close

Вход

Забыли?

вход по аккаунту

?

Automated sequence screening of the entire dystrophin cdna in Duchenne dystrophy Point mutation detection.

код для вставкиСкачать
American Journal of Medical Genetics Part B (Neuropsychiatric Genetics) 141B:44 – 50 (2006)
Automated Sequence Screening of the Entire Dystrophin
cDNA in Duchenne Dystrophy: Point Mutation Detection
Sherifa Ahmed Hamed* and Eric P. Hoffman
Research Center for Genetic Medicine, Children’s National Medical Center, George Washington University, Washington, DC
This is the first report of direct sequencing of the
complete 11 kb coding sequence of the dystrophin
gene affording high sensitivity for all types of
mutations of both coding sequence and splicing.
Direct automated capillary gel sequence analysis
of dystrophin reverse-transcribed polymerase
chain reaction (RT-PCR) products was carried
out in 15 Duchenne muscular dystrophy (DMD)
patient muscle biopsies (170,000 bp sequenced).
We identified mutations in 67% of patients tested
(10/15); including premature stop codons (n ¼ 5)
and small deletions/duplications (n ¼ 5). Mutation-negative patients (n ¼ 5) were also negative
for promoter mutations. All were tested for the
possibility of transcription abnormalities using
quantitative multiplex fluorescence polymerase
chain studies (QMF-PCR), however, equal ratios
of mRNA transcripts were identified at the 50 and 30
regions, with mild reduction in overall quantity,
suggesting that transcription abnormalities were
less likely. We suggested that such patients might
have a problem with the 3.5 kb 30 UTR, polyA site or
undetected stop codons. It is also possible that
splicing defects could result in addition of intron
sequence which could lead to preferential amplification of low level residual normal transcript
skipping.
ß 2005 Wiley-Liss, Inc.
KEY WORDS: Duchenne muscular dystrophy;
point
mutation;
automated
sequencing; quantitative multiplex polymerase chain reaction
INTRODUCTION
Duchenne muscular dystrophy (DMD) is the most common
childhood lethal disorder worldwide [Worton and Thompson,
1988]. The responsible gene and protein were the first to be
isolated by positional cloning in 1987 [Hoffman et al., 1987;
Grant sponsor: Egyptian Government (fellowship to SAH);
Grant sponsor: National Institute of Health (to EPH); Grant
number: 5RO1 NS29525.
*Correspondence to: Dr. Sherifa Ahmed Hamed, M.D., Neurology Consultant, Saudi German Hospital—Aseer, Khamis Mushayt, Saudia Arabia, P.O. Box 2553, Khamis Mushayt.
E-mail: hamed_sherifa@yahoo.com
Received 15 January 2005; Accepted 18 July 2005
DOI 10.1002/ajmg.b.30234
ß 2005 Wiley-Liss, Inc.
Koenig et al., 1987; Monaco et al., 1988]. The gene is
approximately 2.5 Mbp, and remains the only human megagene. There are multiple gene promoters and alternatively
spliced isoforms [Ahn and Kunkel, 1993], however, the fulllength 427 kDa dystrophin protein driven by the muscle
promoter appears the most critical for health.
Approximately 55% of DMD patients show deletion mutation of one or more exons of the gene [Koenig et al., 1987; den
Dunnen et al., 1989; Hoffman, 1993]. In families segregating
deletion mutation, prenatal diagnosis and identification of
female carriers is straightforward. Linkage analysis can be
done in non-deletion families, however, the high spontaneous
mutation rate, early death of patients, 10% intragenic recombination rate, and high rate of gonadal mosaicism in both sexes
serve to complicate interpretation of results [Oudet et al., 1992;
Saito et al., 1995; Hoffman, 1997]. To date many studies have
addressed the nature of non-deletion mutations in Duchenne
dystrophy. All have relied on a screening method that first
localize a potential mutation by electrophoretic shift of PCR,
reverse transcribed PCR product (RT-PCR), or protein fragment, then subsequent sequencing of the aberrant band.
Deletion testing of muscular dystrophy patients is done
routinely in hundreds of laboratories, however few, if any,
molecular diagnostic laboratories have attempted to implement routine point mutation screening. There have been many
issues hindering direct mutation detection in non-deletion
patients: (1) no mutation hot spots or frequently recurring
mutations have been identified to date, (2) use of genomic DNA
would require over 79 exon-specific amplifications per patient,
(3) use of RNA from either muscle biopsy or peripheral blood
cells reduces the number of PCR reactions needed, however
RNA is more problematic during work, and very low level of
dystrophin mRNA in peripheral blood requires nested PCR
which may induce artifacts, (4) methods of heteroduplex
analysis (HAD), single stranded conformation polymorphism
(SSCP) [Lenk et al., 1993; KeKou et al., 1999], or chemical
mismatch cleavage (CMC) [Roberts et al., 1992] are known to
be relatively insensitive, (5) the dystrophin gene has many
polymorphisms (http://www.dmd.nl/), hence, it can be difficult
to distinguish between a band shift from mutations versus
polymorphisms, and (6) protein truncation test (PTT) [Roest
et al., 1993], which seems the most sensitive method to date, is
technically challenging, requiring RNA isolation, complementary DNA (cDNA) production, multiple nested RT-PCR reactions, transcription-coupled translation reactions for each RTPCR product, and denaturing gradient gel electrophoresis
(DGGE), prior to any sequence analysis of potential mutationcontaining gene fragments [Tubiello et al., 1995].
