close

Вход

Забыли?

вход по аккаунту

?

Association study of the adrenergic receptors and childhood-onset mood disorders in Hungarian families.

код для вставкиСкачать
American Journal of Medical Genetics Part B (Neuropsychiatric Genetics) 141B:227 –233 (2006)
Association Study of the Adrenergic Receptors and
Childhood-Onset Mood Disorders in Hungarian Families
I. Burcescu,1 K. Wigg,1 L. Gomez,1 N. King,2 Á. Vetró,3 E. Kiss,3 K. Kapornai,3 J. Gádoros,4
J.L. Kennedy,2 M. Kovacs,5 C.L. Barr1,6* and The International Consortium for
Childhood-Onset Mood Disorders
1
Toronto Western Research Institute, University Health Network, Toronto, Ontario, Canada
Neurogenetics Section, Centre for Addiction and Mental Health, Toronto, Ontario, Canada
3
Department for Child and Adolescent Psychiatry, Szeged University, Szeged, Hungary
4
Vadaskert Hospital, Budapest, Hungary
5
University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania
6
The Hospital for Sick Children, Toronto, Ontario, Canada
2
The adrenergic system has been implicated in the
etiology of depression based on a number of lines
of evidence, particularly, the mechanism of some
classes of antidepressants which increase the
synaptic levels of norepinephrine. Further, several genome scans for mood disorders, both
unipolar and bipolar, have indicated linkage to
the chromosomal regions of 5q23–q33.3, 8p12–
p11.2, 4p16, and 10q24–q26, the location of the
adrenergic receptors a1B (ADRA1B), b3 (ADRB3),
a2C (ADRA2C), a2A (ADRA2A), and b1 (ADRB1). In
this manuscript, we report on the relationship of
the adrenergic receptors and depression using a
family based association approach and 189
families (223 affected children) with childhoodonset mood disorder (COMD) collected in Hungary. We found no significant evidence for an
association with any of the 24 markers, in total,
tested across these genes using single marker
analysis or haplotypes of markers across these
genes. The results in the present sample indicate
that these nine genes are unlikely to be major
susceptibility genes contributing to COMD.
ß 2006 Wiley-Liss, Inc.
KEY WORDS:
adrenergic
receptors;
child;
depression; genetics; mood disorders; gene
INTRODUCTION
The adrenergic system has long been suggested to be
involved in mood disorders with the main line of evidence
stemming from the mechanisms of action of antidepressant
treatments that increase the synaptic levels of norepinephrine
Members are listed in the acknowledgements.
Grant sponsor: National Institute of Mental Health Program
Project grant; Grant number: MH 56193; Grant sponsor: National
Alliance for Research on Schizophrenia and Depression.
*Correspondence to: C.L. Barr, 399 Bathurst St., MP14-302,
Toronto Western Research Institute, University Health Network,
Toronto, Ontario, Canada. E-mail: CBarr@uhnres.utoronto.ca
Received 12 May 2005; Accepted 22 November 2005
DOI 10.1002/ajmg.b.30292
ß 2006 Wiley-Liss, Inc.
[Brunello et al., 2003]. Further, the adrenergic system
regulates key biological processes that are often dysregulated
in depression, sleep, learning, memory, attention, arousal, and
adaptation to stress [Ressler and Nemeroff, 2000]. While a
number of the antidepressants affect multiple monoamines, a
specific contribution of the adrenergic system can be deduced
from the efficacy of noradrenergic specific agents such as
Reboxetine, a selective noradrenaline reuptake inhibitor
[Wong et al., 2000]. After the initial increase in synaptic
monoamines through monoamine transporter blockade, or
receptor blockade, the exact mechanism by which antidepressants exert their effect is not clear. The synaptic levels of
the monoamines increase rapidly, however, the therapeutic
response is not seen for days or weeks after the beginning of
treatment, indicating a more complicated mechanism than the
simple increase in monoamine levels.
Several other lines of evidence suggest a dysregulation of the
adrenergic system in depression. These include alterations in
platelet a2-adrenergic receptor binding, upregulation of badrenoreceptors, decreased cAMP response to b-adrenergic
agonists, and blunted response in growth hormone secretion to
the a2-agonist clonidine [Leonard, 1997; Schatzberg, 1998].
However, these findings have not always been consistent
across studies leading to speculation of biologically subtypes
[Charney, 1998]. The most convincing evidence for biological
subtypes related to the adrenergic system comes from monoamine depletion studies. Depletion of noradrenaline results in
relapse in individuals with a history of depression [Berman
et al., 1999]. There are also indications that relapse in response
to catecholamine depletion is specific to individuals that
respond to noradrenergic antidepressants, but not to individuals that respond to serotonergic agents [Delgado and
Moreno, 2000]. Further, monoamine depletion does not appear
to affect individuals without a previous depressive episode, or
without a family history of depression, indicating that this
differential response is based on an underlying biological
vulnerability with different biological mechanisms [Delgado
and Moreno, 2000].
The location of six of the adrenergic receptors in regions
identified as linked to mood disorders, also points to these
particular genes as potential risk factors for mood disorders.
