kb loss in copy number on the distal
long arm of chromosome 3 at band 3q28, with the maximal interval
spanning nucleotides 189,395,885–189,951,376 (nucleotide position based on hg18) (Fig. 1A,B). This region of chromosome 3
includes a single known gene, LPP, which encodes LIM domain
containing preferred translocation partner in lipoma, also known
as Lipoma preferred partner: at least 5 of the 11 exons (exons 3–7,
Fig. 1C) were deleted. The copy number loss was confirmed by
fluorescence in situ hybridization analysis using a bacterial artificial
chromosome (BAC) clone RP11-116H13 (Fig. 1D). The mother
was available for testing by FISH analysis and showed no evidence of
a 3q28 deletion using the same BAC probe (Fig. 1D). The father
declined genetic testing; therefore, it is not known whether the
deletion was inherited or occurred de novo. In the database of
2010 Wiley-Liss, Inc.
How to Cite this Article:
Arrington CB, Patel A, Bacino CA, Bowles NE.
2010. Haploinsufficiency of the LIM domain
containing preferred translocation partner in
lipoma (LPP) gene in patients with tetralogy
of Fallot and VACTERL association.
Am J Med Genet Part A 152A:2919–2923.
20,000 cases at the Baylor Medical Genetics laboratory, a deletion in
this region has not been observed, suggesting it is very rare in the
US population. In the Database of Genetic Variation (http://
projects.tcag.ca/variation/) [Iafrate et al., 2004] there is one report
of an LPP coding deletion occurring in 5 of 3,000 individuals from
Micronesia [Gusev et al., 2009]. From this publication, describing a
method to identify relatedness using SNP data, it is unclear how the
3q28 deletions were confirmed and whether any of the carriers had a
relevant phenotype.
Based upon this finding we investigated the role of LPP mutations in patients with TOF and other conotruncal heart defects
(double outlet right ventricle, truncus arteriosus, transposition of
the great arteries or interrupted aortic arch). With approval from
the University of Utah Institutional Review Board and after obtaining informed consent, DNA was isolated from peripheral blood
samples of 37 probands. Among the probands there were eight with
Grant sponsor: Division of Cardiology, Department of Pediatrics,
University of Utah; Grant Number: M01-RR00064.
*Correspondence to:
Neil E. Bowles, Ph.D., Division of Cardiology, Department of Pediatrics,
University of Utah School of Medicine, Eccles Institute of Human Genetics,
15 North 2030 East, Room 7110B, Salt Lake City, UT 84112.
E-mail: neil.bowles@hsc.utah.edu
Published online 12 October 2010 in Wiley Online Library
(wileyonlinelibrary.com)
DOI 10.1002/ajmg.a.33718
2919
2920
AMERICAN JOURNAL OF MEDICAL GENETICS PART A
FIG. 1. Identification of loss of copy number of the LPP locus in a patient with TOF and VACTERL association. Panel A: Genome view of the CGH results
showing a copy number loss at 3q28 indicated by the circled signals. This is shown in greater detail in (Panel B), a zoomed in view of the copy number
loss region showing individual oligonucleotide probes. Panel C: A view from the UCSC browser of the position of the oligonucleotides showing a copy
number loss (red tick marks) with respect to the LPP gene. The reference transcript (ENST00000312675/NM_005578.3) is indicated by the arrow
showing exons 1–8 of LPP (from left to right). The 50 breakpoint is upstream of exon 3 (the non-coding exons 1 and 2 could be deleted) and the 30
breakpoint is between exons 7 and 8. Panel D: FISH analysis with BAC clone RP11-116H13 on the patient and the mother showing the normal (nl 3)
and deleted chromosome 3 (del 3): LPP is stained red. Panel E: The pedigree of this family. Square, male; circle, female. Black: affected; white:
unaffected. Del 3 ve, normal chromosome 3. Del 3 þve, deletion at 3q28. NT, not tested.
ARRINGTON ET AL.
