close

Вход

Забыли?

вход по аккаунту

?

Brief communication Molecular analysis of the Kwday Dn Ts'finchi ancient remains found in a glacier in Canada.

код для вставкиСкачать
AMERICAN JOURNAL OF PHYSICAL ANTHROPOLOGY 119:288 –291 (2002)
Brief Communication: Molecular Analysis of the
Kwäday Dän Ts’ı̀nchi Ancient Remains Found in a
Glacier in Canada
M. Victoria Monsalve,1* Anne C. Stone,2 Cecil M. Lewis,2 Allan Rempel,1 Michael Richards,3
Dan Straathof,1 and Dana V. Devine1,4
1
Department of Pathology and Laboratory Medicine, University of British Columbia, Vancouver,
British Columbia V6T 2B5, Canada
2
Department of Anthropology, University of New Mexico, Albuquerque, New Mexico 87131-1086
3
Department of Archaeological Sciences, University of Bradford, Bradford, UK BD7 1DP
4
Canadian Blood Services, Vancouver, British Columbia V6T 2B5, Canada
KEY WORDS
ancient DNA; Native American; mtDNA haplogroups; control region;
biochemical analysis
ABSTRACT
DNA was extracted from the frozen remains of a man found in the northwest corner of British
Columbia, Canada, in 1999. His clothing was radiocarbondated at ca. 550 years old. Nitrogen and carbon content in
whole bone and collagen-type residue extracted from both
bone and muscle indicated good preservation of proteinaceous macromolecules. Restriction enzyme analysis of
mitochondrial DNA (mtDNA) determined that the remains belong to haplogroup A, one of the four major Native American mtDNA haplogroups. Data obtained by
PCR direct sequencing of the mtDNA control region, and
by sequencing the clones from overlapping PCR products,
were duplicated by an independent laboratory. Comparison of these mtDNA sequences with those of North American, Central American, South American, East Siberian,
Greenlandic, and Northeast Asian populations indicates
that the remains share an mtDNA type with North American, Central American, and South American populations.
Am J Phys Anthropol 119:288 –291, 2002.
In August 1999, the frozen remains of a man were
found on a glacier in Canada’s Tatshenshini-Alsek
Park near the Pacific coast border with Alaska. His
clothing was radiocarbon-dated at 500 ⫾ 30 BP (Beattie et al., 2000). The local Champagne-Aishihik
people named the remains “Kwäday Dän Ts’ı̀nchi”
(KDT), i.e., Long-Ago Person Found. With the consent of a committee comprised of First Nations representatives and British Columbia’s Archaeology
Branch, we extracted mitochondrial DNA (mtDNA)
from KDT hard and soft tissues and determined that
his mtDNA belongs to haplogroup A, one of the four
common Native American haplogroups.
It is generally accepted that the first people to
move into North America passed over the Bering
land bridge at the end of the Pleistocene, ⬃12,000 –
31,000 years ago (Marshall, 2001). The descendants
of the first inhabitants eventually formed the Pacific
Northwest populations and fall into at least three
linguistic groups (Greenberg, 1987). The Tlinglit
and Athabaskan are Na-Dene, while the Haida
speak an isolated language, although they have genetic affinities with Na-Dene speakers (Shields et
al., 1993). The Tsimshian, Nuu-Chah-Nulth, and
Bella Coola, also inhabitants of the Northwest Pacific coast, speak Amerindian languages. The Champagne-Aishihik First Nations aboriginal language is
Tutchone, a member of the Athabaskan language
family.
MATERIALS AND METHODS
©
2002 WILEY-LISS, INC.
©
2002 Wiley-Liss, Inc.
The protocol and consent form for the study of
ancient human remains were reviewed by the Clinical Research Ethics Board Committee at the University of British Columbia. To minimize risk of
contamination by contemporary DNA, we were provided first access to the KDT remains to take tissue
samples for DNA extraction. Pieces of the upper left
humerus and overlying muscle were selected for
their excellent preservation, and removed under
sterile conditions. The bone sample was split into
two pieces of 100 mg and 200 mg to provide for DNA
extraction in separate laboratories.