We reasoned that direct sequencing of RT-PCR products
might afford the most sensitive and specific method of detecting non-deletion mutations. We also felt that relatively recent
advances in automated sequencing using capillary gel electrophoresis directly loaded from microliter plates of RT-PCR
reactions might make full sequence analysis of the 11 kb
dystrophin coding region technically and economically
feasible.
Point Mutation Detection
METHODS
This study included 15 unrelated DMD patients (from
different areas of the USA) tested negative for deletion
mutation of the dystrophin gene by either multiplex PCR or
Southern blot analysis. Muscle biopsies was the initial starting
material.
Sequence Analysis of Complete Coding
Sequence From Muscle Biopsy RNA
RNA was isolated from 25 mg of flash-frozen muscle biopsy
using guanidium isothiocynanate homogenization, followed by
precipitation of RNA through CsCl cushion [Ljunggren et al.,
1995]. Total RNA (500 ng) was reverse transcribed into
cDNA using oligo-dT and AMV reverse transcriptase. RT-PCR
reactions were done using 36 sets of primers designed against
the dystrophin coding sequence. Primer pairs were designed so
as to amplify 330–535 bp fragments (Table I). Fragments
typically overlapped by 50–100 bp. Common amplification
conditions were used for all primer sets (948C for 10 min,
35 cycles of 948C for 30 sec, 558C for 30 sec, 728C for 2 min, and
final extension of 728C for 10 min). RT-PCR products were
checked on 1.5% agarose gels, then purified using QIAquick
PCR purification kits (Qiagen, BD Biosciences Clontech,
Mountain View, CA), and sequenced by automated capillary
sequencing using 8 capillary bed machine using protocols
recommended by the manufacturer (Beckman-Coulter
CEQ2000, Fullerton, CA). Sequencing reactions were prepared
in 20 ml reaction using the DTS sequencing kits (Dye
Terminator Cycle sequencing Kits) (Beckman-Coulter). Each
RT-PCR product was sequenced in both directions, for a total of
72 sequencing reactions. Diluted templates were heated at
968C for 1 min as a hot start followed by 35 cycles of 968C for
20 sec, 508C for 20 sec, and 608C for 4 min. Sequencing PCR
products were purified using CENTRI-SEP as described by the
supplier (Princeton, Princeton, NJ), vacuum dried for 30–
45 min and then resuspended in 40 ml of deionized formamide.
Samples were run on Beckman-Coulter CEQ2000 8 channel
capillary electrophoresis and sequence data were compared to
the normal published dystrophin mRNA sequence. Nucleotide
changes were confirmed in genomic DNA of each patient by
amplification of the mutation-containing exon, using DNA
purified from peripheral blood or muscle biopsy [Pegoraro et al.,
1995].
In Mutation-Negative Patients
We sequenced the promoter region (535 bp) of the dystrophin
gene amplified from genomic DNA. This PCR product covers
from 433 bp from the transcription start site, through þ95 bp
in the first exon.
Quantitation of Dystrophin mRNA for
Mutation-Negative Patients
We used low cycle number co-amplification of multiple RTPCR products (QMF-PCR) [Zhou and Hoffman, 1994; Hamed
et al., 2005]. Briefly, three PCR products were designed which
could be co-amplified in a single reaction: dystrophin 50 (244 bp,
1,355–1,589 bp); dystrophin 30 (250 bp, 9,362–9,612 bp);
ryanodine receptor (247 bp, 11,989–11,236 bp), their RT-PCR
products differed by only 3 bp each. The forward primer of each
PCR primer was synthesized with an infrared dye (IRD700,
LiCor Inc) (LiCor Bioscience, Lincoln, NE). Patients’ RNA was
reverse transcribed and random-primed cDNA corresponding
to approximately 20 ng of mRNA was subjected to 25 cycles
using all three sets of labeled RT-PCR primers (dystrophin 50 ,
dystrophin 30 , and ryanodine receptor). A small aliquot of each
reaction was then resolved on 6% acrylamide gels on a LiCor
45
TABLE I. Primer Pairs Used to Amplify the Complete Coding
Sequence of Dystrophin cDNA
Primer
name
Primer sequence
433F
þ95R
44F
21F
428R
305F
726R
621F
1137R
1030F
1431R
1355F
1729R
1682F
2030R
1985F
2342R
2300F
2648R
2603F
2952R
2909F
3256R
3207F
3187F
3556R
3507F
3487F
3857R
3859R