TOF, five with TOF/pulmonary valve atresia, and one with TOF/
absent pulmonary valve. Three of these patients (two with TOF and
one with TOF/pulmonary valve atresia) had a family history of TOF
in 1st or 2nd degree relatives and the other 11 had no known history
of congenital heart disease. PCR primers were designed to amplify
the 9 coding exons (exons 3–11: NM_005578) of LPP using
the Exon Primer utility (http://ihg.gsf.de/ihg/ExonPrimer.html).
All patient DNA samples were amplified by PCR in duplicate,
along with negative (water) controls, using Platinum Taq DNA
polymerase (Invitrogen, Carlsbad, CA); primer sequences and
amplification conditions are available on request. After amplification, LC Green I (Idaho Technology, Salt Lake City, UT) and DMSO
were added to each reaction to final concentrations of 0.5 and
10%, respectively. The mix was heated at 95 C for 5 min and then
cooled to 4 C.
2921
PCR products were analyzed on a Lightscanner (Idaho
Technology), according to the manufacturer’s instructions
[Arrington et al., 2008]. Samples giving abnormal curves were
treated with 4 ml of Exo-SAP-IT (USB, Cleveland, OH) at 37 C
for 2 h and 80 C for 15 min. DNA aliquots were then analyzed by
agarose gel electrophoresis and submitted to the University of
Utah DNA sequencing core for analysis. DNA sequences were
compared with published sequences using BLAST analysis
(http://www.ncbi.nlm.nih.gov/blast/Blast.cgi) and with genomic
sequences downloaded from Ensembl (http://www.ensembl.org/
Homo_sapiens/Gene/Summary?g¼ENSG00000145012).
In one of the 37 probands (Fig. 2A) we identified a novel LPP
variant that consisted of a deletion within intron 4 (c.306 þ 27_54
del AGGTAAGAGCTGAAGTTAAAGTCATGTT; Fig. 2B). This
Caucasian patient was born with TOF/pulmonary valve atresia,
FIG. 2. Identification of an intronic deletion in LPP in a family with TOF. Panel A: The pedigree of a two-generation family with TOF. Square, male; circle,
female. Black, affected; white, unaffected; c.306 þ 27_54 del, carries the c.306 þ 27_54 del AGGTAAGAGCTGAAGTTAAAGTCATGTT variant; negative, no
variants in LPP. The proband is indicated by the arrow. Panel B: LPP DNA sequence electropherograms from exon 4 of the proband. The region
encompassing the deletion is annotated to show the sequence of wild-type allele (top) and the mutant allele (bottom) with the region deleted shown
in red and underlined. The sequence of the 30 end of exon 4 is boxed. Panel C: The expression of LPP mRNA normalized to a house keeping gene, glucose
-6-dehydrogenase, in two patients harboring the LPP c.306 þ 27_54 del AGGTAAGAGCTGAAGTTAAAGTCATGTT variant (samples 1: proband and 2:
affected sister [gray bars]) and two unaffected family members (samples 3: mother and 4: unaffected sister, respectively [black bars]). Values were
derived by the comparative Ct method (DDCt) using RNA from the unaffected sister as the reference. Expression levels are presented as
mean standard deviation and were compared using one way ANOVA (Holm–Sidak method; SigmaStat, SysStat Software, Chicago, IL). There were no
statistical differences comparing samples 1 and 2 or 3 and 4, but all other comparisons were significantly different (P < 0.05).
2922
hypoplasia of the native pulmonary arteries, systemic to pulmonary
artery collaterals from the descending aorta, and a right aortic arch.
The father and one sister of this patient, both with TOF, were found
to harbor the same LPP deletion (Fig. 2A). As part of a routine
clinical evaluation, the proband and affected sibling were screened
for 22q11 deletion by FISH and both were negative. Notably, a
phenotypically normal sister of the proband did not have the LPP
deletion. No other family members beyond this nuclear family were
available to determine if the father inherited the LPP deletion.
