close

Вход

Забыли?

вход по аккаунту

?

Brief communication Evidence of Bartonella quintana infections in skeletons of a historical mass grave in Kassel Germany.

код для вставкиСкачать
AMERICAN JOURNAL OF PHYSICAL ANTHROPOLOGY 146:134–137 (2011)
Brief Communication: Evidence of Bartonella quintana
Infections in Skeletons of a Historical Mass Grave in
Kassel, Germany
Philipp v. Grumbkow,1* Anna Zipp,1 Verena Seidenberg,1 Lars Fehren-Schmitz,1,2
Volkhard A.J. Kempf,3 Uwe Groß,4 and Susanne Hummel1
1
Institute of Zoology and Anthropology, Department of Historical Anthropology and Human Ecology,
Georg-August-University Goettingen, Buergerstraße 50, 37073 Goettingen, Germany
2
Department of Anthropology, Yale University, New Haven, CT 06511
3
Institute of Medical Microbiology and Hospital Hygiene, Johann-Wolfgang-Goethe University, 60596 Frankfurt am
Main, Germany
4
Institute of Medical Microbiology, Centre of Hygiene and Human Genetics, Georg-August-University Goettingen,
Kreuzbergring 57, 37075 Goettingen, Germany
KEY WORDS
Napoleon’s wars; skeletons; aDNA; typhoid fever; Bartonella quintana
ABSTRACT
In 2008, a mass grave was found on the
grounds of the University of Kassel, Germany. Historians hypothesized that the individuals died in a typhoid
fever epidemic in winter 1813/14. To test this hypothesis,
the bones were investigated on the presence of specific
DNA of pathogens linked to the historical diagnosis
of typhoid fever. It was possible to prove the specific
DNA of Bartonella quintana in three individuals,
suggesting that their cause of death is linked to an epidemic background. Am J Phys Anthropol 146:134–137,
2011. V 2011 Wiley-Liss, Inc.
THE MASS GRAVE OF KASSEL
of illnesses whose main symptoms are a high fever and
red spots on the skin. In 1836 W.W. Gerhard in the USA,
and later in 1847 the royal physician Sir William Jenner
in England discovered there were differences among
examined corpses, despite their common diagnosis. They
both hypothesized independently of each other that various diseases had been given the same diagnosis (Seddon,
2004; Bechah et al., 2008). In addition to what is called
typhoid fever today, there are, e.g., typhus, paratyphoid
fever, and trench fever, all caused by different species of
bacteria but causing similar symptoms. The assumed
time of death of the individuals was clearly before there
was a method to distinguish among the various diseases.
We therefore tested for four different bacteria species by
analyzing DNA extracts of the bones: Salmonella enterica typhi and S. enterica paratyphi, as agents of typhoid
and paratyphoid fever, Rickettsia prowazekii, the cause
of epidemic typhus, and Bartonella quintana, the pathogen causing trench fever. The latter two have previously
been associated with Napoleon’s Grand Army (Raoult et
al., 2006) and other war-related events (e.g., World War
I, Foucault et al., 2006).
In 2008, a mass grave was found during construction
works on the site of the University of Kassel. Different
investigations by historians, anthropologists, and medical examiners led to the assumption of a military cohort
who died in an epidemic event in the late 18th or early
19th century. For example, investigations of age and sex
distribution on a sample revealed that most of the individuals had been males in the age classes juvenis and
adultas indicating that the site of the find was not used
as a normal cemetery and could point to a military background. Further, no evidence of death because of injury
or violence was found.
A relevant event related to an epidemic in Kassel in
this time was an outbreak of a so-called typhoid fever in
the winter of 1813/14. Because of a fire in the Historical
City Archive in 1943 (Dettmar, 1983), no documents or
other historical sources remain describing the epidemic
in Kassel although there are some indications left that
the city suffered a high death toll. Descriptions found in
other cities’ histories (e.g., Mainz [Germany]) suggest
that after Napoleon’s defeat at the Battle of Leipzig the
fleeing troops brought a fatal disease to all cities they
encountered (Schaab, 1835). This epidemic was described
displaying the symptoms of a typhoid fever (Holtmeyer,
1923) but the species of the pathogen remains unclear.
