close

Вход

Забыли?

вход по аккаунту

?

Association study between the genetic polymorphisms of glutathione-related enzymes and schizophrenia in a Japanese population.

код для вставкиСкачать
RESEARCH ARTICLE
Neuropsychiatric Genetics
Association Study Between the Genetic
Polymorphisms of Glutathione-Related Enzymes and
Schizophrenia in a Japanese Population
Daisuke Matsuzawa,1,2 Kenji Hashimoto,3* Tasuku Hashimoto,1 Eiji Shimizu,2 Hiroyuki Watanabe,1
Yuko Fujita,3 and Masaomi Iyo1
1
Department of Psychiatry, Chiba University Graduate School of Medicine, Chiba, Japan
Integrative Neurophysiology, Chiba University Graduate School of Medicine, Chiba, Japan
2
3
Division of Clinical Neuroscience, Chiba University Center for Forensic Mental Health, Chiba, Japan
Received 19 November 2007; Accepted 27 March 2008
Several lines of evidence suggest that oxidative stress plays a role
in the pathogenesis of schizophrenia, and that glutathione (GSH)
plays a crucial role in antioxidant defense mechanisms. In this
study, we performed association studies between GSH-related
genes (GSTM1, GSTP1, GSTO1, GSTT1, GSTT2, GPX1, and
GCLM) and schizophrenia in a Japanese population. The overall
distributions of the genotypes and alleles of each gene were not
different between schizophrenic patients and controls. Subjects
with residual-type schizophrenia showed different distributions
in the analysis of GSTM1 genotype and in the combination
analysis of GSTs, GPX1, and GCLM genotypes although the
small sample size should be considered as a limitation of this
study. In addition, our findings revealed that there were large
ethnic differences in the genotype distributions of those GSHrelated genes. The present study suggests that GSH-related genes
may not play a major role in the pathogenesis of schizophrenia in
a Japanese population. However, a dysregulation of GSH metabolism may be one of the vulnerability factors contributing to the
development of a certain type of schizophrenia, and it is likely
that the ethnic background should be considered in further study
for those GSH-related genes. 2008 Wiley-Liss, Inc.
Key words: schizophrenia; oxidative stress; glutathione; susceptibility; polymorphism
INTRODUCTION
Schizophrenia is a devastating psychiatric disease with a complex
genetic etiology. Several lines of evidence suggest that oxidative
stress plays a role in the pathogenesis of schizophrenia [Mahadik
and Mukherjee, 1996; Schulz et al., 2000; Yao et al., 2001; Carter,
2006]. Dopamine (DA) is a major source of reactive oxygen species
(ROS) in the central nervous system, as excess DA can easily autooxidize to produce DA-quinone [Baez et al., 1997; Smythies, 1997].
Glutathione (GSH), one of the major non-protein antioxidants and
redox regulators, detoxifies ROS and thus plays a major role in
protecting neural tissues [Dringen, 2000b; Schulz et al., 2000].
Interestingly, in a study by Do et al. [2000], GSH levels in the
2008 Wiley-Liss, Inc.
How to Cite this Article:
Matsuzawa D, Hashimoto K, Hashimoto T,
Shimizu E, Watanabe H, Fujita Y, Iyo M. 2009.
Association Study Between the Genetic
Polymorphisms of Glutathione-Related
Enzymes and Schizophrenia in a Japanese
Population.
Am J Med Genet Part B 150B:86–94.
cerebrospinal fluid of drug-free patients with schizophrenia were
significantly decreased as compared with those in control groups,
and non-invasive proton magnetic resonance spectroscopy revealed a significant reduction of GSH in the medial prefrontal
cortex of schizophrenic patients, suggesting that a deficit in GSH
and GSH-related enzymes might play a role in the pathophysiology
and might constitute a major risk factor of schizophrenia. Given the
role of GSH in the anti-oxidative process, the genes encoding the
proteins known as polymorphic glutathione S-transferases (GSTs:
Enzyme Commission (EC) number 2.5.1.18), glutathione
peroxidase-1 (GPX1: EC 1.11.1.9), and glutamate cysteine ligase
(GCL: EC 6.3.2.2) are clearly worthy of investigation [Hayes and
Strange, 2000; Forsberg et al., 2001; Yoshimura et al., 2003; Tosic
et al., 2006].
The GSTs are a family of multifunctional enzymes that catalyze
the conjugation of reduced GSH with electrophilic groups of a wide
Grant sponsor: Minister of Education, Culture, Sports, Science, and
Technology of Japan.
*Correspondence to:
Dr. Kenji Hashimoto, Ph.D., Division of Clinical Neuroscience, Chiba
University Center for Forensic Mental Health, 1-8-1 Inohana, Chiba 2608670, Japan. E-mail: hashimoto@faculty.chiba-u.jp
Published online 30 April 2008 in Wiley InterScience
(www.interscience.wiley.com)
DOI 10.1002/ajmg.b.30776
86
MATSUZAWA ET AL.
variety of compounds, including carcinogens, environmental contamination, and products of oxidative stress [Mannervik, 1985;
Hayes and Strange, 2000]. Genes of human cytosol GST consist of at
least eight distinct gene families (alpha, mu, theta, pi, zeta, sigma,
kappa, omega) and, among them, several classes of GST genes have
been shown to be polymorphic: GSTM (mu) 1 and M3 on chromosome 1p13.3, GSTT (theta) 1 and T2 on 22q11.2, GSTO (omega)
1 on 10q24.3, and GSTP (pi) 1 on 11q13 [Strange et al., 2001;
Whitbread et al., 2005]. Homozygous deletion of GSTM1 (null type
of GSTM1: GSTM1*0) and GSTT1 (null type of GSTT1: GSTT1*0)
results in the absence of the respective enzyme activities. Polymorphism of GSTM3 appears as a 3 bp deletion in intron 6 (GSTM3*A
as a wild-type and GSTM3*B with the deletion). Polymorphisms
with an amino acid substitution are found in GSTO1 (Ala140Asp
and Thr217Asn), GSTP1 (Ile105val), and GSTT2 (Met139Ile), and
those of GSTO1 and GSTP1 have been shown to decrease the
activity of the enzyme [Watson et al., 1998; Tanaka-Kagawa et al.,
2003]. Increased incidence of the null-type GSTM1 gene
(GSTM1*0) in schizophrenia patients has been reported in a
Japanese and a Korean population [Harada et al., 2001; Pae
et al., 2004].
Glutathione peroxidase 1 (GPX1), which belongs to a family of
selenium-dependent peroxidases, protects cells by eliminating
hydrogen peroxides and a wide range of organic peroxides by using
GSH as a reducing substrate [Schweizer et al., 2004]. Lower levels of
glutathione peroxidase have been reported in schizophrenic patients and schizophrenic patients with tardive dyskinesia [Ranjekar
et al., 2003; Yao et al., 2006; Zhang et al., 2007]. One functional
polymorphism of the GPX1 gene is a substitution at codon 198
(Pro198Leu), and the leucine allele is less responsive to added
selenium than it is with the proline allele [Hu et al., 2005].
