close

Вход

Забыли?

вход по аккаунту

?

Association study of CHRFAM7A copy number and 2bp deletion polymorphisms with schizophrenia and bipolar affective disorder.

код для вставкиСкачать
American Journal of Medical Genetics Part B (Neuropsychiatric Genetics) 141B:571 –575 (2006)
Association Study of CHRFAM7A Copy Number
and 2bp Deletion Polymorphisms With Schizophrenia
and Bipolar Affective Disorder
Rachel H. Flomen,1* David A. Collier,1,2 Sarah Osborne,1 Janet Munro,1 Gerome Breen,1,2
David St Clair,3 and Andrew J. Makoff1
1
Division of Psychological Medicine, Institute of Psychiatry, King’s College London, London, United Kingdom
MRC Social Genetic and Developmental Psychiatry Research Centre, Institute of Psychiatry, King’s College London, London,
United Kingdom
3
Department of Mental Health, Institute of Medical Science, University of Aberdeen, Aberdeen, Scotland, United Kingdom
2
Schizophrenia and bipolar disorder are major
psychiatric diseases that have a strong genetic
element. Markers in the vicinity of the CHRNA7
gene at 15q13-q14 have been linked with an
endophenotype of schizophrenia, P50 sensory
gating disorder, with schizophrenia itself and
with bipolar disorder. We have measured
the copy number of the polymorphic partial
duplication of CHRNA7 (CHRFAM7A) and genotyped a polymorphic 2bp deletion within exon 6 of
CHRFAM7A. In this study, 208 probands with a
primary diagnosis of schizophrenia, 217 with a
diagnosis of bipolar affective disorder and 28 with
schizoaffective or other psychotic disorders were
examined together with 197 controls recruited
from the same region in Scotland. No significant
association was seen for schizophrenia and bipolar disorder by genotype or allele overall for
either polymorphism, but a mildly significant
association by genotype (P ¼ 0.04) was observed
for absence of CHRFAM7A when the sample was
analyzed as a single psychosis phenotype.
ß 2006 Wiley-Liss, Inc.
KEY WORDS:
copy
number
polymorphism;
CHRNA7; CHRFAM7A; schizophrenia; bipolar disorder
Please cite this article as follows: Flomen RH, Collier
DA, Osborne S, Munro J, Breen G, St Clair D, Makoff AJ.
2006. Association Study of CHRFAM7A Copy Number
and 2bp Deletion Polymorphisms With Schizophrenia
and Bipolar Affective Disorder. Am J Med Genet Part B
141B:571–575.
INTRODUCTION
The alpha-7 nicotinic cholinergic receptor subunit
(CHRNA7) gene is widely expressed in the central nervous
system, with high levels in the hippocampus. It maps to
chromosome 15q13-q14 [Chini et al., 1994], a region that has
*Correspondence to: Rachel H. Flomen, Division of Psychological Medicine, Institute of Psychiatry, King’s College London,
1 Windsor Walk, Denmark Hill, London SE5 8AF, UK.
E-mail: r.flomen@iop.kcl.ac.uk
Received 28 July 2005; Accepted 17 February 2006
DOI 10.1002/ajmg.b.30306
ß 2006 Wiley-Liss, Inc.
been implicated in several neuropsychiatric disorders, including epilepsy and psychosis, by linkage and association study.
Markers at or near CHRNA7 show evidence of strong linkage to
a secondary phenotype of schizophrenia, P50 [Freedman et al.,
1997; Leonard et al., 1998], which compares the amplitudes of
the responses after 50 msec to two auditory signals 500 msec
apart. In most individuals the second response is attenuated,
which is believed to be a measure of the ability to filter out
repetitive stimuli. In schizophrenic patients and around half of
their first-degree relatives, the normal attenuation of P50
response is reduced and this effect is normalized by nicotine
and atypical antipsychotics such as clozapine [Freedman et al.,
1997]. Linkage to P50 mapped at 15q13-q14 with a peak LOD
score of 5.3 at a marker within intron 2 of CHRNA7, so that P50
appears to segregate as a Mendelian trait with strong evidence
of linkage to this gene [Freedman et al., 1997]. Not surprisingly
for a complex disorder, it has proved more difficult to
demonstrate strong linkage of this region to schizophrenia
itself, with the same study having a much lower LOD score of
1.33 [Freedman et al., 1997]. Many other studies have reported
weak evidence for linkage to schizophrenia [Kaufmann et al.,
1998; Leonard et al., 1998; Riley et al., 2000; Gejman et al.,
2001; De Luca et al., 2004] and others had negative findings
[Neves-Pereira et al., 1998; Curtis et al., 1999; Meyer et al.,
2002]. Significant linkage has been demonstrated with bipolar
affective disorder [Edenberg et al., 1997; Turecki et al., 2001],
where abnormal P50 has also been described [Baker et al.,
1990]. These linkage studies have been supported by the
observation that schizophrenia and bipolar disorder are
associated with 15q13-q14 markers [Stassen et al., 2000].