HISTORICAL TYPHOID FEVER EPIDEMICS
The assumptions about the typhoid fever epidemic as
cause of death of the individuals could be proven by evidence of specific pathogen DNA in the bones, throwing
light on the possible cause of death. In historical times
the diagnose ‘‘typhoid fever’’ was a generic term for a lot
C 2011
V
WILEY-LISS, INC.
C
Grant sponsor: Department of Historical Anthropology.
*Correspondence to: Philipp v. Grumbkow, Institute of Zoology and
Anthropology, Department of Historical Anthropology and Human
Ecology, Georg-August-University Goettingen, Buergerstraße 50,
37073 Goettingen, Germany. E-mail: pgrumbk@gwdg.de
Received 26 March 2011; accepted 18 April 2011
DOI 10.1002/ajpa.21551
Published online 27 June 2011 in Wiley Online Library
(wileyonlinelibrary.com).
135
BARTONELLA INFECTIONS IN SKELETONS
TABLE 1. Primers used for targeting bacterial specific DNA
System
Primer
Sequence (50 –30 )
Length (bp)
Species
16S rDNA
Upper
Lower
Upper
Lower
Upper
Lower
Upper
Lower
Upper
Lower
TTCTCGGGCCTTGTACACAC
CCCCTACGGCTACCTTGTTAC
CCGGAAATGATATTCTCTCACA
GTAAACCATTTCATTCTGGATATTATAG
GGTGAATGTGGCTGTTTCTCAG
TGCATCTTCGCCAGTGAGATAT
GGCAGTTTCAAGATATTTTCTCCATGT
GCACGCACAATAAAATGATCTGTCA
CATCAGGGGCAGTGTTTGAATCTAATC
CGCCTTGGGTTATTTTGTTTGATGTA
136
All bacteria
150
Salmonella spec.
125
S. typhi
142
B. quintana
115
R. prowazekii
STY0312
STY0316
hbpE
dnaA
GeneBank references: Salmonella typhi: NC_003198; Salmonella paratyphi A: NC_006511; R. prowazekii: AJ 235272; B. quintana:
AY 126675.
METHODS AND MATERIALS
Contamination prevention
Taking commonly applied precautions (e.g., Hummel,
2003), the DNA analysis of the bones was carried out
under strict conditions, such as separation of pre- and
post-PCR laboratories and the use of disposable protective clothing, glasses, and disposable gloves, to avoid
contamination with external, modern DNA. All experiments took place with disposable laboratory ware, such
as pipette tips and cups, while workbenches and other
laboratory equipment were cleaned with detergents
(AlconoxTM Detergent, Aldrich, Germany), bi-distillated
water, and ethanol before use for each sample to avoid
cross-contamination. In accordance with the recommendations of Tamariz et al. (2006), all disposable ware and
most solutions, buffers, and MgCl2 were irradiated with
ultraviolet light at a short distance employing aluminum
foil coating. Negative PCR and extraction controls as
well as positive controls were employed in this study.
To avoid contamination with positive control DNA it
was handled strictly separated from the DNA extracts of
the individuals. The bones of the individuals were stored
in a separate building to the PCR laboratory; DNA
extraction took place in a separate laboratory only used
for extraction where control DNA was never present and
even before any control DNA of the investigated species
arrived at the PCR laboratory. The positive controls
were stored separately to the DNA extracts in a different
fridge only used for control DNA; only after pipetting
the settings of the DNA extracts of the bones and after
these left the pre-PCR laboratory for cycling the settings
with control DNA were pipetted. When positive control
DNA has been pipetted, no further testing on the ancient samples took place on the same day.
Sample preparation and DNA extraction
For this study, a commingled sample size of the
original finding was accessible for investigation. In this
sample a total number of 18 individuals, represented by
femora or humeri, could be identified and assembled
through morphological examination.