Phenotypic examination of members of this family did not reveal
obvious dysmorphisms, thus, they were considered non-syndromic. Screening of 330 Caucasian controls did not identify this
variant in the normal population. Analysis of this variant in
silico using online splice prediction algorithms (Fruitfly:
http://www.fruitfly.org/seq_tools/splice.html and NetGene: http://
www.cbs.dtu.dk/services/NetGene2/) did not predict any change in
mRNA splicing. However, to investigate effects on RNA splicing
and stability we obtained saliva samples from the proband, the
affected sister, the unaffected sister, and the unaffected mother in
Oragene RNA tubes (DNA Genotek, Kanata, ON, Canada). RNA
was isolated from 1 ml of saliva using an RNeasy Micro kit (Qiagen,
Valencia, CA), according to the manufacturer’s instructions. Complementary DNA (cDNA) was synthesized using Superscript III
(Invitrogen) with random primers, according to the manufacturer’s instructions. Aliquots of cDNA were amplified by PCR using
combinations of forward primers in exons 3 and 4 and reverse
primers in exons 5 and 6 (primer sequences available on request)
and the products analyzed by agarose gel electrophoresis. This did
not reveal any qualitative differences in RNA splicing. We then
performed quantitative PCR on the cDNA products using Applied
Biosystems 2 mastermix with SYBR green (Invitrogen) using the
exon 4F and 5R and exon 3F and 6R primer combinations. The
reactions were analyzed on an ABI 7900 (Invitrogen) real-time PCR
machine. As shown in Figure 2C, the amount of LPP transcript,
detected using the 4F and 5R primers, was significantly less (about
half) in the samples of the proband and his affected sister compared
to the unaffected sister and mother; concordant data were obtained
with the exon 3F and 6R primer combination (data not shown). We
concluded there was either increased degradation of the transcript
or that the deletion prevented normal splicing of this transcript:
intron 4 is 39,960 bp in length and, thus, too large to amplify by
standard PCR. RT-PCR using a forward primer in exon 4 and a
reverse primer 7 bp downstream of the deletion in intron 4 failed to
amplify a product suggesting the RNA had been degraded.
There have been a number of previous reports of novel gene
variants in patients with TOF. These include variants in NKX2.5
[Goldmuntz et al., 2001], JAG1 [Eldadah et al., 2001], ZFPM2
[Pizzuti et al., 2003], GDF1 [Karkera et al., 2007] GATA4 [TomitaMitchell et al., 2007], CFC1, FOXH1 and TDGF1 [Roessler et al.,
2008], and NODAL [Roessler et al., 2009]. Recently analysis of copy
number variants (CNV) identified 11 de novo CNVs that were
positively associated with TOF [Greenway et al., 2009]. These
regions included chromosome 1q21.1, 3p25.1, 7p21.3, and
22q11.2 but did not correspond to the LPP locus (3q28). Our data
suggest that haploinsufficiency of LPP may be an additional cause of
conotruncal anomalies, specifically forms of TOF. LPP is a member
of the zyxin family of proteins with a proline rich LIM domain. It is
AMERICAN JOURNAL OF MEDICAL GENETICS PART A
highly expressed at plasma membrane dense bodies and focal
adhesions in smooth muscle cells (SMCs), but is also expressed in
the heart [Gorenne et al., 2003]. Knockdown of LPP in zebrafish
results in defective cell migration during gastrulation, particularly
in the process of convergence and extension [Vervenne et al., 2008].
In Lpp knockout mice, partial embryonic lethality of Lpp/
females was observed but the cardiovascular status of Lpp/ mice
was not reported [Vervenne et al., 2009]. Further work will be
needed to determine whether LPP is expressed in cells that
migrate into the developing conotruncus such as the secondary
heart field or neural crest and whether haploinsufficiency of LPP
leads to abnormalities in conotruncal development in animal
models.
The etiology of VACTERL association is unknown. It has been
suggested that mutations in BRCA2 and mitochondrial DNA may
be linked to VACTERL association [Damian et al., 1996; Stone and
Biesecker, 1997; Alter et al., 2007]. In animal models, altered sonic
hedgehog (SHH) signaling leads to a spectrum of developmental
defects similar to those seen in VACTERL association [Kim et al.,
2001]. Though mutations in SHH have not yet been identified in
patients with VACTERL association [Aguinaga et al., 2010], a
recent study reported a heterozygous de novo 21-bp deletion in
HOXD13, a downstream target of SHH, in a patient with anal
atresia, vesicoureteric reflux, and TOF [Garcia-Barcelo et al., 2008].
