close

Вход

Забыли?

вход по аккаунту

?

Association analysis of the monoamine oxidase A and B genes with attention deficit hyperactivity disorder (ADHD) in an Irish sample Preferential transmission of the MAO-A 941G allele to affected children.

код для вставкиСкачать
American Journal of Medical Genetics Part B (Neuropsychiatric Genetics) 134B:110 –114 (2005)
Association Analysis of the Monoamine Oxidase A and
B Genes With Attention Deficit Hyperactivity Disorder
(ADHD) in an Irish Sample: Preferential Transmission
of the MAO-A 941G Allele to Affected Children
Katharina Domschke,1,2 Karen Sheehan,1 Naomi Lowe,1 Aiveen Kirley,1 Celine Mullins,1 Roderick O’Sullivan,1
Christine Freitag,3 Tim Becker,3 Judith Conroy,1 Michael Fitzgerald,1 Michael Gill,1 and Ziarih Hawi1*
1
Departments of Genetics and Psychiatry, Trinity College Dublin, Ireland
Department of Psychiatry, University of Muenster, Germany
3
Department of Child and Adolescent Psychiatry, University of Saarland, and Institute for Medical Biometry,
Informatics, and Epidemiology, University of Bonn, Germany
2
Pharmacological and genetic studies suggest the
importance of the dopaminergic, serotonergic,
and noradrenergic systems in the pathogenesis of
attention deficit hyperactivity disorder (ADHD).
Monoamine oxidases A and B (MAO-A and MAO-B)
degrade biogenic amines such as dopamine and
serotonin and thereby control the levels of these
neurotransmitters in the central nervous system.
We examined four polymorphisms in the MAO-A
gene (30 bp promoter VNTR, CA microsatellite in
intron 2, 941G/T SNP in exon 8, and A/G SNP in
intron 12) as well as two markers in the MAO-B
gene (CA microsatellite in intron 2 and T/C SNP in
intron 13) for association with ADHD in an Irish
sample of 179 nuclear families. TDT analysis of the
examined MAO-A markers revealed a significant
association of the more active MAO-A 941G allele
with the disorder (x2 ¼ 5.1, P ¼ 0.03, OR ¼ 1.7). In
addition, haplotype analysis revealed a significantly increased transmission of a haplotype
consisting of the shorter allele of the promoter
VNTR (allele 1), the 6-repeat allele of the CA
microsatellite and the G-allele of the 941G/T SNP
(famhap global statistic 34.54, P ¼ 0.01) to ADHD
cases. No significant distortion in the number of
transmitted alleles was observed between the two
examined MAO-B polymorphisms and ADHD.
These findings suggest the importance of the
941G/T MAO-A polymorphism in the development
of ADHD at least in the Irish population.
ß 2005 Wiley-Liss, Inc.
Grant sponsor: Health Research Board, Dublin (to K.S., N.L.,
and A.K.); Grant sponsor: Wellcome Trust; Grant sponsor: Dublin
Molecular Medicine Centre (to Z.H.); Grant sponsor: Heinrich–
Hertz–Stiftung (to K.D.); Grant sponsor: Hyperactive and Attention Disorder (HAD) Group Ireland.
*Correspondence to: Dr. Ziarih Hawi, Department of Genetics,
Trinity College Dublin, Dublin 2, Ireland. E-mail: zhhawi@tcd.ie
Received 31 August 2004; Accepted 9 November 2004
DOI 10.1002/ajmg.b.30158
ß 2005 Wiley-Liss, Inc.
KEY WORDS:
attention deficit hyperactivity
disorder; monoamine oxidase A;
monoamine oxidase B; TDT; Xchromosome
INTRODUCTION
Attention deficit hyperactivity disorder (ADHD) is one of the
most common behavioral disorders affecting 2%–6% of schoolaged children worldwide [Tannock, 1998]. It is characterized
by inattention, hyperactive, and impulsive behavior leading to
difficulty organizing tasks, excessive motor activity and risk
taking behavior. Although the aetiology of ADHD is not fully
understood, a strong genetic component in the pathogenesis of
the disease with an estimated heritability of 70%–90% has
been reported [Levy et al., 1997].