Four adrenergic receptors are located in chromosomal regions
identified in a genome scan of families with recurrent (2
episodes), early onset (onset age 25) major depressive
disorders [Zubenko et al., 2003]. These are the adrenergic
receptors; a1B (ADRA1B) located on 5q23–q33.3, b3 (ADRB3)
located on 8p12–p11.2, and a2A (ADRA2A) and b1 (ADRB1)
both located on 10q24–q26. The location of the adrenergic
receptors a1A (ADRA1A, formerly ADRA1C) on 8p21.2 [Cichon
228
Burcescu et al.
TABLE I. Markers Genotyped by Taqman Assays on-Demand
Gene
Marker
ADRA1A
rs1383914
rs544215
rs527340
rs2055197
rs3739215
rs1019920
rs2030373
rs10515805
rs11743363
rs13171967
rs11953285
rs11739589
rs1886844
rs946188
rs835878
rs734290
rs638019
rs1168965
rs13019188
rs11957757
ADRA1B
ADRA1D
ADRA2A
ADRA2B
ADRB2
DNA variant
C!T
A!G
C!T
A!T
C!G
A!C
A!C
A!G
C!G
G!T
A!C
G!T
G!T
A!G
A!G
C!T
A!G
C!G
A!G
A!G
Flanking sequence
TGCTCCTGGCCCGCAGTTACCTACA[C/T]TTTGAGCTGCCCCACCGAAGGCTCC
TCCATGAGAGCCACCATACCTGTTA[A/G]TGTGGCAGCCAGTGTGGTGGGGTAG
CTGCAGCGCCCATTGCACGGGTGCA[C/T]GATCACATGTATGTATATTAGTAAA
TCTGTGCAAAAACCATGTTTTTTCC[A/T]TCTTCGACATTCTCATGCCTGCTTC
GAACGAAGGGGATTTTGTTTTGCAG[C/G]GTGATTTTCATGTCTATGAATGTTC
TCCCCTCCCTGACCTCTGCCTTACT[A/C]AGGAGCCTGGTCACATTCTGTTCTC
CACAATAAAAAGTGAGAGGTTCTTG[A/C]CACCTTGATGCTATCTTGTTTCTCT
CTTCAAGGCTGCACCTGGCTTCAAA[A/G]AGGAAAAATGAACTACAGGCATCTG
TCCGATAACTTTATGGGGACCTCTT[C/G]GGTACTGTCAGTCTTTACACACAGG
AGAGGGGGCAGAGATGATGACCCTT[G/T]TAGCTCCTCCCTGCAAGTCAGCCCC
CCTCATCCTCTTCACCACCTTCTTC[A/C]TCTTGGTAGCAGTGGTACTGGTGGT
GGGTGGCCCACTGGAGTCCTCACTT[G/T]GTGAGACCCCAGTGTCAGGCTCCAT
TTTCTGATGGAAGAGGTTTGAGTGT[G/T]TTTATAAGCTTTGAGAAAAGATTCA
AACGGCCCTAACCTTGGAGCTCAGT[A/G]GCAGCCTTCCCCAGGAGAGGCTGGG
AACATTAATATGGTAATTTATGCTC[A/G]ACCAACCTGAAGTCTGCTGTGAGCT
AGCCCAGAACCTGCTGTAGACTCAC[C/T]GTGTGAAATGTCTGCTCCAAGCCCT
TAGAAAACACCTGGCTTAATTTTCC[A/G]GGCTGGGGCAGGATGGGTTAGCACG
GCATCTTCAAGAGAACAAGATCGGA[C/G]ACCAAGAGACAAATCCCAATGG
GCTGTGTTTAACCCTTGGCTCCCCA[A/G]CAATTGACTGGGGAATCCAAGCAGT
ATATTTGTACAAATCTAGGTTTTTT[A/G]TACACTTCCATATGATTGCTTAAAT
et al., 2001] and a2C (ADRA2C) located on 4p16 [Blackwood
et al., 1996; Ewald et al., 2002] were identified in independent
genome scans for bipolar disorder. As well as supported by the
genome scan of recurrent, early-onset depression [Zubenko
et al., 2003], the 10q24–q26 region was also identified in
independent genome scan studies of bipolar disorder [Cichon
et al., 2001; Kelsoe et al., 2001; Ewald et al., 2002].
Given substantial evidence of the role of the adrenergic
system in depression, several of the receptors genes have been
tested in linkage and association studies of mood disorders.
Early studies used a linkage approach and large, multigenerational families. No evidence for linkage was found for
the ADRA2C [Wang et al., 1992; Byerley et al., 1994] or
ADRA2A receptor genes [Wang et al., 1992]. However, linkage
studies, particularly those using a limited number of multigenerational families, have low power to detect genes of minor
effect and therefore their results cannot be conclusive. Using
an association study, three of the adrenergic receptors,
ADRA1C (ADRA1A), ADRA2A, and ADRA2C, were tested for
association to bipolar I disorder in a sample of 120 German
families and no evidence for association was found [Abou
Jamra et al., 2004]. The ADRA2A gene was also investigated in
a case-control (103 cases and 114 controls) study of mood
disorder patients that found no evidence for an association
[Ohara et al., 1998]. The ADRB1 gene was investigated as a
candidate for mood disorders using a functional polymorphism,
Gly389Arg, in 259 patients and 206 controls; however, no
evidence for association was observed [Zill et al., 2003]. These
association studies used only one polymorphism in each of the
genes and therefore these studies would have limited power to
detect an association.
