close

Вход

Забыли?

вход по аккаунту

?

Brief communication Multiplex XY-PCR improves sex identification in aDNA analysis.

код для вставкиСкачать
AMERICAN JOURNAL OF PHYSICAL ANTHROPOLOGY 121:337–341 (2003)
Brief Communication: Multiplex X/Y-PCR Improves Sex
Identification in aDNA Analysis
Diane Schmidt,* Susanne Hummel, and Bernd Herrmann
Institute for Zoology and Anthropology, Historical Anthropology and Human Ecology, University Göttingen,
37073 Göttingen, Germany
KEY WORDS
PCR; sex identification; ancient DNA; degraded DNA; X-chromosome;
Y-chromosome; STR
ABSTRACT
This study introduces a polymerase chain
reaction (PCR)-based multiplex approach to improve the certainty of molecular sex identification on archaeological skeletal material. We coamplified amelogenin, two X-chromosomal short tandem repeats (STRs) (DXS6789 and
DXS9898), and two Y-specific STRs (DYS391 and DYS392).
The amplification results of this multiplex approach back
each other up, and enable a reliable sex identification. This
coamplification of X- and Y-specific markers in a multiplex
assay combines the added advantage of positive identification of both female and male individuals with raising the
validity of the diagnosis by obtaining multiple data simultaneously. This multiplex system was successfully applied to
3,000-year-old bone material. Am J Phys Anthropol 121:
337–341, 2003. © 2003 Wiley-Liss, Inc.
One of the questions first asked of excavated skeletal remains is its sex. Sex identification is one of the
most basic requirements for any reconstruction of
demographic and social structure in human populations. Morphological and morphometrical methods
(Herrmann et al., 1990) give reliable and consistent
results for adult individuals. However, for determining the sex of children, these methods are less reliable (Schutkowski, 1993).
The development of molecular methods, such as
the polymerase chain reaction (PCR), for analyzing
the remains of children as well as of adults for whom
only a partial skeleton remains, has led to significant improvements in sex determination. PCRbased sexing is a valuable tool for obtaining data in
archaeological studies on remains of infants, as was
demonstrated in the case of infanticide victims of a
Roman brothel where a bias toward males was
found (Faerman et al., 1997). Moreover, molecular
sex determination can also play an important role in
examining hypotheses based on data obtained with
other methods. An example is the investigation of
the early modern burial site Aegerten (Switzerland).
There, subjects of the study were stillborn and neonate individuals buried along the walls of the
church. Morphometrical sex determination showed
a clear female bias (Bacher et al., 1990). Therefore,
the question arose as to whether there was biased
mistreatment by the society towards female neonates. This hypothesis was rejected after PCR-based
sex determination. The results of molecular analysis
provided evidence for an equivalent balance of both
sexes (Lassen et al., 1997, 2000), and even revealed
a disproportion of male individuals that died during
the last trimester of pregnancy, similar to observations found in modern populations (e.g., Bartels et
al., 1990). For the molecular sex determination performed in those studies, the amelogenin gene (Nakahori et al., 1991; Mannucci et al., 1994; Bailey et
al., 1992; Lassen et al., 1995; Stone et al., 1996) was
amplified, exhibiting a length dimorphism for the Xand Y-chromosome (106 and 112 bp). Here, the advantage over earlier attempts to determine sex from
archaeological samples focusing on Y-specific markers (e.g., Hummel and Herrmann, 1991; Honda et
al., 2001) was in the simultaneous detection of both
an X- and Y-chromosomal sequence. Still, allelic
dropouts due to degradation of the DNA were found
to occur, potentially leading to incorrect determination of male individuals as females in cases of the
Y-chromosomal sequence failing to amplify. The
only way to decrease the rate of such false female
determinations was by increasing the number of
amplifications.
In this study, we also describe the use of molecular methods to determine the sex of archaeological
©
2003 WILEY-LISS, INC.
Grant sponsor: Bundesministerium für Bildung und Forschung.
*Correspondence to: Diane Schmidt, Institute for Zoology and Anthropology, Historical Anthropology and Human Ecology, University
Göttingen, Bürgerstrasse 50, 37073 Göttingen, Germany.