Grant sponsor: British Columbia Heritage Trust.
*Correspondence to: Maria Victoria Monsalve, Ph.D., Department
of Pathology and Laboratory Medicine, 2211 Wesbrook Mall, University of British Columbia, Vancouver BC V6T 2B5, Canada.
E-mail: monsalve@interchange.ubc.ca
Received 15 August 2001; accepted 15 March 2002.
DOI 10.1002/ajpa.10116
Published online in Wiley InterScience (www.interscience.wiley.
com).
MTDNA OF 530-YEAR-OLD HUMAN REMAINS
Macromolecules analysis
To determine the presence of proteinaceous material in the samples, the percentage of nitrogen (%N)
and percentage of carbon (%C) contents of two aliquots of the bone and one aliquot of the muscle
tissue were measured. The preservation of macromolecules was assessed by measuring the nitrogen
and carbon content of whole bone and extracted
collagen-type residue, using an elemental analyzer
(Ovchinnikov et al., 2000). Collagen was extracted
from the two bone samples and muscle sample, using methods outlined elsewhere (Richards et al.,
2000), with the addition of a chloroform:methanol
lipid extraction for one bone sample and the muscle
sample. The percentage of carbon and nitrogen in
the extracted collagen was also assessed (Ambrose,
1990).
DNA extraction, amplification, and sequencing
Standard precautions were taken to minimize
contamination from contemporary sources. After removal of superficial tissue, the bone was ground in a
freezer mill and the muscle in a mortar refrigerated
with liquid nitrogen. As a control for extraction of
the bone DNA, parallel grinding and extraction of
DNA from the antler bone from a moose found near
the remains were carried out. An extraction without
any sample was also done as a control on each occasion. Two extractions of DNA from the bone and one
from the muscle were done separately. The DNA
extraction methods used for the humerus and muscle were described elsewhere (Hagelberg and Clegg,
1991; Guhl et al., 1999; Yang et al., 1998). The
aqueous phase was concentrated and purified with
sequential additions to Centricon-30 microconcentrators (Amicon). To screen for the markers that
define the four major haplogroups in Native Americans (Torroni et al., 1992), the DNA samples were
subjected to PCR amplification and subsequent restriction enzyme analysis, as previously described
(Monsalve et al., 1994). Double-stranded PCR fragments of the mtDNA control region were amplified,
using the primer pairs L15996 (5⬘CTCCACCATTAGCACCCAAAG) (Ward et al., 1991) and H16218
(GATTGCTGTACTTGCTTGTA) (Handt et al.,
1996), L16192 (CCATGCTTACAAGCAAGT) and
H16401 (5⬘TGATTTCACGGAGGATGGTG) (Higuchi et al., 1988), and L16131 (5⬘CACCATGAATATTGTACGGT) and H16303 (TGGCTTTATGTACTATGTAC) (Handt et al., 1996). PCR amplification
of 1 ␮L of DNA was performed in a 25-␮L reaction
volume containing 200 ␮M of each dNTP (Pharmacia), 2.0 mM MgCl2, 2 mg/mL BSA (Boehringer
Mannheim), 20 pmol of each primer, and 1.0 unit of
Taq DNA polymerase (BRL). Amplification consisted of 40 cycles of 94°C (40 sec), 55°C (20 sec), and
72°C (1 min); the denaturation step of the first cycle
was lengthened to 5 min to ensure complete denaturation of the template, and the final extension step
was 10 min. Amplification products were electrophoresed on 2% agarose gels to separate nonspecific
289
amplification products and excess primers; excised
bands were purified using QIAquick Gel Extraction
Kit (Qiagen). Sequencing reactions were done in a
thermocycler DNA with 90 ng of DNA template and
3.2 pmol primer, using the ABI BigDye Terminator
Cycle Sequencing Kit (PE Applied Biosystems). Dyebased DNA sequencing was done in an Applied Biosystem ABI PRISM 378 DNA Sequencer with a long
read protocol. DNA sequence data obtained from the
three samples on separate occasions were unambiguous.
