close

Вход

Забыли?

вход по аккаунту

?

Caspase-1Цprocessed interleukins in hyperoxia-induced cell death in the developing brain.

код для вставкиСкачать
Caspase-1–Processed Interleukins in
Hyperoxia-Induced Cell Death in the
Developing Brain
Ursula Felderhoff-Mueser, MD, PhD,1 Marco Sifringer,2 Oliver Polley,1 Mark Dzietko, MD,1
Birgit Leineweber, MD,1 Lieselotte Mahler,1 Michael Baier, PhD,3 Petra Bittigau, MD,2
Michael Obladen, MD, PhD,1 Chrysanthy Ikonomidou, MD, PhD,2 and Christoph Bührer, MD, PhD1
Infants born prematurely may develop neurocognitive deficits without an obvious cause. Oxygen, which is widely used
in neonatal medicine, constitutes one possible contributing neurotoxic factor, because it can trigger neuronal apoptosis in the developing brain of rodents. We hypothesized that two caspase-1–processed cytokines, interleukin (IL)–1␤
and IL-18, are involved in oxygen-induced neuronal cell death. Six-day-old Wistar rats or C57/BL6 mice were exposed
to 80% oxygen for various time periods (2, 6, 12, 24, and 48 hours). Neuronal cell death in the brain, as assessed by
Fluoro-Jade B and silver staining, peaked at 12 to 24 hours and was preceded by a marked increase in mRNA and
protein levels of caspase 1, IL-1␤, IL-18, and IL-18 receptor ␣ (IL-18R␣). Intraperitoneal injection of recombinant
human IL-18 –binding protein, a specific inhibitor of IL-18, attenuated hyperoxic brain injury. Mice deficient in IL-1
receptor–associated kinase 4 (IRAK-4), which is pivotal for both IL-1␤ and IL-18 signal transduction, were protected
against oxygen-mediated neurotoxicity. These findings causally link IL-1␤ and IL-18 to hyperoxia-induced cell death
in the immature brain. These cytokines might serve as useful targets for therapeutic approaches aimed at preserving
neuronal function in the immature brain, which is exquisitely sensitive to a variety of iatrogenic measures including
oxygen.
Ann Neurol 2005;57:50 –59
Advances in the understanding of fetal physiology have
resulted in markedly increased survival rates of premature infants.1,2 However, severe neurological impairments affect a considerable proportion of extremely
low-birth-weight infants.3
Oxygen contributes to the pathogenesis of bronchopulmonary dysplasia and retinopathy of prematurity, two major causes of the long-term morbidity of
infants born preterm.4 Previously, we reported that
exposure of immature rodents to hyperoxia triggers
diffuse apoptosis in various brain regions, associated
with oxidative stress and decreased activation of
neurotrophin-regulated pathways.5,6 Oxygen triggers
inflammatory responses, with production of cytokines
in various organs7,8 that have been implicated as
modulators of neurodegeneration.9
Caspase-1 (interleukin [IL]–1␤ converting enzyme)
catalyzes cleavage of the precursors of IL-1␤ and
IL-18 (interferon-␥–inducing factor) to fully bioactive
forms. Both cytokines are similar in structure, processing, and proinflammatory properties. Engagement
of IL-1␤ and IL-18 receptors (IL-1R, IL-18R) initiates a common intracellular signaling cascade in
which myeloid differentiation factor (MyD88) and
tumor necrosis factor–␣ receptor–associated factor 6
(TRAF6) serve as key adaptor proteins. Signaling between MyD88 and TRAF6 is mediated by members
of the IRAK family, with IRAK-4 being an essential
component in mediating downstream signals initiated
by IL-18R and, to a lesser extent, IL-1R.10 IL-18
binding protein (IL-18BP) constitutes a naturally oc-
From the 1Departments of Neonatology and 2Pediatric Neurology,
Charité, Campus Virchow Klinikum, Humboldt University; and the
3
Robert Koch Institute, Project Neurodegenerative Diseases, Berlin,
Germany.
Address correspondence to Dr Felderhoff-Mueser, Department of
Neonatology, Charité, Campus Virchow-Klinikum, University
Medical Center, Augustenburger Platz 1, D-13353 Berlin, Germany. E-mail: ursula.felderhoff@charite.de
Received Jun 16, 2004, and in revised form Aug 20. Accepted for
publication Sep 16, 2004.
Published online Dec 27, 2004, in Wiley InterScience
(www.interscience.wiley.com). DOI: 10.1002/ana.20322
50
© 2004 American Neurological Association
Published by Wiley-Liss, Inc., through Wiley Subscription Services
Table 1. Sequences of Primers Used for Semiquantitative RT-PCR Analysis
Primer
Caspase-1
IL-1␤
IL-18
IL-18R␣
␤-actin
Primer
Location
Sequence (5⬘-3⬘)
Size (bp)
GenBank
Accession No.
661–681
979–999
522–542
836–856
90–109
468–487
1276–1296
1515–1535
1663–1687
2535–2559
CCAGAGCACAAGACTTCTGAC
TGGTGTTGAAGAGCAGAAAGC
GACAGAACATAAGCCAACAAG
GTCAACTATGTCCCGACCATT
TGGAGACTTGGAATCAGACC
GGCAAGCTAGAAAGTGTCCT
CCAACGAAGAAGCCACAGACA
CTCAGGATGACACTCTCTCAG
CCCTAAGGCCAACCGTGAAAAGATG
GAACCGCTCATTGCCGATAGTGATG
339
NM_012762
335
NM_031512
398
NM_019165
260
NM_008365
433a/897b
V01217
␤-actin primers span an intron, thus producing two different predicted fragment sizes, representing products from, cDNA (a) and DNA (b),
respectively, which were used to check for possible DNA contamination of the samples.
