close

Вход

Забыли?

вход по аккаунту

?

Autosomal dominant dementia with widespread neurofibrillary tangles.

код для вставкиСкачать
Autosomal Dominant Dementia with
Widespread Neurofibrillary Tangles
Lee A. Reed, MD,* Thomas J. Grabowski, MD,? Marie Luise Schmidt, PhDJ John C. Morris, MD,$"
Alison Goate, DPhi1,S Ana Solodkin, PhD,t# Gary W. Van Hoesen, PhD,t# Robert L. Schelper, MD, PhD,*
Chris J. Talbot, PhD,S Michelle A. Wragg, PhD,S and John Q. Trojanowski, MD, PhDS
Several familial dementing conditions with atypical features have been characterized, but only rarely is the neuropathology dominated solely by neurofibrillary lesions. We present a Midwestern American pedigree spanning four generations
in which 15 individuals were affected by early-onset dementia with long disease duration, with an autosomal dominant
inheritance pattern, and with 7-rich neurofibrillary pathology found in the brain post mortem. The average age at
presentation was 55 years with gradual onset and progression of memory loss and personality change. After 30 years'
disease duration, the proband's neuropathologic examination demonstrated abundant intraneuronal neurofibrillary tangles (NFTs) involving the hippocampus, pallidum, subthalamic nucleus, substantia nigra, pons, and medulla. Only sparse
neocortical tangles were present and amyloid plaques were absent. The tangles were recognized by antibodies specific for
phosphorylation-independent (Tau-2, T46, 133, and Alz-50) and phosphorylation-dependent epitopes (AT& T3P,
PHF-1, 12E8, AT6, AT18, AT30) in 7 proteins. Electron microscopy of NFTs in the dentate gyrus and midbrain demonstrated paired helical filaments. Although the clinical phenotype resembles Alzheimer's disease, and the neuropathologic phenotype resembles progressive supranuclear palsy, an alternative consideration is that this familial disorder may
be a new or distinct disease entity.
Reed LA, Grabowski TJ, Schmidt ML, Morris JC, Goate A, Solodkin A, Van Hoesen GW, Schelper RL,
Talbot CJ, Wragg MA, Trojanowski JQ. Autosomal dominant dementia with
widespread neurofibrillary tangles. Ann Neurol 1997;42:564-572
A variery of familial neurodegenerative diseases, many
presenting in the presenium, include dementia as an
early or late manifestation, and several of these diseases
are characterized by neurofibrillary alterations of the
neuronal cytoskeleton. Definition of these disorders requires clinical, pathologic, biochemical, and genetic
correlation. It is known that neurofibrillary changes
are, in most part, composed of the abnormally phosphorylated microtubule-associated protein T [ 1, 21,
which self-aggregates and accumulates causing microtubule instability and dysfunction. The evolving spectrum of these .r-associated disorders includes Alzheimer's disease (AD), Pick's disease, corticobasal degeneration, and progressive supranuclear palsy (PSP) [3].
The distribution and density of the neurofibrillary
changes frequently overlap among these disorders,
causing diagnostic confusion [4].
We present a Midwestern American pedigree with
early-onset dementia, who were especially long-lived,
with a clinical phenotype resembling AD, but postmor-
From the *Division of Neuropathology, Department of Pathology,
and TDeparrment of Neurology, University of Iowa Hospitals and
Clinics, and #Department of Anatomy, University of Iowa, Iowa
Ciry, IA; $Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, Philadelphia, PA; and
%Departments of Neurology, "Pathology (Neuropathology), and
Vsychiatry, Washington University School of Medicine, S t Louis,
tem brain examination of the proband demonstrated
limbic and subcortical neurofibrillary degeneration similar to PSP. The clinical features of this family are reported along with the neuropathology of the proband,
including the T immunophenotype, ultrastructural
analysis of the neurofibrillary tangles (NFTs), apolipoprotein E (ApoE) genotyping, and analysis of the
presenilin-2 (PS-2) gene.
Subjects and Methods
Clinical Summa y
An autosomal dominantly transmitted dementing disorder
affected four generations in this family (Fig 1). Preliminary
data from 15 affected members show an early onset of disease at approximately 55 years of age (range, 45-75 years)
with the predominant clinical manifestation being dementia
in which memory loss (9 of 15) and personality change (5 of
15) were the most striking features; parkinsonism (2 of 15)
was reported for only 2 members. Disease onset is insidious
Received Aug 8, 1996, and in revised form Apr 10, 1997. Accepted
for publication Apr 28, 1997.
Address correspondence to Dr Reed, Department of Pathology, ML
155, University of Iowa Hospitals and Clinics, 200 Hawkins Drive,
Iowa City, 1A 52242.
MO.
564 Copyright 0 1997 by the American Neurological Association
IV
1
Fig I . Pedigree. 0
2
3
unaffected female; 0 = affected female;
= affected male. Slashed symbols
indicute deceased @mi& members.
=
17 = unaffected male;
with gradual progression. Some affected members survive 20
years or longer.