Several lines of evidence have implicated the dopaminergic,
noradrenergic, and serotonergic systems in the development of
ADHD. Monoamine oxidase A (MAO-A) is an enzyme that
degrades biogenic amines such as dopamine, noradrenaline,
adrenaline, and serotonin by oxidative deamination and thereby plays a key role in the modification of signal transduction in
these neurotransmitter systems [Shih and Thompson, 1999].
In addition, MAO-A inhibitors such as tranylcypromine have
been shown to be effective in the pharmacological treatment of
ADHD [Zametkin et al., 1985]. Furthermore, MAO-A has also
been reported to be involved in the pathogenesis of the
intermediate phenotypes ‘‘impulsivity’’ and ‘‘aggression’’.
Brunner et al. [1993] described a rare point mutation in the
MAO-A gene associated with loss of function, which resulted in
a highly impulsive and aggressive behavioural phenotype.
Moreover, MAO-A knockout mice have been observed to
exhibit a significantly increased aggressive behavior accompanied by elevated levels of serotonin, noradrenaline, and
dopamine [Cases et al., 1995]. Finally, maltreated children
with a genotype conferring high levels of MAO-A expression
were reported to be less likely to develop antisocial problems
[Caspi et al., 2002].
In children with ADHD, significantly lower levels of platelet
MAO-A activity associated with increased impulsivity and
inattention were reported [Shekim et al., 1986]. These findings
indicate that MAO-A is a good candidate gene for ADHD and
that DNA variations in this gene may play a role in the
predisposition to the disorder. The gene maps to chromosome
Xp11.4-p11.3. A functionally relevant 30 bp VNTR has been
Association Analysis of the MAO-A and B Genes and ADHD Genes
identified in the promoter region of the MAO-A gene [Sabol
et al., 1998]. The longer alleles (3a, 4, and 5) have been shown to
affect the transcription of the gene three to four times more
efficiently than the shorter allele 3 [Deckert et al., 1999].
Significant association between the longer alleles of the VNTR
and ADHD has been observed [Manor et al., 2002], but could
not be replicated in an independent study [Lawson et al., 2003].
The short allele has been reported to be associated with
impulsivity and aggression [Manuck et al., 2000], which was
confirmed in a subgroup of patients with ADHD and broadly
defined concurrent conduct disorder [Lawson et al., 2003].
Another functional variant, a silent 941G/T polymorphism in
exon 8 has been reported to be associated with low (941T) and
high (941G) MAO-A activity, respectively [Hotamisligil and
Breakefield, 1991]. However, a recent study did not find any
association of this polymorphism with either ADHD in general
or a subgroup of patients with ADHD and broadly defined
concurrent conduct disorder [Lawson et al., 2003]. Finally, a
CA-repeat microsatellite located in intron 2 [Black et al., 1991]
was reported to be associated with ADHD in a Chinese sample
[Jiang et al., 2001]. This has been supported by similar findings
describing a trend towards preferential transmission of the
122 bp allele of the CA(n) microsatellite, which, however, is not
the same allele that Jiang et al. reported to be linked with the
disease [Payton et al., 2001].
Monoamine oxidase B (MAO-B) catalyzes the oxidative
deamination of neurotransmitters such as dopamine, phenylethylamine, and benzylamine. Additionally, pharmacological
studies provide preliminary evidence for a beneficial effect of
monoamine oxidase B inhibitors such as selegiline or deprenyl
in the treatment of ADHD [Feigin et al., 1996; Akhondzadeh
et al., 2003]. Administration of deprenyl has also been shown to
significantly reduce impulsiveness in an animal model of
ADHD [Boix et al., 1998]. Thus, the MAO-B gene was regarded
as a good candidate gene for ADHD. The gene coding for MAOB maps to chromosome Xp11.23 in close proximity to the MAOA gene. The MAO-A and MAO-B genes are functionally related
to each other by exhibiting an identical exon-intron organization as well as a high sequence similarity [Grimsby et al., 1991].
A CA-repeat polymorphism in intron 2 of the MAO-B gene
(rs3838196) has been analyzed in a Chinese sample with
ADHD, but was not found to be associated with the disorder
[Jiang et al., 2001]. Additionally, a single nucleotide T/C
polymorphism (rs1799836) in intron 13 has been reported as a
possible risk factor for Parkinson disease [Costa et al., 1997],
but to date has not yet been examined in relation to ADHD.