RT-PCR ⫽ reverse transcription polymerase chain reaction; IL ⫽ interleukin.
curring specific inhibitor of IL-18 as a result of its
ability to bind IL-18 with high affinity.11
Experimental evidence indicates involvement of
caspase-1-processed cytokines in various models of
brain injury.12 While IL-1␤ has been characterized as
a pathogenic mediator of neuronal loss13; the role of
IL-18 has been less well studied.14 Experimental animal studies indicate that IL-18 may be implicated in
neurodegeneration after brain trauma and hypoxiaischemia.15,16
This study demonstrates involvement of the proinflammatory cytokines IL-1␤ and IL-18 in the pathogenesis of oxygen-induced neurotoxicity in the immature brain. We provide evidence that inhibition of
IL-18 by IL-18BP or absence of IRAK-4 confers neuroprotection in this model.
Materials and Methods
Animal Experiments
EXPOSURE TO HYPEROXIA. Six-day-old (P6) Wistar rat
pups (BgVV, Berlin, Germany) or IRAK-4 –deficient
(IRAK-4 [⫺/⫺]) C57/BL6 mice, kindly provided by Dr.
Yeh, Ontario Cancer Institute, Toronto, Canada, and wildtype controls were placed together with their mothers into
an oxygen chamber containing 80% oxygen. For histology,
animals were exposed to oxygen for 0, 12, and 24 hours
and were killed 24 hours after the beginning of exposure.
For molecular studies, animals were exposed for 0, 2, 6, 12,
24, and 48 hours and were killed at the end of exposure. In
experiments exceeding 24 hours, mothers were switched to
prevent oxygen-induced acute lung injury.17
Recombinant human IL-18BP
(R&D Systems, Wiesbaden, Germany) was administered
intraperitoneally (40␮g) to 6-day-old Wistar rats to determine whether this compound mitigates damage after hyperoxia. Animals were randomly assigned to receive either IL18BP or normal saline at the beginning of 24 hours of
hyperoxia. Body temperature was recorded from each aniTREATMENT PROTOCOLS.
mal before and after injection (1, 2, 3, 6, 9, 12, 18, and 24
hours) of IL-18BP using a digital thermometer placed in
the oral cavity.
Tissue Sampling
Animals subjected to histological analysis received an overdose of chloral hydrate and were transcardially perfused with
heparinized 0.1 M phosphate-buffered saline, followed by
4% paraformaldehyde. Brains were processed for DeOlmos
silver staining, Fluoro-Jade B staining, terminal deoxynucleotide transferase–mediated dUTP nick end-labeling
(TUNEL), or immunohistochemistry.
For reverse transcription polymerase chain reaction (RTPCR) and Western blotting, animals were decapitated
and brain tissue was microdissected from the cingulate and
parietal cortex, the corpus callosum, the striatum, and the
thalamus, snap-frozen in liquid nitrogen, and stored at
⫺80°C.
All animal experiments were performed in accordance to
the guidelines of the Humboldt University.
Histology
CUPRIC SILVER STAINING. Agar sections
(70␮m) were cut on a vibratome (Leica VT 1000 S,
Nußloch, Germany) and processed for staining with silver
nitrate and cupric nitrate.18 Degenerating cells were identified by a distinct dark appearance resulting from the silver
impregnation.
DEOLMOS
Staining was performed on paraffin
sections (5␮m, cut on a microtome HM 360; Microm,
Giessen, Germany) using the ApopTag Peroxidase kit (Oncor Appligene, Heidelberg, Germany) according to the
manufacturer’s instructions. After pretreatment with proteinase K and quenching of endogenous peroxidase, sections were incubated in equilibration buffer followed by
TdT enzyme (incorporating digoxigenin-labeled dUTP nucleotides to free 3⬘-OH DNA termini), incubation in stop/
wash buffer, treatment with anti–digoxigenin-peroxidase
TUNEL STAINING.
Felderhoff-Mueser et al: Il-1␤ and Il-18 in Hyperoxia
51
Fig 1. Hyperoxia induces cell death in the immature rat brain. Neurodegenerative changes in the brains of P7 rats who had been
subjected to hyperoxia (80% O2) for 12 hours on P6 and killed at 24 hours. (A) In the injured parietal cortex from an animal
subjected to 12 hours of hyperoxia, degenerating cells appear as small dark dots in 70␮m silver-stained sections (⫻40). (B) Terminal deoxynucleotide transferase–mediated dUTP nick end-labeling (TUNEL) staining performed in a 5␮m-thick cortical section
confirms DNA fragmentation within degenerating cells (⫻40). (C) Immunohistochemistry demonstrates caspase-3–immunopositive
cells (arrows) in the laterodorsal thalamus of a 7-day-old rat subjected to 24 hours of hyperoxia (⫻40). (D) Methylene blue/Azur
II staining of plastic sections from the parietal cortex of a rat subjected to hyperoxia demonstrates a neuron with nuclear fragmentation as a hallmark of apoptosis (⫻100). (E) This light micrograph shows extensive degenerative changes in a 5␮m-thick section of
the thalamus labeled by Fluoro-Jade (⫻40).
conjugate followed by diaminobenzidine (Sigma, Deisenhofen, Germany).