Based on strong biological evidence implicating the adrenergic system in depression, as well as the location of six of the
receptors as positional candidates based on genome scans, we
TABLE II. Markers Genotyped by Taqman Assays-by-Design
Gene
Marker
DNA variant
ADRA1B
rs3729604
G!A
ADRA2A
rs553668
A!G
rs1800544
G!C
rs2429511
G!A
rs18011252
A!G
rs2183378
G!A
rs1042718
C!A
rs1042717
G!A
rs1042719
G!C
rs4994
T!C
rs4998
C!G
ADRB1
ADRB2
ADRB3
Primers
F: CTTGTCCACCGTCATCTCCAT
R: CCGCACTCCTTGTCATCGTT
F: CAGGGCTGCCCTTAGCATT
R: TAATTCCCCTTCCATTCCCAACT
F: GTGCCCGTTGCGTTCTG
R: TGGGAGTTGGCCATGCA
F: CCAATCCCTTGGCTATTTTGAGACT
R: GATTAGAGGCATGAGCCACTGT
F: CCGCCCGCCTCGTT
R: CGCTGTCCACTGCTGAGA
F: TTGTTAAGCACATTTTCCTAGCTTATGTT
R: TGCAGAATTTCTGTCTGGCAATTT
F: CCTTCTTGCCCATTCAGATGCA
R: GCATAGCAGTTGATGGCTTCCT
F: ACTGGCCTGTGCTGATCTG
R: TGGGCGGCCCCAAAG
F: GCCTTCCAGGAGCTTCTGT
R: ACTCTGCTCCCCTGTGTTG
F: GTTGGTCATGGTCTGGAGTCT
R: GCAACCTGCTGGTCATCGT
F: TGAACTTCACTCCTCCCTCAGT
R: GGGTGCCCCTACCAAAGC
Probes
VIC: CTCTCCTTGGgTGGAAG
FAM: TCTCCTTGGaTGGAAG
VIC: CTCTCTCTCTTTTTaAAGAAA
FAM: TCTCTCTTTTTgAAGAAA
VIC: CCGTCGGCCCgGAG
FAM: CCGTCGGCCCcGAG
VIC: CTTCTGGACCCaCAAGG
FAM: TCTGGACCCgCAAGG
VIC: CCAGCGAAaGCCCCGA
FAM: CAGCGAAgGCCCCGA
VIC: CAGAGGAACgGGCACA
FAM: CAGAGGAACaGGCACA
VIC: CTGGTACcGGGCCAC
FAM: CTGGTACaGGGCCAC
VIC: CATGGGCCTgGCAGT
FAM: TCATGGGCCTaGCAGT
VIC: CCTATGGgAATGGCT
FAM: CTATGGcAATGGCT
VIC: CATCGCCtGGACTC
FAM: ATCGCCcGGACTC
VIC: CACGGCAcCTGGACA
FAM: ACGGCAgCTGGACA
Association of Adrenergic Receptor Genes and Childhood-Onset Mood Disorders
229
TABLE III. Categorical Analysis of the Markers Genotyped for the Adrenergic Genes
Gene
Location
50
rs1383914
Intron
rs544215
Intron
rs527340
Intron
rs2055197
Exon
30
rs1048101
Arg347Cys
rs3739215
50
rs1019920
Exon
rs3729604
Intron
rs2030373
Intron
rs10515805
Intron
rs11743363
Intron
rs13171967
Intron
rs11953285
30
rs11739589
ADRA1A
ADRA1B
ADRA1D
3
0
rs946188
Intron
rs835878
50
rs1886844
5
0
rs1800544
3 UTR
rs553668
50
rs1168965
3
ADRB1
0
30 UTR
5
0
Exon
ADRB2
ADRB3
rs638019
50
0
ADRA2C
rs734290
Intron
ADRA2A
ADRA2B
Marker
rs13019188
rs11269124
rs2429511
30
rs1801252
Gly49Ser
rs2183378
30
rs11957757
Exon
rs1042719
Exon
rs1042718
Exon
rs1042717
Exon
rs4994
Arg64Trp
rs4998
30 UTR
Allele
Allele frequency
T
C
G
A
C
T
T
A
T
C
G
C
A
C
G
A
C
A
G
A
G
C
G
T
A
C
G
T
C
T
A
G
A
G
G
T
G
A
C
G
G
A
G
A
G
C
Ins
Del
G
A
A
G
G
A
G
A
G
C
C
A
G
A
T
C
C
G
0.561
0.439
0.485
0.515
0.690
0.310
0.552
0.448
0.541
0.459
0.545
0.455
0.663
0.337
0.841
0.159
0.763
0.237
0.815
0.185
0.827
0.173
0.766
0.234
0.872
0.128
0.752
0.248
0.742
0.258
0.751
0.249
0.575
0.425
0.689
0.311
0.747
0.253
0.742
0.258
0.827
0.173
0.631
0.369
0.670
0.330
0.865
0.135
0.525
0.475
0.858
0.142
0.862
0.138
0.604
0.396
0.657
0.343
0.811
0.189
0.772
0.228
0.919
0.081
0.923
0.077
Transmission
94
83
86
86
75
82
88
89
88
87
88
87
75
94
40
58
56
76
49
67
45
63
61
71
40
39
59
75
71
57
57
69
75
76
71
65
74
55
68
58
49
45
71
70
78
72
40
38
87
95
44
39
44
42
74
98
68
80
49
66
57
64
30
19
28
19
Non-transmission
83
94
86
86
82
75
89
88
87
88
87
88
94
75
58
40
76
56
67
49
63
45
71
61
39
40
75
59
57
75
69
57
76
75
65
71
55
74
58
68
45
49
70
71
72
78
38
40
95
87
39
44
42
44
98
74
80
68
66
49
64
57
19
30
19
28
w2
P-value
0.684
0.408
0.000
1.000
0.312
0.577
0.006
0.938
0.006
0.938
0.006
0.938
2.136
0.144
3.306
0.069
3.030
0.082
2.793
0.095
3.000
0.083
0.758
0.384
0.013
0.909
1.910
0.167
1.531
0.216
1.143
0.285
0.007
0.933
0.265
0.607
2.798
0.094
0.794
0.373
0.170
0.680
0.240
0.624
0.007
0.933
0.051
0.821
0.352
0.553
0.301
0.583
0.047
0.828
3.349
0.067
0.973
0.324
2.513
0.113
0.405
0.525
2.469
0.116
1.723
0.189
230
Burcescu et al.