111
In the present study, we attempted to assess the importance
of the above-mentioned three variants at the MAO-A locus in a
sample of 179 Irish ADHD nuclear families. Furthermore, we
also examined an additional MAO-A marker in an effort to
conduct linkage disequilibrium and haplotype analysis of the
studied markers. We also examined two markers at the MAO-B
locus for possible association/linkage with ADHD.
MATERIALS AND METHODS
Subjects
The Irish clinical ADHD sample comprising 179 nuclear
families was recruited from child psychiatric clinics and
schools in West County Dublin and from the Hyperactive and
Attention Deficit Children’s Support Group of Ireland. Further
details on the sample used in the present study can be found in
Kirley et al. [2004].
Genotyping
DNA was extracted from whole blood using standard phenol
chloroform procedure or from buccal cells as described in Daly
et al. [1999]. Fragments containing the respective polymorphisms were amplified by PCR on a PTC-225 Peltier
Thermocycler (MJ Research, Dublin, Ireland) and subsequently genotyped using the conditions given in Table I. The
two microsatellite markers (MAO-A CA(n) and MAO-B CA(n)
(rs3838196)) were genotyped using the semi automated florescent method on an ABI 3100 DNA sequencer (ABI Applied
Biosystems, Warrington, UK).
Statistical Analysis
For single marker analysis, we used the transmission
disequilibrium test (TDT) [Spielman et al., 1993]. The
McNemar w2 test was used to assess the significance level.
For the analysis of multi-allelic markers, we applied the ETDT
(TDTPHASE v2.40) [Dudbridge, 2003]. Since MAO-A and
MAO-B are x-linked markers, genotype information from
fathers was only used in the analysis of female patients with
ADHD. Linkage disequilibrium (LD) between the markers
expressed as D0 was assessed by means of the GOLD program
(www.well.ox.ac.uk/asthma/gold). Only parents’ (in female
probands) and mothers’ (in male probands) genotypes
were used to assess LD. Hardy–Weinberg equilibrium was
TABLE I. PCR and Genotyping Conditions for the Examined MAO-A and MAO-B Markers
Primer (50 –30 )
MAO-A
30 bp VNTR
CA(n) repeat
94IG/T
A/G (rs979605)
MAO-B
T/C (rs1799836)
CA(n) repeat
(rs3838196)
F: CCCAGGCTGCTCCAGAAAC
R: GGACCTGGGCAGTTGTGC
F: AGAGACTAGACAAGTTGCAC
R: CACTATCTTGTTAGCTCACT
F: GACCTTGACTGCCAAGAT
R: CTTCTCCTTCCAGAAGGCC
F: GCTGCTACACGGCCTACTTC
R: AGAAATGGGGATTTTGACAAC
F(T): CACTGGCAAATAGCAAAAGT
F(C): CACTGGCAAATAGCAAAAGC
R: GGATTTACTTTGCAGGCACC
F: GTGTTGGTGTGAAGGAAGCA
R: GATTGAGTAAGAGGGAAATGG
Annealing
temperature (8C)
Restriction
enzyme
56
—
Deckert et al. [1999]
56
—
Black et al. [1991]
54
Fnu4HI
64
TspRI
64
—
64
—
Reference
Hotamisligil and
Breakefield [1991]
—
Costa et al. [1997]
—
w2 ¼ 0, df ¼ 1, P ¼ 1.0
w2 ¼ 0.2, df ¼ 1, P ¼ 0.71
w2 ¼ 5.1, df ¼ 1, P ¼ 0.03*
LRS ¼ 10.8, df ¼ 7, P ¼ 0.15
9
0
20
9
4
18
34
11
7
2
27
2
4
15
42
6
w2 ¼ 0.9, df ¼ 1, P ¼ 0.39
48
39
As in previous studies [Manor et al., 2002; Lawson et al., 2003], due to their functional roles [Deckert et al., 1999] the alleles of the MAO-A 30 bp VNTR were grouped into two classes (3 allele vs. all longer alleles
(3a, 4, and 5) and named allele 1 and 2, respectively. Alleles 3 and 4, however, in concordance with other studies constituted over 95% of all observed alleles.