E-mail: shummel1@gwdg.de
Received 14 March 2002; accepted 15 August 2002.
DOI 10.1002/ajpa.10172
338
D. SCHMIDT ET AL.
TABLE 1. Primers used in this study: sequences, dye labelling, and allele ranges
Primer
Sequence (5⬘ to 3⬘)
Dye label
Repeats
(alleles)
Size of
alleles (bp)
DXS6789, upper
DXS6789, lower
DXS9898, upper
DXS9898, lower
Amelogenin, upper
Amelogenin, lower
DYS391, upper
DYS391, lower
DYS392, upper
DYS392, lower
GTTGGTACTTAATAAACCCTCTTTT
GGATCCCTAGAGGGACAGAA
CACACCTACAAAAGCTGAGATATAT
CATCCAGATAGACAGATCAATAGATT
CCCTGGGCTCTGTAAAGAATAGT
ATCAGAGCTTACACTGGGAAGCTG
TTGTGTATCTATTCATTCAATCATA
GGAATAAAATCTCCCTGG T
CAAGAAGGAAAACAAATTTTTT
GGATCATTAAACCTACCAATC
NED
14–25
120–164
HEX
8.3–15
130–155
HEX
X–Y
106–112
7–14
138–166
6–16
91–121
6FAM
6FAM
amplified ranged from 91–166 bp due to the new
primer design we conducted.
MATERIALS AND METHODS
Initially, the multiplex PCR system was tested on
modern saliva samples. Then it was applied to
3,000-year-old skeletal material from the Lichtenstein cave (a Bronze Age cave in the Harz Mountains) where extensive genetic analysis has already
been performed (Schultes, 2000), including a molecular sex determination through the analysis of the
amelogenin gene as a part of the AmpFlSTR Profiler
Plus™ kit (ABI).
Extraction
Fig. 1. Agarose gel, showing overall amplification success for
X-/Y-multiplex approach for historical samples from the Lichtenstein cave (DO). Amplification products ranged from 91–166 bp
(partially overlapping in size), below 75-bp primer dimers. MW, 1
kb (kilobase) molecular weight standard; bp, base pairs.
skeletal remains. However, our study focused on
improving the certainty of sexing by reducing false
interpretations due to allelic dropout in the
amelogenin system or those rare cases of a deletion
of its Y-chromosomal part (Santos et al., 1998). We
aimed to positively identify both females and males
by simultaneously analyzing several gonosomal
markers. For that purpose, a multiplex PCR was
used to amplify the amelogenin gene together with
two X- and two Y-specific short tandem repeats
(STRs). This strategy, of amplifying multiple X- and
Y-chromosomal sequences, has been used successfully in forensics (Pfitzinger et al., 1993; Tun et al.,
1999; Young et al., 2000; Honda et al., 2001), and is
recommended for archaeological investigations
(Brown, 1998). The multiplex PCR approach presented here is particularly suitable for application to
highly degraded DNA, as the lengths of the products
Saliva samples were extracted with Chelex 100™,
basically following the protocol described by Walsh
et al. (1991). The extraction of DNA from archaeological bone samples was performed using a phenol/
chloroform-based method (for details, see Baron et
al., 1996; Lassen et al., 1996). All precautions and
steps of sample preparation and extraction followed
laboratory routines for ancient DNA (aDNA) handling (Schmidt et al., 1995; Lassen et al., 1996; Gerstenberger et al., 1998).
PCR amplification for sex determination
Amelogenin was amplified revealing a sex-specific
length dimorphism. For the detection of the Y-chromosome, two polymorphic Y-specific markers
(DYS391 and DYS392; Kayser et al., 1997) were
amplified.1 For the detection of the X-chromosome,
the markers DXS6789 (Hering et al., 2001),
DXS9898 (Hering and Szibor, 2000) were used,
which are also polymorphic STRs. Males show only
one allele for each STR system. Females exhibit two
alleles, and due to the comparatively high heterozygosity (H) of the markers (H ⫽ 0.78 for DXS6789 and
0.75 for DXS9898), one might expect at least one of
the systems to be heterozygous in most individuals.