Paraffin sections (5␮m) were
stained with Fluoro-Jade B.19 Slides were incubated for 10
minutes in a 0.06% solution of potassium permanganate and
stained for 20 minutes in a 0.0004% solution of Fluoro-Jade
B (Histo-Chem, Jefferson, AR) dissolved in 0.1% acetic acid.
FLUORO-JADE STAINING.
52
Annals of Neurology
Vol 57
No 1
January 2005
Sections were xylene cleared, coverslipped with D.P.X. nonfluorescent mounting media (Sigma), and examined with an
epifluorescent microscope using blue light (excitation 450 –
490nm, emission 515–565nm).
METHYLENE BLUE/AZUR II STAINING OF PLASTIC SECTIONS. For plastic embedding, 70␮m brain sections were
osmicated (1% osmium tetroxide), dehydrated in graded etha-
nols, cleared in toluene, and embedded in araldite. Onemicrometer sections were cut, using glass knives (1/2 inch
wide), heat-dried on glass slides, and stained with azure II and
methylene blue for evaluation by light microscopy.
IMMUNOHISTOCHEMISTRY FOR CASPASE-3, INTERLEUKIN18, AND INTERLEUKIN-18R␣. Paraffin sections were micro-
waved in 10mM citrate buffer, and endogenous peroxidase
activity was blocked with 0.6% hydrogen peroxide. Sections
were incubated with normal goat serum and left overnight at
4°C with a cleaved caspase-3 antibody (1:100; Cell Signaling, Beverly, MA), a goat polyclonal anti–IL-18 (1:200;
R&D Systems, Minneapolis, MN), or a goat polyclonal
anti–IL-18R␣ (1:200; R&D Systems). Controls were performed by including the corresponding blocking peptide as a
competitor of antibody binding. Sections were treated with
rabbit anti–goat IgG. After detection with the ABC kit (Vector Laboratories, Peterborough, UK), positive cells were visualized with diaminobenzidine.
Molecular Studies
SEMIQUANTITATIVE REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION FOR CASPASE-1, INTERLEUKIN-1␤,
INTERLEUKIN-18, AND INTERLEUKIN-18R␣. Total cellular
RNA was isolated by acidic phenol/chloroform extraction
and DNase I treated (Roche Diagnostics, Mannheim, Germany); 500ng of RNA was reverse transcribed with Moloney
murine leukemia virus reverse transcriptase (Promega, Madison, WI) in 25␮L of reaction mixture. The cDNA (1␮L)
was amplified by PCR. The oligonucleotide primers used for
caspase-1, IL-1␤, IL-18, IL-18R␣, and the internal standard
␤-actin are summarized in Table 1. cDNA was amplified in
28 to 32 cycles, consisting of denaturing over 30 seconds at
94°C, annealing over 45 seconds at 58°C, and primer extension over 45 seconds at 72°C. Amplified cDNA was subjected to 5% polyacrylamide gel electrophoresis, silver staining, and densitometric analysis (BioDocAnalyze; Whatman
Biometra, Göttingen, Germany).
IMMUNOBLOTTING FOR CASPASE-1, INTERLEUKIN-1␤,
INTERLEUKIN-18, AND INT ERLEUKIN-18R␣.
Tissue was homogenized in lysis buffer (pH 7.6, 50mM
Tris, 166mM KCl, 5mM ethylene diamine tetraacetic acid,
1% Triton X-100) and centrifuged at 1,050g. The microsomal fraction was centrifuged at 17,000g, and the supernatant
was collected. Protein concentrations were determined using
the bicinchoninic acid kit (Interchim, Montluçon, France).
Protein extracts (20␮g per sample) and a biotinylated molecular weight marker (Cell Signaling Technology, Beverly,
MA) were denaturated in Laemmli sample loading buffer at
95°C, separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis and electrotransferred in transfer
buffer to a nitrocellulose membrane (0.2␮m pore, Protran;
Schleicher & Schüll, Dassel, Germany). The membrane was
rinsed with Tween 20 –containing Tris-buffered saline
(TBST) and treated with blocking solution (5% nonfat dry
milk in TBST). Equal loading and transfer of proteins was
confirmed by staining the membranes with Ponceau S solution (Fluka, Buchs, Switzerland). The membrane was incubated overnight at 4°C with rabbit polyclonal anti–caspase-1
Fig 2. Hyperoxia induces and activates caspase-1. P6 rats
were subjected to 80% O2 or normoxia (n ⫽ 5). (A) Increased expression of caspase-1 mRNA, as detected by reverse
transcription polymerase chain reaction, is evident in the
thalamus at 2, 6, 12, and 24 hours after the beginning of
the hyperoxia. (B) Densitometric quantification of caspase-1
mRNA levels in thalamus, striatum, and cortex. Values represent mean normalized ratios of the caspase-1 band to
␤-actin as an internal standard (n ⫽ 5). Analysis of variance showed a highly significant effect of treatment with
hyperoxia on caspase-1 (2 hours p ⫽ 0.0383; 6 hours p ⬍
0.0001). (C) Immunoblotting was performed with an antibody specific for the active p 20 subunit of caspase-1. Protein samples from thalamus are shown in normoxic controls
and animals subjected to 6, 12, and 24 hours of 80% oxygen. Representative of a series of Western blots from the thalamus, cortex, and striatum demonstrating a strong increase
in the levels of the 45kDa caspase-1 protein in the thalamus
after hyperoxia, most evident at 12 hours.
(1:1,000, Upstate; Charlottesville, VA), goat polyclonal anti–
IL-1␤ (1:200; Santa Cruz Biotechnology, Santa Cruz, CA),
goat polyclonal anti–IL-18 (1:200, R&D Systems), or goat
polyclonal anti–IL-18R␣ (1:200’; R&D Systems).