3813F
4160R
4114F
4464R
4418F
4782R
4740F
5090R
5043F
5393R
5348F
5700R
5656F
6006R
5959F
6308R
6262F
6237F
6624R
6578F
6927R
6883F
7232R
7177F
7526R
7481F
7811R
7762F
8112R
8068F
8038F
8413R
8360F
8706R
8660F
Gaagatctagaacagtggatacataacaaatgcatg
Ttctccgaaggtaattgcctccccagatctgagtcc
CAATTACCTTCGGAGAAAAACG
CTACAGGACTCAGATCTGGG
GGGCATGAACTCTTGTGGAT
GGGAAGCAGCATATTGAGAA
ATGAGAGCATTCAAAGCCAG
AGATTCTCCTGAGCTGGGTC
GAGGTGGTGACATAAGCAGC
TTCTCAACAGATCACGGTCA
CCAATCAGCTTACTTCCCAA
GAGGGGTACATGATGGATTTG
GACCCTGACTTGTTCTTGTT
CAACATAAGGTGCTTCAAGA
CGCTTTTAAAACGGCCAGTT
CAAAATGAAATGTTATCAAG
TCTTCTTTTGGGGAGGTGGT
ATGCTCAAGAGGAACTTCCA
CGATCCACCGGCTGTTCAGT
GATAGCATCAAACAAGCCTC
GTAAAGGCCACAAAGTCTGC
GGACAAGGACCCATGTTCCT
CCGGCTAATTTCAGAGGGCG
GCACCACTGTGAAAGAGATG
AAGTGGGCTATACTATCTCAG
CTTTATCTTCTGCCCACCTT
CAATTCAGCCCAGTCTAAAC
TTTAGTCAGTGATATTCAGAC
GGAGTTTCACTTTCGCTTCT
AAGGAGTTTCACTTTCGCTTC
GAGCTAAAGAAGAGGCCCAA
CCTCTGAATGTCGCATCAAA
CTCTGAGGTGCTAGATTCAC
CTTGTCAAATCAGATTGGAT
GCTCAAAATGCCTCAGGAAGC
GTCTTTATCACCATTTCCAC
GTCTGAGTGAAGTGAAGTCT
GGTGCACCTTCTGTTTCTCA
CCTGGGGAAAGCTACTCAA
GGCGTATGTCATTCAGTTCT
GAAGACGTGCTTAAGCGTTT
CCTCTTTGCAACAATTCTTT
GAATGAAGACAATGAGGGTA
GCTTGCCTACGCACTGCATT
GGAATTGCAGAAGAAGAAAG
GCTTAAAGAGATCTTCAAAG
CAATGCTCCTGACCTCTGTG
GCCCTATTAGAAGTGGAACAAC
GCATGTTCCCAATTCTCAGG
GAACAGTTTCTCAGAAAGAC
GGTTCAAGTGGGATACTAGC
ATGGTTGGAGGAAGCAGATA
GCAGCAGATGATTTAACTGC
TGGGCAGCTTGAAAAAAAGCT
GAGTAGGAGAGGCTCCAATA
CCTGACCTAGCTCCTGGACT
GGGCAGCGGTAATGATCATC
AGGATTTGGAACAGAGGCGTC
GTCTGCCACTGGCGGAGGTC
CACAGAAACCAAGCAGTTGG
GGAGGGTCCCTATACAGTAG
CATCAGCTCTTTTACTCCCTT
GCTACCCGTAAGGAAAGGCT
GGTGCCTGCCGGCTTAATTC
CTGGTGTGGCTACAGCTGAA
Product
size
535 bp
385 bp
408 bp
422 bp
517 bp
402 bp
349 bp
351 bp
358 bp
349 bp
350 bp
380 bp
350 bp
370 bp
351 bp
373 bp
348 bp
351 bp
365 bp
351 bp
351 bp
353 bp
351 bp
350 bp
363 bp
388 bp
350 bp
350 bp
351 bp
331 bp
351 bp
346 bp
376 bp
347 bp
346 bp
(Continued )
46
Hamed and Hoffman
TABLE I. (Continued )
Primer
name
Primer sequence
Product
size
transcript, suggesting absence of splicing defect or some other
type of loss-of-function mutation.
DISCUSSION
9005R
8952F
9302R
9143F
9581R
9458F
9885R
9751F
10227R
10164F
10631R
10531F
10975R
10937F
11383R
GGGTCTCATCTATTTTTCTC
GGGAAAAATTGAACCTGCAC
CGACGGCCACCTGCAGAAGC
AAGGCACTTCGAGGAGAAAT
TCAAGAGATCCAAGCAAAGG
GACCATCCCAAAAATGACAGA
GTTGAACTTGCCACTTGCTT
GCTGCTGAATGTTTATGATA
CAGCTTTGGCAGATGTCATA
GTCCAATCATTGGATTCAGG
AATGCTGGATTAACAAATGT
TAGCAGGCTAGCAGAAATGG
CTGTGACTCCAGCTGTTT
CAAATCCTGGAAGACCACAA
AAACCATGCGGGAATCAG
351 bp
439 bp
428 bp
477 bp
468 bp
445 bp
447 bp
F, forward; R, reverse.
IR2 automated sequencer (LiCor Bioscience) and the respective peaks were quantitated. Peak areas of infrared fluorescence for both dystrophin 50 and 30 were normalized to 100% in
10 controls showing normal dystrophin; the average normalization factor was then applied to each peak ratio in the
experimental samples to drive corrected ratios. All samples
were tested in duplicate reactions and gels.
RESULTS
Small Pathogenic Mutations in the Dystrophin
Gene Detected by Complete Sequencing
of the Coding Sequence
We identified 10 small causative loss-of-function mutations
distributed throughout the dystrophin gene (Fig. 1) in 67% of
our patients (10/15) (Table II) including five stop codons
(Gln625X, Ser757X, Glu1353X, Arg1967X, Gln2198X), a single
nucleotide deletion (DA2882), intra-exon deletion of 11 bp
between nucleotides 3245 and 3255 (Fig. 2), complete duplication of exon exon 2 (n ¼ 2) and exon 43 (n ¼ 1). The RT-PCR
products containing that exon was of increased size corresponding to such duplications seen by direct sequencing (Figs. 3
and 4).
Mutation-Negative DMD Patients
Five DMD patients (5/15) tested negative for mutations in
the promoter and whole coding sequence of the dystrophin.
Clinical, laboratory, and biochemical features of each is shown
in Table III. All showed faint and variable immunostaining
results for both amino- and carboxyl-terminal dystrophin and
alpha-sarcoglycan antibodies, yet showed no detectable dystrophin by immunoblot. QMF-PCR showed reductions in RNA
levels of dystrophin ranging from 25% to 70% of normal levels.