The region has also been linked to two idiopathic epilepsies
[Elmslie et al., 1997; Neubauer et al., 1998].
The 15q13-q14 region is highly duplicated and this has
hindered mapping, especially with earlier incorrectly
assembled sequence data for this region. More recent assemblies (e.g., NT_010194 which had this region correctly
assembled since version 15, build 33 available in April 2003)
now confirm and extend the map produced in this laboratory
[Riley et al., 2002]. Exons 5–10 of CHRNA7 are located at one
end of a 300 kb duplicon, with the promoter and exons 1–4 in a
unique region. In the other 300 kb duplicon, exons 5–10 are
distal to exons D-A which are duplicated from an unknown
gene FAM7A in different duplicons. This forms a hybrid gene
(CHRFAM7A), which is transcribed, although translation is
uncertain [Gault et al., 1998; Riley et al., 2002]. These
duplicons are polymorphic, due to copy number polymorphisms (CNPs). Chromosomes with one or no copies of the hybrid
CHRFAM7A have so far been identified [Riley et al., 2002;
Taske et al., 2002], as have two or three copies of FAM7A in the
few individuals represented in the sequence databases.
CHRFAM7A additionally carries a polymorphic 2bp deletion
572
Flomen et al.
within exon 6, which, if translated, is predicted to result in a
truncated protein [Gault et al., 1998].
The presence of CHRFAM7A in many but not all human
genomes as well as the near 100% identity of the 30 part in
common with CHRNA7 strongly suggests that its acquisition is
a recent event in human evolution [Riley et al., 2002; Taske
et al., 2002]. This view is supported by the failure to detect
CHRFAM7A in chimpanzee DNA by FISH mapping [Locke
et al., 2003] and in the chimpanzee sequence database [http://
www.ncbi.nlm.nih.gov/genome/guide/chimp/]. The high frequencies of CHRFAM7A in a variety of populations suggest
that it, or a subsequent event such as the 2bp deletion, may
confer a selective advantage.
In order to clarify the role of CHRFAM7A and its 2bp deletion
in susceptibility to psychosis, we have investigated these two
polymorphisms for association with schizophrenia and bipolar
disorder in a large sample of white Caucasians. We have used
robust assays to investigate the 2bp deletion in combination
with CHRFAM7A copy number and these identify three
CHRFAM7A alleles (null, wild-type, and 2bp deletion) in a
total of six possible genotypes.
MATERIALS AND METHODS
Clinical Samples
Four hundred and fifty three probands with a major
psychosis were analyzed together with 197 ethnically matched
controls collected from the same geographical region of Scotland [McGinnis et al., 2001; Stefansson et al., 2003; NevesPereira et al., 2005]. Subjects were recruited through Scottish
psychiatric hospitals and met DSM111R criteria for schizophrenia or schizoaffective disorder and DSM1V for bipolar
1 disorder. Consensus diagnosis was made by two consultant
psychiatrists based on a combination of examination of
psychiatric case notes and clinical interview. The psychosis
sample was clinically classified as follows: 208 schizophrenia,
217 bipolar disorder, and 28 other psychoses (including 11 with
schizoaffective disorder). Controls were recruited via the
Scottish blood transfusion service from the same region of
Scotland and were 57% male and 43% female. As the incidence
of psychosis in the general population is low, they were not
specifically screened for mental illness. In the UK only healthy
people not taking medication can donate blood, and therefore
these controls are unlikely, if at all, to include a significant
number of psychotic individuals. All individuals gave written
consent to participate and Multiregional Ethics Committee
(MREC) approval was granted for this study.