After incubation with horseradish peroxidase–labeled secondary antibody (anti-rabbit 1:5,000; Amersham, Freiburg,
Germany; anti–goat 1:10,000; Vector Laboratories, Burlingame, CA), the immunoreactive protein was detected by
the enhanced chemiluminescence system (ECL, Amersham), and serial exposures were made (Hyperfilm ECL,
Amersham) and densitometrically analyzed (TINA 2.09).
Quantitation of Neurodegeneration in Different
Brain Regions
Degenerating cells were determined in the frontal, parietal,
cingulate, retrosplenial cortex, caudate nucleus, corpus callo-
Felderhoff-Mueser et al: Il-1␤ and Il-18 in Hyperoxia
53
sum and adjacent white matter, thalamus, hippocampal dentate gyrus, and subiculum by means of a stereological disector,20 estimating mean numerical cell densities (Nv) of
degenerating cells (cells/mm3).21 An unbiased counting
frame (0.05 ⫻ 0.05mm, dissector height 0.01– 0.07mm) and
a high-aperture objective were used for the sampling. Numerical densities (Nv) for each brain region were determined
with eight to 10 dissectors. A scoring system was created as
follows: 17 regions were analyzed, each region was given several points, and scores were added to assess degeneration
within each brain.
Statistical Analyses
Values are presented as mean ⫾ standard error of the mean
(SEM). Comparisons were made using analysis of variance
(ANOVA) or unpaired Student’s t test.
Results
Physiological Parameters
There was no difference in body weight and breathing
pattern between animals exposed to 80% oxygen and
normoxia-exposed controls. Hyperoxia, IL-18BP, and
their combination had no significant effect on body
temperature. No side effects were registered in animals
treated with recombinant IL-18BP.
Histological Evaluation of Apoptotic
Neurodegeneration after Oxygen Exposure
Exposure to 80% oxygen caused widespread cell death
in the forebrain of P7 rats, detected by DeOlmos cupric silver, TUNEL, and Fluoro-Jade staining. Frontal,
parietal, cingulate and retrosplenial cortex, periventricular white matter, thalamus, striatum, and caudate
nucleus were strongly affected, whereas there were
fewer degenerating cells in the hippocampus. TUNEL
staining displayed a similar distribution pattern of degenerating cells as silver and Fluoro-Jade staining, indicating nuclear DNA fragmentation. Caspase-3 immunohistochemistry and methylene blue/Azur II
staining of plastic sections gave findings consistent with
apoptosis (Fig 1). Previously, we provided a detailed
Fig 3. Hyperoxia has an impact on the production of caspase-1–dependent proinflammatory cytokines. P6 rats were subjected to
hyperoxia (n ⫽ 5), and samples from the thalamus, striatum, and cortex were prepared at the end of oxygen exposure. (A) Increased density of the interleukin (IL)–1␤, IL-18, and IL-18R␣–specific bands, detected by reverse transcription polymerase
chain reaction, is evident in the thalamus at 2, 6, 12, and 24 hours after the beginning of hyperoxia. (B) Densitometric quantification of mRNA levels for IL-1␤, IL-18, and IL-18R␣ in the thalamus. Values represent mean normalized ratios (⫾SEM)
of the cytokine bands to the internal standard ␤-actin (n ⫽ 5). Two-way analysis of variance showed significant effect of oxygen
treatment on levels of proinflammatory cytokines at 6 hours of exposure (pIL-1␤ ⫽ 0.0070, pIL-18 ⫽ 0.0047, pIL-18R␣ ⫽
0.0058). (C) Western blot analysis of IL-1␤, IL-18, and IL-18R␣ in brain extracts of controls (C) and oxygen-exposed rats.
Representative blot from the thalamus of a series (thalamus, striatum, cortex), demonstrating an increase of IL-1␤ and IL-18 at
12 and 24 hours of oxygen treatment. A corresponding strong increase in IL-18R␣ activity is demonstrated at the same time
points. (D) Immunohistochemical staining of the laterodorsal thalamus of a rat subjected to 12 hours of 80% hyperoxia. IL-18
immunopositivity is detected on microglial cells and neurons; IL-18R␣ is mainly expressed on neurons (⫻40).
54
Annals of Neurology
Vol 57
No 1
January 2005
description of the distribution pattern and time course
of the neurodegenerative response to hyperoxia and
confirmed the apoptotic nature of the process by electron microscopy. Cell death was detectable as early as 6
hours, peaking at 12 and 24 hours of exposure. Threeto 7-day-old animals were most vulnerable.6
Caspase-1 mRNA and Protein Expression after
Hyperoxia
To determine whether the expression of caspase-1 was
altered after exposure to hyperoxia, we analyzed
mRNA levels for caspase-1 in thalamus, cortex, and
striatum of 6-day-old rats subjected to hyperoxia for
0, 2, 6, 12, 24, and 48 hours and normoxia controls
(n ⫽ 5).
Oxygen triggered an increase of caspase-1 mRNA in
thalamus, cortex, and striatum. This effect was evident
at 2 hours, was highest at from 6 to 12 hours, and
decreased by 24 hours (Fig 2A, B). There were no
changes in the levels of ␤-actin that served as an internal control.
Protein levels of caspase-1 were analyzed by means
of Western blotting in brain extracts from thalamus,
striatum, and cortex sampled at 0, 6, 12, and 24 hours
of oxygen exposure. A 45kDa band for the active p20
subunit of caspase-1 was found in the thalamus at from
12 to 24 hours of oxygen exposure (see Fig 2C). Similar results were obtained in protein samples of striatum and cortex.