The proband (111-9) was a high school graduate with a
history of poliomyelitis as a youth with residual left lowerextremity weakness and atrophy. There were no cognitive
problems until age 47, when he developed progressive memory difficulties, including repetition of questions and forgetting conversations, and demonstrated geographic disorientation. These changes prompted his retirement from farming
at age 59; evaluation for dementia occurred at age 65. General neurologic evaluation was unremarkable. Mental status
testing indicated a reduced digit span and “nil” anterograde
memory. Language was normal. Dementia progressed slowly,
such that by his early 70s he could not reliably feed himself
and was incontinent of urine. He no longer recognized his
family consistently. A parkinsonian gait, hypomimia, and
paucity of speech were noted. Combativeness in the last year
of life required neuroleptic drugs. Rigidity was noted but was
of unclear relationship to the neuroleptic therapy. During
the last year of life, the patient experienced a 20-lb weight
loss, and he was examined by one of us (T.J.G.) at age 76
years, 5 weeks before his demise. The patient was severely
abulic, bradykinetic, mute, and drooled continuously. H e
produced brief palilalic, but occasionally intelligible, speech.
Hypometric saccades were noted; no vertical gaze could be
established. Babinski signs were absent and coordination was
normal. H e walked unassisted with a narrow-based gait with
short steps and minimal arm swing. There was pronounced
rigidity and an action tremor of the upper extremities. A
mild resting tremor of the hands was present. Primitive reflexes were prominent, including snout and rooting reflexes.
Computerized tomography of the head demonstrated generalized atrophy of the hemispheres, which was considered age
related. There was mild ventriculomegaly. After about 30
years of disease duration, he died after a fall complicated by
a fractured humerus.
The proband’s maternal grandfather (1-1) emigrated from
Denmark and died in a state mental hospital, with the diagnosis of “alcoholism,” at the age of 70 years. Five of his 6
children were affected, including the proband’s mother (II3). Known ages at onset were 55 years (11-2), 45 years (11-3),
and 55 years (11-4). Three cases (11-2, 11-3, and 11-5) had a
course characterized by the gradual onset and progression of
memory and other cognitive deficits in the absence of other
known dementing conditions. An unusual feature was a long
disease duration of 21, 35, and 20 years, respectively. All 3
eventually were institutionalized. Another sibling (11-4) developed personality changes at age 55 such that he neglected
his previously successful business, exhibited poor judgment
and eccentric behavior, and adopted a lifestyle, characterized
by his family, as a “bum.” Little information is known of the
last affected member of this generation (11-6); but reportedly,
she “developed alcoholism” in late life and died before age
70.
Most of those affected in this generation demonstrated apparent autosomal dominant transmission of the dementing
illness to several of their offspring, including the proband.
111-3 developed confusion and memory loss at age 75. The
son of the proband (IV-2) presented with complaints of decreased memory and concentration and was examined at age
49 by the same author (T.J.G.). Neuropsychological testing
demonstrated mild anterograde amnesia. No focal neurologic
deficits were present. Magnetic resonance imaging and
positron emission tomography were normal. The daughter of
the proband (IV-1) had a neurologic evaluation at age 54 by
one of us (J.C.M.), after a few years of mild memory changes
reported by a collateral source.
Methods
Examination of the brain of the 76-year-old proband was
performed after a postmortem interval of 16 hours. The
brain was subject to immersion fixation in 10% buffered formalin for 2 weeks. Sections were taken from the middle
frontal gyrus, cingulate gyrus, inferior parietal lobule, superior temporal gyrus, calcarine cortex, hippocampus and parahippocampal gyrus, neostriatum, globus pallidus, subthalamic nucleus, thalamus, hypothalamus, mamillary bodies,
amygdala, midbrain, pons, medulla, cerebellum, and high
cervical cord. Select sections were stained with hematoxylin
and eosin, a Bielschowsky silver impregnation, using a modification reported by Yamamoto and Hirano [5], Lux01 fast
blue, Congo red, and thioflavine S.
Immunohistochemistry was performed on 5-pm sections
of neocortex, hippocampus, entorhinal cortex, basal ganglia,
basal forebrain, subthalamic nucleus, amygdala, mesencephalon, pons, medulla, cerebellum, and spinal cord as previously described [6]. The methods used, including the primary antibodies and their specificities, are listed in Table 1.
Tissue sections immunostained wirh antiserum for pamyloid (Ap) were pretreated with 80 or 90% formic acid
for 20 minutes. Positive tissue controls from AD brain were
used for anribodies to T, AP, and ubiquitin. Negative patient
controls were incubated with preimmune mouse or rabbit
serum with omission of the primary antibody. In addition,
50-km-thick sections from a parahippocampal block including hippocampus and amygdala were incubated with antiA68 (Az-50) or anti-1OD5. Diaminobenzadine was used as
the chromagen for all the procedures.
For electron microscopy, tissue from the dentate gyrus
and midbrain was fixed in 10% buffered formalin for 3 or 6
weeks, then postfixed in 1% osmium tetroxide. After processing, sections were embedded in Epon and 1-pm sections
were stained with toluidine blue. Ultrathin sections of interest were stained with lead citrate and uranyl acetate and
viewed with a Phillips C M 10 electron microscope.