None showed preferential loss of the 30 end of the dystrophin
Fig. 1. Localization of mutations identified in 10 Duchenne muscular
dystrophy (DMD) patients through sequencing of the complete dystrophin
coding sequence.
Here, we present a new strategy for automated capillary gel
sequence analysis that permits systematic scanning of the
complete coding sequence of the dystrophin gene [Cohen et al.,
1990; Huang et al., 1992]. We believe that our method can
simplify the detection of small mutations in this enormous
gene. The feasibility of capillary electrophoresis instruments
for high-throughput genomic sequencing is further illustrated
by the announcement of a whole human genome shotgun
sequencing project facilitated by this technology. We identified
causative mutations in 10 out of 15 patients studied. This
suggests that the sensitivity of our method is 67%, which, to our
knowledge, is the highest sensitivity reported to date. All our
mutations are added on Leiden Muscular Dystrophy Pages,
http://www.dmd.nl/.
Many specific techniques have been addressed to reveal the
causative mutation in Duchenne dystrophy. All were PCRbased to first localize a potential mutation by electrophoretic
shift, RT-PCR products, or protein fragments with subsequent
sequencing of the aberrant bands. Most are technically
demanding, labor intensive, and in addition costly. However,
even with application of specific precautions, many pathogenic
mutations will go undetected. Prior et al. [1995] screened 80%
of the dystrophin coding region using amplification of individual exons from patient genomic DNA by heteroduplex
analysis, followed by sequencing of aberrant bands. Twenty
six small mutations were identified in 110 DMD patients, i.e.,
25% sensitivity rate. Both Lenk et al. [1993] and KeKou et al.
[1999] studied patients using SSCP analysis of exons corresponding to carboxyl-terminal region of the dystrophin
protein; Lenk et al. found 6 point mutations in 26 patients,
while Kekou et al. found 5 mutations in 31 DMD patients, both
consistent with a similar 25% sensitivity rate as that reported
by Prior et al. Roberts et al. [1992] used CMC to identify seven
point mutations in amplified exons, however the total number
screened was not reported. Roest et al. [1993] reported an
application of the PTT to dystrophin RNA amplified from
peripheral blood. A similar assay was used by Gardner et al.
[1995] and able to detect 12 mutations in 22 patients, i.e., 60%
sensitivity rate. Both Whittock et al. [1997] and TufferyGiraud et al. [1999] used PTT, and both found 10 mutations in
10 non-deletion patients. A recently described technique,
multiplex amplifiable probe hybridization (MAPH) [Armour
et al., 2000] and modified by White et al. [2002] was utilized for
screening DMD gene. Only 37 samples out of 72 (i.e., 51%) were
utilized and the 29 out of 39 (74%) checked for deletions and
point mutations were tested positive for mutations by the use of
this technique including small novel rearrangements especially small one or two exon duplications. MAPH involves the
quantitative recovery of specifically designed probes following hybridization to immobilized genomic DNA. Engineered
probes for each of the 79 exons of the DMD gene will then be
analyzed using a 96-capillary sequencer. The authors suggested that this technique is simple, quick, and accurate based
on existing technology (i.e., hybridization, PCR, and electrophoresis) and should allow easy implementation in routine
diagnostic laboratories. Furthermore, they suggested that this
methodology should be applicable to any genetic disease, it
could be easily expandable to cover >200 probes and its
characteristics should facilitate high-throughput screening.
Unrelated 2 of the 15 patients sequenced (13.3%) showed the
same novel duplication of exon 2 suggesting that this may be a
recurring mutation of the dystrophin gene. Previous surveys of
deletion and duplication mutations of the dystrophin gene
have found that some introns appear to be ‘‘hot spots’’ for
Point Mutation Detection
47
TABLE II. Small Pathogenic Mutations in the Dystrophin Gene
Patient no.
1
2
3
4
5
6
7
8
9
10
a
Nucleotide change
Amino acid change
Exon no.
6107C > Ta
240?_301þ?dup
6326?_6499þ?dup
C2081T
D A2882
240?_301þ?dup
3245_3255delGAAATTAGCCG
2478C > G
6800C > T
4265G > T
Arg 1967X
41
2
43
16
20
2
23
18
45
29
Gln625X
Ser757X
Gln2198X
Glu1353X
Protein domain
Rod (R15)
N-terminus
Rod (R 16)
Rod (R 3)
Rod (R 4,5)
N-Terminus
Rod (R 6)
Rod (R 4)
Rod (R 17)
Rod (R 9)
CPK IU/L
Dystrophin results
19,180
25,000
9,200
22,000
20,000
38,340
16,000
10,000
25,000
9,600
0%
0%
1% of 427 kDa
0%
0%
3% of 427 kDa
0%
0%
0%
0%
This mutation has been previously reported by Saad et al. [1993].
deletion/duplication, for example 33% of DMD/BMD deletion
mutations show a breakpoint in intron 44 (119 of 362 deletion
positive patients) [Koenig et al., 1987; den Dunnen et al., 1989].
This translates into 20% of all DMD/BMD (both deletion and
non-deletion) patients having one breakpoint in this intron.
Intron 44 is approximately 170 kb in size [den Dunnen et al.,
1989], and has been shown to be a major replication termination site in the dystrophin gene [Verbovaia and Razin, 1997].
Pulse-field analyses of the breakpoints for deletions within
intron 44 have shown that they are relatively widespread over
intron 44, with 30% of the intron 44 deletions originating in a
25–40 kb region [Wapenaar et al., 1988]. Thus, there does not
appear to be sequence specificity (hot spot for deletion) to intron
44, but instead a relative genomic instability.