Hyperoxia Triggers Production of Interleukin-1␤
mRNA levels for IL-1␤ were analyzed by RT-PCR in
samples (n ⫽ 5) from thalamus, cingulate cortex, and
striatum of 6-day-old rats exposed to oxygen (0, 2, 6,
12, 24, and 48 hours). Hyperoxia-triggered increase of
IL-1␤ mRNA in all brain regions analyzed. This effect
was evident at 2 hours, peaked at 6 hours of oxygen
exposure, and returned to basal levels by 24 and 48
hours (Fig 3A, B).
Control animals showed low expression of IL-1␤
protein. After oxygen treatment for 12 hours, Western
blotting demonstrated a significant increase of IL-1␤,
in line with mRNA findings (see Fig 3C).
Induction of Interleukin-18 and Interleukin-18R␣
mRNA and Protein after Exposure to Oxygen
Analysis of mRNA levels for IL-18 and IL-18R␣ was
performed in samples from the laterodorsal thalamus,
the retrosplenial cortex, and the striatum of rats
exposed to oxygen (0, 2, 6, 12, 24, and 48 hours;
n ⫽ 5).
IL-18 and IL-18R␣ mRNA levels were increased in
all three brain regions (see Fig 3A, B) at 2 hours of
hyperoxia peaking at 6 hours and returning to basal
Fig 4. Recombinant interleukin (IL)–18 binding protein (BP)
protects against hyperoxia-mediated brain damage. (A) The
parietal cortex of 7-day-old rats treated with either 40␮g of
recombinant IL-18BP or vehicle at the beginning of 24 hours
of hyperoxia. In comparison with the control (top panel) there
is a marked reduction of silver-stained cells in the IL-18BP
treated animal (bottom panel) (DeOlmos cupric silver staining, ⫻40). (B) Statistical analysis showed that IL-18BP significantly protected from apoptotic neurodegeneration in all
brain regions analyzed (n ⫽ 6; **p ⫽ 0.0057).
levels by 24 hours. A significant time-dependent effect
on IL-18R␣ mRNA levels was seen after oxygen treatment, especially in the thalamus (see Fig 3A, B).
Hyperoxia also increased IL-18 and IL-18R␣ protein
levels. At 12 hours of oxygen exposure, Western blotting showed a marked increase in expression of IL-18
and IL-18R␣ (see Fig 3C).
In brain tissue sections, IL-18 protein was lightly ex-
Felderhoff-Mueser et al: Il-1␤ and Il-18 in Hyperoxia
55
Table 2. IL-18BP Treatment Confers Neuroprotection in Hyperoxic Neonatal Rats
Brain Region
Cortex frontalis, II
Cortex frontalis, IV
Cortex parietalis, II
Cortex parietalis, IV
Cortex cinguli, II
Cortex cinguli, IV
Cortex retrospl., II
Cortex retrospl., IV
White matter
Nucleus caudatus
Thalamus mediodorsalis
Thalamus laterodorsalis
Thalamus ventralis
Hippocampus
21% O2/Vehicle
80% O2/Vehicle
80% O2/IL-18BP
1,986 ⫾ 307
361 ⫾ 74
2,832 ⫾ 221
347 ⫾ 37
1,875 ⫾ 236
350 ⫾ 39
1,289 ⫾ 101
364 ⫾ 48
367 ⫾ 55
579 ⫾ 61
761 ⫾ 24
400 ⫾ 34
254 ⫾ 28
779 ⫾ 67
10,640 ⫾ 2,888
1,904 ⫾ 866
12,868 ⫾ 4,480
2,880 ⫾ 1,268
3,872 ⫾ 1,582
1,982 ⫾ 623
5,774 ⫾ 3,380
1,065 ⫾ 244
12,354 ⫾ 2,768
6,480 ⫾ 1,623
5,803 ⫾ 1,830
8,868 ⫾ 1,635
2,577 ⫾ 900
3,403 ⫾ 1,266
5,468 ⫾ 1,942
1,265 ⫾ 468
7,992 ⫾ 2,340
1,676 ⫾ 898
2,444 ⫾ 986
1,140 ⫾ 476
4,624 ⫾ 1,600
648 ⫾ 262
7,276 ⫾ 2,450
3,680 ⫾ 1,400
3,476 ⫾ 1,358
5,348 ⫾ 1,460
1,456 ⫾ 768
2,206 ⫾ 980
P6 rats were exposed to normoxia hyperoxia (80% O2, 24 hours) or combined O2 and IL-18BP treatment (40␮g ip at 0 hours). Data are
expressed as mean numerical densities of degenerating cells ⫾ SEM (n ⫽ 6) evaluated at 24 hours after the beginning of hyperoxia.
pressed in normoxia controls on microglial cells and
neurons. Immunoreactivity increased in microglial cells
and, to a lesser extent, in neurons, peaking at 12 hours
after exposure to high oxygen levels (see Fig 3D). IL18R␣ immunoreactivity was mainly detected on thalamic and cortical neurons, increasing on 12 hours of
exposure to oxygen (see Fig 3D). No changes in immunoreactivity were observed in sections treated with
blocking peptide as a competitor of antibody binding.
Effect of Interleukin-18 Binding Protein Treatment
on Cellular Damage after Exposure to Oxygen
To counteract oxygen-induced cytotoxic processes, we
investigated whether administration of IL-18BP may
ameliorate hyperoxic cell death in the developing rat
brain.