Genotyping
Genotyping for the 2bp deletion polymorphism was by
limited cycle fluorescent PCR (21 cycles of 948C/30 sec, 588C/
30 sec, 728C/1.5 min) using primers flanking the 2bp
deletion. 2bpForFAM GGGCATATTCAAGAGTTCCTGCTAC
and 2bpRev CCACTAGGTCCCATTCTCCATTG gave a product size of 170 bp in the absence of the deletion and 168 bp in
its presence. PCR products were resolved using a 3100
fluorescent genotyper and Genemapper v3.0 software to
ascertain 170 bp:168 bp ratios. Each assay was performed at
least twice.
Copy number of CHRFAM7A was determined with a Taqman assay spanning the breakpoint between FAM7A exons DA and CHRNA7 exons 5–10 (forward primer: AGTAATAGTGTAATACTGTAACTTTAAAATGTGTTACTTGT, reverse primer: AGCCGGGATGGTCTCGAT, MGB labeled probe: TCCT
GACTGTACACATAAAA). Ct values were determined on three
separate occasions for the CHRFAM7A specific assay and
compared with Ct values for an endogenous control, the beta-2-
microglobulin gene (forward primer: TGGGTTTCATCCATCCGACATT, reverse primer: AGACAAGTCTGAATGCTCCAC
TTTT, MGB labeled probe: ATTCTTCAGTAAGTCAACTTC).
The differential value between test and control was used to
determine copy number of the CHRFAM7A duplicon. Taqman
results were interpreted using values corresponding to 0, 1, or
2 copies of CHRFAM7A which was determined empirically
using 86 samples of known copy number in addition to
11 members of 2 families which included homozygous null
and obligate heterozygous individuals [Riley et al., 2002; Taske
et al., 2002].
RESULTS
The presence or absence of CHRFAM7A, containing exon
6 either identical to that in CHRNA7 or with the 2bp deletion,
results in three alleles and six possible genotypes (Table I). All
samples were initially assayed for the 2bp deletion by
measuring the ratio of exon 6 copy number with and
without the deletion. For three of the six genotypes, the assay
identifies CHRFAM7A copy number. These three genotypes
had two product sizes with informative ratios: 1:1 ¼ 2 copies
of CHRFAM7A, both with the 2bp deletion; 3:1 ¼ 2 copies of
CHRFAM7A, 1 with the 2bp deletion; 2:1 ¼ 1 copy of
CHRFAM7A with the 2bp deletion (see Table I). Samples
lacking the 2bp deletion on both chromosomes had only
one product size and were therefore uninformative for
CHRFAM7A copy number, which was determined using the
Taqman assay. Results from the Taqman and 2bp fluorescent
assays were then combined to identify all six genotypes.
This combined assay was validated for CHRFAM7A
copy number in preliminary experiments which showed
that the three genotypes informative in the 2bp deletion
assay generated the expected CHRFAM7A copy numbers
using Taqman assay in 90 out of 91 comparisons. This
single discrepancy was due to Taqman values predicting
CHRFAM7A copy number in between 1 and 2.
The genotype frequencies for schizophrenia, bipolar, and
controls are shown in Table II, with patient numbers given
from both assays separately (a and b) and combined (c).
Comparison of genotype frequencies between schizophrenia or
bipolar samples and controls show no significant difference,
either analyzed separately (w2 ¼ 8.00, 5 df, P ¼ 0.2; w2 ¼ 6.96, 5
df, P ¼ 0.2), or in the combined psychosis phenotype (w2 ¼ 7.26,
5 df, P ¼ 0.2). The genotype data were also analyzed to
investigate whether (1) CHRFAM7A copy number, (2) presence of wild-type CHRFAM7A, or (3) presence of the 2bp
deletion were associated with any of the psychosis phenotypes.
When copy number of CHRFAM7A was considered alone, there
were small differences between schizophrenia or bipolar
probands and controls (w2 ¼ 3.85, 2 df, P ¼ 0.2; w2 ¼ 4.93, 2 df,
P ¼ 0.09), but when all psychosis patients were combined there
was a small significant difference from controls (w2 ¼ 6.26, 2 df,
TABLE I. Six Possible Genotypes for CHRFAM7A þ 2bp Deletion
CHRNA7a
Genotype
11
12
22
13
23
33
CHRFAM7Aa
Wt
Wt
2
2
2
2
2
2
0
1
2
0
1
0
2bp deletion Wt:2bp deletion
0
0
0
1
1
2
1 peak
1 peak
1 peak
2:1
3:1
1:1
Allele 1 ¼ absence of CHRFAM7A, allele 2 ¼ presence of wild-type (wt)
CHRFAM7A, allele 3 ¼ presence of CHRFAM7A with 2bp deletion in exon 6.
a
Number of copies of exon 6.