Reed et al: Autosomal Dominant Dementia
565
Table 1. Antibodies
Epitope
Dilution
Merhod
Antibodies
Monoclonals
12E8
AT6
AT8
AT1 8
AT30
PHF-1
T46
Tau-2
Alz- 50
Phos Ser2"'
Unknown
Phos Ser202 and Thr205
Phos Thr"'
Phos ThrI8'
I'hos Ser3')'" and Ser4'/'
P-ind aa404-44 1
P-ind aa92-I 08
aa2- 10
250 ngiml
1:2,300
1:200
1:4,000
1:500
1:800
1:2,000
1:1,000
1:1,000
PAP
PAP
PAP
PAP
PAP
PAP
PAP
ABC
PAP
Polyclonals
133
T3P
P-ind aal-16
~ h o sSer"'"
1:500
1:50
PAP
PAP
Other Antibodies
1 OD5
2332
6F/3D
mAbl510
NH2-AP
AB
AP aa8-17
Ubiquitin
1: 1,000
1:5,000
1:50
1:20,000
PAPIABC
PAP
ABC
PAP
Reference No.
Source
7
Phos = phosphorylated; Ser = serine; PAP
ABC = avidin-biotin complex.
=
7
Athena
Innogenetics
Innogenetics
Innogenetics
Innogenetics
S. C. Greenberg
V. M.-Y.
Lee
Sigma
P. Davies
M. Goedert
V. M.-Y. Lee
Athena
14
6
V. M.-Y. Lee
Accuspec
Chemicon
15
peroxidase-antiperoxidase; Thr = threonine; P-ind = phosphate independent; aa = amino acids;
Table 2. Primers and Reaction Conditions @Y Presenilin-2 Gene Analysis
Exon
3
4
5
6
7
8
9
10
11
12
Primer
Sequence
5' x 3
3' x 3
INT115L
INTl16R
5' x 5
3' 5
5'X6
3' X 6
Seq3' X 6
5'X7
3' x 7
5' X 8
3' x 8
Seq3' X 8
5' x 9
3' x 9
5' x 10
3' x 10
5' x 11
3' x 11
Seq3' X 11
5' x 12
3' x 12
TGAGTCCTCCACTGCCTTTG
CGCAGGGACCTGTTTGAAGG
CATATGCCCTAGTAGCTCATAG
CCATTATACGAACAAGGAAGCTG
AGCCTCGAGGAGCAGTCAG
GCAGACGGAGAGAAGGGT
GGTATCAGTCTCAGGATCATGGG
TGGGGAAGACTGGAGCTCGATG
GAAGACTGGAGCTCGATGGTCA
GTAAAGAGGGCCAGGTTGGG
GTGCAGCACTGGGGACGATTT
GGGCAGGCTCTTCTTCAGGG
GAAAGCCACGGCCAGGAAG
GCTGCCTGCCTGACCCCGAGT
TTAGCACCGCCTGAGACGT
CCTCCTGAACTCATGCCTCT
CTCTGACCAGCTGTTGTTTC
AGCCTCCACCCTCTGTCT
TTCCATTCTGTGCACGCCTC
ACCTGCCCCCACCACAATG
TGCCCCCACCACAATGAGGA
ACAGCTCCTGTCCACACCA
ACTAGAGTGTAAAACTATACAA
Annealing
Temperature ("C)
TNK
Buffer
(mM)
Product
Size (bp)
55
100
278
45
0.75
Hot
dNTP
C
597
C
53
50
240
60
50
26 I
C
A
68
50
386
61
50
253
A
53
50
230
57
50
249
57
50
243
A/C
C
C
45
100
288
C
TNK = Tris-NH,CI-KCI; dNTP = dcoxynucleoside triphosphate (radiolabeled "P dCTP or 32P dATP used for cycle sequencing after the
sequencing primer).
Suitable tissue was not available for western blot analysis.
A portion of the proband's brain was frozen at -70°C for
ApoE genotyping and DNA sequence analysis of the PS-2
gene. Genomic DNA was extracted, using a standard protocol, and ApoE genotyping was performed as previously de-
566 Annals of Neurology Vol 42
No 4
October 1997
scribed [16]. Exons of PS-2 were amplified by polymerase
chain reaction (PCR), using intronic primers (Table 2). The
products were cycle sequenced with the 3 dNTP-labeling
technique and sequencing kit from Amersham. The sequencing primers and reaction conditions are also given in Table
2. The sequence reactions were electrophoresed through 6%
denaturing acrylamide gels. The gels were dried and exposed
to autoradiographic film for 4 to 48 hours.
Results
Gross Examination
The fresh brain weighed 1,285 g. There was mild symmetric atrophy of the frontal and temporal poles, but
the cortical ribbon was intact and of average thickness
throughout. There was severe and symmetric atrophy
of the hippocampi with enlargement of the temporal
horns (Fig 2). Moderate enlargement of the lateral and
third ventricles was also present. The substantia nigra
was pale.