DXS6789 is located on the short arm of X-chromosome Xq22.3 (Hering et al., 2001). DXS9898 is found
at the Xq21.33 pericentric region (Hering and Szi-
1
The primer sequences used in this study are part of the diploma
thesis of Boris Mueller (Institute for Zoology and Anthropology, Historical Anthropology and Human Ecology, University Göttingen).
X/Y MULTIPLEX PCR FOR SEX IDENTIFICATION
339
Fig. 2. Electropherogram, showing amplification results for a male (DO 1911) and female (DO 3742) individual from the
Lichtenstein cave. Numbers (100, 139,150, 160, 200) on top of small peaks indicate size (in bp) of internal lane standard GS 500. In
male individual (top), in addition to amelogenin, the two Y-STRs (DYS391 and DYS392) ensure sex identification. In the female
(bottom), DO 3742, Y-chromosomal signals are completely absent, while both X loci (DXS6789 and DXS9898) are expressed as
heterozygous, which represents positive proof for female individuals.
bor, 2000). Thus, as degradation of DNA starts at
the telomeric ends of the chromosome (Hummel et
al., 1999), the possibility is assumed to be high for
amplifying both markers, even from severely degraded DNA. All amplifications were carried out
from at least two independent extracts of each individual.
Primer sequences and allele lengths are given in
Table 1.
Amplification parameters
F1–5 ␮l DNA extract was added to a mixture
containing KCl (50 mM), 10 mM Tris-HCl (GeneAmp 10 ⫻ PCR Buffer II, Applied Biosystems), 2
mM MgCl2, 2.5 U AmpliTaq Gold™, 200 ␮M dNTPs,
0.4 ␮M primer DXS6789, 0.2 ␮M primer DXS9898,
0.35 ␮M primer DYS391, 0.2 ␮M primer DYS392,
0.2 ␮M primer amelogenin.
Cycling parameters
Eleven min initial activation was followed by
50 –55 cycles of 40 sec denaturation at 94°C, 1 min
hybridization at 50°C and 1 min extension at 72°C,
followed by a final extension for 30 min at 60°C.
Detection
Overall amplification success was determined by
(2.5– 4%) agarose gel electrophoresis. The specific
detection and determination of the alleles were performed with ABI 373A stretch (Applied Biosystems),
employing the fragment length detection software
package 672 GENESCAN™ Analysis (Applied Biosystems).
RESULTS AND DISCUSSION
The initial investigation to test the primers on
recent samples was successful (data not shown).
Amplification of the historical samples also showed
good amplification results for all individuals (Figs. 1,
2). The sexing of historical samples was in full agreement with the earlier data (Schultes, 2000) our
study had reference to. Allele determinations for 11
individuals (7 females and 4 males) are shown in
Table 2. In our study, all female individuals were
heterozygous for at least one X-STR. In combination
with the absence of Y-chromosomal amplification
results, this supported the validity of the amelogenin results and ensured a positive sex determination
as female. This advantage of the coamplified X- and
Y-STRs confirming each other can be demonstrated
in the case of an ambiguous result for amelogenin in
a single PCR reaction of DO 3742 (female). There, in
addition to the clear signal for the X-allele, a weak
signal of the size of its Y-allele was detected. Since
there were simultaneously amplified heterozygous
results for both X-STRs and no Y-STR signals at all,
even for this single PCR, the sexing as female was
sure, in spite of the appearance of this (not reproducible) artifact.
The combined amplification of X- and Y-specific
markers enables ancient DNA investigators to reliably determine the biological sex even of skeletal
340
D. SCHMIDT ET AL.
TABLE 2. Allele determination from bronze age bone samples1
Sample/ref. sex from earlier study
DO
DO
DO
DO
DO
DO
DO
DO
DO
DO
DO
Amelogenin
DXS6789
DXS9898
DYS 392
DYS 391
X/X
X/Y
X/Y
X/Y
X/X
X/Y
X/X
X/X
X/X
X/X
X/X
15/21
21
24
21
15/(23)
20
21/23
20/21
20
20/23
(19)/20
8.3/11
13
8.3
8.3
12/14
12
8.3/12
8.3/13
12/14
8.3/14
11/12
⫺
⫺
11
11
⫺
11
⫺
⫺
⫺
⫺
⫺
⫺
11
11
11
⫺
11
⫺
⫺
⫺
⫺
⫺
26, ref.sex: X/X
58.3, ref.sex: X/Y
1076, ref.sex: X/Y
1102, ref.sex: X/Y
1500, ref.sex: X/X
1911, ref.sex: X/Y
2388, ref.sex: X/X
3742, ref.sex: X/X
3750, ref.sex: X/X
3756, ref.sex: X/X
R1, ref.sex: X/X
1
ref. sex, reference molecular sex determination performed in an earlier study (Schultes 2000) with the AmpFISTR Profiler Plus™.