Association of CHRFAM7A Polymorphism and Psychosis
573
TABLE II. Genotype Frequencies for Schizophrenia, Bipolar, and Control Samples. (a) Patient
counts from 2bp assay, (b) patient counts from taqman assay, (c) combined patient counts. Alleles
are defined as in Table I
(a) 2bp assay (all samples)
No. of peaks
1
2
2
2
2
(2:1)
(3:1)
(1:1)
(unclear)
Genotype
Genotype
11
12
22
13
23
33
Total
Schizophrenia
Bipolar
Others
11,12, or 22
76
76
82
13
11
8
23
23
73
72
83
33
32
27
25
13, 23, or 33
3
10
3
Total
195
193
216
(b) Taqman assay (only samples with 1 peak on 2bp assay)
CHRFAM7A copy no.
0
1
2
Unclear
Controls
Genotype
11
12
22
11, 12, or 22
Total
Controls
Schizophrenia
3
19
49
5
76
(c) Combined results
11
2
7
5
1
26
Bipolar
Others
1
33
34
8
76
1
28
53
0
82
0
4
6
1
11
Controls
Schizophrenia
Bipolar
Others
Psychosis
3 (0.02)
19 (0.10)
49 (0.26)
11 (0.06)
73 (0.39)
32 (0.17)
187
1 (0.01)
33 (0.19)
34 (0.19)
8 (0.05)
72 (0.41)
27 (0.15)
175
1 (0.00)
28 (0.13)
53 (0.25)
23 (0.11)
83 (0.39)
25 (0.12)
213
0 (0.00)
4 (0.17)
6 (0.25)
2 (0.08)
7 (0.29)
5 (0.21)
24
2 (0.00)
65 (0.16)
93 (0.23)
33 (0.08)
162 (0.39)
57 (0.14)
412
Overall genotype comparisons: schizophrenia versus control: w2 ¼ 8.00, 5 df, P ¼ 0.2, bipolar versus controls:
w2 ¼ 6.96, 5 df, P ¼ 0.2, psychosis versus controls: w2 ¼ 7.26, 5 df, P ¼ 0.2.
CHRFAM7A copy number comparisons (11 vs. 12/13 vs. 22/23/33): schizophrenia versus controls: w2 ¼ 3.85, 2 df,
P ¼ 0.06, bipolar versus controls: w2 ¼ 4.93, 2 df, P ¼ 0.09, psychosis versus controls: x2 ¼ 6.26, 2 df, P ¼ 0.04.
CHRFAM7A wt comparisons (22 vs. 12/23 vs. 11/13/33): schizophrenia versus controls: w2 ¼ 4.40, 2 df, P ¼ 0.1,
bipolar versus controls: w2 ¼ 0.34, 2 df, P ¼ 0.8, psychosis versus controls: w2 ¼ 1.84, 2 df, P ¼ 0.4.
2bp deletion comparisons (33 vs. 13/23 vs. 11/12/22): schizophrenia versus controls: w2 ¼ 0.19, 2 df, P ¼ 0.9, bipolar
versus controls: w2 ¼ 2.52, 2 df, P ¼ 0.3, psychosis versus controls: w2 ¼ 1.12, 2 df, P ¼ 0.6.
P ¼ 0.04). However, this mild significance is lost after correction for multiple testing. We found no evidence for association
of wild-type CHRFAM7A with schizophrenia (w2 ¼ 4.40, 2 df,
P ¼ 0.1), bipolar disorder (w2 ¼ 0.34, 2 df, P ¼ 0.8) or combined
psychosis (w2 ¼ 1.84, 2 df, P ¼ 0.4). Similarly we found no
evidence for association of the 2bp deletion alone with any of
the three phenotypes (w2 ¼ 0.19, 2 df, P ¼ 0.9; w2 ¼ 2.52, 2 df,
P ¼ 0.3; w2 ¼ 1.12, 2 df, P ¼ 0.6).