After morphological examination we took a small sample of the diaphysis of every right femur and in two
cases of the right humeri. After removal of the surface
with an electric drill with a diamond-tipped saw blade
(K10, KaVo, Germany) under an air exhauster, the bone
samples were taken to a second laboratory used only for
DNA extraction and were mechanically ground to pow-
der. About 0.2g of the powder was used for DNA extraction following a standardized protocol as described in
Fehren-Schmitz et al. (2010). After incubation with 500
ll EDTA (0.5 M, pH 8.3) for 18 h at 378C under constant
inversion in a sample tube rotator we added 12 ll Proteinase K (20 mg ml21, Qiagen, Germany) and incubated
further for 2 h at 568C under constant agitation. After
centrifugation at 6,000 rpm for 5 min, 200 ll of the supernatant were used for automated DNA extraction with
the Biorobot1 EZ1 (Qiagen, Germany) following the forensic protocol for trace samples. The elution volume was
50 ll; the DNA extract was stored at 2208C. We carried
out two independent DNA extractions for each individual
to permit authentication of the analysis results by
means of comparison.
When working with skeletal remains excavated from
soil, the DNA of soil-inhabiting bacteria might cause
false-positive PCR results (Baron et al., 1996). To test
the specificity of the primers and avoid false positive
results we collected soil samples from the ground where
the bones had been found. In accordance with current
protocols (LaMontange, 2002; Maciel, 2009; Wu, 2009),
four settings of 0.2 g of fine soil were incubated in G2
buffer (Qiagen) and 10 ll lysozyme (10 mg ml21, Sigma
Aldrich) at 378C for 1 h. After additional incubation with
10 ll Proteinase K (20 mg ml21, Qiagen) at 568C for 2 h
100 ll SDS solution (10 mg ml21) were pipetted to the
setting and heated to 658C for 5 min under constant agitation. After centrifugation at 6,000 rpm for 5 min, the
following extraction was done as mentioned above, the
elution volume was 100 ll.
PCR parameters
Bacterial-specific primers were developed based on literature (Andersson et al., 1998; Raoult et al., 2006;
Nagarajan et al., 2009) targeting specific genes of each
species (cf. Table 1). Two different multiplex PCR settings each for two species were designed. The reaction
volume in each setting was 25 ll, containing 13 AmpliTaq1 Gold 360 master mix (ABI), 0.4 lM of each primer,
and 10.5 ll DNA extract of femur or humerus samples.
The first setting for the two species of Salmonella was
carried out under the following conditions: initialization
958C for 5 min; 5 cycles at 958C for 1 min; 578C for 1
min; 728C for 2 min; followed by 55 cycles at 958C for 0.5
min; 578C for 1 min; and 728C for 2 min. The second setting for the species of Bartonella and Rickettsia was carried out under the same conditions except that the
annealing temperature was set to 658C. In each setting,
American Journal of Physical Anthropology
136
P.v. GRUMBKOW ET AL.
Fig. 1. Alignment of the hbpE-sequence of Bartonella quintana and four amplified products of the femoral DNA extracts (KS-Fe
#) as well as two positive samples (B. quintana 10-2 resp. 11). Numbers 5 nucleotide positions relative to the hbpE gene
(AY126675).
the amplified products vary in length in a way that enables them to be distinguished by means of high-resolution agarose gel electrophoresis. To verify the specificity
of the PCR products, they were sequenced: after the
PCR success and product quantity were checked by
agarose gel electrophoresis, further purification and
sequencing were carried out with commercial kits
(MinElute1 PCR Purification Kit, Qiagen and NucleoSeq
Kit, Macherey-Nagel) as specified by the manufacturers.
BLAST analysis (http://blast.ncbi.nlm.nih.gov/Blast.cgi)
of the analyzed sequences was carried out to confirm
that the sequences are found only in the specific pathogen genome.
To avoid false positive results, soil samples from the
bones were collected and DNA extracts of these were
co-amplified, along with human control DNA K562
(Promega) serving as negative controls. To identify possible inhibitors, PCR settings of randomly chosen DNA
extracts of the sample material were spiked with small
amounts of serially diluted bacterial-positive control
DNA. In cases of potent inhibitor presence, the sensitivity of the PCR assay was expected to decrease.
RESULTS
From three different bone samples, the specific fragment of Bartonella quintana could be amplified repeatedly. In the cases of the femora No. 4 and 32, two of
three settings using different DNA extracts were positive; femur No. 2, two out of five. Sequence analysis
showed the expected sequence of the hpbE-gene (see Fig.