At the University of New Mexico, DNA was extracted as described (Hoss and Pääbo, 1993) followed by PCR using 5 sets of primers: L16055 and
H16142, L16131 and H16218, L16209 and H16303,
L16287 and H16356, and L16347 and H16410
(Handt et al., 1996; Stone and Stoneking, 1998).
Each 30-␮L PCR contained 5 ␮L of DNA extract, 1
unit of AmpliTaq Gold polymerase (Roche Molecular
Systems), 10 mM Tris HCL (pH 8.3), 50 mM KCL,
0.1 mM each of the four deoxyribonucleotide triphosphates (Pharmacia), 2.5 mM MgCl2, 2 mg/mL BSA
(Boehringer Mannheim), and 0.2 mM of each
primer. Forty cycles of PCR were carried out (30 sec
at 94°C, 30 sec at 54°C, and 30 sec at 72°C) in an MJ
Research PTC 200 cycler. Eight microliters were
electrophoresed in 2.8% NuSieve (FMC) agarose
gels. PCR product bands were excised from the gel
and used for reamplification, as described by Stone
and Stoneking (1998). The reamplified DNA was
purified with Qiagen QIAquick-spin columns. The
purified products were then sequenced with the ABI
Prism Big Dye Sequencing Kit (PE Applied Biosystems) and a model 377 DNA sequencer. The sequence reported in this paper has been deposited in
the GenBank database (accession no. AF 502945).
RESULTS AND DISCUSSION
Modern bone has a bulk %N value of 3– 4% due to
the presence of proteinaceous material. Measurement of the KDT sample provided bulk %N values of
1.5% and 1.6% in the two pieces of bone and 0.8% in
the muscle tissue, which indicated the presence of
relatively large amounts of proteinaceous material.
The %C was 51.1% and 52.6% in the pieces of bone,
and 25.3% in the muscle. Determination of macromolecules in the collagen alone can also indicate preservation of the samples. Collagen extracted from modern
bovine tendon (sigma collagen) was 15.2–16.7%N and
47.0 – 47.6%C (Richards, 1998). Collagen extracted
from the two bone samples had %C values of 47% and
42%, and %N values of 17 % and 16%, and collagen
extracted from the muscle sample had 42%C and 14
%N. These are all similar to the modern bovine samples, and therefore indicate the presence of good-quality collagen (Richards et al., 2000; Richards, 1998).
Modern bone is approximately 20% collagen by mass,
and the two bone samples yielded 18.7% and 19.2%
collagen-type material, while the muscle sample
yielded 3.7% collagen-type material.
The ⫹663HaeIII, ⫹5176AluI, and ⫹13259HincII
sites and the absence of the 9-bp deletion catego-
290
M.V. MONSALVE ET AL.
rized the DNA of these human remains as belonging
to haplogroup A, one of the major mtDNA haplogroups identified in Native Americans (Torroni et
al., 1992).
All Native American Natives have been categorized as belonging to mtDNA haplogroups A, B, C, or
D (Torroni et al., 1993), or X (Brown et al., 1998).
Haplogroup A is the most common in the North
America Natives. It is found in the highest frequencies in the Dogrib Continental Na-Dene (Torroni et
al., 1993) and in the Haida from the Queen Charlotte Islands (Torroni et al., 1993); both groups are
inhabitants of the Northwest Pacific coast. This haplogroup is also found in high frequencies in Central
American Natives (Torroni et al., 1994). The frequency is lower in South America and is not found in
some groups from the Amazon (Torroni et al., 1993)
and the Andes (Lalueza-Fox, 1996). This haplogroup
has also been found in ancient remains from the
Norris Farms Oneota in North America (Stone and
Stoneking, 1998) and in ancient remains from South
America (Monsalve et al., 1996). This haplogroup is
not restricted to any linguistic or ethnic group.