investigated these genes as risk factors for childhood-onset
mood disorder (COMD). We used a sample of 189 nuclear
families (189 probands and 34 affected siblings) identified
through a proband with onset of depression by 14 years of age.
As well as the six genes specifically identified in the genome
scans of mood disorders listed above, we investigated the genes
for the adrenergic receptors a1D (ADRA1D) on 20p13, a2B
(ADRA2B) on 2p13–q13, and b2 (ADRB2) on 5q32.
METHODS
Subjects
This genetics study was conducted as part of a multidisciplinary Program Project of research on multiple risk
factors in COMD. The families have been previously described
in detail [Adams et al., 2005]. Our sample consisted of 189
families with 223 affected children recruited from 21 mental
health facilities across Hungary. The probands met DSM-IV
criteria for either unipolar major depression or bipolar
disorder, with the onset of the first episode by age 14. The
Psychiatric Interview Schedule for Children and AdolescentsDiagnostic Version (ISCA-D), an extension and modification of
the ISCA [Sherrill and Kovacs, 2000] was used for the
diagnoses. Proband and parent informants were separately
interviewed on two occasions, approximately 1 month apart, by
trained clinicians. Consensus diagnosis of two independent
child psychiatrists was used as the final diagnosis.
Genotyping
DNA was extracted from blood using a high salt method
[Miller et al., 1988]. To genotype the Cys492Arg polymorphism
of ADRA1A, (rs1048101) we amplified a 501 bp fragment using
a reaction mixture of 100 ng of genomic DNA, the primers
ADRA1A-Pst1 (50 atg ctc cag cca aga gtt ca 30 ) and ADRA1APst2 (50 tcc aag aag agc tgg cct tc 30 ), 1.5 mM MgCl2, and 1 unit of
Taq polymerase [Shibata et al., 1996]. The polymerase chain
reaction (PCR) reaction consisted of an initial denaturation
stage of 4 min at 948C followed by 35 cycles of denaturing at
948C for 30 sec, annealing at 588C for 30 sec, and an extension of
728C for 30 sec. A final extension step of 728C was added for
10 min after the last cycle. To detect the polymorphism, 10 ml of
the PCR product was digested with 8 U of PstI restriction
enzyme (New England Biolabs, Beverly MA) for approximately
2 hr at 378C. The alleles were separated on a 2% agarose gel.
Allele 1 (C, Cys492) was not cut with the restriction enzyme
and was seen as a 501 bp band. Allele 2 (T, Arg492) was cut into
two bands of 442 and 58 bp. The ADRA2C insertion/deletion
polymorphism was genotyped using the following primers:
ADRA2C-indelF: cgg tct tca acc agg att tc and ADRA2C-indelR:
tct ctc tgc caa gct cct g. The alleles were separated on a 3%
agarose gel. The insertion and deletion alleles yield fragments
of 249 bp and 228 bp, respectively.
The remaining polymorphisms were genotyped using the
TaqMan1 50 nuclease assay with primers and probes available
commercially (Table I, Applied Biosystems, Foster, CA, Assay
by Demand) or designed specifically for this study (Table II,
Applied Biosystems, Assay by Design). The reference sequence
for Assays by Demand or the primers and probes for Assay by
Design are listed in the Tables I and II, respectively. Five
microliters of PCR reactions contained 30 ng of genomic DNA,
5 mmol of TaqMan1 Universal PCR Master Mix (Applied
Biosystems), and 0.125 ml of allelic discrimination mix which
contained 18 mM of each primer and 4 mM of each probe. The
thermal cycling conditions for the Assays-on-Demand1
obtained from Applied Biosystems were 958C for 10 min, then
50 cycles of 928C for 15 sec and 1 min at the annealing
temperature of 608C. Two negative controls were included
within each 96-well plate. Plates were read on the ABI 7900HT Sequence Detection System using the allelic discrimination end-point analysis mode of the software package version
2.0 (Applied Biosystems).