Human glutamate cysteine ligase (GCL) is a rate-limiting enzyme for GSH synthesis that plays a crucial role in antioxidant
defense mechanisms in most mammalian cells [Meister and Anderson, 1983], and GCL modifier (GCLM) is one of two subunits
composing GCL [Huang et al., 1993]. Nakamura et al. [2002] found
a functional polymorphism (ss60197536: 588C/T) in the 50 flanking region of the GCLM gene, and the minor 588T allele
of the polymorphism suppressed oxidant-induced up-regulation of
GCLM gene expression and was associated with lower plasma GSH
levels [Nakamura et al., 2002]. Furthermore, it has been demonstrated that a polymorphism (A/G: rs2301022) in intron 1 of the
GCLM gene was associated with schizophrenia in a Danish
population [Tosic et al., 2006].
Considering the role of GSH and its metabolism in oxidative
stress, we considered that it would be of great interest to study
the association between GST-related genes and schizophrenia.
Interestingly, these GSH-related genes are located in the genomic
region conferring associated with susceptibility to schizophrenia:
the genes of GSTM1 and M3 are on chromosome 1p13.3, GSTP1 is
on 11q13, GSTT1 and T2 are on 22q11.2, GPX1 is on 3p21.3 and
GCLM is on 1p21 [Mulcrone et al., 1995; Shaw et al., 1998; Lewis
et al., 2003; Arinami et al., 2005]. The aim of the present study was,
therefore, to evaluate the influence of the genetic variance of the
GSH-related genes (GSTM1, GSTP1, GSTO1, GSTT1, GSTT2,
GPX1, and GCLM) as a risk factor for schizophrenia in a Japanese
population.
87
MATERIALS AND METHODS
Subjects
The research was performed after the study was approved by the
Ethics Committee of Chiba University Graduate School of Medicine. Genomic DNA was extracted from blood samples after
obtaining written informed consent. The subjects were 220 healthy
controls (102 males and 118 females; mean age, 32.9 16.7 years)
with no past history of psychotic disorders or drug dependence and
214 schizophrenic patients (106 males and 108 females; mean age,
51.8 14.8). The average age of onset for the 214 patients was
24.9 years (SD 8.3). Gender and geographical origin of both
groups were matched, but due to the substantial numbers of
chronic inpatients with the long mean duration of illness
(26.7 14.7 years), the mean age between controls and patient
groups were statistically different (unpaired t-test, P < 0.01). Each
patient met the DSM-IV criteria for schizophrenia [American
Psychiatric Association, 1994] and had no other psychiatric disorders. In order to compare the distributions of gene polymorphisms amongst schizophrenia subtypes, the patient group was
subdivided according to DSM-IV criteria into a disorganized-type
(n ¼ 19, 9 females; mean age, 49.1 15.3 years old; onset, 19.8 5.8 years old), catatonic-type (n ¼ 19, 10 females; mean age,
53.3 16.0 years old; onset, 25.3 5.6 years old), paranoid-type
(n ¼ 75, 42 females; mean age, 48.8 14.9 years old; onset,
25.7 8.5 years old), residual-type (n ¼ 83, 40 females; mean age,
55.3 13.1 years old; onset, 24.1 7.9 years old), and undifferentiated-type (n ¼ 18, 7 females; mean age, 43.9 18.3 years old;
onset, 27.1 9.2 years old) group of patients.
Genotyping
GSTM1 and GSTT1. Genotyping was performed by PCR
coamplified with the b-globin gene as a positive control. PCR
conditions were the same as reported previously [Sreelekha
et al., 2001]. The primers used for GSTM1, GSTT1, and b-globin
are shown in Table I, and the amplified PCR product sizes were 220,
450, and 268 bp, respectively. Negative controls (containing the
PCR mixture without DNA template) were also used to test for
contamination. Following the genotyping, subjects were categorized as having either the positive (those with þ/þ and þ/null
genotypes) or null genotype (those with null/null genotype).
GSTM3, GSTO1, GSTP1, GPX1. Genotyping was performed
by PCR-restriction fragment length polymorphism (RFLP) analysis, and the PCR conditions of GSTO1, GSTP1, and GPX1 were the
same as in previous reports [Li et al., 2003; Hashimoto et al., 2005;
Matsuzawa et al., 2005]. The primers for each gene are shown in
Table II. The PCR product of GSTM3 was 400 bp in length.
Digestion was performed with the restriction enzyme EarI (New
England Biolabs, Inc., Beverly, MA), and the bands indicate the
presence of 220, 93, and 87 bp fragments (GSTM3*A/*A; although,
the 93 and 87 bp fragments are usually seen as a single band), 307,
220, 93, and 87 bp fragments (*A/*B), and 307 and 93 bp fragments
(*B/*B). The PCR product of GSTO1 Ala140Asp was 455 bp in
length. Digestion was performed with Cac8I (New England Biolabs,
Inc.), and the bands are visible with 243, 145, and 67 bp fragments
(C/C, although, the 67 bp fragment is usually not visible on the gels),
388, 243, 145, and 67 bp fragments (C/A) and 388 and 67 bp
88
AMERICAN JOURNAL OF MEDICAL GENETICS PART B
TABLE I. PCR Primers for GSTs, GPX1, and GCLM Genes
Primer sequences
Gene
GSTP1
GSTM1
GSTM3
GSTT1
GSTO1 (Ala140Asp)
GSTO1 (Thr217Asn)
GPX1
b-globin
Forward (50 –30 )
GTAGTTTGCCCAAGGTCAAG
CGCCATCTTGTGCTACATTGCCCG
TGCCCTGATTAACTACAAAGATGA
TCCAGGAGGCCCATGAGGTCA
TGTGCCCCTACGGTA
GGAGACTCTGTGATGTCATCC
TGTGCCCCTACGGTA
CAACTTCATCCACGTTCACC
Reverse (50 –30 )
AGCCACCTGAGGGGTAAG
TTCTGGATTGTAGCAGATCA
GGGAGCCTGTGAGTGTTTTTAT
TTCTGCTTTATGGTGGGGTCT
AAGTGACTTGGAAAGTGGGAA
CATAGCTTTATTGCTGACTCCTG
CCAAATGACAATGACACAGG
GAAGAGCCAAGGACAGGTAC
Primer or probe sequences
Reverse primer (50 –30 ) or probe2 (50 –30 )
Gene
Forward primer (50 –30 ) or probe1 (50 –30 )
TaqMan 50 -exonclease allelic discrimination assay was used for genotyping GSTT2 and GCLM genes
GSTT2
GAGAAGGTGGAACGCAACAG
TTGTCCTCCAGCCATTGCA
Probe1: VIC-CTGCCATGGACCAGG-MGB
Probe2: FAM-CTGCCATAGACCAGG-MGB
GCLM 588
ACAGCGCGAGGCAGACA
TGCTTCTGAGAACGAAAACTACGT
Probe1: VIC-TCTCCCGGCGTTCA-MGB
Probe2: FAM-TCTCCCACGTTCA- MGB
rs2301022
CAGAGTCACACACCACAGTTTGTA
GTTTTATCCTACTGTTATGAAGCACCCTAA
Probe1: VIC-CAAAGGACTAATTCTGG-MGB
Probe2: FAM-CAAAGGACTAGTTCTGG-MGB
fragments (A/A). The PCR product of GSTO1 Thr217Asn was 248
bp in length. Because the distribution of this polymorphism had not
yet been reported, we preliminarily surveyed the minor allele
frequencies in 32 control samples by direct sequencing. The sequencing reaction was performed on an ABI 310 genetic analyzer
(PE Biosystems, Foster City, CA) following the manufacturer’s
protocol. Because none of the samples had the minor allele, we did
not perform further genotyping. The PCR product of GSTP1 gene
was 433 bp in length. Digestion was performed with BsmA1 (New
England Biolabs, Inc.), and the bands are visible with 328 and 105 bp
(A/A), 328, 222, 106, and 105 bp (A/G), and 222, 106, and 105 bp
(G/G). PCR product of GPX1 is 337 bp. Digestion was performed
with ApaI (New England Biolabs, Inc.), and the bands are visible
with 337 bp fragment (C/C), 337, 258, and 79 bp fragments (C/T,
although, the 79 bp fragment is typically not visible) and 258 and
79 bp fragment (T/T). All of the DNA fragments were separated on a
2% agarose gel stained with ethidium bromide.