Thus, there is no reason to conclude that the remains are not of an ancestor of the contemporary
people of the region.
The presence of haplogroup A in the KDT remains
suggests that he is one of the descendants of the first
inhabitants who arrived from Asia. Haplogroups
A–D have been found in Asian populations (Torroni
et al., 1993). Haplotype X, on the other hand, has not
been found in Asian populations, and it has been
postulated that this mtDNA was brought to Beringia/
America by the eastward migration of people who were
also ancestral to Europeans (Brown et al., 1998).
A total of 405 bp of the hypervariable region I
(HVRI) on the mtDNA was amplified with three overlapping polymerase chain reaction (PCR) fragments
with lengths of 222 bp, 209 bp, and 172 bp. Products
from independent PCR amplifications from the 222-bp
and 209-bp fragments from the humerus were also
cloned into pBluescript vector and sequenced (Fig. 1).
Comparison of a 362-bp fragment of the control region
HVRI with the reference sequence (Anderson et al.,
1981) revealed 16111T, 16189C, 16223T, 16290T,
16319A, and 16362C polymorphisms. These six substitutions were found in 1 of 41 Haida analyzed (Ward
et al., 1993). An extension of the survey of the HVRI
control region in Native Americans from Central and
South America indicated that only 1 Amerindian
Maya of 3 (Torroni et al., 1993), 1 Amerindian Quiche
of 30 (Boles et al., 1995), and 3 of 247 unrelated Brazilian individuals (Alves-Silva et al., 2000) shared this
sequence. The cloned PCR contained all the substitutions that were detected by direct sequencing; one
additional 16113G transition was present in one clone
only. The 16189C transition was present in the PCR
direct sequence products and the clones analyzed.
Length differences in the cytosine homopolymer at
position 16184–16193 were found in association with
the 16189C transition. This transition produces an
interrupted string of 10 Cs that is copied with low
Fig. 1. Variable sites in DNA sequences obtained from PCR
amplification of overlapping fragments. P1–P8 correspond to
fragments from PCR direct sequences. A1–A6 and B1–B4 are
fragments from cloned PCR products. Human reference sequence
is included for comparison (Anderson et al., 1981).
fidelity during mtDNA replication (Bendall and Sykes,
1995). Cloning and sequencing showed that individuals with a 16189C transition had extensive length
heteroplasmy in the homopolymeric tract (Bendall and
Sykes, 1995). Two of 6 clones presented a string of 11
Cs, and one a string of 9 Cs, indicating the existence of
heteroplasmy in the homopolymeric tract in these remains. Both template strands gave the same result.
Alternatively, it could reflect errors that arose during
cloning. To independently confirm the results of the
DNA analysis, a piece of the bone was analyzed at the
University of New Mexico. The results corroborated
those collected at the University of British Columbia.
In addition, the KDT sequence did not match that of
any of the investigators.
The control region sequence resolves the RFLPdefined haplogroup into A1 and A2 types (Forster et
al., 1996). High frequencies of type A2 have been
found in American Eskimos, Haida, and Na-Dene
(Forster et al., 1996). Interestingly, the KDT remains present an A2-16189C sequence variant that
has been found throughout the Americas. It has not
yet been determined if this variant is common in the
contemporary inhabitants of the area where the remains were found.
The KDT remains were found in an area equidistant between two present-day aboriginal settlements: Klukwan, a Chilkat Tlingit community near
Haines, Alaska, and the Klukshu, a ChampagneAishihik First Nations settlement in the Yukon. A
woven hat made of plant fibers with an attached
MTDNA OF 530-YEAR-OLD HUMAN REMAINS
hide chinstrap, radiocarbon-dated AD 1405–1445,
was found in the vicinity of the body (Beattie et al.,
2000). Its brimmed conical shape is characteristic of
contemporary Northwest Pacific populations living
in this area (Holm, 1988). High frequencies of
mtDNA haplogroup A have been found in American
Eskimos, Athabaskans, Haida, and Bella Coola from
the northwest coast (Forster et al., 1996). Although
the KDT remains are unique and thus are not amenable to population-level analyses, these results as
well as the geographic location of the find suggest a
connection to modern populations in this region.