The mechanism for duplication and deletion hot spots are
thought to be quite different. It is generally accepted that most
duplication mutations occur due to tandemly arranged homologous sequences which result in mispairing during recombination, or slippage of the DNA replication machinery [Hu et al.,
1990; Cooper and Krawczak, 1993; Galvagni et al., 1994]. If
unequal cross-over during meiotic recombination were the
mechanism that lead to exon 2 duplication, then we would
expect to see reciprocal exon 2 deletion in some patients. To the
contrary, deletion of exon 2 has never been reported in either
DMD or BMD (Leiden muscular dystrophy pages). Taken
Fig. 2. Detection of an 11 bp deletion of exon 23 by direct sequence
analysis of cDNA. Shown are RT-PCR products from muscle biopsy RNA
from DMD patient no. 7 and three normal controls (panel A). No difference
in size is seen in the 350 bp RT-PCR product, however direct sequence
analysis shows an intra-exon deletion of 11 bp (panel B). Note that the
deletion seems to have been caused by recombination between a short repeat
sequence (ATTTC) (dots) flanking the deleted region.
together, this data suggests that there is a region of homology
between intron 1 and 2 that leads to intragenic slippage or
mispairing during replication, leading to the duplication of
exon 2. Given the extremely large size (190 and 170 kb) of
introns flanking exon 2, it is not surprising that a deletion or
duplication of exon 2 by itself is a mutation that has been found
more than once. Two cosmids have been sequenced which
contain exon 2 (130 kb) and exon 3 (100 kb), however these two
cosmid sequences do not overlap. Interestingly, White et al.
[2002] recently reported that duplication of exon 2 is the single
most common duplication, occurring five times among his
patients. However, no deletion of exon 2 alone has so far been
reported (Leiden Muscular, Dystrophy Pages). We attributed
the previously unreported duplication of exon 2 is due to a
number of confounding technical issues: (1) exon 2 is a particularly small exon of only 64 bp. The early characterization of
deletion and duplication mutations in DMD/BMD patients
was done using Southern blot analysis of genomic DNA, with
the dystrophin cDNA as a probe to detect exon-containing
Fig. 3. Duplication of exon 2 is seen by RT-PCR and direct sequencing in
two unrelated DMD patient muscle biopsy cDNAs. Shown are 350 bp RTPCR products from muscle biopsy cDNA (panel A), where two unrelated
patients (no’s 1, 4) show an abnormally large amplicon relative to controls.
Direct automated sequence analysis of patients showed a duplication of exon
2 (panel B).
46.5
50.0
0%
Faint
26.2
30.5
0%
Faint
66.8
61.0
0%
Faint
27.1
30.2
0%
Faint
69.2
72.8
1% of 417 kDa
Faint
7,800
Negative
12,000
Positive (two maternal
uncles)
12,000
Negative
1
3
3
10
12
13
14
15
Delayed developmental mile stones
Onset at the age of 3 years
Progressive proximal girdle weakness
Calf hypertrophy
Waddling gait
Slow progressive lower extremity
weakness, easy fatigue
Calf hypertrophy
Still ambulant
Negative
35,000
Faint and variable
Nice group of revertants
60 kDa and d10
Faint and variable
60 kDa and d10
Faint and variable
60 kDa and d10
Faint and variable
Nice group of revertants
60 kDa and d10
Faint and variable
25,000
Positive family history
(maternal lineage)
8
11
Onset at the age of 5 years
Progressive proximal girdle weakness
Still ambulant
CK screening
a-sarcoglycan
Immunostaining
Dystrophin
CPK IU/L
Family history
Clinical presentation
Age at
biopsy
restriction fragments [Koenig et al., 1987; den Dunnen et al.,
1989]. Thus, only 64 bp hybridizes to exon 2 containing genomic
restriction fragments, which leads to a relatively weak and
variable hybridization signal on Southern blot. As a result, it
was probably difficult to ascertain duplication mutations of
exon 2, (2) the restriction enzyme typically used for study of the
dystrophin gene in genomic DNA was HindIII. In HindIII
digest, the genomic fragment containing exon 2 was very
closely spaced with fragments containing exon 1 and 5 (exon
5 ¼ 3.1 kb, exon 1 ¼ 3.2 kb, exon 2 ¼ 3.25 kb), making discernment of dosage abnormalities of the weakly hybridizing exon 2
technically problematic, (3) duplications are inherently more
difficult to detect than deletions in hemizygous males, as 2:1
dosage relative to control individuals must be observed, rather
than the simple absence of a band. Thus, methods that are not
strictly quantitative, such as PCR from genomic DNA, are not
adequately sensitive for detecting duplications, and (4) the
failure to see the duplication of exon 2 in early studies led to
exclusion of exon 2 in multiplex PCR reactions, so exon 2 is not
assayed in the now-standard 18 exon multiplex PCR [Chamberlain et al., 1988; Beggs et al., 1990].
We observed that patients with duplication mutations (exon
2 and 43) showed some common clinical and histological
features, including (1) weakness was milder than typically
seen in age-matched DMD patients; all were fully ambulant at
12 years of age, (2) their muscle biopsies showed a particularly
high rate of ‘‘revertant fibers’’ (data not shown). Mutation
analysis revealed that revertants occurred in DMD with
identifiable deletions or duplications and in non-deletion
patients. Revertants are most likely due to a second-site
mutation occurring in a somatic cell allowing restoration of the
translational reading frame of the dystrophin transcript
[Hoffman et al., 1990; Klein et al., 1992]. A single report has
found a correlation between the presence of revertant fibers
and lessening clinical course [Nicholson et al., 1993], and it
Pat
no.