GSTT2 and GCLM. Genotyping was performed by TaqMan 50 exonuclease allelic discrimination assay in accord with the
manufacturer’s protocol (Applied Biosystems, Foster city, CA).
The primers and probes used for these genes are shown in Table I.
Statistical Analyses
The differences between groups were evaluated by Fisher’s exact
test. Hardy–Weinberg equilibrium was tested using the Chi-square
goodness-of-fit test. The odds ratio and 95% confidence intervals
(CIs) between two variables were calculated as an estimate of risk.
Multiple regression analysis was performed to evaluate the relation
between the schizophrenic patients’ age of onset and the genetic
polymorphisms. For the regression analysis, age of onset was used as
the dependent variable, and the genotypes were used as the inde-
pendent variables. The analysis was performed with SPSS software
(SPSS version 12.0J, Tokyo, Japan). Values of P < 0.05 were considered to indicate statistical significance in all analyses.
RESULTS
The frequencies of alleles and genotypes in schizophrenic patients
and controls are shown in Table II. All of the genotype distributions
in both schizophrenic patients and controls were in
Hardy–Weinberg equilibrium (c2, P > 0.05, df ¼ 1). As shown in
Table II, the overall distributions of genotypes and alleles of each
gene were not significantly different between schizophrenic patients
and controls. In the multiple regression analysis, none of the
genotypes showed significant association with age of onset of
schizophrenia. No gender difference was found in the distributions
of any of the genes. The data for GSTM3 are not shown because the
GSTM3*A/*B type was seen in only one sample and none of the
samples had the GSTM3*B/*B type, and thus further analysis was
not executed for GSTM3.
In the analysis of the gene distributions among schizophrenia
subtypes, our study revealed that the null type of the GSTM1 gene
was significantly more frequent among patients with residual-type
schizophrenia than among control subjects (P ¼ 0.037, odds
ratio ¼ 1.790, 95% CI ¼ 1.003–1.986; Table III). For the other
genes, however, no significant difference was found between any
of the schizophrenia subtypes and the controls (data not shown).
From the perspective of the functional deficits resulting from a
gene polymorphism, those subjects with any of the high-risk
genotypes GSTM1*0, GSTT1*0, or GSTP1 (Ile/Val and Val/Val
type) are considered to have lesser overall GST activity. Similarly,
those with GPX1 (Leu/Pro and Pro/Pro) or GCLM 588 (C/T and
T/T) are considered to have lower amounts of the corresponding
MATSUZAWA ET AL.
89
TABLE II. Genotype and Allele Distributions of Controls and Schizophrenia Patients
n
Positive
Null
GSTM1
Ct
Pt
220
214
101
85
P ¼ 0.208
45.9%
39.7%
119
129
54.1%
60.3%
GSTT1
Ct
Pt
220
214
140
127
P ¼ 0.375
63.6%
59.1%
80
88
36.4%
40.9%
Genotype
GSTT2 (Met139Ile)
Ct
Pt
n
220
214
GG
157
155
GA
55
25.9%
50
24.4%
P ¼ 0.884
71.4%
72.4%
Allele
AA
8
9
3.6%
4.2%
G
369
360
Genotype
GSTO1 (Ala140Asp)
Ct
Pt
n
220
214
CC
175
165
CA
41
19.0%
45
21.4%
P ¼ 0.875
79.5%
77.1%
n
220
214
AA
162
154
AG
54
25.0%
55
26.3%
P ¼ 0.891
73.6%
72.0%
AA
4
4
1.8%
1.9%
C
391
375
n
220
214
CC
189
180
CT
29
13.3%
31
14.7%
P ¼ 0.798
85.9%
84.1%
GG
4
5
1.8%
2.3%
A
378
363
n
220
214
CC
148
153
67.3%
71.5%
TT
2
3
0.9%
1.4%
C
407
391
n
220
214
GG
131
126
59.5%
58.9%
CT
63
29.9%
52
25.4%
P ¼ 0.579
GA
73
35.8%
76
37.6%
P ¼ 0.729
G
85.9%
62
84.8%
65
P ¼ 0.701
14.1%
15.2%
T
92.5%
33
91.4%
37
P ¼ 0.618
7.5%
8.6%
Allele
TT
9
9
4.1%
4.2%
C
359
358
Genotype
GCLM rs2301022
Ct
Pt
11.1%
12.4%
Allele
Genotype
GCLM 588 ss60197536
Ct
Pt
A
83.9%
49
87.6%
53
P ¼ 0.599
Allele
Genotype
GPX1 (Pro198Leu)
Ct
Pt
16.1%
15.9%
Allele
Genotype
GSTP1 (Ile105Val)
Ct
Pt
A
83.9%
71
84.1%
68
P ¼ 0.924
T
81.6%
81
83.6%
70
P ¼ 0.474
18.4%
16.4%
Allele
AA
16
12
7.3%
5.6%
G
335
328
A
76.1%
105
76.6%
100
P ¼ 0.873
23.9%
23.4%
90
AMERICAN JOURNAL OF MEDICAL GENETICS PART B
TABLE III. Distribution of GSTM1 Genotype in Schizophrenia Patients Divided by Subtypes and Controls
Subjects
Controls
Disorganized type
Catatonic type
Paranoid type
Residual type
Undifferentiated type
n
220
19
19
75
83
18
Positive
101
6
9
35
27
9
45.9%
31.6%
47.4%
46.7%
32.5%
50.0%
Null
119
13
10
40
56
9
54.1%
68.4%
52.6%
53.3%
67.4%
50.0%
P-value
Odds ratio (95% CI)
0.336
1.00
1.00
0.037
0.808
1.839 (0.674–5.014)
0.943 (0.369–2.411)
0.970 (0.574–1.640)
1.760 (1.003–1.986)
0.849 (0.325–2.219)
P values are shown versus controls. CI; confidence interval.