The overall genotype frequencies for controls and bipolar
probands were in Hardy–Weinberg equilibrium (w2 ¼ 2.02, 3
df, P ¼ 0.6; w2 ¼ 3.00, 3 df, P ¼ 0.4), while schizophrenia
probands deviated from expected values (w2 ¼ 14.23, 3 df,
P ¼ 0.003). However, when the copy number of
CHRFAM7A was considered alone all were in Hardy–Weinberg equilibrium (controls: w2 ¼ 1.33, 1 df, P ¼ 0.3; bipolar:
w2 ¼ 2.09, 1 df, P ¼ 0.2; schizophrenia: w2 ¼ 1.14, 1 df, P ¼ 0.3),
while combined psychosis was of borderline significance
(w2 ¼ 3.84, 1 df, P ¼ 0.05).
Failures or ambiguities in either assay are potential
confounders of the validity of the combined assay as they
differentially affect the relative proportions of two groups of
genotypes. Where a sample was omitted due to the Taqman
assay failing to estimate a copy number, this results in the
affected genotypes (11, 12, and 22) being under-represented.
Conversely, where the 2bp deletion assay produced two peaks
that failed to give a clear value for their ratios (e.g., between 2:1
and 3:1), omission of these samples results in the other group of
genotypes (13, 23, and 33) being under-represented. To check
whether these omitted samples significantly affected the
outcome, genotype counts were adjusted to maintain the ratio
between the two groups of genotypes (13 þ 23 þ 33/
11 þ 12 þ 22) as indicated by the 2bp deletion assay (data not
shown). For all three patient groups, the adjustment was very
small, with no more than one patient count added to or
subtracted from each genotype group. This had only a small
effect on all of the comparisons, with the association of
combined psychosis with CHRFAM7A copy number of borderline significance (w2 ¼ 5.96, 2 df, P ¼ 0.05).
DISCUSSION
The 2bp deletion polymorphism is in exon 6 of CHRFAM7A,
which is itself polymorphic, existing as a null allele or single
copy allele. The 2bp deletion can clearly only occur with the
single copy allele of the CHRFAM7A CNP, and may be present
in one (genotype 23) or both (genotype 33) of two copies of
CHRFAM7A, or in the only copy (genotype 13) of CHRFAM7A
(see Table I). It is therefore important that both polymorphisms are considered together. We have achieved this by
combining a fluorescent PCR assay with a robust Taqman
assay to determine copy number accurately. Our data show no
evidence for schizophrenia or bipolar disorder separately or as
a combined psychosis phenotype being associated with the two
CHRFAM7A polymorphisms together. This agrees with a
French study using a much smaller sample size (70 cases and
77 controls) which also found no association with schizophrenia [Raux et al., 2002].
A Chinese group investigated the 2bp deletion polymorphism without considering the CHRFAM7A CNP. They reported
weak association for presence of the 2bp deletion with bipolar
574
Flomen et al.
disorder (P ¼ 0.044) using 77 cases and 135 controls [Hong
et al., 2004], but no association with schizophrenia using
146 cases and 151 controls [Lai et al., 2001]. The French group
also found no association of the 2bp deletion with schizophrenia, although they did find an association with abnormal
P50, which was mostly limited to the control group [Raux et al.,
2002].
We found no evidence for association between 2bp deletion
and any psychosis phenotype, but have not investigated the
P50 endophenotype in our Scottish cohort. We will be
performing association studies with P50 on a sample of
patients and their families attending the Maudsley Hospital,
when the electrophysiological data is complete. The Chinese
group also found evidence for more than two alleles of the 2bp
deletion genotype in 3 out of 77 bipolar cases [Hong et al., 2004],
implying either a copy number of more than one per
chromosome for the CHRFAM7A CNP or the presence of the
2bp deletion on CHRNA7. We have examined over 600 patient
and control samples here and an additional 480 samples in
other studies (R. Flomen, unpublished observations) but have
never observed a ratio of wt/2bp<1. As all our DNA samples
are from white Caucasians, this difference may be due to
ethnicity, although methodological differences cannot be
excluded.
Our data produced weak evidence for a combined psychosis
phenotype being associated with only one copy of CHRFAM7A
(P ¼ 0.04), regardless of presence or absence of the 2bp deletion.
This observation clearly needs to be treated with considerable
caution, as the association is lost following Bonferroni
correction for multiple testing. Whether there is a stronger
association with no copies of CHRFAM7A could not be
determined, as this genotype is too rare to draw any conclusion.
Other studies have similarly found that this genotype is very
rare [Gault et al., 1998; Raux et al., 2002; Li et al., 2004]. As
discussed above, we found no evidence for association with
the 2bp deletion, and we also failed to find association of any
psychosis phenotype with the presence of a wild-type
CHRFAM7A.