CONCLUSIONS
Ancient DNA authenticity was established by: 1)
verifying that nitrogen and carbon percentages in
the hard and soft tissues met requirements for preservation of proteinaceous material, 2) analyzing
mtDNA sequences from PCR fragments and cloning
products of overlapping fragments of the HVRI control region, and, 3) validating the humerus DNA
results in an independent laboratory.
Comparison of the KDT mtDNA sequences with
those of North American, Central American, South
American, East Siberian, Greenlandic, and Northeast Asian populations indicates that the remains
share an mtDNA type with the Haida of North
America, Maya and Quiche from Central America,
and Brazilians from South America.
ACKNOWLEDGMENTS
We thank the Kwäday Dän Ts’ı̀nchi Committee,
and in particular Al Mackie, for facilitating the execution of this project, Dr. Owen Beattie for his
constant support, and the British Columbia Royal
Museum. We are grateful to Helene Le Cordier, the
University of British Columbia Bureau for Forensic
Dentistry, and Jim Sibley for technical assistance.
The project was financially assisted by the Government of British Columbia through the British Columbia Heritage Trust.
LITERATURE CITED
Alves-Silva J, da Silva Santos M, Guimaraes PEM, Ferreira ACS,
Bandelt H-J, Pena SD, Ferreira Prado V. 2000. The ancestry of
Brazilian mtDNA lineages. Am J Hum Genet 67:444 – 461.
Ambrose SH. 1990. Preparation and characterization of bone and
tooth collagen for stable carbon and nitrogen isotope analysis. J
Archaeol Sci 17:431– 451.
Anderson S, Bankier AT, Barrell BG, de Bruijn MHL, Coulson
AR, Drouin J, Eperon IC, Nierlich DP, Roe BA, Sanger F,
Schreier H, Smith AJH, Staden R, Young IG. 1981. Sequence
and organization of the human mitochondrial genome. Nature
290:457– 474.
Beattie O, Apland B, Blake EW, Cosgrove JA, Gaunt S, Greer S,
Mackie AP, Mackie KE, Straathof D, Thorp V, Troffe PM. 2000.
The Kwäday Dän Ts’ı̀nchi discovery from a glacier in British
Columbia. Can J Archaeol 24:129 –148.
Bendall KE, Sykes BC. 1995. Length heteroplasmy in the first
hypervariable segment of the human mtDNA control region.
Am J Hum Genet 57:248 –259.
Boles TC, Snow CC, Stover E. 1995. Forensic DNA testing on
skeletal remains from mass graves: a pilot project in Guatemala. J Forensic Sci 40:349 –355.
Brown MD, Hosseini SH, Torroni A, Bandelt H-J, Allen JC,
Schurr TD, Scozzari R, Cruciani F, Wallace DC. 1998. MtDNA
291
haplogroup X: an ancient link between Europe/Western Asia
and North America? Am J Hum Genet 63:1852–1861.
Forster P, Harding R, Torroni A, Bandel H-J. 1996. Origin and
evolution of Native American mtDNA variation: a reapraisal.
Am J Hum Genet 59:935–945.
Greenberg J. 1987. Languages of the Americas. Stanford: Stanford University Press.
Guhl F, Jaramillo C, Vallejo GA, Yockteng R, Cardenas-Arroyo F.
1999. Isolation of Trypanosoma cruzi in 4,000-year-old mummified human tissue from Northern Chile. Am J Phys Anthropol 108:401– 407.
Hagelberg E, Clegg JB. 1991. Isolation and characterization of
DNA from archaeological bone. Proc R Soc Lond [Biol] 244:45–
50.
Handt O, Krings M, Ward RH, Pääbo S. 1996. The retrieval of
ancient human DNA sequences. Am J Hum Genet 59:368 –376.
Higuchi R, von Beroldigen CH, Sensabaugh GF, Erlich HA. 1988.