The bold type is used because the residual type showed significant difference (P < 0.05).
enzyme activities than those with the high-risk genotypes. Therefore, we stratified patients and controls according to the number of
these high-risk genotypes for the combination analysis of the GSTs,
and GPX1 and GCLM. As shown in Table IV, the frequency of highrisk genotypes was significantly increased among residual-type
schizophrenics compared to controls (P ¼ 0.005). The calculated
odds ratio of residual-type schizophrenia patients with any risk
genotypes of those gene reached 5.91 (95% CI ¼ 1.375–25.38) with
those who had no risk genotypes as a reference.
DISCUSSION
In the present study, we examined the association between the
polymorphisms of GSTM1, GSTP1, GSTO1, GSTT1, GSTT2,
GPX1, and GCLM and schizophrenia in a Japanese population.
To the best of our knowledge, this is the first study to investigate
these six gene polymorphisms simultaneously in the same subjects.
There have been several reports which analyzed the allele frequencies of GSTM1, GSTT2, GSTP1, and GPX1 in Japanese samples. The
minor allele frequencies of our control samples were in good accord
with previous reports [Harada et al., 2001; Nakazato et al., 2003;
Yoshimura et al., 2003; Ichimura et al., 2004; Hashimoto et al.,
2005]. Case–control association studies between GSTM1 [Harada
et al., 2001; Pae et al., 2004], GSTP1 [Pae et al., 2003; Shinkai et al.,
2005], GPX1 [Shinkai et al., 2004], and GCLM [Tosic et al., 2006]
and schizophrenia have been reported.
Our study did not show that the distribution of GSTM1 genotype
was significantly different between normal controls and schizo-
phrenic patients as a whole (Table II). However, the null type of the
GSTM1 gene was significantly more frequent in residual-type
schizophrenia patients than control subjects (P ¼ 0.037, odds
ratio ¼ 1.790, 95% CI ¼ 1.003–1.986; Table III). Harada et al.
[2001] reported that the null type of GSTM1 was more frequent
among schizophrenic patients as a whole and also among those with
disorganized-type schizophrenia than in normal controls. The
reason for this discrepancy might be the small sample size of their
study (87 schizophrenics and 176 controls). Considering the small
sample size of both studies, a lager sample size for each subtype of
schizophrenia should be needed to obtain the sufficient statistic
power to exclude type I error. In addition, the results we found in
the residual-type schizophrenics would be rendered as insignificant
with applying post hoc analysis for multiple testing. However, it
should be noted that both our study and that of Harada et al. [2001]
indicated that the distribution of the null-type GSTM1 gene was
significantly more frequent in the subtypes of schizophrenia that are
dominantly characterized by negative and cognitive symptoms
according to DSM-IV criteria. Moreover, Pae et al. [2004] reported
a positive association between the GSTM1 null type and schizophrenia in a Korean population (P ¼ 0.014, odds ratio ¼ 1.93, 95%
CI ¼ 1.115–3.351) but provided no information as to subtypes.
Several lines of evidence suggest that the heterogenerous pathophysiological basis underlies the schizophrenic individuals with
different clinical features [Kirkpatrick et al., 2001], and especially
those who with persistent negative symptoms should be
distinguished [Buchanan, 2007]. Further study with a large sample
size would verify the difference in the effect of polymorphisms of
TABLE IV. Combination Analysis of GSTs, GPX1, and GCLM-588 Genotypes
Number of high-risk genotypesa
Subjects (n)
Controls (220)
Schizophrenia (214)
Disorganized type (20)
Catatonic type (19)
Paranoid type (75)
Residual type (83)
Undifferentiated type (17)
a
0
28 (12.7%)
22 (10.3%)
2 (10.0%)
0 (0%)
13 (17.3%)
2 (2.4%)
0 (0%)
1
110 (50.0%)
119 (55.6%)
8 (40.0%)
13 (68.4%)
35 (46.7%)
55 (66.3%)
9 (52.9%)
2
78 (35.5%)
66 (30.8%)
8 (40.0%)
6 (31.6%)
25 (33.3%)
23 (27.7%)
8 (47.1%)
3
4 (1.8%)
7 (3.3%)
2 (10.0%)
0 (0%)
2 (2.7%)
3 (3.6%)
0 (0%)
Those with any high-risk genotype of GSTs (GSTM1*0, GSTT1*0, GSTP1 (Ile/Val or Val/Val type)), GPX1 (Leu/Pro or Pro/Pro type), or GCLM-588 (C/T or T/T type).
The bold type is used because the residual type showed significant difference (P < 0.05).
P-value
0.428
0.188
0.293
0.438
0.005
0.441
MATSUZAWA ET AL.
GSTM1 among schizophrenia subtypes. Taken together, these
results suggest that the deletion of GSTM1 is likely to play a role
in the pathogenesis of a subtype of schizophrenia in Asian
populations, including Japanese and Korean populations.
Our samples did not show any significant difference between
GSTP1 polymorphism (Ile105Val) and schizophrenia, consistent
with a previous report demonstrating a negative association between GSTP1 Ile105Val and schizophrenia in a Korean population
[Pae et al., 2003]. From the viewpoint of the role of oxidative stress
in the development of tardive dyskinesia, Shinkai et al. [2005]
reported no association between GSTP1 Ile105Val polymorphism
and chronic treatment-refractory schizophrenia with and without
tardive dyskinesia. Taken together, these findings suggest that
GSTP1 Ile105Val polymorphism is unlikely to contribute to the
genetic susceptibility in the pathogenesis of schizophrenia in Japanese and Korean populations.
The GSTT1 null type was more frequent in the schizophrenic
patients (40.9%) than in the controls (36.4%), but the difference
did not reach the level of statistical significance (P ¼ 0.375). In
addition, patients with residual-type schizophrenia showed a greater tendency toward increased frequency of the GSTT1 null type
(47.0%, P ¼ 0.113, data not shown) compared to the controls. Very
recently, Saadat et al. [2007] reported that the GSTT1 null type
(GSTT1*0) was less frequent in schizophrenic patients (17.8%,
odds ratio ¼ 0.42, 95% CI ¼ 0.28–0.63, P < 0.001) than in controls
(33.9%), suggesting that it was associated with a reduced risk of
developing schizophrenia in the Iranian population. The reason
underlying this discrepancy is unknown, since the frequencies
(Japanese ¼ 36.4%, Iranian ¼ 33.9%) of this polymorphism in the
Japanese and Iranian populations were almost the same. Factors
other than ethnicity may have contributed to this discrepancy. As is
other polymorphisms of GSTs, the genetic risk of the GSTT1 null
type has been investigated from the perspective of the association
with a number of cancers, and the effect of the GSTT1 null type as a
genetic risk for cancer has varied among studies [Raimondi et al.,
2006].