We coadministered recombinant human IL-18BP
intraperitoneally at a dose of 40␮g at the beginning of
24 hours of hyperoxia to 6-day-old rats and analyzed
their brains at the end of exposure. A robust degenerative reaction was detected in brains of hyperoxiaexposed, vehicle-treated pups. When IL-18BP was coadministered, it significantly ameliorated the apoptotic
response to hyperoxia (Fig 4A, B; Table 2). Administration of IL-18BP at the dose of 40␮g had no influence on the amount of ongoing physiological apoptosis
in the brains of P7 rats.
Mice Deficient in IRAK-4 Are Protected against
Hyperoxia-Induced Cell Death
To confirm a functional contribution of IL1-␤ and
IL-18 to hyperoxia-induced cell death, we exposed
IRAK-4 (⫺/⫺) mice to 24 hours of hyperoxia at the
age of 6 days. Brains were processed for Fluoro-Jade
staining to detect cell death after the end of oxygen
treatment. Hyperoxia (80% O2 over 24 hours) caused
56
Annals of Neurology
Vol 57
No 1
January 2005
neuronal cell death in brains of wild-type C57/BL6
mice with a distribution pattern very similar to the one
seen in 6-day-old rats. In contrast, mice deficient in
IRAK-4 were largely protected against hyperoxiainduced brain damage (Fig 5A). Quantification of cell
death showed that brains of IRAK-4 (⫺/⫺) transgenic
mice displayed a significant reduction in cumulative
apoptotic scores compared to wild-type age-matched
littermates after 24 hours of hyperoxia (see Fig 5B).
Protection against hyperoxia-induced cell death was
observed in IRAK-4 (⫺/⫺) mice in all brain regions
analyzed.
Discussion
We present evidence that apoptotic neurodegeneration
triggered by oxygen in the developing rodent brain is
associated with an increase of caspase-1 and the proinflammatory interleukins IL-1␤ and IL-18. These molecular changes are pathogenetically linked to cell
death, as inhibition of IL-18 by IL-18BP and disruption of the intracellular signaling cascade activated by
IL-1␤ and IL-18 in IRAK-4 knockout mice confers
protection. Hyperoxia-induced apoptosis is associated
with increased expression of caspase-1, which has the
peculiarity of being involved in the activation of both
apoptosis and inflammation.22 A role for caspase-1 in
brain injury has been inferred from caspase-1–deficient
mice, which are resistant to neonatal hypoxiaischemia.23,24 The production of biologically active
IL-1␤ and IL-18 requires both synthesis of the inactive
precursors and proteolytic cleavage by caspase-1. Hyperoxia induces expression of caspase-1 as well as its
substrates, pro–IL-1␤ and pro-IL-18, in the brain of
newborn rats. Mature IL-1␤ is a mediator of neuronal
loss caused by ischemic, excitotoxic, and traumatic
brain injury.9 Our findings are reminiscent of reports
Fig 5. Mice deficient in IRAK-4 are less vulnerable to
hyperoxia-induced neurodegeneration. Six-day-old IRAK-4
(⫺/⫺) and wild-type IRAK (⫹/⫹) mice were subjected to
80% O2 or normoxia for 24 hours. Quantification of apoptosis was performed on Fluoro-Jade–labeled sections. (A) IRAK-4
(⫺/⫺) mice (bottom panel) displayed less degenerating cells
compared with wild-type (top panel). (B) IRAK-4 –deficient
mice were less vulnerable toward brain damage compared
with wild-type mice after oxygen treatment (n ⫽ 7; ***p ⬍
0.0001). The level of physiological apoptosis (dotted line) did
not differ between wild-type and IRAK-4 (⫺/⫺) mice.
describing enhanced expression of IL-1␤ in neonatal
hypoxia-ischemia25 and fetal inflammation.26 Systemic
injection of IL-1␤ exacerbates lesions in a neonatal
model of excitotoxic white matter injury,27 and administration of IL-1 receptor antagonist reduces
lipopolysaccharide-induced oligodendrocyte death.28 In
contrast with IL-1␤, the role of IL-18 in the central
nervous system is just beginning to unfold.
We present evidence that exposure to hyperoxia
leads to upregulation of IL-18 and IL-18R␣ in areas
with pronounced apoptotic cell death. Moreover, IL-18
and IL-18R␣ immunoreactivity was demonstrated on
apoptotic cells, indicating a possible role in cell death
in this model. Immunopositivity for IL-18R␣ confirms
the previously described presence of this receptor on
neuronal cells16 in affected brain areas.
Although IL-18 does not appear to affect infarct size
during the first 24 hours in a stroke model, the IL-18
pathway may contribute to delayed neuronal injury,
with elevated IL-18 levels observed up to 14 days after
trauma,15 ischemia,29 and neonatal hypoxic-ischemia.16
Our results show upregulation of IL-18 and IL-18R in
the early phase of injury. As in a model of closed head
injury, damage was largely attenuated by administration of IL-18BP.15 These findings reinforce IL-18BP as
a candidate for future therapeutic interventions in
acute neurodegenerative diseases. Although the first
clinical studies in adult patients with rheumatoid arthritis are currently being conducted,30 a potential clinical use of this compound in pediatric medicine should
be preceded by further experimental investigations.
The finding that IL-18 might, in addition to IL-1␤,
have an essential function in the signaling cascade leading to cell death is supported by the fact that mice
lacking functional IRAK-4 were markedly protected
from hyperoxia-induced brain damage. IRAK-4 is the
most receptor-proximal kinase described for IL-1␤ and
IL-18 and is pivotal for IL-18R–mediated signal transduction.10,31 Therefore, inhibiting IRAK-4 activity
may limit the effects mediated by IL-1␤ and IL-18 and
serve as a therapeutic target in a variety of injury models.