Parentheses indicate alleles derived from weak signals. ⫺, no detectable amplification result for this system.
individuals who are preserved highly fragmented.
Even when the amelogenin marker only showed the
X-allele due to allelic dropout events, the presence of
the Y-STRs still proved this individual to be male.
The other way around, a female individual can be
diagnosed not only by the absence of the Y-allele of
amelogenin, but also by the complete absence of
Y-STRs. Additionally, in most cases, at least one of
the X-STRs will show a heterozygous result for females. Thus, the results of the markers in this PCR
confirm each other and will raise the accuracy of the
sex determination of skeletal remains not amenable
to morphological determination, as well as samples
with poor DNA preservation and possible allelic
dropouts.
Besides sex determination, another potential of
the markers used here should be mentioned: X- and
Y-STRs are polymorphic STRs with a structure similar to that of autosomal STRs, and are inherited as
haplotypes (Y-STRs) or in a haplotype-like way
(closely linked X-STRs), so that they can also be
used for extended kinship analysis (Schultes et al.,
1999; Gerstenberger et al, 1999), or in forensic deficiency cases (Hering et al., 2001).
ACKNOWLEDGMENTS
Samples were kindly provided by S. Flindt. We
thank Sandra Hering (Institut für Rechtsmedizin,
Dresden, Germany) for feedback on the choice of
X-markers.
LITERATURE CITED
Bacher R, Suter PJ, Eggenberger P, Ulrich-Bochsler S, Meyer L.
1990. Aegerten. Die spätrömischen Anlagen und der Friedhof
der Kirche Bürglen. Bern, Stuttgart: Haupt. p 98 –131.
Bailey DMD, Affara NA, Ferguson-Smith MA. 1992. The X-Y
homologous gene Amelogenin maps to the short arms of both
the X and Y chromosomes and is highly conserved in primates.
Genomics 14:203–205.
Baron H, Hummel S, Herrmann B. 1996. Mycobacterium tuberculosis complex DNA in ancient human bones. J Archaeol Sci
23:667– 671.
Bartels I, Hansmann I, Eiben B. 1990. Excess females in chromosomally normal spontaneous abortuses. Am J Med Genet
35:297–298.
Brown K. 1998. Gender and sex—what can ancient DNA tell us?
Ancient Biomol 2:3–15.
Faerman M, Kahila G, Smith P, Greenblatt C, Stager L, Filon D,
Oppenheim A. 1997. DNA analysis reveals the sex of infanticide victims. Nature 385:212–212.
Gerstenberger J, Hummel S, Herrmann B. 1998. Assignment of
an isolated skeletal element to the skeleton of Duke Christian
II through STR typing. Ancient Biomol 2:63– 68.
Gerstenberger J, Hummel S, Schultes T, Häck H, Herrmann B.
1999. Reconstruction of a historical genealogy by means of STR
analysis and Y-haplotyping of ancient DNA. Eur J Hum Genet
1999;7:469 – 677.
Hering S, Szibor R. 2000. Development of the X-linked tetrameric
microsatellite marker DXS9898 for forensic purposes. J Forensic Sci 45:929 –931.
Hering S, Kuhlisch E, Szobor R. 2001. Development of the Xlinked tetrameric microsatellite marker HumDXS6789 for forensic purposes. Forensic Sci Int 119:42– 46.
Herrmann B, Grupe G, Hummel S, Piepenbrink H, Schutkowski
H. 1990. Prähistorische Anthropologie. Leitfaden der Feld- und
Labormethoden. Heidelberg: Springer.
Honda K, Tun Z, Matoba R. 2001. DNA testing of the Klinefelter’s
syndrome in a criminal case using XY chromosomal STR multiplex-PCR. J Forensic Sci 46:1235–1238.