Light Microscopic Examination
Only occasional intraneutonal NFTs were present in
layers 111 and V in the frontal, superior temporal, parietal, and occipital neocortex. Rare glial tangles were
also present in these cortical regions, but neuropil
threads were not seen. Ballooned neurons were absent,
and neither neuritic nor diffuse amyloid plaques were
identified by Bielschowsky, Congo red, or thioflavine S
staining. However, abundant intraneuronal NFTs were
present throughout the medial temporal lobe including
the hippocampus, entorhinal cortex, and adjacent isotemporal cortices. Extraneuronal ghost tangles were
also abundant, especially in the CA1 sector of the hippocampus and subiculum. Loss of pyramidal neurons
was severe and gliosis was conspicuous in these tanglerich regions. The fascia dentata also contained a high
density of NFTs of various configurations. Neither
Pick bodies nor Lewy bodies were present. Similar tan-
gles were also numerous in several subcortical structures including the amygdala, globus pallidus, substantia innominata (where they were associated with
neuronal loss and gliosis), mamillary bodies, midline
thalamic nuclei, and subthalamic nucleus. Rare tangles
were present in neurons of the neostriatum and claustrum. Occasional astrocytes, especially conspicuous in
the amygdala, also contained tangle-like inclusions.
Dense accumulations of NFTs and neuropil threads
were also present within the pars compacta of the substantia nigra, periaqueductal gray matter, and the midline raphe nuclei. Rare tangles were found in neurons
of the red nucleus and superior colliculi, as well as in
neurons within the locus ceruleus, nucleus centralis superioris, and the reticulotegmental nucleus. Variable
numbers of tangles were present in neurons of the motor nucleus of XI, in the medial accessory olive, and in
the dentate nucleus of the cerebellum. Sections of the
high cervical cord demonstrated a high density of tangles in every section, especially in the anterior horns
(Fig 3 ) . There was no evidence suggestive of remote
poliomyelitis, although only the high cervical cord was
available for examination. Occasional NFTs in the hippocampus and anterior horn of the spinal cord showed
apple green birefringence with Congo red staining under polarized light. The NFTs throughout the medial
temporal lobe (Fig 4), subcortical nuclei, and brainstem stained strongly with thioflavine
s.
Fig 3. Two neurojbrillary tangles are seen in large neurons in
the anterior horn of the spinal cord (hematoyllin and eosin).
Bar = 10 pm.
Fig 2. There is bilateral atrophy of the hippocampi and pronounced dilatation of the temporal horns.
Reed et
al:
Autosomal Dominant Dementia
567
gles were also weakly to moderately immunoreactive
for ubiquitin. Neocortical, allocortical, subcortical, and
spinal cord NFTs demonstrated a similar T immunophenotype. Morphologically identifiable astrocytes,
some with end feet wrapping around blood vessels, also
bore tangles recognized by these anti-T antibodies. Specifically, these tangles labeled with antibodies 133,
AT6, AT8, and AT18. There was no immunohistochemical evidence of AP deposition in the brain parenchyma or in blood vessel walls.
Electron Microscopy
Fig 4. Abundant neurojbrillay tangles are present in layer 11
and rr1 of the entorbinal cortex. Bar = 20 prn.
Immunohistochemist~
Intraneuronal NFTs and neuropil threads were immunoreactive for Tau-2, Az-50, 133, PHF-1, T3P, 12E8,
AT6, ATS, AT18, AT30, and T46 (Fig 5). Many tan-
Ultrastructural analysis of randomly observed granular
neurons in the fascia dentata, substantia nigra, and
midbrain tegmentum revealed neurons with bundles of
intracytoplasmic paired helical filaments with a maximum diameter of 20 to 24 nm and periodic constrictions at 70-to 80-nm intervals (Fig 6).
ApoE genotyping revealed an ApoE ~ 2 genotype.
~ 3
PS-2 gene analysis demonstrated a normal PS-2 gene
sequence.
Fig 5. Numerous neurojbrillary tangles are present in granular neurons of the fascia dentata (anti-T3P) (A; bar
in the substantia nigra along with dystrophic neurites (anti-AT8) (B; bar = 20 pin).
568 Annals of Neurology
Vol 42
No 4
October 1997
=
20 pm) and
Fig G. Electron microscopy demonstrates paired helical fibments in neurons of the dentate fascia (X91,OOO befDwe 3%
reduction). Bar = 110 nm.
Discussion
Abundant NFTs are present in a limited number of
neurodegenerative diseases. The most common are AD
and PSP, but others include Niemann-Pick type C disease [171, myotonic dystrophy [ 181, and subacute sclerosing panencephalitis [ 191. In the absence of AP deposition, AD is extremely unlikely. Abundant NFTs as
the sole or predominant brain abnormality, aside from
neuronal loss and gliosis, are a diagnostic feature of
several neurodegenerative disorders. PSP is the prototype of such disorders [20],which also include amyotrophic lateral sclerosis/parkinsonism-dementia complex of Guam (ALSIPDC) [21, 221, postencephalitic
parkinsonism [23], dementia pugilistica [24], motor
neuron disease with neurofibrillary tangles described by
Hilton and colleagues [25],and “diffuse neurofibrillary
tangles with calcification” [26].Other .r-associated disorders classically or often lacking AP deposition are
characterized by various other abnormal 7 inclusions,
such as corticobasal bodies in corticobasal degeneration, Pick bodies in Pick’s disease, and argyrophilic
grains in “dementia with argyrophilic grains” [27].
Although similar to AD clinically, the neuropathology in our patient most closely resembles PSP. Although clinical [28-301 and neuropathologic [2O, 31,
321 diagnostic criteria for PSP have been proposed, remarkable heterogeneity in the presentation and subsequent manifestations are recognized [33, 341, and the
antemortem diagnosis of PSP may only reach approximately 69% accuracy due to atypical presentations.