Statistical Analysis
The extended TDT (ETDT) program [Sham and Curtis,
1995] was used to test for biased transmission of alleles for
single markers and the transmission of haplotypes were
analyzed using the TRANSMIT program [Clayton, 1999].
The robust estimator option was used for the TRANSMIT
analysis, and only haplotypes with frequencies greater than
0.10 were used. The degree of linkage disequilibrium (LD)
between marker alleles in this study was evaluated using
Haploview v3.11 (http://www.broad.mit.edu/mpg/haploview)
[Barrett et al., 2005].
RESULTS
We genotyped in total 24 markers across the adrenergic
receptor genes. We targeted polymorphisms that had been
confirmed with known allele frequencies at the time we began
the study. The adrenergic receptors are encoded by relatively
small genes with either one or two exons. We chose markers
that covered the coding region as well as the 50 and 30 regions
wherever possible. We designed assays to test a number of
unconfirmed polymorphisms to improve our coverage of the
genes when necessary. Of these unconfirmed polymorphisms
tested, two were not polymorphic in our sample. We examined
data from the HapMap project (http://www.hapmap.org/) to
determine the coverage of the genes by the markers we
selected. Several of the genes, ADRA2A, ADRA2B, ADRA2C,
ADRB1, and ADRB2, are contained within a single LD block.
For the remaining genes, we genotyped at least one marker in
TABLE IV. Haplotype Analysis of the ADRA1B Gene
Haplotype
Haplotype frequency
Observed
Expected
Var (O–E) Chisq (1 df)
ADRA1B-rs1019920, rs3729604, rs2030373
AGC
0.648
287.94
288.12
52.948
CGC
0.114
48.043
49.222
21.969
CAA
0.143
66.984
61.647
25.799
Global chisquared test, on 6 degrees of freedom ¼ 5.854, P ¼ 0.440
Chi-squared test on 3 degrees of freedom ¼ 1.846, P ¼ 0.605
ADRA1B-rs11743363, rs13171967, rs11953285
CGA
0.668
288.4
288.74
45.388
GTA
0.137
58.565
57.197
24.571
Global chisquared test, on 7 degrees of freedom ¼ 6.026, P ¼ 0.537
Chi-squared test on 2 degrees of freedom ¼ 0.093, P ¼ 0.955
P-value
0.001
0.063
1.104
0.980
0.802
0.401
0.003
0.076
0.959
0.480
Association of Adrenergic Receptor Genes and Childhood-Onset Mood Disorders
231
TABLE V. Haplotype Analysis of the ADRB2 Gene
Haplotype
Haplotype frequency
Observed
Var
(O–E)
Chisq
(1 df)
P-value
39.901
42.895
17.688
6.082
1.305
0.706
0.014
0.253
0.401
Expected
ADRB2-rs11957757, rs1042719, rs1042718, rs1042717
GGCG
0.351
125.24
140.82
AGCG
0.304
129.76
122.27
GCCG
0.118
49.835
46.3
Global chisquared test, on 9 degrees of freedom ¼ 16.344, P ¼ 0.060.
Chisquared test on 3 degrees of freedom ¼ 6.278, P ¼ 0.099.
TABLE VI. Linkage Disequilibrium Between Markers
ADRA1A
rs1383914
rs1383914
rs544215
rs527340
rs2055197
rs1048101
rs3739215
0.07
0.00
0.01
0.00
0.01
rs544215
0.29
0.48
0.00
0.00
0.00
rs527340
0.09
0.98
0.00
0.00
0.00
rs2055197
0.09
0.05
0.01
rs1048101
0.08
0.03
0.02
0.91
0.79
0.77
rs3739215
0.10
0.04
0.02
0.89
1.00
0.98
ADRA1B
rs1019920
rs1019920
rs3729604
rs2030373
rs10515805
rs11743363
rs13171967
rs11953285
rs11739589
0.35
0.50
0.05
0.04
0.07
0.01
0.01
rs3729604
0.96
0.54
0.03
0.03
0.04
0.01
0.00
rs2030373
0.90
0.93
0.01
0.01
0.01
0.01
0.00
rs10515805
0.34
0.82
0.12
rs11743363
0.31
0.94
0.13
1.00
0.92
0.55
0.00
0.00
ADRA1D
rs1886844
rs1886844
rs946188
rs835878
rs734290
0.04
0.03
0.00
rs946188
0.63
0.24
0.09
rs835878
0.28
0.98
rs734290
0.16
0.79
0.43
0.11
ADRA2A
rs638019
rs638019
rs1800544
rs553668
0.93
0.91
rs1800544
0.97
rs553668
0.97
0.98
0.92
ADRA2B
rs1168965
rs1168965
rs13019188
rs13019188
0.99
0.83
ADRB1
rs2429511
rs2429511
rs1801252
rs2183378
0.15
0.14
rs1801252
1.00
rs2183378
0.98
0.99
0.94
ADRB2
rs11957757
rs11957757
rs1042719
rs1042718
rs1042717
0.03
0.00
0.00
rs1042719
0.27
0.37
0.46
rs1042718
0.08
0.91
rs1042717
0.01
0.92
0.99
0.81
ADRB3
rs4994
rs4994
rs4998
rs4998
0.98
0.91
D0 values are shown in the upper half of the table, r2 values in the lower half of the table.