Eight alleles were detected, which were name according to fragment length from 1 (longest) through 8 (shortest).
c
Twelve alleles were detected, which were named according to fragment length from 1 (longest) through 12 (shortest). Only eight of these alleles, however, were found to be transmitted from heterozygous
mothers.
*Significant P-value at a significance level of 0.05.
b
a
47
47
47
47
941G/T
1 (T)
2 (G)
26
45
45
26
1 (A)
2 (G)
35
31
31
35
1 (T)
2 (C)
T/C (rs1799836)
A/G(rs979605)
T
Marker alleles
NT
CA(n)
1
2
3
4
5
6
7
8
NT
T
Marker allelesc
NT
NT
Marker alleles
T
MAO-B
T
Marker alleles
NT
T
39
48
1(3)
2(3a,4,5)
DISCUSSION
In the present study, we conducted TDT analysis on four
markers in the MAO-A gene, three of which have been
previously analyzed for association with ADHD in several
different studies [Jiang et al., 2001; Payton et al., 2001; Manor
et al., 2002; Lawson et al., 2003]. The examined markers are
spaced about 20 kb along the MAO-A gene. Significant linkage/
30 bp VNTR
No difference in the transmission of T or C alleles of the
MAO-B rs1799836 marker to affected children was observed
(Table II). ETDT analysis performed on the CA(n) (rs3838196)
marker showed a slight, but insignificant increase in the
transmission of allele 3 (Table II). D0 analysis showed no
evidence for LD between the two markers (D0 ¼ 0.27, P ¼ 0.2).
Marker allelesb
MAO-B
NT
MAO-A
TDT analysis conducted on all examined markers of the
MAO-A gene (Table II) showed significantly higher transmission of the more active 941G allele (allele 2) to ADHD cases as
compared to the lower active 941T allele (allele 1) (transmitted:
45, not transmitted: 26; w2 ¼ 5.1, P ¼ 0.03, OR ¼ 1.7). Additionally, stratifying the sample for parental history of ADHD, an
increased transmission of the more active 941G allele from
parents with a positive history for ADHD was observed
(transmitted: 26, not transmitted: 13; w2 ¼ 4.3, P ¼ 0.06). None
of the remaining examined markers showed any significant
distortion in the transmission to ADHD cases. LD measured as
D0 among the MAO-A markers was significant between all
examined markers (Table III) with D0 ranging between 0.63
and 0.85. Haplotype analysis using a two-marker window
revealed a significantly increased transmission of a haplotype
containing the shorter 3 allele of the 30 bp VNTR (allele 1) and
allele 6 of the CA-repeat (transmitted: 24, not transmitted: 11;
famhap global statistic: 24.86, P ¼ 0.05). This association was
further enhanced when a three-marker window (including
the 941G/T) was analyzed. A haplotype comprising allele 1 of
the 30 bp VNTR, allele 6 of the CA-repeat and the 941G allele
(allele 2) was preferentially transmitted to ADHD cases
(transmitted: 14, not transmitted: 5; famhap global statistic:
34.54, P ¼ 0.01).
T
The distribution of genotypes (from parents with no history
of ADHD) for all examined markers did not significantly differ
from those expected according to the Hardy–Weinberg
equilibrium.
Marker allelesa
RESULTS
MAO-A
examined using the online site (http://kursus.kvl.dk/shares/
vetgen/_Popgen/genetik/applets/kitest.htm). Haplotype analysis was carried out using the program FAMHAP (version 14)
[Becker and Knapp, 2004]. In this program, an expectation
maximization (EM) algorithm is implemented to estimate
transmitted and nontransmitted haplotype frequencies. The
test statistic is computed from the table of transmitted and
nontransmitted haplotypes. FAMHAP is unique in taking the
smallest P-value found among the combinations as test
statistic. The transmission/nontransmission status is then
permuted to obtain the distribution of the test statistic. The
empirical P-value is the fraction of permutation replicates
resulting in a test statistic greater than or equal to the test
statistics of the real data. The program was run on genotypes
from 170 parent child trios, where genotype information for all
four MAO-A SNPs was obtainable. For families with a male
proband, transmitted and nontransmitted haplotypes of the
mother only were used. Statistical analyses were not corrected
for multiple testing.
CA(n)
(rs3838196)
1
0
0
2
5
10
3
37
27
4
23
23
5
25
34
6
17
17
7
8
5
8
1
0
9
0
0
10
1
1
11
0
0
12
0
0
LRS ¼ 5.8, df ¼ 7, P ¼ 0.56
Domschke et al.