Our patient meets the criteria for PSP proposed by the
National Institute of Neurological Disorders and
Stroke (NINDS) [ZO], which require a high density of
tangles or neuropil threads in three of the following
areas: globus pallidus, subthalamic nucleus, substantia
nigra, or pons, as well as low-density tangles or neuropi1 threads in at least three of the following areas: striarum, oculomotor complex, medulla, or dentate nucleus. Glial tangles, once thought to be specific for
PSP, are now recognized in a variety of neurodegenerative diseases [35].Yet the clinical features of this family
are unusual for PSP and include the early age of onset,
the long duration of the disease, and the paucity of
extrapyramidal findings in most family members. Neuropathologic features considered unusual for PSP were
also present in our patient. For example, PSP is usually
characterized by bundles of 15-nm straight tubules, by
electron microscopy, but we demonstrated paired helical filaments, in both the fascia dentata and the midbrain structures. However, paired helical filaments have
been shown in some patients with the classic presentation and otherwise classic neuropathology of PSP [36].
The overwhelming majority of cases of PSP appear
to be sporadic, although the low population frequency
(minimal prevalence of 1.39 per 100,000) [29] may
obscure recognition of familial forms of PSI‘. It has
been speculated that a gene with low penetrance may
be involved [37],precluding diagnosis of potentially affected family members. In addition, unrelated mortality may prevent diagnosis of family members with PSP
due to the late onset of this disease. Rare families with
putative familial PSP have been reported (for recent reviews, see References 38 and 39), but no genetic investigations have been published to date.
PSP has been reported with coexisting AD [33, 34,
401, but that diagnostic possibility in our patient is unlikely in the absence of neuritic plaques required for
the diagnosis of AD [41]. It is noted, however, that
allocortical NFT-predominant dementia (so-called limbic AD), with minimal or no neuritic plaques, has
been reported in rare demented elderly individuals
[42-441. Of these, only rare patients also had NFTs in
the brainstem. If this entity was present in our patient,
the concomitant severe subcortical involvement might
be interpreted as a manifestation of long disease duration, corresponding to late parkinsonism symptoms
seen in 2 patients of our pedigree. The ApoE genotype
in our patient, ApoE &2&3,is interesting in that it is
similar to that reported for NFT-predominant dementia in which a high incidence of ApoE €2 has been
found [45]. Further systematic studies are needed to
Reed et al: Autosomal Dominant Dementia
569
clarify whether this entity is truly a subtype of AD or a
separate disease. Although ApoE genotyping has been
less well studied in non-AD disorders [46],such as PSP
[47],the absence or paucity of the ApoE ~4 allele in
these disorders, as in our patient, may have a suggested
protective mechanism against the accumulation of AP.
Nonmendelian forms of AD are associated with an increased frequency of the ApoE ~4 allele (reviewed in
Reference 48) and an E4 dose-dependent increase in
AP deposition. Mendelian forms of AD are associated
with mutations in three genes, ie, the amyloid precursor protein (APP) gene, the presenilin-1 gene (PS-I),
and the PS-2 gene. PS-1 and APP mutations lead to
disease with age of onset at 29 to 62 years but with
little variance within a family. In contrast, individuals
in PS-2 mutation families exhibit a wide range in age
of onset, spanning the traditional division of late- and
early-onset AD (40-84 years). This is similar to that
observed in the pedigree described here. We therefore
sequenced the coding region of the PS-2 gene. Analysis
of the PS-1 and APP genes remain to be performed in
this patient; however, the excessive AP load reported in
families with mutations in these genes and their lower
mean age of onset makes a mutation in these genes
unlikely in our patient with NFT-only dementia. It appears likely that an as yet unidentified gene locus is
associated with our patient’s disorder.
Because the clinical and pathologic phenotypes do
not clearly fit either PSP or AD, an alternate possibility
is that this family represents a distinct disease entity. A
few clinicopathologically distinct familial autosomal
dominant
have now been characterized’ by
?-rich pathology in the absence of AP deposition [49521. The Seattle family reported by Surni and colleagues [49], with “familial presenile dementia with
tangles,” now localized to chromosome 17
differs
from ours in the clinical presentation with psychotic
symptoms and the neuropathologic findings of severe
cortical involvement with hippocampal sparing [49,
501. The brainstem regions were relatively preserved in
most of these patients and lacked NFTs. “Dysinhibition-dementia-parkinsonism-amyotrophy
complex,” a
familial syndrome also linked to chromosome 17 [52]
has, in part, a 7-rich pathology in the absence of AP
deposition but is quite distinct from the pathology in
our patient by its circumscribed cortical atrophy, hippocampal sparing, and unique intraneuronal inclusions
composed of phosphorylated neurofilaments within
several subcortical structures.
Because the neocortex was largely spared, the dementia in our patient best correlates with the severe
pathology in the limbic system, as reported in AD
[54].Involvement of these structures may also occur in
most cases of PSP [33, 34, 551, and staging of medial
temporal lobe pathology similar to that for AD has
been proposed [56]. The severe subcortical pathology
570
Annals of Neurology
Vol 42
No 4 October 1997
in our patient may also suggest a concomitant anatomic basis for the cognitive deficits manifested by our
patient.