Fig. 4. Duplication of exon 43 is seen by RT-PCR and direct sequencing
in DMD patient muscle biopsy cDNAs. Shown are 350 bp RT-PCR products
from muscle biopsy cDNA (panel A), where the patient (no. 3) show an
abnormally large amplicon relative to controls. Shown also a low level on
normal sized transcript in the patient’s cDNA. Direct automated sequence
analysis of patients showed a duplication of exon 43 (panel B).
TABLE III. Clinical and Molecular Features of Mutation-Negative DMD Patients
Immuno-blot
50
30
Hamed and Hoffman
RNA quantitation
% of control
48
Point Mutation Detection
would be interesting to determine if patients showing such a
milder course might have the same duplication mutation as we
identified here. Interestingly, we were able to detect a low level
of normal size transcript in the cDNA of the patient with exon
43 duplication (Fig. 4).
We also identified a series of novel stop codon mutations
(Gln625X, Ser757X, Glu1353X, Arg1967X [Saad et al., 1993],
Gln2198X). Although, it has been postulated that there should
be a possible impact of premature translation termination on
the steady level of mRNA, premature termination of translation destabilize the mRNA released by the polysomes [Baserga
and Benz, 1988; Chelly et al., 1991; Culterson, 1999; Hentze
and Kulozik, 1999]; It has also been claimed that premature
stop codons that may result from nonsense or frame shift
mutations can induce intranuclear instability of the transcript
and impairs its transport to the cytoplasm [Takeshita et al.,
1984; Humphires et al., 1994].
Although mutation detection obviously is critical for diagnosis, it may also be important for future therapeutic purposes.
Recent reports have showed the potential use of read-through
protein synthesis (Gentamicin) [Barton-Davis et al., 1999]
and exon skipping (with antisense oligoribonucleotides) [van
Deutekom et al., 2001] in the restoration of the reading frame of
the dystrophin transcript. White et al. [2002] suggested that
single-exon duplications, in particular would make an ideal
target for exon skipping. The presence of two targets will not
double the efficiency but also should produce a normal
transcript, leading to a wild-type protein [Barton-Davis et al.,
1999; Wagner et al., 2001].
We also identified two small deletions (delA2882, del(11 bp)
3245-3255). The mechanism generating the deletion of 11 bp is
likely slipped-mispairing at the replication fork between a 5 bp
repeat due to the presence of repetitive DNA sequence in the
vicinity (ATTTC) [Kunkel and Soni, 1988].
Although the whole dystrophin coding region and the 535 bp
of the gene promoter were screened for pathogenic mutations,
we failed to identify the disease causing mutation in 1/3 of
patients. The clinical presentation and disease progression in
such patients were consistent with DMD, as were serum CK
levels. Interestingly, all five patients showed faint and variable
immunostaining results for both amino- and carboxyl-terminal
dystrophin and alpha-sarcoglycan antibodies, yet showed no
detectable dystrophin by immunoblot. This data suggested
that some residual dystrophin might be produced by these
patients that was not detected by immunoblot studies. We suggested that such patients might have a problem with the 3.5 kb
30 UTR, polyA site or undetected stop codons. It is also possible
that splicing defects could result in addition of intron sequence
that could lead to preferential amplification of low level
residual normal transcript skipping [Cooper and Krawczak,
1990]. Germline mosaicism has been reported elsewhere
[Bakker et al., 1987; Wood and McGillivray, 1988] and would
not necessarily be detectable by use of the available methods.
Another less likely reason, is mutation in a gene that is
involved in the regulation of dystrophin expression. Alternatively, we suggested that mutation negative patients may have
reduction in dystrophin protein in muscle that is secondary to
other detect; i.e., not ‘‘primary’’ ‘‘dystrophinopathy’’ and this
has also been suggested by others [White et al., 2002]. Studying
the steady state RNA levels in muscle biopsies of mutationnegative patients using QMF-PCR, to test the possibility of
transcription abnormality, revealed that there was an equal
levels of 50 and 30 RT-PCR products, indicating that there was
no missed stop codon mutation or splicing error. However, all
showed relatively mild reductions in dystrophin RNA, ranging
from 25% to 60% of normal. While the reductions in RNA might
suggest a promoter mutation or mRNA metabolism defect, we
find it hard to rationalize the complete lack of dystrophin
protein in those patients’, despite the persistence of apparently
49
normal RNA at 25%–60% levels, further studies are needed.
If those patients do not have Duchenne dystrophy, then our
ascertainment for mutations approaches 100%.
REFERENCES
Ahn AH, Kunkel LM. 1993. The structural and functional diversity of
dystrophin. Nat Genet 3:283–291.
Armour JA, Sismani C, Patsalis PC, Cross G. 2000. Measurement of locus
copy number by hybridisation with amplifiable probes. Nucleic Acids Res
28:605–609.
Bakker E, Van Broeckhoven C, Bonten EJ, Van De Vooren MJ, Veenema H,
Van Hul W, van Ommen GJB, Vandenberghe A, Pearson PL. 1987.
Germline mosaicism and Duchenne muscular dystrophy mutations.
Nature 329:554–556.
Barton-Davis ER, Cordier L, Shoturma DI, Leland SE, Sweeney HL. 1999.
Aminoglycoside antibiotics restore dystrophin function to skeletal
muscles of mdx mice. J Clin Invest 104:375–381.
Baserga SJ, Benz EJ. 1988. Nonsense mutations in the human b-globulin
gene affect mRNA metabolism. Proc Natl Acad Sci USA 85:2056–2060.