0.61
0.00
0.00
rs13171967
0.33
0.84
0.12
0.86
0.95
0.00
0.00
rs11953285
0.38
0.54
0.45
0.05
0.05
0.05
0.05
rs11739589
0.09
0.08
0.01
0.01
0.02
0.00
0.33
232
Burcescu et al.
each LD block and additional markers flanking the blocks. For
the ADRA2C gene, only one polymorphism was genotyped, an
insertion/deletion located in the 30 untranslated region.
Currently there is only one other confirmed polymorphism
for this gene with a minor allele frequency of 0.09, and thus too
low to be sufficiently informative for an association study.
ADRA2C is very small (2,826 bp) and the coding region is
contained in a single exon. For three genes, ADRA1A, ADRB1,
and ADRB3, we genotyped nonsynonymous SNPs that had
minor allele frequencies sufficiently polymorphic to be informative in the analyses. For the ADRA1A gene, we genotyped a
polymorphism (rs1048101) that results in a nonsynonymous
amino acid change (cysteine to arginine) at codon 492 [Shibata
et al., 1996]. This amino acid variation is unlikely to cause a
change in phenotype, since no differences in receptor function
were observed between the two protein variants [Shibata et al.,
1996].
The results of the TDT analysis for the markers used in this
study are shown in Table III. We did not observe significant
evidence for association for any of the markers. We did observe
trends for biased transmission (w2 > 3) for three of the markers
located in the ADRA1B gene and one marker in the ADRB2
gene, however, given the number of tests involved in this study,
these are likely to be the result of chance. To investigate these
results further, an analysis of the haplotypes was performed.
For the ADRA1B gene, the haplotype analysis was performed
for the markers that were in strong linkage disequilibrium,
the first block contained markers rs1019920, rs3729604,
and rs2030373. The second block contained rs11743363,
rs13171967, and rs11953285 (Table IV). The analysis did not
provide significant evidence for association and therefore did
not provide additional support for the trends identified for the
three markers with the single point analysis. For the ADRB2
gene, the GGCG haplotype (see Table V) for the four markers
that were genotyped showed significant evidence of association
(w2 ¼ 6.082, 1d.f., P ¼ 0.014), however, the global analysis was
not significant (w2 ¼ 16.344, 9 d.f. P ¼ 0.06). Our analysis of
haplotypes for the other six genes did not provide significant
evidence for association (data not shown). The linkage
disequilibrium between the markers was estimated using
Haploview, these results are shown in Table VI.
DISCUSSION
Despite strong biological evidence supporting the adrenergic
system in depression, and the evidence from genome scans
supporting the location of six of the genes as contributing to
mood disorders, we found no significant evidence for association with 24 markers for the 9 adrenergic receptors in this
sample of Hungarian families. This is the first association
study to investigate five of the adrenergic receptor genes and
mood disorders and this sample is the largest to be used in an
association study for the ADRA1A, ADRA2A, ADRA2C, and
ADRB1 genes that have been previously tested for association.
Therefore, this is the most comprehensive test of the
adrenergic receptors and mood disorders to date.
Power is always an issue in association studies. The previous
results from the genome scans for bipolar disorder and earlyonset recurrent depression indicate that if there are susceptibility genes in these regions, they must have a major effect to
be identified using a linkage approach. An association study
should have much more power than a linkage approach if the
marker that is chosen is in LD with the risk allele [Risch and
Merikangas, 1996]. Of course there is no way to determine this
until the risk alleles are identified. However, our use of
multiple markers across eight of the nine genes, and the use of
haplotypes, maximized the possibility that we would detect LD
with any potential risk alleles and subsequently increased the
power of our search. Power is also affected by the mode of
inheritance and the mechanism by which genes contribute to
the susceptibility. Risk genes with more complex modes of
inheritance that involve gene by gene or gene–environment
interactions would likely have low power to be detected in this
sample, and cannot be ruled out at this time. The trend for
association for some of these genes may reflect true association
with a complex mode of inheritance and we will pursue these
findings as the sample size increases.
Genetic alteration in the adrenergic receptors could contribute to depression by increasing presynaptic a2-autoreceptor activity resulting in decreased release of norepinephrine or
reduced sensitivity of the postsynaptic receptors. Our failure to
find significant association with the receptor genes suggest
that genetic changes in the receptors themselves may not be
the contributing factor. We cannot rule out other mechanisms
influencing the adrenergic system such as a decrease of
release, or production of norephinephrine, increased catabolism or intracellular response such as changes in second
messengers. Genes contributing to these mechanisms are also
likely candidates and the focus of our continued research.
ACKNOWLEDGMENTS
Members of the International Consortium for ChildhoodOnset Mood Disorders: István Benák, Viola Kothencné
Osváth, Edit Dombovári, Emı́lia Kaczvinszky, and László
Mayer; Department of Child and Adolescent Psychiatry,
Szeged University Medical Faculty, Szeged. Júlia Gádoros,
Ildikó Baji, Zsuzsa Tamás, Márta Besnyö; Vadaskert Hospital,
Budapest. Judit Székely; Department of Pediatrics, Semmelweis University I., Budapest.