It has been established that the microtubuleassociated protein 7 is the primary component of
NFTs; however, western immunoblots distinguish a
different migration among certain 7-associated diseases,
including AD, PSP [57], corticobasal degeneration
[58], and Picks disease [ 5 9 ] . Unfortunately, suitable
tissue was not available for biochemical studies in our
patient, but these pathologic 7 isoforms can be detected in tissue sections with monoclonal antibodies
distinguishing selected phosphorylated serine and
threonine residues [2, 6 , 7,91. Although some investigators have found subtle differences in the immunophenotype of tangles, which may distinguish these neurofibrillary degenerations [40, 601, other studies have
now shown that similar T epitopes are present in AD,
PSP, and ALS/PDC of Guam [61, 621. Indeed, the T
epitopes present in the NFTs in our patient resemble
those previously reported [61, 621, in that the whole 7
protein is present and the same serine and threonine
residues are phosphorylated.
Although the genetic abnormalities in most hereditary dementias characterized by the presence of 7-rich
neurofibrillary lesions remain to be identified, clarification of the molecular basis of these disorders will also
help to clarify the role of neurofibrillary pathology in
these diseases and other related conditions.
Supported in part by grants AG-10124 and AG-09215 (Drs
Schmidt and Trojanowski) and AG-05681 (Drs Morris and Goate)
from the National Institutes of Health. L)r Goate is the recipient of
a career development award from the National Instirute of Aging
(AGOO634).
W e gratefully acknowledge the following technical contributions to
this study: Leesa Fair and Carol Bray (UHIC) for electron microsCOPY> Sherry Kardos and Mary Z ~ b a r t hKJHIC) for his to lo^ and
immunohistochemistry, and Joanne Norton, RN (Alzheimer’s Disease Research Center, Washington University, St Louis, MO) for
communication and follow~up,
______
References
1. Goedert M, Trojanowski JQ, Lee VM-Y. The neurofibrillary
pathology of Alzheimer’s disease. In: Rosenberg RN, Prusiner
SB, DiMauro S, Barchi RL, eds. The molecular and genetic
basis of neurological disease. 2nd ed. Newton, MA: Butterworth Heinemann, 1997:613-627
2. Trojanowski JQ,Clark CM, Schmidt ML, et al. Implications of
rau-rich neurofibrillary lesions for the pathobiology and diagnosis of Alzheimer’s disease. In: Appel S, ed. Current neurology,
vol 16. Chicago: Mosby-Year Book, 1996:93-113
3. Feany MB, Dickson DW. Neurodegenerative disorders with extensive tau pathology: a comparative study and review. Ann
Neurol 1996;40:139-148
4. Feany MB, Mattiace LA, Dickson DW. Neuropathologic overlap of progressive supranuclear palsy, Pick‘s disease and corticobasal degeneration. J Neuropathol Exp Neurol 1396;55:53-67
5. Yamamoto T, Hirano A. A comparative study of modified
Bielschowsky, Bodian and thioflavin S stains on Alzheimer’s
neurofibrillary tangles. Neuropathol Appl Neurobiol 1986;12:
3-9
6. Schmidt ML, DiDario AG, Lee VM-Y, Trojanowski JQ. An
extensive neocortical network of PHFtau-rich dystrophic neurites permeates nearly all neuritic and diffuse plaques in Alzheimer disease. FEBS Lett 1994;344:69-73
7. Seubert P, Mawal-Dewan M, Barbour R, et al. Detection of
phosphorylated SerZG2in fetal tau, adult tau, and paired helical
filament tau. J Biol Chem 1995;270:18917-18922
8. Mercken M, Vandermeeren M, Lubke U, et al. Monoclonal
antibodies with selective specificity for Alzheimer tau are directed against phosphatase-sensitive epitopes. Acta Neuropathol
1992;84:265-272
9. Biernat J, Mandelkow E-M, Schroter C, et al. The switch of
tau protein to an Alzheimer-like state induces the phosphorylation of two serine-proline motifs upstream of the microtubule
binding region. Embo J 1992;11:1593-1597
10. Goedert M, Jakes R, Crowther RA, et al. The abnormal phosphorylation of tau protein at serine-202 in Alzheimer disease
recapitulates phosphorylation during development. Proc Natl
Acad Sci USA 1993;90:5066-5070
11. Bramblett GT, Goedert M, Jakes R, et al. Abnormal tau phosphoiylation at Ser”6 in Alzheimer’s disease recapitulates development and contributes to reduced microtubule binding. Neuron 1993;10:1089-1099
12. Lang E, Otvos L. A serine- proline change in the Alzheimer’s
disease-associated epitope Tau-2 results in altered secondary
structure, but phosphorylation overcomes the conformational
gap. Biochem Biophys Res Commun 1992;188:162-169
13. Ksiezak-Reding H, Chien C-H, Lee VM-Y, Yen S-H. Mapping
of the Alz 50 epitope in microtubule-associated proteins tau.
J Neurosci Res 1990;25:412-419
14. Hyman BT, Tanzi RE, Marzloff K, et al. Kunitz protease
inhibitor-containing amyloid p protein precursor immunoreacrivity in Alzheimer’s disease. J Neuropathol Exp Neurol 1992;
5 1:76-83
15. Shaw G, Chau V. Ubiquitin and microtubule-associated protein tau immunoreactivity each define distinct structures with
differing distributions and solubility properties in Alzheimer
brain. Proc Natl Acad Sci USA 1988;85:2854-2858
16. Talbot C, Houlden H, Craddock N, et al. Polymorphism in
AACT gene may lower age of onset of Alzheimer’s disease.