The mechanisms by which IL-1␤ and IL-18 are capable of promoting tissue injury are not completely understood. Because both cytokines have been shown to
activate c-jun terminal kinase (JNK) and p38,32,33
which can lead to apoptosis,34,35 it is conceivable that
these two signaling cascades become active and contribute to hyperoxia-induced cell death.
Enhanced levels of inflammatory cytokines in response to oxygen have been linked to the development
of neonatal lung disease in premature infants.7 Clinical
studies have reported high levels of IL-1␤ and IL-18 in
cord blood of preterm infants to be an important predictor of cerebral palsy,36,37 and hyperoxia has been
identified as a contributing factor to adverse neurolog-
Felderhoff-Mueser et al: Il-1␤ and Il-18 in Hyperoxia
57
ical outcome.38 These clinical findings are supported
by the experimental data that hyperoxia triggers diffuse
apoptosis in the immature rodent brain peaking at
from 3 to 7 postnatal days.6 This vulnerable period
corresponds to the brain growth spurt of rodents. In
human infants, this time extends from the beginning
of the last trimester of pregnancy to the first years of
life.39 Of interest, in this context is the fact that extremely premature infants are exposed to unphysiologically high oxygen levels compared with the intrauterine
environment (27–35mm Hg) at a time when antioxidant defense mechanisms are still immature.40 Thus,
although neonatologists have become increasingly cautious with the use of supplemental oxygen, oxygen toxicity still constitutes one factor possibly contributing to
neurodegenerative processes in prematurely born infants. Targeting inflammatory mediators may have
therapeutic potential in the treatment of hyperoxiainduced injury to the immature brain and provide a
strong rationale for future studies in other neonatal
brain injury models.
This work was supported by grants from the Bundesministerium für
Bildung und Forschung (01ZZ0101, C.I., C.B.), the Wilhelm
Sander-Stiftung (1999.091.1, U.F.-M., C.B.), and the Sonnenfeld
Stiftung (U.F.-M.).
We are grateful to Dr W.-C. Yeh, Ontario Cancer Institute and
Department of Medical Biophysics, University Health Network,
Toronto, Canada, for providing IRAK-4 –deficient mice.
References
1. Bregman J. Developmental outcome in very low birthweight
infants. Current status and future trends. Pediatr Clin North
Am 1998;45:673– 690.
2. Tin W, Wariyar U, Hey E. Changing prognosis for babies of
less than 28 weeks’ gestation in the north of England between
1983 and 1994. Northern Neonatal Network. Br Med J 1997;
314:107–111.
3. Vohr BR, Wright LL, Dusick AM, et al. Neurodevelopmental
and functional outcomes of extremely low birth weight infants
in the National Institute of Child Health and Human Development Neonatal Research Network, 1993-1994. Pediatrics
2000;105:1216 –1226.
4. Saugstad OD. Is oxygen more toxic than currently believed?
Pediatrics 2001;108:1203–1205.
5. Hoehn T, Felderhoff-Mueser U, Maschewski K, et al. Hyperoxia causes inducible nitric oxide synthase-mediated cellular
damage to the immature rat brain. Pediatr Res 2003;54:
179 –184.
6. Felderhoff-Mueser U, Bittigau P, Sifringer M, et al. Oxygen
causes cell death in the developing brain. Neurobiol Dis 2004;
17:273–282.
7. Rozycki HJ, Comber PG, Huff TF. Cytokines and oxygen
radicals after hyperoxia in preterm and term alveolar macrophages. Am J Physiol Lung Cell Mol Physiol 2002;282:
L1222–L1228.
8. Pierce BT, Napolitano PG, Pierce LM, et al. The effects of
hypoxia and hyperoxia on fetal-placental vascular tone and inflammatory cytokine production. Am J Obstet Gynecol 2001;
185:1068 –1072.
58
Annals of Neurology
Vol 57
No 1
January 2005
9. Allan SM, Rothwell NJ. Cytokines and acute neurodegeneration. Nat Rev Neurosci 2001;2:734 –744.
10. Suzuki N, Suzuki S, Duncan GS, et al. Severe impairment of
interleukin-1 and Toll-like receptor signalling in mice lacking
IRAK-4. Nature 2002;416:750 –756.
11. Reznikov LL, Kim SH, Westcott JY, et al. IL-18 binding protein increases spontaneous and IL-1-induced prostaglandin production via inhibition of IFN-gamma. Proc Natl Acad Sci USA
2000;97:2174 –2179.
12. Rabuffetti M, Sciorati C, Tarozzo G, et al. Inhibition of
caspase-1-like activity by Ac-Tyr-Val-Ala-Asp-chloromethyl ketone induces long-lasting neuroprotection in cerebral ischemia
through apoptosis reduction and decrease of proinflammatory
cytokines. J Neurosci 2000;20:4398 – 4404.
13. Wang CX, Shuaib A. Involvement of inflammatory cytokines in
central nervous system injury. Prog Neurobiol 2002;67:
161–172.
14. Okamura H, Tsutsi H, Komatsu T, et al. Cloning of a new
cytokine that induces IFN-gamma production by T cells. Nature 1995;378:88 –91.
15. Yatsiv I, Morganti-Kossmann MC, Perez D, et al. Elevated intracranial IL-18 in humans and mice after traumatic brain injury and evidence of neuroprotective effects of IL-18-binding
protein after experimental closed head injury. J Cereb Blood
Flow Metab 2002;22:971–978.