DNA typing from single hairs. Nature 332:543–546.
Holm B. 1988. Art and culture change at the Tlingit-Eskimo
border. In: Fitzhugh WW, Crowell A, editors. Crossroads of
continents. Cultures of Siberia and Alaska. Washington, DC:
Smithsonian Institute Press. p 281–293.
Hoss M, PäÃbo S. 1993. DNA extraction from Pleistocene bones
by a silica-based purification method. Nucleic Acid Res 221:
3913–3914.
Lalueza-Fox C. 1996. Mitochondrial DNA haplogroups in four
tribes from Tierra del Fuego-Patagonia: inferences about the
peopling of the Americas. Hum Biol 68:855– 871.
Marshall E. 2001. Pre-Clovis sites fight for acceptance. Science
291:1730 –1732.
Monsalve MV, Groot de Restrepo H, Espinel A, Correal G, Devine
DV. 1994. Evidence of mitochondrial DNA diversity in South
American aboriginals. Ann Hum Genet 58:265–273.
Monsalve MV, Cardenas F, Guhl F, Delaney AD, Devine DV.
1996. Phylogenetic analysis of mtDNA lineages in South American mummies. Ann Hum Genet 60:293–303.
Ovchinnikov IV, Götherström A, Romanova GP, Kharitonov VM,
Lidén K, Goodwin W. 2000. Molecular analysis of Neanderthal
DNA from the northern Caucasus. Nature 404:490 – 493.
Richards MP. 1998. Palaeodietary studies of European human
populations using bone stable isotopes. Unpublished Ph.D. thesis, University of Oxford, UK.
Richards MP, Pettitt PB, Trinkaus E, Smith FH, Karavani I,
Paunovic M, Karavanic I. 2000. Neanderthal diet at Vindija
and Neanderthal predation: the evidence from stable isotopes.
Proc Natl Acad Sci USA 97:7663–7666.
Shields GF, Schmiechen AM, Frazier BL, Redd A, Voevoda MI,
Reed JK, Ward RH. 1993. mtDNA sequences suggest a recent
evolutionary divergence for Beringian and northern North
American populations. Am J Hum Genet 53:549 –562.
Stone AC, Stoneking M. 1998. mtDNA analysis of a prehistoric
Oneota population: implications for the peopling of the New
World. Am J Hum Genet 62:1153–117.
Torroni A, Schurr TG, Yang CC, Szathmary EJ, Williams RC,
Schanfield MS, Troup GA, Knowler WC, Lawrence DN, Weiss
KM, Wallace DC. 1992. Native American mitochondrial DNA
analysis indicates that the Amerind and the Nadene populations were founded by two independent migrations. Genetics
130:153–162.
Torroni A, Schurr TG, Cabell MF, Brown MD. 1993. Asian affinities and continental radiation of the four founding native
American mtDNAs. Am J Hum Genet 53:563–590.
Torroni A, Neel JV, Barrantes R, Schurr TG, Wallace DC. 1994.
Mitochondrial DNA “clock” for the Amerinds and its implications for timing their entry into North America. Proc Natl Acad
Sci USA 91:1158 –1162.
Ward RH, Frazier BL, Dew-Jager K, Pääbo S. 1991. Extensive
mitochondrial diversity within a single Amerindian tribe. Proc
Natl Acad Sci USA 88:8720 – 8724.
Ward RH, Redd A, Valencia D, Frazier B, Pääbo S. 1993. Genetic
and linguistic differentiation in the Americas. Proc Natl Acad
Sci 90:10663–10667.
Yang DY, Eng B, Waye JS, Dudar JC, Saunders SR. 1998. Technical note: improved DNA extraction from ancient bones using
silica-based spin columns. Am J Phys Anthropol 105:539 –543.
Документ
Категория
Без категории
Просмотров
1
Размер файла
65 Кб
Теги
finch, molecular, found, glacier, brief, communication, remains, analysis, canada, kwday, ancient
1/--страниц
Пожаловаться на содержимое документа