TABLE II. Frequencies and Statistical Analysis of Transmitted (T) and Not Transmitted (NT) Alleles of MAO-A and MAO-B Markers to ADHD Cases
112
Association Analysis of the MAO-A and B Genes and ADHD Genes
0
TABLE III. Linkage Disequilibrium Analysis (Measured as D )
Between the Examined MAO-A Markers
Marker 1
30 bp VNTR
30 bp VNTR
30 bp VNTR
CA(n) repeat
CA(n) repeat
941G/T
Marker 2
w2
P-value
D0
CA(n) repeat
941G/T
A/G (rs979605)
941G/T
A/G (rs979605)
A/G (rs979605)
145.2
70.7
88.9
105.5
127.3
153.1
0.0000
0.0000
0.0000
0.0000
0.0000
0.0000
0.746
0.630
0.709
0.690
0.758
0.853
association between ADHD and the more active MAO-A 941G
allele was observed, as it was the case for a haplotype containing the 941G allele.
Evidence arising from functional imaging, genetic and
biochemical studies point towards a hypodopaminergic state
in the pathogenesis of ADHD [Solanto, 2002]. The increased
frequency of the more active MAO-A 941G allele in ADHD can
be explained on the basis that elevated MAO-A activity would
result in a higher turnover and thereby decreased levels of
dopamine, which possibly contributes to the dopamine deficit
proposed for ADHD. Besides degrading dopamine, MAO-A is
additionally involved in the metabolic degradation of serotonin
(5-HT), which has also been implicated in the pathogenesis of
ADHD. Peripheral measures of blood serotonin as well as
central 5-HT function have been reported to be reduced in
children with ADHD [Kruesi et al., 1990; Spivak et al., 1999].
Also, there is some evidence that serotonin agonists such as
fluoxetine might be effective in the pharmacological treatment
of ADHD [Gainetdinov et al., 1999]. A higher activity variant of
MAO-A generating a higher serotonin turnover would be likely
to exacerbate serotonin deficiency in ADHD and thereby
increase the susceptibility to the disorder. Furthermore,
although the MAO-A 941G/T polymorphism is functional, it
is possible that the observed association results from another
functional variant within the coding region or the boundaries
of the MAO-A gene. However, the present study failed to
confirm previous studies reporting positive linkage/association
results of ADHD with the longer, higher activity alleles of the
MAO-A 30 bp VNTR [Manor et al., 2002] and the MAO-A CA(n)
microsatellite [Jiang et al., 2001; Payton et al., 2001]. An
explanation for these diverging findings could be populationspecific genetic heterogeneity as reflected by a Chinese study
reporting strong evidence for association of ADHD with the
DXS7 marker closely linked to the MAO-A gene [Jiang et al.,
2000], which, however, could not be confirmed in an Irish study
[Lowe et al., 2001]. Additionally, applying a TDT design in the
investigation of x-chromosomal markers such as MAO-A and
MAO-B restricts the use of informative transmissions to
heterozygous mothers only. This decreases the statistical
power and thereby increases the risk of false negative results.
In this case, as suggested by Manor et al. [2002] a case-controlbased approach might be of additional value.
With regard to the MAO-B gene, the present study confirms
previous reports of no linkage/association of the MAO-B CA(n)
microsatellite (rs3838196) in a Chinese sample of patients with
ADHD [Jiang et al., 2001]. Additionally, we did not observe
association of MAO-B rs1799836 with the disorder suggesting
no major influence of the examined MAO-B markers on the
pathogenesis of ADHD at least in the Irish population.
In conclusion, the findings of the present study indicate that
the higher activity variant of the monoamine oxidase A (941G)
might be a risk factor in the development of ADHD. This is in
keeping with the hypodopaminergic and/or hyposerotonergic
hypothesis of the pathogenesis of the disorder. In the future, it
will be of interest to investigate the role of this marker by using
intermediate- or endophenotypes such as electrophysiological
113
markers, functional neuroimaging or performance on neuropsychological tasks.
ACKNOWLEDGMENTS
We would also like to thank the families that participated in
the study.