Beggs AH, Koenig M, Boyce FM, Kunkel LM. 1990. Detection of 98% of DMD/
BMD gene deletions by polymerase chain reaction. Hum Genet 86:
45–48.
Chamberlain JS, Gibbs RA, Raier JE, Nguyen PN, Caskey CT. 1988.
Deletion screening of the Duchenne muscular dystrophy locus via
multiplex DNA amplification. Nucleic acid Res 16:11141–11156.
Chelly J, Gilgenkrantz H, Lambert M, Hamard G, Chafey P, Recan D, Katz
P, de la Chapelle A, Koenig M, Ginjaar B, Fardeau M, Tome F, Khan A,
Kaplan JC. 1991. Effect of dystrophin gene deletions on mRNA levels
and processing in Duchenne and Becker muscular dystrophy. Cell 63:
1239–1248.
Cohen AS, Najarian DR, Karger BL. 1990. Separation and analysis of DNA
sequence reaction products by capillary gel electrophoresis. J Chromatogr 516:46–60.
Cooper DN, Krawczak M. 1990. The mutational spectrum of single base pair
substitutions causing human genetic disease: Patterns and predictions.
Hum Genet 85:55–74.
Cooper DN, Krawczak M. 1993. Human gene mutation. Oxford: Bios
Scientific.
Culterson MR. 1999. RNA surveillance. Unforeseen consequences for gene
expression, inherited genetic disorders and cancer. Trends Genet 15:
74–80.
den Dunnen JT, Grootscholten PM, Bakker E, Blonden LA, Ginjaar HB,
Wapenaar MC, van Paassen HM, van Broeckhoven C, Pearson PL, van
Ommen GJ. 1989. Topography of the Duchenne muscular dystrophy.
DMD gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions
and 13 duplications. Am J Hum Genet 45:835–847.
Galvagni F, Saad FA, Danieli GA, Miorin M, Vitiello L, Mostacciolo ML,
Angilini C. 1994. A study on duplications of the dystrophin gene:
Evidence of a geographical difference in the distribution of breakpoints
by intron. Hum Genet 94:83–87.
Gardner RJ, Bobrow M, Roberts RG. 1995. The identification of point
mutations in Duchenne muscular dystrophy patients using reverse
transcript PCR and the protein truncation test. Am J Hum Genet 57:
311–320.
Hamed SA, Sutherland-Smith AJ, Gorospe JRM, Kendrick-Jones J,
Hoffman EP. 2005. DNA sequence analysis for structure/function and
mutation studies in Becker muscular dystrophy. Clin Genet 68:69–79.
Hentze MW, Kulozik AE. 1999. A perfect message: RNA surveillance and
nonsense-mediated decay. Cell 96:307–310.
Hoffman EP. 1993. Genotype/phenotype correlations in Duchenne/Becker
muscular dystrophy. In: Partridge TA, editor. Molecular and cell biology
of muscular dystrophy. London: Chapman and Hall, Inc. pp 12–36.
Hoffman EP. 1997. The muscular dystrophies. In: Rosenberg RN, Prusiner
SB, DiMauro Barchi S, editors. The molecular and genetic basis of
neurological diseases. Newton, Massachusetts: Butterworth-Heinmann.
Hoffman EP, Brown RH, Kunkel LM. 1987. Dystrophin: The protein product
of the Duchenne muscular dystrophy locus. Cell 51:919–928.
Hoffman EP, Morgan JE, Watkins SC, Partridge TA. 1990. Somatic/
reversion suppression of the mouse mdx phenotype in vivo. J Neurol
Sci 99:9–25.
Hu X, Ray PN, Murphy EG, Thompson MW, Worton RG. 1990. Duplication
of Duchenne muscular dystrophy locus: It frequency, distribution,
50
Hamed and Hoffman
origin, and phenotype/genotype correlation. Am J Hum Genet 46:
682–695.
Huang XG, Quesada MA, Mathies RA. 1992. DNA sequencing using
capillary array electrophoresis. Anal Chem 64:2149–2154.
Humphires B, Ley T, Anagnou N, Baur A, Nienhuis A. 1994. b-39
thalassemia gene: A premature termination codon causes b-RNA
deficiency without affecting cytoplasmic b-RNA stability. Blood 64:
23–32.
Kekou K, Mavrou A, Florentin L, Youroukos S, Zafiriou DI, Skouteli HN,
Metaxotou C. 1999. Screening of minor changes in the distal part of the
human dystrophin gene in Greek DMD/BMD patients. Eur J Hum Genet
7:179–187.
Roest PAM, Robers RG, Sugino S, van Ommen GJB, den Dunnen JT. 1993.
Protein truncation test. PTT, for rapid detection of translationterminating mutations. Hum Mol Genet 2:1719–1721.
Saad FA, Vita G, Mora M, Morandi L, Vitiello L, Oliviello S, Danieli GA.
1993. A novel nonsense mutation in the human dystrophin gene. Hum
Mutat 2:314–316.
Saito K, Ikeya K, Kondo E, Yamauchi A, Sukama I, Komine S, Harada T,
Mishima M, Komine M, Osawa M, Fukuyama Y. 1995. Somatic
mosaicism for a DMD gene deletion. Am J Hum Genet 56:806–812.
Takeshita K, Forget B, Scarpa A, Benz E. 1984. intranuclear defect of bglobulin mRNA accumulation due to premature translation termination
codon. Blood 64:13–22.
Klein CJ, Coovert DD, Bulman DE, Ray PN, Mendelll JR, Burghes AH. 1992.