1) and the BLAST analysis confirmed that it is unique to
Bartonella quintana.
No products from the ancient samples could be amplified in the settings for Salmonella spp. Also, no specific
product of Rickettsia prowazekii fragments could be
amplified. All negative controls showed no specific PCR
products, while amplification with positive controls and
spiked samples always showed the expected products.
DISCUSSION
In this study we found specific DNA of Bartonella
quintana in DNA extracts of three individuals of a historical mass grave which may be linked to an epidemic
event. Even though we used control DNA in our study,
the precautions taken and the reproducibility of the
results make it highly unlikely that the amplifications
are modern contaminations. Further, the species of
Bartonella is unable to live outside of a host, contamination of the remains through soil is impossible.
Although we investigated only one gene, the hbpE-gene
sequence is specific for Bartonella quintana only and
not known in other species as confirmed by BLASTanalysis. The positive amplification of a specific DNA
American Journal of Physical Anthropology
fragment of Bartonella quintana in the DNA extracts
of bone samples suggest that the pathogen had infected
the individuals during their lifetimes. However, further
tests, e.g., shorter fragments targeting polymorphic
genes of Bartonella quintana, are needed to confirm
these results.
The absence of evidence of Bartonella in the other 15
individuals as well as Salmonella spp. and Rickettsia is
not the evidence of their absence. As pointed out by various authors (e.g., Gilbert et al., 2004) negative amplification results can have numerous reasons. In this study
we included tests for possible PCR inhibitors by spiking
different settings with serial diluted control DNA but
the sensitivity of the PCR assay did not decrease, ruling
out inhibitors as cause of PCR failure. In addition, total
DNA degradation is unlikely because the fragment of
Bartonella is the second longest in our setting and only
eight base pairs shorter than this of Rickettsia. As
mentioned above, further tests including, e.g., smaller
fragment sizes are needed to answer the question if the
investigated pathogens did indeed never infect the individuals and so are not the causes of the historical
epidemic.
Trench fever spreads easily through its vector, the
body louse (Pediculus humanus humanus), when many
people live in close contact. The assumed time of death,
winter 1813/14 after the Napoleonic wars, would also
support the spreading because clothes were necessary
for survival and the acquirement of clothes of dead people in times of need is not exceptional. Further, people
who are frail or in poor health, in particular, have a
high risk of death if they do not receive appropriate care
(Foucault et al., 2006). An infection with B. quintana
can cause bacillary angiomatosis even in immunocompetent individuals (Zarraga et al., 2011). Nonetheless,
detection of B. quintana is not necessarily indicative of
the cause of death of the individuals. B. quintana has
been found—together with other pathogens—in a number of historical mass graves related to different epidemics, e.g., plague (Yersinia pestis, Tran et al., 2011) and
typhoid fever (Rickettsia prowazekii, Raoult et al., 2006).
Drancourt and Le Forestier detected a B. quintana and
Y. pestis co-infection in individuals excavated from a burial site near Paris dating to the 11th–15th centuries
(unpublished data). The frequent finding of B. quintana
together with other, more deadly pathogens throughout
the centuries could indicate a high prevalence of this
species in historical times, not causing the high death
toll of these epidemics in the first place.
As for the historical mass grave of Kassel, trench fever
has the prerequisites to become a major epidemic causing many deaths among the defeated troops and the
encountered cities’ populations. Whether it was the sole
cause or whether this epidemic was a mixture of different pathogens remains unclear.
BARTONELLA INFECTIONS IN SKELETONS
ACKNOWLEDGMENTS
The authors thank Prof. Siv Andersson of the University of Uppsala, Sweden for providing positive control
samples.
LITERATURE CITED
Andersson SGE, Zomorodipour A, Andersson JO, SicheritzPonten T, Alsmark UCM, Podowski RM, Naeslund AK,
Eriksson AS, Winkler HH, Kurland CG. 1998. The genome
sequence of Rickettsia prowazekii and the origin of mitochondria. Nature 396:133–140.