REFERENCES
Akhondzadeh S, Tavakolian R, Davari-Ashtiani R, Arabgol F, Amini H.
2003. Selegiline in the treatment of attention deficit hyperactivity
disorder in children: A double blind and randomized trial. Prog
Neuropsychopharmacol Biol Psychiatry 27:841–845.
Becker T, Knapp M. 2004. A powerful strategy to account for multiple testing
in the context of haplotype analysis. Am J Hum Genet 75:561–570.
Black GCM, Chen ZY, Craig IW, Powell JF. 1991. Dinucleotide repeat at the
MAOA locus. Nucleic Acid Res 19:689.
Boix F, Qiao SW, Kolpus T, Sagvolden T. 1998. Chronic L-deprenyl
treatment alters brain monoamine levels and reduces impulsiveness in
an animal model of attention-deficit hyperactivity disorder. Behav Brain
Res 94:153–162.
Brunner HG, Nelen M, Breakefield XO, Ropers HH, van Oost BA. 1993.
Abnormal behavior associated with a point mutation in the structural
gene for monoamine oxidase A. Science 262:578–580.
Cases O, Seif I, Grimsby J, Gaspar P, Chen K, Pournin S, Műller U,
Aguet M, Babinet C, Chen Shih J, De Maeyer E. 1995. Aggressive
behavior and altered amounts of brain serotonin and norepinephrine in
mice lacking MAOA. Science 268:1763–1766.
Caspi A, McClay J, Moffitt TE, Mill J, Martin J, Craig IW, Taylor A, Poulton
R. 2002. Role of genotype in the cycle of violence in maltreated children.
Science 297:851–854.
Costa P, Checkoway H, Levy D, Smith-Weller T, Franklin GM, Swanson PD,
Costa LG. 1997. Association of a polymorphism in intron 13 of the
monoamine oxidase B gene with parkinson disease. Am J Med Genet
74:154–156.
Daly G, Hawi Z, Fitzgerald M, Gill M. 1999. Mapping susceptibility loci in
attention deficit hyperactivity disorder: Preferential transmission of
parental alleles at DAT1, DBH and DRD5 to affected children. Mol
Psychiatry 4:192–196.
Deckert J, Catalano M, Syagailo YV, Bosi M, Okladnova O, DiBella D,
Noethen MM, Maffei P, Franke P, Fritze J, Maier W, Propping P,
Beckmann H, Bellodi L, Lesch KP. 1999. Excess of high activity
monoamine oxidase A gene promoter alleles in female patients with
panic disorder. Hum Mol Genet 8:621–624.
Dudbridge F. 2003. Pedigree disequilibrium tests for multilocus haplotypes.
Genet Epidemiol 25:115–221.
Feigin A, Kurlan R, McDermott MP, Beach J, Dimitsopulos T, Brower CA,
Chapieski L, Trinidad K, Como P, Jankovic J. 1996. A controlled trial of
deprenyl in children with Tourette’s syndrome and attention deficit
hyperactivity disorder. Neurology 46:965–968.
Gainetdinov RR, Wetsel WC, Jones SR, Levin ED, Jaber M, Caron MG. 1999.
Role of serotonin in the paradoxical calming effect of psychostimulants
on hyperactivity. Science 283:397–401.
Grimsby J, Chen K, Wang LJ, Lan NC, Shih JC. 1991. Human monoamine
oxidase A and B genes exhibit identical exon–intron organization. Proc
Natl Acad Sci USA 88:3637–3641.
Hotamisligil GS, Breakefield XO. 1991. Human monoamine oxidase A gene
determines levels of enzyme activity. Am J Hum Genet 49:383–392.
Jiang S, Xin R, Wu X, Lin S, Qian Y, Ren D, Tang G, Wang D. 2000.
Association between attention deficit hyperactivity disorder and the
DXS7 locus. Am J Med Genet 96:289–292.
Jiang S, Xin R, Lin S, Qian Y, Tang G, Wang D, Wu X. 2001. Linkage studies
between attention-deficit hyperactivity disorder and the monoamine
oxidase genes. Am J Med Genet 105:783–788.
Kirley A, Lowe N, Mullins C, McCarron M, Daly G, Waldman I, Fitzgerald
M, Gill M, Hawi Z. 2004. Phenotype studies of the DRD4 gene
polymorphisms in ADHD: Association with oppositional defiant disorder
and positive family history. Am J Med Genet (Neuropsychiatry Genet)
15; 131B(1):38–42.