Moreover, we report on copy number loss of LPP in a patient with
VACTERL and LPP has been shown to bind PEA3, an ETS domain
transcription factor that has a role in regulating the SHH pathway
[Guo et al., 2006]. Based on these findings, genes associated with the
SHH pathway may play an important role in VACTERL association
[Kim et al., 2001].
In conclusion, haploinsufficiency of LPP may be a novel cause of
conotruncal cardiac anomalies, particularly forms of TOF. In
addition, further consideration should be given to the SHH pathway as a potential cause of VACTERL association.
ACKNOWLEDGMENTS
This work was supported by funds from the Division of Cardiology,
Department of Pediatrics, University of Utah, Public Health Services research grant #M01-RR00064 from the National Center for
Research Resources, the Children’s Health Research Center at the
University of Utah, and the Clinical Genetics Research Program at
the University of Utah.
REFERENCES
Aguinaga M, Zenteno JC, Perez-Cano H, Moran V. 2010. Sonic hedgehog
mutation analysis in patients with VACTERL association. Am J Med
Genet Part A 152A:781–783.
Alter BP, Rosenberg PS, Brody LC. 2007. Clinical and molecular features
associated with biallelic mutations in FANCD1/BRCA2. J Med Genet
44:1–9.
Arrington CB, Sower CT, Chuckwuk N, Stevens J, Leppert MF, Yetman AT,
Bowles NE. 2008. Absence of TGFBR1 and TGFBR2 mutations in patients
with bicuspid aortic valve and aortic dilation. Am J Cardiol 102:629–631.
Botto LD, Khoury MJ, Mastroiacovo P, Castilla EE, Moore CA, Skjaerven R,
Mutchinick OM, Borman B, Cocchi G, Czeizel AE, Goujard J, Irgens LM,
ARRINGTON ET AL.
Lancaster PA, Martinez-Frias ML, Merlob P, Ruusinen A, Stoll C,
Sumiyoshi Y. 1997. The spectrum of congenital anomalies of the VATER
association: An international study. Am J Med Genet 71:8–15.
Czeizel A, Ludanyi I. 1985. An aetiological study of the VACTERLassociation. Eur J Pediatr 144:331–337.
Damian MS, Seibel P, Schachenmayr W, Reichmann H, Dorndorf W. 1996.
VACTERL with the mitochondrial np 3243 point mutation. Am J Med
Genet 62:398–403.
Eldadah ZA, Hamosh A, Biery NJ, Montgomery RA, Duke M, Elkins R,
Dietz HC. 2001. Familial tetralogy of Fallot caused by mutation in the
jagged1 gene. Hum Mol Genet 10:163–169.
Garcia-Barcelo MM, Wong KK, Lui VC, Yuan ZW, So MT, Ngan ES, Miao XP,
Chung PH, Khong PL, Tam PK. 2008. Identification of a HOXD13 mutation
in a VACTERL patient. Am J Med Genet Part A 146A: 3181–3185.
Goldmuntz E, Geiger E, Benson DW. 2001. NKX2.5 mutations in patients
with tetralogy of fallot. Circulation 104:2565–2568.
Gorenne I, Nakamoto RK, Phelps CP, Beckerle MC, Somlyo AV, Somlyo
AP. 2003. LPP, a LIM protein highly expressed in smooth muscle. Am J
Physiol Cell Physiol 285:C674–C685.
Greenway SC, Pereira AC, Lin JC, DePalma SR, Israel SJ, Mesquita SM,
Ergul E, Conta JH, Korn JM, McCarroll SA, Gorham JM, Gabriel S,
Altshuler DM, Quintanilla-Dieck Mde L, Artunduaga MA, Eavey RD,
Plenge RM, Shadick NA, Weinblatt ME, De Jager PL, Hafler DA, Breitbart
RE, Seidman JG, Seidman CE. 2009. De novo copy number variants
identify new genes and loci in isolated sporadic tetralogy of Fallot. Nat
Genet 41:931–935.