The present study is the first to investigate the association of the
polymorphisms of GSTO1 Ala140Asp and GSTT2 Met139Ile with
schizophrenia. Several studies have reported a positive association
between GSTO1 Ala140Asp and neurological diseases such as
Alzheimer’s disease and Parkinson’s disease [Li et al., 2003; Kolsch
et al., 2004], but our study showed no association between this
polymorphism and schizophrenia. It has been reported that the
polymorphism encoding the GSTO1 Thr217Asn substitution had a
considerable effect on the GSTO1 activity [Tanaka-Kagawa et al.,
2003]. We therefore investigated the frequency of this polymorphism in the present study, but no substitution was detected in our
samples. This implies that the substitution, if present at all, must be
extremely rare in the Japanese population, which is concordant
with previous studies [Marnell et al., 2003; Whitbread et al., 2003].
As to GSTT2, no association with schizophrenia was shown.
Whether the GSTT2 Met139Ile polymorphism affects the function
of the protein remains unknown, but our study suggests that this
SNP might not contribute to the risk of schizophrenia in the
Japanese population. Therefore, GSTO1 and GSTT2 are unlikely
to be associated with susceptibility to schizophrenia in the Japanese
population.
91
In our study, neither the genotype nor the allele distributions of
the GPX1 Pro198Leu polymorphism were significantly different
between schizophrenia patients and normal controls (Table II).
This finding was consistent with a previous association study on the
same polymorphism performed with 113 nuclear families that had a
proband with schizophrenia, and which found no association
between the SNP and patients [Shinkai et al., 2004]. Although
these two studies did not provide any evidence of an association
between the GPX1 gene and schizophrenia, several studies have
reported that the glutathione peroxidase activity was altered in
schizophrenic patients. Postmortem brain sample studies revealed
that the glutathione peroxidase level was significantly lower in the
caudate region of schizophrenic brains than in the caudate region of
control brains [Yao et al., 2006], and the levels of erythrocytes’
plasma membrane glutathione peroxidase as well as other antioxidant enzymes (superoxide dismutase and catalase) were significantly lower in schizophrenic patients than in controls [Ranjekar
et al., 2003]. Furthermore, in a study by Zhang et al. [2007],
schizophrenic patients with tardive dyskinesia showed lower plasma glutathione peroxidase levels but higher malondialdehide levels,
and malondialdehide levels were positively correlated with the
severity of symptoms, suggesting that oxidative stress is involved
in the pathophysiology of schizophrenia with tardive dyskinesia. In
addition, Buckman et al. [1987] reported a strong negative correlation between the glutathione peroxidase activity of platelets and
erythrocytes and morphological changes in the brains of schizophrenic patients as measured by CT scan. Taking these results into
consideration, there might be other genetic grounds besides
Pro198Leu polymorphism causing the altered GPX1 activity in
schizophrenia.
Recently, Tosic et al. [2006] reported the intriguing result that
the expression level of the GCLM gene was lower in the fibroblasts of
schizophrenic patients than in those of controls, and that a significant relation was observed between either of two SNPs (ss60197536
(588) and rs2301122) in the GCLM gene and schizophrenia in
Swiss and Danish populations. In regard to the Japanese population, our study suggests that neither GCLM polymorphism
(ss60197536 and rs2301122) is associated with susceptibility to the
pathogenesis of schizophrenia. Although the reasons underlying
this discrepancy are currently unclear, one possibility is that there is
an ethnic difference in the two SNPs of the GCLM gene that
engendered different results in the two studies (Japanese vs. Swiss
and Danish; see below and Table V). In contrast, it has been
reported that GCLM knockout mice show an increased sensitivity
to oxidative stress and a decreased level of GSH [Yang et al., 2002]. It
is thus likely that GCLM may be involved in the pathophysiology of
schizophrenia, since GCLM may play a role in the decreased GSH
levels in CSF and in the medial prefrontal cortex of schizophrenia
[Do et al., 2000].
Although the individual effects of the GSTT1, GSTP1, GPX1, and
GCLM genes did not alter the risk for schizophrenia, the combination analysis revealed that the residual type of schizophrenia has
significantly more risk genotypes of GSTs, GPX1, or GCLM
(Table IV). The odds ratio of residual-type schizophrenia with any
risk genotypes of those gene showed 5.91 (95% CI ¼ 1.375–25.38)
with those who had no risk genotypes as a reference. Accumulating
evidence shows that the proteins including GSTs, GPX1, and
Caucasians
African-Americansc
P*
b
51.8%, 48.2% (n ¼ 220)
74.4%, 25.6% (n ¼ 79)
x 2 ¼ 19.5, df ¼ 2; P < 0.0001
47.7%, 40.9%, 11.4%b (n ¼ 220) 31.6%, 50.6%, 17.7% (n ¼ 79) x 2 ¼ 59.6, df ¼ 4; P < 0.0001
80.5%, 19.5% (n ¼ 79)
x2 ¼ 9.23, df ¼ 2; P ¼ 0.011
73.6%, 23.4%b (n ¼ 220)
d
x 2 ¼ 31.2, df ¼ 2; P < 0.0001
73.1%, 23.7%, 3.1% (n ¼ 350)
b
x 2 ¼ 61.8, df ¼ 2; P < 0.0001
43.6%, 45.9%, 10.5% (n ¼ 220)
e
x 2 ¼ 63.6, df ¼ 2; P < 0.0001
54.4%, 36.1%, 9.5% (n ¼ 377)
f
x2 ¼ 1.37, df ¼ 2; P ¼ 0.485
70.7%, 26.7%, 2.6% (n ¼ 348)
f
x2 ¼ 12.2, df ¼ 2; P ¼ 0.002
45.1%, 42.0%, 12.9% (n ¼ 348)
GCLM in the GSH metabolism play substantial role in maintaining
the antioxidant properties of GSH, and thus the cells with alternated those protein function might be more susceptible to oxygen
free radicals when exposed [Dringen, 2000a; Klivenyi et al., 2000;
Smeyne et al., 2007]. The small sample size for each subtype of
schizophrenia patient was a limitation of our study.
Pae et al. [2003, 2004] referred to ethnic differences of the
distributions of GSTM1 and GSTP1 polymorphisms. Table V
summarizes the ethnic differences in the distributions in GSTM1,
GSTP1, GSTT1, GSTM3, GSTO1, GPX1, and GCLM [Risch et al.,
2001; Gilliland et al., 2002; Ravn-Haren et al., 2006; Tosic et al.,
2006; Wahner et al., 2007]. As can be seen, there were significant
ethnic differences in each genetic distribution. Further genetic
association studies of these GSH-related genes using other ethnic
population (e.g., Caucasians, African-Americans) would be interest to study the role of oxidative stress in the pathogenesis of
schizophrenia.
Some limitations in the present study should be considered.