Hummel S, Herrmann B. 1991. Y-chromosome-specific DNA amplified in ancient human bone. Naturwissenschaften 78:266 –
267.
Hummel S, Herrmann B, Rameckers J. 1999. Proving the authenticity of ancient DNA by comparative genomic hybridization.
Naturwissenschaften 86:500 –503.
Kayser M, Caglia A, Corach D, Fretwell N, Gehrig C, Graziosi G,
Heidorn F, Herrmann S, Herzog B, Hidding M, Honda K,
Jobling M, Krawczak M, Leim K, Meuser S, Meyer E, Oesterreich W, Pandya A, Parson W, Penacino G, Perez-Lezaun A,
Piccinini A. 1997. Evaluation of Y-chromosomal STRs: a multicenter study. Int J Legal Med 110:125–133.
Lassen C, Hummel S, Herrmann B. 1995. Comparison of DNA
extraction and amplification from ancient human bone and
mummified soft tissue. Int J Legal Med 107:152–155.
Lassen C, Hummel S, Herrmann B. 1996. PCR based sex identification of ancient human bones by amplification of X- and
Y-chromosomal sequences: a comparison. Ancient Biomol 1:25–
33.
Lassen C, Hummel S, Herrmann B. 1997. Molekulare Geschlechtsbestimmung an Skelettresten früh- und neugeborener
Individuen des Gräberfeldes Aegerten, Schweiz. Anthropol Anz
55:183–191.
Lassen C, Hummel S, Herrmann B. 2000. Molecular sex identification of stillborn and neonate individuals (“Traufkinder”)
from the burial site Aegerten. Anthropol Anz 58:1– 8.
Mannucci A, Sullivan KM, Ivanov PL, Gill P. 1994. Forensic
application of a rapid and quantitative DNA sex test by amplification of the X-Y homologous gene amelogenin. Int J Legal
Med 106:190 –193.
X/Y MULTIPLEX PCR FOR SEX IDENTIFICATION
Nakahori Y, Takenaka O, Nakagome Y. 1991. A human X-Y
homologous
region
encodes
“Amelogenin”.
Genomics
9:264 –269.
Pfitzinger H, Ludes B, Mangin P. 1993. Sex determination of
forensic samples: co-amplification and simultaneous detection
of a Y-specific and an X-specific DNA sequence. Int J Legal Med
106:213–216.
Santos FR, Pandya A, Tyler-Smith C. 1998. Reliability of DNAbased sex tests. Nat Genet 18:103–103.
Schmidt T, Hummel S, Herrmann B. 1995. Evidence of contamination in PCR laboratory disposables. Naturwissenschaften
82:423– 431.
Schultes T. 2000. Typisierung alter DNA zur Rekonstruktion von
Verwandtschaft in einem bronzezeitlichen Skelettkollektiv.
Dissertation. Göttingen: Cuvellier.
Schultes T, Hummel S, Herrmann B. 1999. Amplification of Ychromosomal STRs from ancient skeletal material. Hum Genet
104:164 –166.
341
Schutkowski H. 1993. Sex determination of infant and juvenile
skeletons: I. morphognostic features. Am J Phys Anthropol
90:199 –205.
Stone AC, Milner GR, Pääbo S, Stoneking M. 1996. Sex determination of ancient human skeletons using DNA. Am J Phys
Anthropol 99:231–238.
Tun Z, Honda K, Nakatome M, Nakamura M, Shimada S,
Ogura Y, Kuroki H, Yamazaki M, Terada M, Matoba R. 1999.
Simultaneous detection of multiple STR loci on sex chromosomes for forensic testing of sex and identity. J Forensic Sci
44:772–777.
Walsh PS, Metzger DA, Higuchi R. 1991. Chelex 100 as a medium
for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques 10:506 –513.
Young DR, Tun Z, Honda K, Matoba R. 2000. Identifying sex
chromosome abnormalities in forensic DNA testing using
amelogenin and sex chromosome short tandem repeats. J Forensic Sci 46:346 –148.
Документ
Категория
Без категории
Просмотров
0
Размер файла
198 Кб
Теги
sex, pcr, adna, brief, communication, analysis, identification, multiple, improve
1/--страниц
Пожаловаться на содержимое документа