Heads of the Units and Departments where the patients
were collected and collaborators: Rózsa Hasuly, M.D.; Outpatient Unit of Child Psychiatry, Szent Rókus Hospital,
Budapest. Ilona Riegler, M.D., Márta Fohn, M.D.; Outpatient
Unit of Child Psychiatry, Heim Pál Hospital, Budapest.
Katalin Benkö, M.D.; Outpatient Unit of Child Psychiatry,
Szeged. Mária Mojzes, M.D.; Outpatient Unit of Child
Psychiatry, Baja. Róza Oláh, M.D.; Department of Child and
Adolescent Psychiatry, Kenézy Gyula Hospital, Debrecen.
Mária Károlyfalvi, M.D., Gyöngyi Farkas, M.D., Zsuzsa Bánk,
M.D.; Outpatient Unit of Child Psychiatry, Debrecen. Ferenc
Dicsö, M.D., Dénes Kövendy, M.D.; Outpatient Unit of Child
Psychiatry, Jósa András Hospital, Nyı́regyháza. Mária
Gyurcsó, M.D.; Outpatient Unit of Child Psychiatry, Petz
Aladár Hospital, Györ. Zsuzsanna Fekete, M.D., Mariann
Vados, M.D.; Outpatient Unit of Child Psychiatry, Szent
György Hospital, Székesfehérvár. Zsuzsa Takács, M.D.; Outpatient Unit of Child Psychiatry, Szekszárd Hospital, Szekszárd. Eszter Gyenge, M.D., Mária Palaczky, M.D., Ágnes
Horváth, M.D., Outpatient Department of Child Psychiatry,
Pécs. Ilona Mógor, M.D., Péter Steiner, M.D.; Outpatient Unit
of Child Psychiatry, Csolnoky Ferenc Hospital, Veszprém.
Enikö Juhász; Outpatient Unit of Child Psychiatry, Szolnok
Hospital, Szolnok. Mária Révhelyi, M.D., Department of Child
and Adolescent Psychiatry, Petz Aladár Hospital, Györ. Éva
Gyulai, M.D.; Baja Hospital Outpatient Unit of Child Psychiatry, Baja. Katalin Bense, M.D., Edina Farkas, M.D.; Outpatient Unit of Child Psychiatry, Kecskemét Hospital,
Kecskemét. Sörfözö Zsuzsanna, M.D.; Outpatient Unit of
Child Psychiatry, Kaposi Mór Hospital, Kaposvár. Magdolna
Gácser; Department for Child and Adolescent Psychiatry,
Kálmán Pándy Hospital, Gyula. Emöke Endreffy Ph.D.;
Szeged University Pediatric Department. Interviewers: Judit
Tömöri, Tünde Horváth M., Eszter Szamosi, Laura Német.
Regional research office members: Edit Sitkei, Noémi Takács,
Erika Kolonics. Central research office members: Szilvia
Szabó Kelemenné, Zoltán Széll, Márta Dobó, and Éva
Lehoczky.
Association of Adrenergic Receptor Genes and Childhood-Onset Mood Disorders
REFERENCES
Abou Jamra R, Schumacher J, Golla A, Richter C, Otte AC, Schulze TG,
Ohlraun S, Maier W, Rietschel M, Cichon S, Propping P, Nothen MM.
2004. Family-based association studies of alpha-adrenergic receptor
genes in chromosomal regions with linkage to bipolar affective disorder.
Am J Med Genet (Neuropsychiatr Genet) Part B 126B:79–81.
Adams JH, Wigg KG, King N, Burcescu I, Vetro A, Kiss E, Baji I, George CJ,
Kennedy JL, Kovacs M, Barr CL. 2005. Association study of neurotrophic tyrosine kinase receptor type 2 (NTRK2) and childhood-onset
mood disorders. Am J Med Genet (Neuropsychiatr Genet) Part B
132B:90–95.
Barrett JC, Fry B, Maller J, Daly MJ. 2005. Haploview: Analysis and
visualization of LD and haplotype maps. Bioinformatics 21(2):263–265.
Epub 2004 August 5.
Berman RM, Narasimhan M, Miller HL, Anand A, Cappiello A, Oren DA,
Heninger GR, Charney DS. 1999. Transient depressive relapse induced
by catecholamine depletion: Potential phenotypic vulnerability marker?
Arch Gen Psychiatry 56(5):395–403.
Blackwood DH, He L, Morris SW, McLean A, Whitton C, Thomson M,
Walker MT, Woodburn K, Sharp CM, Wright AF, Shibasaki Y, St. Clair
DM, Porteous DJ, Muir WJ. 1996. A locus for bipolar affective disorder on
chromosome 4p. Nat Genet 12(4):427–430.
Brunello N, Blier P, Judd LL, Mendlewicz J, Nelson CJ, Souery D, Zohar J,
Racagni G. 2003. Noradrenaline in mood and anxiety disorders: Basic
and clinical studies. Int Clin Psychopharmacol 18(4):191–202.
Byerley W, Hoff M, Holik J, Coon H. 1994. A linkage study with D5 dopamine
and alpha 2C-adrenergic receptor genes in six multiplex bipolar
pedigrees. Psychiatr Genet 4(3):121–124.