Neuroreport 1996;7:534-536
17. Auer IA, Schmidt ML, Lee VM-Y, et al. Paired helical filament
tau (PHFrau) in Niemann-Pick type C disease is similar to
PHFtau in Alzheimer’s disease. Acta Neuropathol 1995;90:
547-55 1
18. Kiuchi A, Otsuka N, Namba Y, et al. Presenile appearance of
abundant Alzheimer’s neurofibrillary tangles without senile
plaques in the brain in myotonic dystrophy. Acta Neuropathol
1991;82:1-5
19. Mandybur TI, Nagpaul AS, Pappas Z, NiMowitz WJ. Alzheimer neurofibrillary change in subacute sclerosing panencephalitis. Ann Neurol 1977;1:103-107
20. Hauw JJ, Daniel SE, Dickson D, et al. Preliminary NINDS
neuropathologic criteria for Steele-Richardson-Olszewski syndrome (progressive supranuclear palsy). Neurology 1994;44:
20 15-2019
21. Hof PR, Nimchinsky EA, Buke-Scherrer V, et al. Amyotrophic
lateral sclerosis/parkinsonism-dementia complex of Guam:
quantitative neuropathology, immunohistochemical analysis of
neuronal vulnerability, and comparison with related neurodegenerative disorders. Acta Neuropathol 1994;88:397-404
22. Oyanagi K, Makifuchi T, Ohtoh T, et al. Amyotrophic lateral
sclerosis of Guam: the nature of the neuropathological findings.
Acta Neuropathol 1994;88:405-412
23. Geddes JF, Hughes AJ, Lees AJ, Daniel SE. Pathological overlap in cases of parkinsonism associated with neurofibrillary
tangles: a study of recent cases of postencephalitic parkinsonism
and comparison with progressive supranuclear palsy and Guamanian parkinsonism-dementia complex. Brain 1993; 1 16281302
24. Geddes JF, Vowles GH, Robinson SFD, Sutcliffe JC. Neurofibrillary tangles, but not Alzheimer-type pathology, in a young
boxer. Neuropathol Appl Neurobiol 1996;22: 12-16
25. Hilton DA, Love S, Ferguson I, Newman P. Motor neuron
disease with neurofibrillary tangles in a non-Guamanian patient. Acta Neuropathol 1995;90:101-106
26. Kosaka K. Diffuse neurofibrillary tangles with calcification: a
new presenile dementia. J Neurol Neurosurg Psychiatry 1994;
57:594-536
27. Masliah E, Hansen LA, Quijada S, et al. Late onset dementia
with argyrophilic grains and subcortical [angles or atypical progressive supranuclear palsy. Ann Neuol 1991;29:389 -396
28. Collins SJ, Ahlskog JE, Parisi JE, Maraganote DM. Progressive
supranuclear palsy: neuropathologically based diagnostic clinical
criteria. J Neurol Neurosurg Psychiatry 1995;58:167-173
29. Globe LI, Davis PH, Schoenberg BS, Duvoisin RC. Prevalence
and natural history of progressive supranuclear palsy. Neurology
1988;38:1031-1034
30. Maher ER, Lees AJ. The clinical features and natural history of
the Steele-Richardson-Olszewski syndrome (progressive supranuclear palsy). Neurology 1986;36: 1005-1008
31. Lantos PL. The neuropathology of progressive supranuclear
palsy. J Neural Transm Suppl 1994;42: 137-1 52
32. Litvan I, Hauw JJ, Bartko JJ, et al. Validity and reliability of
the preliminary NINDS neuropathologic criteria for progressive
supranuclear palsy and related disorders. J Neuropathol Exp
Neurol 1996;55:97-105
33. Gearing M, Olson DA, Watts RL, Mirra SS. Progressive supranuclear palsy: neuropathologic and clinical heterogeneity.
Neurology 1994;44:1015-1024
34. Daniel SE, de Bruin VMS, Lees AJ. The clinical and pathological spectrum of Steele-Richardson-Olszewski syndrome (progressive supranuclear palsy): a reappraisal. Brain 1995; 118:759770
35. Chin SS-M, Goldman JE. Glial inclusions in CNS degenerative
diseases. J Neuropathol Exp Neurol 1996;55:439-508
36. Ohara S, Kondo K, Morita H , et al. Progressive supranuclear
palsy-like syndrome in two siblings of a consanguineous marriage. Neurology 1992;42:1009-101 4
37. Brown J, Lantos P, Stratton M, et al. Familial progressive supranuclear palsy. J Neurol Neurosurg Psychiatry 1993;56:473476
38. Tetrud JW, Golbe LI, Forno LS, Farmer I’M. Autopsy proven
progressive supranuclear palsy in two siblings. Neurology 1996;
6931-934
39. de Yt-benes JG, Sarasa JL, Daniel SE, Lees AJ. Familial progressive supranuclear palsy: description of a pedigree and review of
the literature. Brain 1995;118:1095-1103
40. Cruz-Sanchez FF, Rossi ML, Cardozo A, et al. Clinical and
pathological study of two patients with progressive supranuclear
palsy and Alzheimer’s changes. Antigenic determinants that distinguish cortical and subcortical neurofibrillary tangles. Neurosci Letr 1992;136:43-46
41. Mirra SS, Heyman A, McKeel D, et al. The Consortium to
Establish a Registry for Alzheimer’s Disease (CERAD). Part 11.