Guo B, Sallis RE, Greenall A, Petit MM, Jansen E, Young L, Van de Ven WJ,
Sharrocks AD. 2006. The LIM domain protein LPP is a coactivator for the
ETS domain transcription factor PEA3. Mol Cell Biol 26:4529–4538.
2923
Karkera JD, Lee JS, Roessler E, Banerjee-Basu S, Ouspenskaia MV,
Mez J, Goldmuntz E, Bowers P, Towbin J, Belmont JW, Baxevanis AD,
Schier AF, Muenke M. 2007. Loss-of-function mutations in
growth differentiation factor-1 (GDF1) are associated with congenital
heart defects in humans. Am J Hum Genet 81:987–994.
Kim J, Kim P, Hui CC. 2001. The VACTERL association: Lessons from the
Sonic hedgehog pathway. Clin Genet 59:306–315.
Pizzuti A, Sarkozy A, Newton AL, Conti E, Flex E, Digilio MC, Amati F,
Gianni D, Tandoi C, Marino B, Crossley M, Dallapiccola B. 2003.
Mutations of ZFPM2/FOG2 gene in sporadic cases of tetralogy of Fallot.
Hum Mutat 22:372–377.
Roessler E, Ouspenskaia MV, Karkera JD, Velez JI, Kantipong A, Lacbawan
F, Bowers P, Belmont JW, Towbin JA, Goldmuntz E, Feldman B, Muenke
M. 2008. Reduced NODAL signaling strength via mutation of several
pathway members including FOXH1 is linked to human heart defects and
holoprosencephaly. Am J Hum Genet 83:18–29.
Roessler E, Pei W, Ouspenskaia MV, Karkera JD, Velez JI, Banerjee-Basu S,
Gibney G, Lupo PJ, Mitchell LE, Towbin JA, Bowers P, Belmont JW,
Goldmuntz E, Baxevanis AD, Feldman B, Muenke M. 2009. Cumulative
ligand activity of NODAL mutations and modifiers are linked to
human heart defects and holoprosencephaly. Mol Genet Metab 98:
225–234.
Stone DL, Biesecker LG. 1997. Mitochondrial NP 3243 point mutation is
not a common cause of VACTERL association. Am J Med Genet 72:
237–238.
Tomita-Mitchell A, Maslen CL, Morris CD, Garg V, Goldmuntz E. 2007.
GATA4 sequence variants in patients with congenital heart disease. J Med
Genet 44:779–783.
Gusev A, Lowe JK, Stoffel M, Daly MJ, Altshuler D, Breslow JL, Friedman
JM, Pe’er I. 2009. Whole population, genome-wide mapping of hidden
relatedness. Genome Res 19:318–326.
Vervenne HB, Crombez KR, Lambaerts K, Carvalho L, Koppen M,
Heisenberg CP, Van de Ven WJ, Petit MM. 2008. Lpp is involved in
Wnt/PCP signaling and acts together with Scrib to mediate convergence
and extension movements during zebrafish gastrulation. Dev Biol
320:267–277.
Iafrate AJ, Feuk L, Rivera MN, Listewnik ML, Donahoe PK, Qi Y, Scherer
SW, Lee C. 2004. Detection of large-scale variation in the human genome.
Nat Genet 36:949–951.
Vervenne HB, Crombez KR, Delvaux EL, Janssens V, Van de Ven WJ, Petit
MM. 2009. Targeted disruption of the mouse lipoma preferred partner
gene. Biochem Biophys Res Commun 379:368–373.
Документ
Категория
Без категории
Просмотров
1
Размер файла
277 Кб
Теги
tetralogy, domain, lim, haploinsufficiency, patients, lpp, lipoma, containing, associations, fallos, preferred, vacterl, genes, translocation, partner
1/--страниц
Пожаловаться на содержимое документа