First, sample size is small. Larger sample size for each subtypes of
schizophrenia should be needed to obtain the sufficient statistic
power to exclude type I error. In addition, the results we found in
the residual-type schizophrenics would be rendered as insignificant
with applying post hoc analysis for multiple testing. However, the
heterogenerous pathophysiological basis could underlie the schizophrenic individuals with different clinical features [Kirkpatrick
et al., 2001], and especially those with persistent negative symptoms
should be distinguished [Buchanan, 2007]. Further study with
larger sample size would verify the difference in the effect of
polymorphisms of GSH-related genes among schizophrenia subtypes. Second, due to the substantial numbers of chronic inpatients
with the long duration of illness (mean 26.7 14.7 years) of
schizophrenia subjects, the mean age between controls and patient
groups were statistically different (unpaired t-test, P < 0.01). Although, most of the young control subjects were medical students
and they are confirmed not to develop schizophrenia so far, this
factor might decrease the power of our study.
Japanesea
45.9%, 54.1% (n ¼ 220)
73.6%, 25.0%, 1.8% (n ¼ 220)
63.6%, 36.4% (n ¼ 220)
99.0%, 1.0%, 0.0% (n ¼ 220)
79.5%, 19.0%, 1.8% (n ¼ 220)
85.9%, 13.3%, 0.9% (n ¼ 220)
67.3%, 29.9%, 4.1% (n ¼ 220)
59.5%, 35.8%, 7.3% (n ¼ 220)
CONCLUSION
*Chi-square test.
a
Our data.
b
Wahner et al. [2007].
c
Gilliland et al. [2002].
d
Risch et al. [2001].
e
Ravn-Haren et al. [2006].
f
Tosic et al. [2006].
The bold type means significant difference (P < 0.05).
Gene
GSTM1: positive, null type
GSTP1: Ile105/Val Ile/Ile, Ile/Val, Val/Val
GSTT1: positive, null type
GSTM3 A/B: A/A, A/B, B/B
GSTO1 Ala140Asp: Ala/Ala, Ala/Asp, Asp/Asp
GPX1 Pro198Leu: Pro/Pro, Pro/Leu, Leu/Leu
GCLM ss60197536: C/C, C/T, T/T
GCLM rs2301022: G/G, G/A, A/A
Ethnicity
AMERICAN JOURNAL OF MEDICAL GENETICS PART B
TABLE V. Summarized Ethnic Differences of Distributions in GSTM1, GSTP1, GSTT1, GSTM3, GSTO1, GPX1, and GCLM
92
In conclusion, the present study suggests that the GSTM1 null type
might increase the risk for the residual-type of schizophrenia, and
that other GSH-related genes, including GSTM1, GSTT1, GSTP1,
GPX1, and GCLM, might have no major genetic effects on the
pathogenesis of schizophrenia in the Japanese population. The
present results do not, however, exclude the possibility that oxidative stress plays a role in the pathophysiology of schizophrenia. In
addition, the present findings suggest that the ethnic difference
might underlie in the antioxidant system in which those GSHrelated enzymes involved.
ACKNOWLEDGMENTS
This study was supported in part by grants from the Minister of
Education, Culture, Sports, Science, and Technology of Japan (to
K.H.). The authors thank Ms. Tamaki Ishima and Ms. Mami
Kohno, and Ms. Hiroko Hagiwara, for collecting and extracting
DNA samples from the subjects.
MATSUZAWA ET AL.
REFERENCES
American Psychiatric Association. 1994. Diagnostic and Statistical Manual
of Mental Disorders, 4th edition (DSM-IV). Washington, DC: American
Psychiatric Association.
Arinami T, Ohtsuki T, Ishiguro H, Ujike H, Tanaka Y, Morita Y, Mineta M,
Takeichi M, Yamada S, Imamura A, Ohara K, Shibuya H, Ohara K, Suzuki
Y, Muratake T, Kaneko N, Someya T, Inada T, Yoshikawa T, Toyota T,
Yamada K, Kojima T, Takahashi S, Osamu O, Shinkai T, Nakamura M,
Fukuzako H, Hashiguchi T, Niwa SI, Ueno T, Tachikawa H, Hori T,
Asada T, Nanko S, Kunugi H, Hashimoto R, Ozaki N, Iwata N, Harano M,
Arai H, Ohnuma T, Kusumi I, Koyama T, Yoneda H, Fukumaki Y,
Shibata H, Kaneko S, Higuchi H, Yasui-Furukori N, Numachi Y, Itokawa
M, Okazaki Y, Japanese Schizophrenia Sib-Pair Linkage Group. 2005.
Genomewide high-density SNP linkage analysis of 236 Japanese families
supports the existence of schizophrenia susceptibility loci on chromosomes 1p, 14q, and 20p. Am J Hum Genet 77:937–944.
Baez S, Segura-Aguilar J, Widersten M, Johansson AS, Mannervik B. 1997.
Glutathione transferases catalyse the detoxication of oxidized metabolites (o-quinones) of catecholamines and may serve as an antioxidant
system preventing degenerative cellular processes. Biochem J 324(Pt1):
25–28.
Buchanan RW. 2007. Persistent negative symptoms in schizophrenia: An
overview. Schizophr Bull 33:1013–1022.
Buckman TD, Kling AS, Eiduson S, Sutphin MS, Steinberg A. 1987.
Glutathione peroxidase and CT scan abnormalities in schizophrenia.
Biol Psychiatry 22:1349–1356.
Carter CJ. 2006. Schizophrenia susceptibility genes converge on interlinked
pathways related to glutamatergic transmission and long-term potentiation, oxidative stress and oligodendrocyte viability. Schizophr Res 86:
1–14.
Do KQ, Trabesinger AH, Kirsten-Kruger M, Lauer CJ, Dydak U, Hell D,
Holsboer F, Boesiger P, Cuenod M. 2000. Schizophrenia: Glutathione
deficit in cerebrospinal fluid and prefrontal cortex in vivo. Eur J Neurosci
12:3721–3728.
Dringen R. 2000a. Glutathione metabolism and oxidative stress in neurodegeneration. Eur J Biochem 267:4903.
Dringen R. 2000b. Metabolism and functions of glutathione in brain. Prog
Neurobiol 62:649–671.
Forsberg L, de Faire U, Morgenstern R. 2001. Oxidative stress, human
genetic variation, and disease. Arch Biochem Biophys 389:84–93.
Gilliland FD, Gauderman WJ, Vora H, Rappaport E, Dubeau L. 2002.
Effects of glutathione-S-transferase M1, T1, and P1 on childhood lung
function growth. Am J Respir Crit Care Med 166:710–716.
Harada S, Tachikawa H, Kawanishi Y. 2001. Glutathione S-transferase M1
gene deletion may be associated with susceptibility to certain forms of
schizophrenia. Biochem Biophys Res Commun 281:267–271.
Hashimoto T, Hashimoto K, Matsuzawa D, Shimizu E, Sekine Y, Inada T,
Ozaki N, Iwata N, Harano M, Komiyama T, Yamada M, Sora I, Ujike H,
Iyo M. 2005. A functional glutathione S-transferase P1 gene polymorphism is associated with methamphetamine-induced psychosis in Japanese population. Am J Med Genet Part B 135B:5–9.
Hayes JD, Strange RC. 2000. Glutathione S-transferase polymorphisms and
their biological consequences. Pharmacology 61:154–166.