Baron H, Hummel S, Herrmann B. 1996. Mycobacterium tuberculosis complex DNA in ancient human bones. J Archaeol Sci
23:667–671.
Bechah Y, Capo C, Mege JL, Raoult D. 2008. Epidemic typhus.
Lancet Infect Dis 8:417–426.
Dettmar W. 1983. Die Zerstörung Kassels im Oktober 1943.
Hesse, Fuldabrueck: Hesse GmbH.
Fehren-Schmitz L, Reindel M, Cagigao ET, Hummel S,
Herrmann B. 2010. Pre-Columbian population dynamics in
coastal southern Peru: a diachronic investigation of mtDNA
patterns in the Palpa region by ancient DNA analysis. Am J
Phys Anthropol 141:208–221.
Foucault C, Brouqui P, Raoult D. 2006. Bartonella quintana
characteristics and clinical management. Emerg Infect Dis
12:217–223.
Gilbert MT, Cuccui J, White W, Lynnerup N, Titball RW, Cooper
A, Prentice MB. 2004. Absence of Yersinia pestis-specific DNA
in human teeth from five European excavations of putative
plague victims. Microbiology 150:341–354.
Holtmeyer A. 1923. Die Bau- und Kunstdenkmäler im Regierungsbezirk Cassel, Vol.6. Kreis Cassel-Stadt: Selbstverlag der
Landesverwaltung. p 545–546.
Hummel S. 2003. Ancient DNA typing: methods, strategies and
applications. Berlin: Springer.
137
LaMontagne MG, Michel FC Jr, Holden PA, Reddy CA. 2002.
Evaluation of extraction and purification methods for obtaining PCR-amplifiable DNA from compost for microbial community analysis. J Microbiol Methods 49:255–264.
Maciel BM, Santos ACF, Dias JCT, Vidal RO, Dias RJC, Gross
E, Cascardo JCM, Rezende RP. 2009. Simple DNA extraction
protocol for a 16S rDNA study of bacterial diversity in tropical landfarm soil for bioremediation of oil waste. Genet Mol
Res 8:375–388.
Nagarajan A, Karnam G, Lahiri A, Allam U, Chakravortty D.
2009. Reliable means of diagnosis and serovar determination
of blood-borne Salmonella strains: quick PCR amplification of
unique genomic loci by novel primer sets. J Clin Microbiol
47:2435–2441.
Raoult D, Dutour O, Houhamdi L, Jankauskas R, Fournier P-E,
Ardagna Y, Drancourt M, Signoli M, Dang La V, Macia Y,
Aboudharam G. 2006. Evidence for louse-transmitted diseases
in soldiers of Napoleon’s grand army in Vilnius. J Infect Dis
193:112–120.
Schaab KA. 1835. Die Geschichte der Bundes-Festung Mainz,
historisch und militärisch nach den Quellen bearbeitet. Mainz.
Seddon D. 2004. Sir William Jenner (1815–1898) and Queen
Victoria. J Med Biogr 12:161–163.
Tamariz J, Voynarosvka K, Prinz M, Caragine T. 2006. The
application of ultraviolet irradiation to exogenous sources of
DNA in plasticware and water for the amplification of low
copy number DNA. J Forensic Sci 51:790–794.
Tran TN, Signoli M, Fozzati L, Aboudharam G, Raoult D,
Drancourt M. 2011. High throughput, multiplexed pathogen
detection authenticates plague waves in medieval Venice,
Italy. PLoS One 6:e16735.
Wu L, Li F, Deng C, Xu D, Jiang S, Xiong Y. 2009. A method for
obtaining DNA from compost. Appl Microbiol Biotechnol
84:389–395.
Zarraga M, Rosen L, Herschthal D. 2011. Bacillary angiomatosis
in an immunocompetent child: a case report and review of
the literature. Am J Dermatopathol. Epub ahead of print.
doi: 10.1097/DAD.06013e3181ec846a.
American Journal of Physical Anthropology
Документ
Категория
Без категории
Просмотров
0
Размер файла
150 Кб
Теги
mass, german, grave, evidence, historical, skeleton, brief, communication, kassel, infectious, bartonella, quintana
1/--страниц
Пожаловаться на содержимое документа