If translated in the same cell, the CHRFAM7A translation
products might interact with those of CHRNA7 and disrupt
formation of the alpha-7 receptor homopentamer, acting in a
dominant negative manner [Raux et al., 2002]. This could be
prevented by the 2bp deletion, which would cause a truncated
product to be formed. Consequently either polymorphism could
contribute to pathogenesis of the major psychoses linked to
15q13-q14. Our suggestive evidence for reduced levels of
CHRFAM7A in psychosis is inconsistent with deleterious
interaction with CHRNA7 polypeptides being the diseaseassociated mechanism. Indeed, our findings cannot be reconciled with any role for the CHRFAM7A gene product in
psychosis, although it may be involved in other phenotypes
such as cognitive functions in psychosis patients or even in the
general population. If CHRFAM7A protein were implicated in
schizophrenia or bipolar disorder, absence of the gene product
would affect the phenotype irrespective of whether this was a
consequence of the CHRFAM7A null allele or of the 2bp
deletion. However, only the absence of one copy of the
CHRFAM7A gene appears to be a risk allele. Therefore if the
weak association of CHRFAM7A copy number with psychosis
is real, our data suggest that the mechanism involves
transcription rather than translation of CHRFAM7A. One
possible mechanism might be competition between the two
genes for a transcription factor that binds to a sequence
element in the shared part of each gene. However, examination
of this region for repetitive elements on the UCSC database
(www.genome.ucsc.edu) has failed to identify a plausible
candidate (data not shown). Another possibility might
be production of anti-sense RNA by transcription of the
anti-sense strand of CHRFAM7A, thereby modulating expres-
sion of CHRNA7. However, this is unlikely as all published
CHRFAM7A cDNAs are transcribed on the sense strand [Riley
et al., 2002].
As CHRFAM7A is located on a 300 kb duplicon, the
CHRFAM7A CNP may affect a much larger region than
the gene itself. We have evidence that it covers a region in the
range of 380–560 kb in 15q13-q14 (in preparation). Therefore,
any gene in this region would also have its copy number altered
by this CNP and potentially may have a role in the phenotype.
Six genes of unknown function have been identified in
this region with the following accession numbers: CR749235,
AL117445, AK131275, AK090401, AK090403 (www.genome.ucsc.edu). Finally, it is possible that the CHRFAM7A
CNP is in linkage disequilibrium with the functional polymorphism responsible for predisposition to psychosis.
Abundance of CHRFAM7A in several human populations
and its absence in other higher primates suggests that it may
have an evolutionarily beneficial effect. Our data demonstrating a weak association of reduced levels of CHRFAM7A
with psychosis are consistent with this view. Many more
studies on this complex region on chromosome 15 are necessary
to resolve these issues. Accordingly, we are currently investigating CHRFAM7A and other variants on 15q13-q14 for
possible association with psychosis and with endophenotypes
such as P50.
ACKNOWLEDGMENTS
This work was supported by a NARSAD Independent
Investigator Award.
REFERENCES
Baker NJ, Staunton M, Adler LE, Gerhardt GA, Drebing C, Waldo M,
Nagamoto H, Freedman R. 1990. Sensory gating deficits in psychiatric
inpatients: Relation to catecholamine metabolites in different diagnostic
groups. Biol Psychiatry 27:519–528.
Chini B, Raimond E, Elgoyhen AB, Moralli D, Balzaretti M, Heinemann S.
1994. Molecular cloning and chromosomal localization of the human
alpha 7- nicotinic receptor subunit gene (CHRNA7). Genomics 19:379–
381.
Curtis L, Blouin JL, Radhakrishna U, Gehrig C, Lasseter VK, Wolyniec P,
Nestadt G, Dombroski B, Kazazian HH, Pulver AE, Housman D,
Bertrand D, Antonarakis SE. 1999. No evidence for linkage between
schizophrenia and markers at chromosome 15q13-14. Am J Med Genet
(Neuropsychiatr Genet) 88:109–112.
De Luca V, Wong AHC, Muller D, Wong GWH, Tyndale R, Kennedy JL.
2004. Evidence of association between smoking and alpha7 nicotinic
receptor subunit gene in schizophrenia patients. Neuropsychopharmacology 29:1522–1526.