Hu Y, Benya RV, Carroll RE, Diamond AM. 2005. Allelic loss of the gene for
the GPX1 selenium-containing protein is a common event in cancer. J
Nutr 135:3021S–3024S.
Huang CS, Chang LS, Anderson ME, Meister A. 1993. Catalytic and
regulatory properties of the heavy subunit of rat kidney gamma-glutamylcysteine synthetase. J Biol Chem 268:19675–19680.
93
Ichimura Y, Habuchi T, Tsuchiya N, Wang L, Oyama C, Sato K, Nishiyama
H, Ogawa O, Kato T. 2004. Increased risk of bladder cancer associated
with a glutathione peroxidase 1 codon 198 variant. J Urol 172:728–732.
Kirkpatrick B, Buchanan RW, Ross DE, Carpenter WT. 2001. A separate
disease within the syndrome of schizophrenia. Arch Gen Psychiatry
58:165–171.
Klivenyi P, Andreassen OA, Ferrante RJ, Dedeoglu A, Mueller G, Lancelot
E, Bogdanov M, Andersen JK, Jiang D, Beal MF. 2000. Mice deficient in
cellular glutathione peroxidase show increased vulnerability to malonate,
3-nitropropionic acid, and 1-methyl-4-phenyl-1,2,5,6-tetrahydropyridine. J Neurosci 20:1–7.
Kolsch H, Linnebank M, Lutjohann D, Jessen F, Wullner U, Harbrecht U,
Thelen KM, Kreis M, Hentschel F, Schulz A, von Bergmann K, Maier W,
Heun R. 2004. Polymorphisms in glutathione S-transferase omega-1 and
AD, vascular dementia, and stroke. Neurology 63:2255–2260.
Lewis CM, Levinson DF, Wise LH, DeLisi LE, Straub RE, Hovatta I,
Williams NM, Schwab SG, Pulver AE, Faraone SV, Brzustowicz LM,
Kaufmann CA, Garver DL, Gurling HM, Lindholm E, Coon H, Moises
HW, Byerley W, Shaw SH, Mesen A, Sherrington R, O’Neill FA, Walsh D,
Kendler KS, Ekelund J, Paunio T, Lonnqvist J, Peltonen L, O’Donovan
MC, Owen MJ, Wildenauer DB, Maier W, Nestadt G, Blouin JL,
Antonarakis SE, Mowry BJ, Silverman JM, Crowe RR, Cloninger CR,
Tsuang MT, Malaspina D, Harkavy-Friedman JM, Svrakic DM, Bassett
AS, Holcomb J, Kalsi G, McQuillin A, Brynjolfson J, Sigmundsson T,
Petursson H, Jazin E, Zoega T, Helgason T. 2003. Genome scan metaanalysis of schizophrenia and bipolar disorder, part II: Schizophrenia.
Am J Hum Genet 73:34–48.
Li YJ, Oliveira SA, Xu P, Martin ER, Stenger JE, Scherzer CR, Hauser MA,
Scott WK, Small GW, Nance MA, Watts RL, Hubble JP, Koller WC,
Pahwa R, Stern MB, Hiner BC, Jankovic J, Goetz CG, Mastaglia F,
Middleton LT, Roses AD, Saunders AM, Schmechel DE, Gullans SR,
Haines JL, Gilbert JR, Vance JM, Pericak-Vance MA, Hulette C, WelshBohmer KA. 2003. Glutathione S-transferase omega-1 modifies age-atonset of Alzheimer disease and Parkinson disease. Hum Mol Genet
12:3259–3267.
Mahadik SP, Mukherjee S. 1996. Free radical pathology and antioxidant
defense in schizophrenia: A review. Schizophr Res 19:1–17.
Mannervik B. 1985. The isoenzymes of glutathione transferase. Adv
Enzymol Relat Areas Mol Biol 57:357–417.
Marnell LL, Garcia-Vargas GG, Chowdhury UK, Zakharyan RA, Walsh B,
Avram MD, Kopplin MJ, Cebrian ME, Silbergeld EK, Aposhian HV.
2003. Polymorphisms in the human monomethylarsonic acid (MMA V)
reductase/hGSTO1 gene and changes in urinary arsenic profiles. Chem
Res Toxicol 16:1507–1513.
Matsuzawa D, Hashimoto K, Shimizu E, Fujisaki M, Iyo M. 2005. Functional polymorphism of the glutathione peroxidase 1 gene is associated
with personality traits in healthy subjects. Neuropsychobiology 52:
68–70.
Meister A, Anderson ME. 1983. Glutathione. Annu Rev Biochem 52:
711–760.
Mulcrone J, Whatley SA, Marchbanks R, Wildenauer D, Altmark D, Daoud
H, Gur E, Ebstein RP, Lerer B. 1995. Genetic linkage analysis of schizophrenia using chromosome 11q 13-24markers in Israeli pedigrees. Am J
Med Genet 60:103–108.
Nakamura S, Kugiyama K, Sugiyama S, Miyamoto S, Koide S, Fukushima
H, Honda O, Yoshimura M, Ogawa H. 2002. Polymorphism in the 50 flanking region of human glutamate-cysteine ligase modifier subunit
gene is associated with myocardial infarction. Circulation 105:
2968–2973.
Nakazato H, Suzuki K, Matsui H, Koike H, Okugi H, Ohtake N, Takei T,
Nakata S, Hasumi M, Ito K, Kurokawa K, Yamanaka H. 2003. Association
94
of genetic polymorphisms of glutathione-S-transferase genes (GSTM1,
GSTT1 and GSTP1) with familial prostate cancer risk in a Japanese
population. Anticancer Res 23:2897–2902.
Pae CU, Kim JJ, Lee SJ, Lee CU, Lee C, Paik IH, Park HR, Yang S, Serretti A.
2003. Association study between glutathione S-transferase P1 polymorphism and schizophrenia in the Korean population. Prog Neuropsychopharmacol Biol Psychiatry 27:519–523.
Pae CU, Yu HS, Kim JJ, Kim W, Lee CU, Lee SJ, Jun TY, Lee C, Paik IH,
Serretti A. 2004. Glutathione S-transferase M1 polymorphism may
contribute to schizophrenia in the Korean population. Psychiatr Genet
14:147–150.
Raimondi S, Paracchini V, Autrup H, Barros-Dios JM, Benhamou S,
Boffetta P, Cote ML, Dialyna IA, Dolzan V, Filiberti R, Garte S, Hirvonen
A, Husgafvel-Pursiainen K, Imyanitov EN, Kalina I, Kang D, Kiyohara C,
Kohno T, Kremers P, Lan Q, London S, Povey AC, Rannug A, Reszka E,
Risch A, Romkes M, Schneider J, Seow A, Shields PG, Sobti RC, Sorensen
M, Spinola M, Spitz MR, Strange RC, Stucker I, Sugimura H, To-Figueras
J, Tokudome S, Yang P, Yuan JM, Warholm M, Taioli E. 2006. Meta- and
pooled analysis of GSTT1 and lung cancer: A HuGE-GSEC review. Am J
Epidemiol 164:1027–1042.