Standardization of the neuropathologic assessment of Alzheimer’s disease. Neurology 1991;41:479-486
42. Itoh Y, Yamada M, Yoshida R, et al. Dementia characterized by
abundant neurofibrillary tangles and scarce senile plaques: a
quantitative pathological study. Eur Neurol 1996;36:94-97
43. Bancher C, Jellinger KA. Neurofibrillary tangle predominant
Reed et al: Autosomal Dominant Dementia
571
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
form of senile dementia of Alzheimer type: a rare subset in very
old subjects. Acta Neuropathol 1994;88:565-570
Ulrich J, Spillantini MG, Goedert M, et al. Abundant neurofibrillary tangles without senile plaques in a subset of patients
with senile dementia. Neurodegeneration 1992;1 :257-264
Ikeda K, Akiyama H , Arai T, et al. A subset of senile dementia
with high incidence of the apolipoprotein E € 2 allele. Ann
Neurol 1997;41:693-695
Martinoli MG, Trojanowski JQ, Schmidt ML, et al. Association of apolipoprotein ~4 allele and neuropathologic findings in
patients with dementia. Acta Neuropathol 1995;90:239-243
Tabaton M, Rolleri M, Masturzo P, et al. Apolipoprotein E ~4
allele frequency is not increased in progressive supranuclear
palsy. Neurology 1995;45:1764-1765
Roses AD. Apolipoprotein E affects the rate of Alzheimer disease expression: P-amyloid burden is a secondary consequence
dependent on ApoE genotype and duration of disease. J Neuropathol Exp Neurol 1994;53:429-437
Sumi SM, Bird TD, Nochlin D, Raskind MA. Familial presenile dementia with psychosis associated with cortical neurofibrillary tangles and degeneration of the amygdala. Neurology
1992;42:120-127
Spillantini MG, Crowther RA, Goedert M. Comparison of the
neurofibrillary pathology in Alzheimer’s disease and familial
presenile dementia with tangles. Acta Neuropathol 1996;92:
42-48
Brown 1, Lantos PL, Roques P, et al. Familial dementia with
swollen achromatic neurons and corticobasal inclusion bodies: a
clinical and pathologic study. J Neurol Sci 1796;135:21-30
Sima AAF, Defendini R, Keohane C, et al. The neuropathology
of chromosome 17-linked dementia. Ann Neurol 1996;39:
734-743
Foster NL, Wilhelmsen K, Sima AAF, et al. Frontotemporal
572 Annals of Neurology Vol 42 No 4
October 1997
54.
55.
56.
57.
58.
59.
60.
61.
62.
dementia and parkinsonism linked to chromosome 17: a consensus conference. Ann Neurol 1997;41:706-715
Hyman BT, Van Hoesen GW, Kromer LJ, Damasio AR. Perforant pathway changes and the memory impairment of dzheimer’s disease. Ann Neurol 1986;20:472-481
Higuchi Y, Iwaki T, Tateishi J. Neurodegeneration in the limbic and paralimbic system in progressive supranuclear palsy.
Neuropathol Appl Neurobiol 1995;21:246-254
Braak H, Jellinger K, Braak E, Bohl J. Allocortical neurofibrillary changes in progressive supranuclear palsy. Acra Neuropathol 1992;84:478-483
Flament S, Delacourte A, Verny M, et al. Abnormal tau proteins in progressive supranuclear palsy. Similarities and differences with the neurofihrillary degeneration of Alzheimer’s type.
Acta Neuropathol 1991 ;81:591-596
Ksiezak-Reding H, Morgan K, Mattiace IA, et al. Ultrastructure and biochemical composition of paired helical filaments in
corticobasal degeneration. Am J Pathol 1994;145:1496-1508
Delacourte A, Robitaille Y, Sergeant N , et al. Specific pathological tau protein variants characterize Picks disease. J Neuropathol Exp Neurol 1996;159-168
Feany MB, Ksiezak-Reding H, Liu W-K, et al. Epitope expression and hyperphosphorylation of tau protein in corticobasal
degeneration: differentiation from progressive supranuclear
palsy. Acta Neuropathol 1995;90:37-43
Schmidt ML, Huang R, Martin JA, et al. Neurofibrillary tangles in progressive supranuclear palsy contain the Same epitopes
identified in Alzheimer’s disease PHF-tau. J Neuropathol Exp
Neurol 1996;55:534-539
Mawal-Dewan M, Schmidt ML, Balin B, et al. Identification of
phosphorylated sites in PHF-tau from patients with Guam
amyotrophic lateral sclerosis/parkinsonism-dementia complex.
J Neuropathol Exp Neurol 1996;55:1051-1059
Документ
Категория
Без категории
Просмотров
1
Размер файла
974 Кб
Теги
autosomal, dementia, dominantly, widespread, tangled, neurofibrillary
1/--страниц
Пожаловаться на содержимое документа