Somatic reversion/suppression in Duchenne muscular dystrophy. DMD:
Evidence supporting a frame-restoring mechanism in rare dystrophinpositive fibers. Am J Hum Genet 50:950–959.
Tubiello G, Carrera P, Soriani N, Morandi L, Ferrari M. 1995. Mutational
analysis of muscle and brain specific promoter region of dystrophin in
DMD/BMD Italian patients by denaturing gradient gel electrophoresis
(DGGE). Molecular Cell Probes 9:441–446.
Koenig M, Hoffman EP, Bertelson CJ, Monaco AP, Feener C, Kunkle LM.
1987. Complete cloning of Duchenne muscular dystrophy. DMD, cDNA
and preliminary genomic organization of the DMD gene in normal and
affected individuals. Cell 50:509–517.
Tuffery-Giraud S, Chambert S, Demaille J, Claustres M. 1999. Point
mutations in the dystrophin gene: Evidence for frequent use of cryptic
splice sites as a result of splicing defects. Hum Mutat 14:359–368.
Leiden Database for DMD/BMD. 2005. http://www.dmd.nl/
van Deutekom JC, Bremmer-Bout M, Janson AAM, Ginjaar HB, Baas F, den
Dunnen JT, van Ommen GJB. 2001. Antisense-induced exon skipping
restores dystrophin expression in DMD patient derived muscle cells.
Hum Mol Genet 10:1547–1554.
Lenk U, Hanke R, Thiele H, Speer A. 1993. Point mutations at the carboxy
terminus of the human dystrophin gene: Implications for an association
with mental retardation in DMD patients. Hum Mol Genet 2:877–1881.
Verbovaia LV, Razin SV. 1997. Mapping of replication origins and
termination sites in Duchenne muscular dystrophy gene. Genomics 45:
24–30.
Ljunggren A, Duggan DJ, McNally E, Boylan KB, Gama CH, Kunkle LM,
Hoffman EP. 1995. Primary adhalin deficiency as a cause of muscular
dystrophy in patients with normal dystrophin. Ann Neurol 38:367–
372.
Wagner KR, Hamed S, Hadley DW, Gropman AL, Burstein AH, Escolar DM,
Hoffman EP, Fischbeck KH. 2001. Gentamicin treatment of Duchenne
and Becker muscular dystrophy due to nonsense mutation. Ann Neurol
49:706–711.
Monaco AP, Nerve RL, Colletti-Feener CA, Bertelson CJ, Kurnit DM,
Kunkel LM. 1988. Isolation of candidate cDNAs for portions of Duchenne
muscular dystrophy gene. Nature 323:646–650.
Wapenaar MC, Kievits T, Hart KA, Abbs S, Blonden LA, den Dunnen JT,
Groostscholten PM, Bakker E, Verellen-Dumoulin C, Bobrow M, van
Ommen GJB, Pearson PL. 1988. A deletion hot spot in the Duchenne
muscular dystrophy gene. Genomics 22:102–108.
Kunkel TA, Soni A. 1988. Mutagenesis by transient misalignment. J Biol
Chem 263:14784–14789.
Nicholson LVB, Johnson MA, Bushby KMD, Gardner-Medwin D. 1993.
Functional significance of dystrophin positive fibers in DMD. Arch Dis
Child 68:632–636.
Oudet C, Hanauer A, Clemens P, Caskey T, Mendell JR. 1992. Two hot spots
of recombination in the DMD gene correlate with the deletion prone
regions. Hum Mol Genet 1:599–603.
Pegoraro E, Schimke RN, Garcia C, Stern H, Cadaldini M, Angilini C,
Barbosa E, Carroll J, Marks WA, Neville HE, Hoffman EP. 1995. Genetic
and biochemical normalization in female carriers of Duchenne muscular
dystrophy: Evidence of failure of dystrophin production in dystrophin
component myonuclei. Neurology 45:677–690.
Prior TW, Bartolo C, Pearl DK, Papp AC, Snyder PJ, Sedra MS, Burghes AH,
Mendell JR. 1995. Spectrum of small mutations in the dystrophin coding
region. Am J Hum Genet 57:22–33.
Roberts RG, Bobrow M, Bentley DR. 1992. Point mutations in the dystrophin
gene. Proc Natl Acad Sci USA 89:2331–2335.
White S, Kalf M, Liu Q, Villerius M, Engelsma D, Kriek M, Vollebregt E,
Bakker B, van Ommen GB, Breuning MH, den Dunnen JT. 2002.
Comprehensive detection of genomic duplications and deletions in the
DMD gene, by use of multiplex amplifiable probe hybridization. Am J
Hum Genet 71:365–374.
Whittock NV, Roberts RG, Mathew CG, Abbs SJ. 1997. Dystrophin point
mutation screening using a multiplexed protein truncation test. Genet
Test 1:115–123.
Wood S, McGillivray BC. 1988. Germinal mosaicism in Duchenne muscular
dystrophy. Hum Genet 78:282–284.
Worton RG, Thompson MW. 1988. Genetics of Duchenne muscular
dystrophy. Annu Rev Genet 22:601–629.
Zhou JH, Hoffman EP. 1994. Pathophysiology of sodium channelopathies:
Studies of sodium channel expression by quantitative multiplex
fluorescence polymerase chain reaction. J Biol Chem 269:18563–18571.
Документ
Категория
Без категории
Просмотров
1
Размер файла
162 Кб
Теги
point, mutation, screening, sequence, detection, duchenne, automaten, entire, dystrophy, cdna
1/--страниц
Пожаловаться на содержимое документа