Ranjekar PK, Hinge A, Hegde MV, Ghate M, Kale A, Sitasawad S, Wagh UV,
Debsikdar VB, Mahadik SP. 2003. Decreased antioxidant enzymes and
membrane essential polyunsaturated fatty acids in schizophrenic and
bipolar mood disorder patients. Psychiatry Res 121:109–122.
Ravn-Haren G, Olsen A, Tjonneland A, Dragsted LO, Nexo BA, Wallin H,
Overvad K, Raaschou-Nielsen O, Vogel U. 2006. Associations between
GPX1 Pro198Leu polymorphism, erythrocyte GPX activity, alcohol
consumption and breast cancer risk in a prospective cohort study.
Carcinogenesis 27:820–825.
Risch A, Wikman H, Thiel S, Schmezer P, Edler L, Drings P, Dienemann H,
Kayser K, Schulz V, Spiegelhalder B, Bartsch H. 2001. Glutathione-Stransferase M1, M3, T1 and P1 polymorphisms and susceptibility to nonsmall-cell lung cancer subtypes and hamartomas. Pharmacogenetics
11:757–764.
Saadat M, Mobayen F, Farrashbandi H. 2007. Genetic polymorphism of
glutathione S-transferase T1: A candidate genetic modifier of individual
susceptibility to schizophrenia. Psychiatry Res 153:87–91.
Schulz JB, Lindenau J, Seyfried J, Dichgans J. 2000. Glutathione, oxidative
stress and neurodegeneration. Eur J Biochem 267:4904–4911.
Schweizer U, Brauer AU, Kohrle J, Nitsch R, Savaskan NE. 2004. Selenium
and brain function: A poorly recognized liaison. Brain Res Brain Res Rev
45:164–178.
Shaw SH, Kelly M, Smith AB, Shields G, Hopkins PJ, Loftus J, Laval SH, Vita
A, De Hert M, Cardon LR, Crow TJ, Sherrington R, DeLisi LE. 1998. A
genome-wide search for schizophrenia susceptibility genes. Am J Med
Genet 81:364–376.
Shinkai T, De Luca V, Zai G, Shaikh S, Matsumoto C, Arnold PD, Hwang R,
King N, Trakalo J, Potapova N, Wong G, Hori H, Wong AH, Ohmori O,
Nakamura J, Kennedy JL. 2004. No association between the Pro197Leu
polymorphism in the glutathione peroxidase (GPX1) gene and schizophrenia. Psychiatr Genet 14:177–180.
Shinkai T, De Luca V, Hwang R, Matsumoto C, Hori H, Ohmori O,
Remington G, Meltzer HY, Lieberman JA, Potkin SG, Nakamura J,
Kennedy JL. 2005. Association study between a functional glutathione
AMERICAN JOURNAL OF MEDICAL GENETICS PART B
S-transferase (GSTP1) gene polymorphism (Ile105Val) and tardive
dyskinesia. Neurosci Lett 388:116–120.
Smeyne M, Boyd J, Raviie Shepherd K, Jiao Y, Pond BB, Hatler M, Wolf R,
Henderson C, Smeyne RJ. 2007. GSTpi expression mediates dopaminergic neuron sensitivity in experimental Parkinsonism. Proc Natl Acad Sci
USA 104:1977–1982.
Smythies JR. 1997. Oxidative reactions and schizophrenia: A reviewdiscussion. Schizophr Res 24:357–364.
Sreelekha TT, Ramadas K, Pandey M, Thomas G, Nalinakumari KR, Pillai
MR. 2001. Genetic polymorphism of CYP1A1, GSTM1 and GSTT1 genes
in Indian oral cancer. Oral Oncol 37:593–598.
Strange RC, Spiteri MA, Ramachandran S, Fryer AA. 2001. Glutathione-Stransferase family of enzymes. Mutat Res 482:21–26.
Tanaka-Kagawa T, Jinno H, Hasegawa T, Makino Y, Seko Y, Hanioka N,
Ando M. 2003. Functional characterization of two variant human GSTO
1-1s (Ala140Asp and Thr217Asn). Biochem Biophys Res Commun
301:516–520.
Tosic M, Ott J, Barral S, Bovet P, Deppen P, Gheorghita F, Matthey ML,
Parnas J, Preisig M, Saraga M, Solida A, Timm S, Wang AG, Werge T,
Cuenod M, Do KQ. 2006. Schizophrenia and oxidative stress: Glutamate
cysteine ligase modifier as a susceptibility gene. Am J Hum Genet 79:
586–592.
Wahner AD, Glatt CE, Bronstein JM, Ritz B. 2007. Glutathione S-transferase mu, omega, pi, and theta class variants and smoking in Parkinson’s
disease. Neurosci Lett 413:274–278.
Watson MA, Stewart RK, Smith GB, Massey TE, Bell DA. 1998. Human
glutathione S-transferase P1 polymorphisms: Relationship to lung tissue
enzyme activity and population frequency distribution. Carcinogenesis
19:275–280.
Whitbread AK, Tetlow N, Eyre HJ, Sutherland GR, Board PG. 2003.
Characterization of the human omega class glutathione transferase genes
and associated polymorphisms. Pharmacogenetics 13:131–144.
Whitbread AK, Masoumi A, Tetlow N, Schmuck E, Coggan M, Board PG.
2005. Characterization of the omega class of glutathione transferases.
Methods Enzymol 401:78–99.
Yang Y, Dieter MZ, Chen Y, Shertzer HG, Nebert DW, Dalton TP. 2002.
Initial characterization of the glutamate-cysteine ligase modifier subunit
gclm(/) knockout mouse. Novel model system for a severely compromised oxidative stress response. J Biol Chem 277:49446–49452.
Yao JK, Reddy RD, van Kammen DP. 2001. Oxidative damage and
schizophrenia: An overview of the evidence and its therapeutic implications. CNS Drugs 15:287–310.
Yao JK, Leonard S, Reddy R. 2006. Altered glutathione redox state in
schizophrenia. Dis Markers 22:83–93.
Yoshimura K, Hanaoka T, Ohnami S, Ohnami S, Kohno T, Liu Y, Yoshida
T, Sakamoto H, Tsugane S. 2003. Allele frequencies of single nucleotide
polymorphisms (SNPs) in 40 candidate genes for gene-environment
studies on cancer: Data from population-based Japanese random samples. J Hum Genet 48:654–658.
Zhang XY, Tan YL, Zhou DF, Cao LY, Wu GY, Haile CN, Kosten TA,
Kosten TR. 2007. Disrupted antioxidant enzyme activity and elevated
lipid peroxidation products in schizophrenic patients with tardive
dyskinesia. J Clin Psychiatry 68:754–760.
Документ
Категория
Без категории
Просмотров
0
Размер файла
124 Кб
Теги
population, japanese, associations, polymorphism, enzymes, stud, glutathione, related, genetics, schizophrenia
1/--страниц
Пожаловаться на содержимое документа