Kruesi MJ, Papoport JL, Hamburger S, Hibbs E, Potter WZ, Lenane M,
Brown GL. 1990. Cerebrospinal fluid monoamine metabolites, aggression, and impulsivity in disruptive behavior disorders of children and
adolescents. Arch Gen Psychiatry 47:419–426.
114
Domschke et al.
deficit hyperactivity disorder: A family-based study. Am J Med Genet
105:464–470.
Lawson DC, Turic D, Langley K, Pay HM, Govan CF, Norton N, Hamshere
ML, Owen MJ, O’Donovan MC, Thapar A. 2003. Association analysis of
monoamine oxidase A and attention deficit hyperactivity disorder. Am
J Med Genet 116:84–89.
Sabol SZ, Hu S, Hamer D. 1998. A functional polymorphism in the
monoamine oxidase A gene promoter. Hum Genet 103:273–279.
Levy F, Hay DA, McStephen M, Wood C, Waldman I. 1997. Attentiondeficit hyperactivity disorder: A category of a continuum? Genetic
analysis of a large-scale twin study. J Am Acad Child Adolesc Psychiatry
36:737–744.
Shekim WO, Bylund DB, Alexson J, Glaser RD, Jones SB, Hodges K, Perdue
S. 1986. Platelet MAO and measures of attention and impulsivity in boys
with attention deficit disorder and hyperactivity. Psychiatry Res 18:
179–188.
Lowe N, Hawi Z, Fitzgerald M, Gill M. 2001. No evidence of linkage or
association between ADHD and DXS7 locus in Irish population. Am J
Med Genet 105:394–395.
Shih JC, Thompson RF. 1999. Monoamine oxidase in neuropsychiatry and
behavior. Am J Hum Genet 65:593–598.
Manor I, Tyano S, Mel E, Eisenberg J, Bachner-Melman R, Kotler M,
Ebstein RP. 2002. Family-based and association studies of monoamine
oxidase A and attention deficit hyperactivity disorder (ADHD): Preferential transmission of the long promoter-region repeat and its
association with impaired performance on a continuous performance
test (TOVA). Mol Psychiatry 7:626–632.
Spielman RS, McGinnis RE, Ewens WJ. 1993. Transmission test for linkage
disequilibrium: The insulin gene region and insulin-dependent diabetes
mellitus (IDDM). Am J Hum Genet 52:506–516.
Manuck SB, Flory JD, Ferrell RE, Mann JJ, Muldoon MF. 2000. A regulatory polymorphism of the monoamine oxidase-A gene may be associated with variability in aggression, impulsivity, and central nervous
system serotonergic responsivity. Psychiatry Res 95:9–23.
Payton A, Holmes J, Barrett JH, Hever T, Fitzpatrick H, Trumper AL,
Harrington R, McGuffin P, O’Donovan M, Owen M, Ollier W,
Worthington J, Thapar A. 2001. Examining for association between
candidate gene polymorphisms in the dopamine pathway and attention-
Solanto MV. 2002. Dopamine dysfunction in AD/HD: Integrating clinical
and basic neuroscience research. Behav Brain Res 130:65–71.
Spivak B, Vered Y, Yoran-Hegesh R, Averbuch E, Mester R, Graf E, Weizman
A. 1999. Circulatory levels of catecholamines, serotonin and lipids in
attention deficit hyperactivity disorder. Acta Psychiatr Scand 99:300–304.
Tannock R. 1998. Attention deficit hyperactivity disorder: Advances in
cognitive neurobiological and genetics research. J Child Psychol
Psychiatry 39:65–99.
Zametkin A, Rapoport JL, Murphy DL, Linnoila M, Ismond D. 1985.
Treatment of hyperactive children with monoamine oxidase inhibitors.
I. Clinical efficacy. Arch Gen Psychiatry 42:962–966.
Документ
Категория
Без категории
Просмотров
0
Размер файла
68 Кб
Теги
iris, allele, transmission, disorder, children, attention, affected, 941g, associations, hyperactivity, analysis, samples, genes, mao, deficit, adhd, oxidase, monoamines, preferential
1/--страниц
Пожаловаться на содержимое документа