16. Hedtjarn M, Leverin AL, Eriksson K, et al. Interleukin-18 involvement in hypoxic-ischemic brain injury. J Neurosci 2002;
22:5910 –5919.
17. Taglialatela G, Perez-Polo JR, Rassin DK. Induction of apoptosis in the CNS during development by the combination of hyperoxia and inhibition of glutathione synthesis. Free Radic Biol
Med 1998;25:936 –942.
18. De Olmos JS, Ingram WR. The projection field of the stria
terminalis in the rat brain. An experimental study. J Comp
Neurol 1972;146:303–334.
19. Schmued LC, Hopkins KJ. Fluoro-Jade B: a high affinity fluorescent marker for the localization of neuronal degeneration.
Brain Res 2000;874:123–130.
20. West MJ, Gundersen HJ. Unbiased stereological estimation of
the number of neurons in the human hippocampus. J Comp
Neurol 1990;296:1–22.
21. Bittigau P, Sifringer M, Pohl D, et al. Apoptotic neurodegeneration following trauma is markedly enhanced in the immature
brain. Ann Neurol 1999;45:724 –735.
22. Kuida K, Lippke JA, Ku G, et al. Altered cytokine export and
apoptosis in mice deficient in interleukin-1 beta converting enzyme. Science 1995;267:2000 –2003.
23. Liu XH, Kwon D, Schielke GP, et al. Mice deficient in
interleukin-1 converting enzyme are resistant to neonatal
hypoxic-ischemic brain damage. J Cereb Blood Flow Metab
1999;19:1099 –1108.
24. Xu H, Barks JD, Schielke GP, Silverstein FS. Attenuation of
hypoxia-ischemia-induced
monocyte
chemoattractant
protein-1 expression in brain of neonatal mice deficient in
interleukin-1 converting enzyme. Brain Res Mol Brain Res
2001;90:57– 67.
25. Hagberg H, Gilland E, Bona E, et al. Enhanced expression of
interleukin (IL)-1 and IL-6 messenger RNA and bioactive protein after hypoxia-ischemia in neonatal rats. Pediatr Res 1996;
40:603– 609.
26. Cai Z, Pan ZL, Pang Y, et al. Cytokine induction in fetal
rat brains and brain injury in neonatal rats after maternal
lipopolysaccharide administration. Pediatr Res 2000;47:
64 –72.
27. Dommergues MA, Patkai J, Renauld JC, et al. Proinflammatory cytokines and interleukin-9 exacerbate excitotoxic lesions
of the newborn murine neopallium. Ann Neurol 2000;47:
54 – 63.
28. Pang Y, Cai Z, Rhodes PG. Disturbance of oligodendrocyte
development, hypomyelination and white matter injury in the
neonatal rat brain after intracerebral injection of lipopolysaccharide. Brain Res Dev Brain Res 2003;140:205–214.
29. Jander S, Schroeter M, Stoll G. Interleukin-18 expression after
focal ischemia of the rat brain: association with the late-stage inflammatory response. J Cereb Blood Flow Metab 2002;22:
62–70.
30. Dinarello CA. Interleukin-18 and the treatment of rheumatoid
arthritis. Rheum Dis Clin North Am 2004;30:417– 434, ix.
31. Suzuki N, Chen NJ, Millar DG, et al. IL-1 receptor-associated
kinase 4 is essential for IL-18-mediated NK and Th1 cell responses. J Immunol 2003;170:4031– 4035.
32. Lee JK, Kim SH, Lewis EC, et al. Differences in signaling pathways by IL-1beta and IL-18. Proc Natl Acad Sci USA 2004;
101:8815– 8820.
33. Wald D, Commane M, Stark GR, Li X. IRAK and TAK1 are
required for IL-18-mediated signaling. Eur J Immunol 2001;
31:3747–3754.
34. Harris C, Maroney AC, Johnson EM, Jr. Identification
of JNK-dependent and -independent components of cerebellar granule neuron apoptosis. J Neurochem 2002;83:
992–1001.
35. Takeda K, Ichijo H. Neuronal p38 MAPK signalling: an
emerging regulator of cell fate and function in the nervous system. Genes Cells 2002;7:1099 –1111.
36. Nelson KB, Dambrosia JM, Grether JK, Phillips TM. Neonatal
cytokines and coagulation factors in children with cerebral
palsy. Ann Neurol 1998;44:665– 675.
37. Minagawa K, Tsuji Y, Ueda H, et al. Possible correlation between high levels of IL-18 in the cord blood of pre-term infants
and neonatal development of periventricular leukomalacia and
cerebral palsy. Cytokine 2002;17:164 –170.
38. Collins MP, Lorenz JM, Jetton JR, Paneth N. Hypocapnia and
other ventilation-related risk factors for cerebral palsy in low
birth weight infants. Pediatr Res 2001;50:712–719.
39. Dobbing J, Sands J. Comparative aspects of the brain growth
spurt. Early Hum Dev 1979;3:79 – 83.
40. Nishida A, Misaki Y, Kuruta H, Takashima S. Developmental
expression of copper, zinc-superoxide dismutase in human brain
by chemiluminescence. Brain Dev 1994;16:40 – 43.
Felderhoff-Mueser et al: Il-1␤ and Il-18 in Hyperoxia
59
Документ
Категория
Без категории
Просмотров
2
Размер файла
1 865 Кб
Теги
caspase, death, induced, developing, hyperoxic, 1цprocessed, interleukin, brain, cells
1/--страниц
Пожаловаться на содержимое документа