Edenberg HJ, Foroud T, Conneally PM, Sorbel JJ, Carr K, Crose C, Willig C,
Zhao J, Miller M, Bowman E, Mayeda A, Rau NL, Smiley C, Rice JP,
Goate A, Reich T, Stine OC, McMahon F, DePaulo JR, Meyers D, DeteraWadleigh SD, Goldin LR, Gershon ES, Blehar MC, Nurnberger JI Jr.
1997. Initial genomic scan of the NIMH genetics initiative bipolar
pedigrees: Chromosomes 3, 5, 15, 16, 17, and 22. Am J Med Genet
(Neuropsychiatr Genet) 74:238–246.
Elmslie FV, Rees M, Williamson MP, Kerr M, Kjeldsen MJ, Pang KA,
Sundqvist A, Friis ML, Chadwick D, Richens A, Covanis A, Santos M,
Arzimanoglou A, Panayiotopoulos CP, Curtis D, Whitehouse WP,
Gardiner RM. 1997. Genetic mapping of a major susceptibility locus
for juvenile myoclonic epilepsy on chromosome 15q. Hum Mol Genet 6:
1329–1334.
Freedman R, Coon H, Myles-Worsley M, Orr-Urtreger A, Olincy A, Davis A,
Polymeropoulos M, Holik J, Hopkins J, Hoff M, Rosenthal J, Waldo MC,
Reimherr F, Wender P, Yaw J, Young DA, Breese CR, Adams C,
Patterson D, Adler LE, Kruglyak L, Leonard S, Byerley W. 1997.
Linkage of a neurophysiological defect in schizophrenia to a chromosome
15 locus. Proc Natl Acad Sci USA 94:587–592.
Gault J, Robinson M, Berger R, Drebing C, Logel J, Hopkins J, Moore T,
Jacobs S, Meriwether J, Choi MJ, Kim EJ, Walton K, Buiting K, Davis A,
Breese C, Freedman R, Leonard S. 1998. Genomic organisation and
partial duplication of the human alpha7 neuronal nicotinic acetylcholine
receptor. Genomics 52:173–185.
Association of CHRFAM7A Polymorphism and Psychosis
Gejman PV, Sanders AR, Badner JA, Cao Q, Zhang J. 2001. Linkage analysis
of schizophrenia to chromosome 15. Am J Med Genet (Neuropsychiatr
Genet) 105:789–793.
Hong CJ, Lai IC, Liou LL, Tsai SJ. 2004. Association study of the human
partially duplicated alpha7 nicotinic acetylcholine receptor genetic
variant with bipolar disorder. Neurosci Lett 355:69–72.
Kaufmann CA, Suarez B, Malaspina D, Pepple J, Svrakic D, Markel PD,
Meyer J, Zambuto CT, Schmitt K, Matise TC, Harkavy Friedman JM,
Hampe C, Lee H, Shore D, Wynne D, Faraone SV, Tsuang MT, Cloninger
CR. 1998. NIMH genetics initiative millennium schizophrenia consortium: Linkage analysis of African–American pedigrees. Am J Med Genet
(Neuropsychiatr Genet) 81:282–289.
Lai IC, Hong CJ, Tsai SJ. 2001. Association study of a nicotinic receptor
variant with schizophrenic disorders. Neuropsychobiology 43:15–18.
Leonard S, Gault J, Moore T, Hopkins J, Robinson M, Olincy A, Adler LE,
Cloninger CR, Kaufmann CA, Tsuang MT, Faraone SV, Malaspina D,
Svrakic DM, Freedman R. 1998. Further investigation of a chromosome
15 locus in schizophrenia: Analysis of affected sibpairs from the NIMH
genetics initiative. Am J Med Genet (Neuropsychiatr Genet) 81:308–
312.
Li CH, Liao HM, Chen CH. 2004. Identification of molecular variants at the
promoter region of the human alpha 7 neuronal nicotinic acetylcholine
receptor subunit gene but lack of association with schizophrenia.
Neurosci Lett 372:1–5.
Locke DP, Archidiacono N, Misceo D, Cardone MF, Deschamps S, Roe B,
Rocchi M, Eichler EE. 2003. Refinement of a chimpanzee pericentric
inversion breakpoint to a segmental duplication cluster. Genome Biol
4:R50.
McGinnis RE, Fox H, Yates P, Cameron LA, Barnes MR, Gray IC, Spurr NK,
Hurko O, St Clair D. 2001. Failure to confirm NOTCH4 association with
schizophrenia in a large population-based sample from Scotland. Nat
Genet 28:128–129.