Charney DS. 1998. Monoamine dysfunction and the pathophysiology and
treatment of depression. J Clin Psychiatry 59(suppl 14):11–14.
Cichon S, Schumacher J, Muller DJ, Hurter M, Windemuth C, Strauch K,
Hemmer S, Schulze TG, Schmidt-Wolf G, Albus M, BorrmannHassenbach M, Franzek E, Lanczik M, Fritze J, Kreiner R, Reuner U,
Weigelt B, Minges J, Lichtermann D, Lerer B, Kanyas K, Baur MP,
Wienker TF, Maier W, Rietschel M, Propping P, Nothen MM. 2001. A
genome screen for genes predisposing to bipolar affective disorder detects a new susceptibility locus on 8q. Hum Mol Genet 10(25):2933–2944.
Clayton D. 1999. A generalization of the transmission/disequilibrium test for
uncertain-haplotype transmission. Am J Hum Genet 65(4):1170–1177.
Delgado PL, Moreno FA. 2000. Role of norepinephrine in depression. J Clin
Psychiatry 61(suppl 1):5–12.
Ewald H, Flint T, Kruse TA, Mors O. 2002. A genome-wide scan shows
significant linkage between bipolar disorder and chromosome 12q24.3
and suggestive linkage to chromosomes 1p22-21, 4p16, 6q14-22, 10q26
and 16p13.3. Mol Psychiatry 7(7):734–744.
Kelsoe JR, Spence MA, Loetscher E, Foguet M, Sadovnick AD, Remick RA,
Flodman P, Khristich J, Mroczkowski-Parker Z, Brown JL, Masser D,
233
Ungerleider S, Rapaport MH, Wishart WL, Luebbert H. 2001. A genome
survey indicates a possible susceptibility locus for bipolar disorder on
chromosome 22. Proc Natl Acad Sci USA 98(2):585–590. Epub 2001
January 9.
Leonard BE. 1997. Noradrenaline in basic models of depression. Eur
Neuropsychopharmacol 7(suppl 1):S11–S16; discussion S71-77.
Miller SA, Dykes DD, Polesky HF. 1988. A simple salting out procedure for
extracting DNA from human nucleated cells. Nucleic Acids Res
16(3):1215.
Ohara K, Nagai M, Tani K, Tsukamoto T, Suzuki Y. 1998. Polymorphism in
the promoter region of the alpha 2A adrenergic receptor gene and mood
disorders. Neuroreport 9(7):1291–1294.
Ressler KJ, Nemeroff CB. 2000. Role of serotonergic and noradrenergic
systems in the pathophysiology of depression and anxiety disorders.
Depress Anxiety 12(suppl 1):2–19.
Risch N, Merikangas K. 1996. The future of genetic studies of complex
human diseases. Science 273(5281):1516–1517.
Schatzberg AF. 1998. Noradrenergic versus serotonergic antidepressants:
Predictors of treatment response. J Clin Psychiatry 59(suppl 14):15–
18.
Sham PC, Curtis D. 1995. An extended transmission/disequilibrium test
(TDT) for multi-allele marker loci. Ann Hum Genet 59(Pt 3):323–
336.
Sherrill JT, Kovacs M. 2000. Interview schedule for children and adolescents
(ISCA). J Am Acad Child Adolesc Psychiatry 39(1):67–75.
Shibata K, Hirasawa A, Moriyama N, Kawabe K, Ogawa S, Tsujimoto G.
1996. Alpha 1a-adrenoceptor polymorphism: Pharmacological characterization and association with benign prostatic hypertrophy. Br J
Pharmacol 118(6):1403–1408.
Wang Z, Crowe RR, Tanna VL, Winokur G. 1992. Alpha 2 adrenergic
receptor subtypes in depression: A candidate gene study. J Affect Disord
25(3):191–196.
Wong EH, Sonders MS, Amara SG, Tinholt PM, Piercey MF, Hoffmann WP,
Hyslop DK, Franklin S, Porsolt RD, Bonsignori A, Carfagna N,
McArthur RA. 2000. Reboxetine: A pharmacologically potent, selective,
and specific norepinephrine reuptake inhibitor. Biol Psychiatry
47(9):818–829.
Zill P, Baghai TC, Engel R, Zwanzger P, Schule C, Minov C, Behrens S,
Bottlender R, Jager M, Rupprecht R, Moller HJ, Ackenheil M, Bondy B.
2003. Beta-1-adrenergic receptor gene in major depression: Influence on
antidepressant treatment response. Am J Med Genet (Neuropsychiatr
Genet) Part B 120B:85–89.
Zubenko GS, Maher B, Hughes HB, IIId, Zubenko WN, Stiffler JS, Kaplan
BB, Marazita ML. 2003. Genome-wide linkage survey for genetic loci
that influence the development of depressive disorders in families with
recurrent, early-onset, major depression. Am J Med Genet (Neuropsychiatr Genet) Part B 123B:1–18.
Документ
Категория
Без категории
Просмотров
4
Размер файла
82 Кб
Теги
associations, hungarian, stud, disorder, adrenergic, childhood, receptors, moody, onset, familie
1/--страниц
Пожаловаться на содержимое документа