575
Neves-Pereira M, Bassett AS, Honer WG, Lang D, King NA, Kennedy JL.
1998. No evidence for linkage of the CHRNA7 gene region in Canadian
schizophrenia families. Am J Med Genet (Neuropsychiatr Genet)
81:361–363.
Neves-Pereira M, Cheung JK, Pasdar A, Zhang F, Breen G, Yates P, Sinclair
M, Crombie C, Walker N, St Clair DM. 2005. BDNF gene is a risk factor
for schizophrenia in a Scottish population. Mol Psychiatry 10:208–
212.
Raux G, Bonnet-Brilhault F, Louchart S, Houy E, Gantier R, Levillain D,
Allio G, Haouzir S, Petit M, Martinez M, Frebourg T, Thibaut F,
Campion D. 2002. The -2 bp deletion in exon 6 of the ‘alpha 7-like’
nicotinic receptor subunit gene is a risk factor for the P50 sensory gating
deficit. Mol Psychiatry 7:1006–1011.
Riley BP, Makoff A, Mogudi-Carter M, Jenkins T, Williamson R, Collier D,
Murray R. 2000. Haplotype transmission disequilibrium and evidence
for linkage of the CHRNA7 gene region to schizophrenia in Southern
African Bantu families. Am J Med Genet (Neuropsychiatr Genet)
96:196–201.
Riley B, Williamson M, Collier D, Wilkie H, Makoff A. 2002. A 3-Mb map of a
large segmental duplication overlapping the alpha7-nicotinic acetylcholine receptor gene (CHRNA7) at human 15q13-q14. Genomics 79:197–
209.
Stassen HH, Bridler R, Hagele S, Hergersberg M, Mehmann B, Schinzel A,
Weisbrod M, Scharfetter C. 2000. Schizophrenia and smoking: Evidence
for a common neurobiological basis? Am J Med Genet (Neuropsychiatr
Genet) 96:173–177.
Stefansson H, Sarginson J, Kong A, Yates P, Steinthorsdottir V, Gudfinnsson E, Gunnarsdottir S, Walker N, Petursson H, Crombie C, Ingason A,
Gulcher JR, Stefansson K, St Clair D. 2003. Association of neuregulin 1
with schizophrenia confirmed in a Scottish population. Am J Hum Genet
72:83–87.
Meyer J, Ortega G, Schraut K, Nurnberg G, Ruschendorf F, Saar K, Mossner
R, Wienker TF, Reis A, Stober G, Lesch KP. 2002. Exclusion of the
neuronal nicotinic acetylcholine receptor alpha7 subunit gene as a
candidate for catatonic schizophrenia in a large family supporting the
chromosome 15q13-22 locus. Mol Psychiatry 7:220–223.
Taske NL, Williamson MP, Makoff A, Bate L, Curtis D, Kerr M, Kjeldsen MJ,
Pang KA, Sundqvist A, Friis ML, Chadwick D, Richens A, Covanis A,
Santos M, Arzimanoglou A, Panayiotopoulos CP, Whitehouse WP, Rees
M, Gardiner RM. 2002. Evaluation of the positional candidate gene
CHRNA7 at the juvenile myoclonic epilepsy locus (EJM2) on chromosome 15q13-14. Epilepsy Res 49:157–172.
Neubauer BA, Fiedler B, Himmelein B, Kampfer F, Lassker U, Schwabe G,
Spanier I, Tams D, Bretscher C, Moldenhauer K, Kurlemann G, Weise S,
Tedroff K, Eeg-Olofsson O, Wadelius C, Stephani U. 1998. Centrotemporal spikes in families with rolandic epilepsy: Linkage to chromosome
15q14. Neurology 51:1608–1612.
Turecki G, Grof P, Grof E, D’Souza V, Lebuis L, Marineau C, Cavazzoni P,
Duffy A, Betard C, Zvolsky P, Robertson C, Brewer C, Hudson TJ,
Rouleau GA, Alda M. 2001. Mapping susceptibility genes for bipolar
disorder: A pharmacogenetic approach based on excellent response to
lithium. Mol Psychiatry 6:570–578.
Документ
Категория
Без категории
Просмотров
1
Размер файла
72 Кб
Теги
2bp, chrfam7a, associations, polymorphism, affective, stud, disorder, number, bipolar, deletion, schizophrenia
1/--страниц
Пожаловаться на содержимое документа