close

Вход

Забыли?

вход по аккаунту

?

Catechol-O-methyltransferase polymorphism (COMT) in suicide attempters A possible gender effect on anger traits.

код для вставкиСкачать
American Journal of Medical Genetics Part B (Neuropsychiatric Genetics) 144B:1042 –1047 (2007)
Catechol-O-Methyltransferase Polymorphism (COMT)
in Suicide Attempters: A Possible Gender Effect on
Anger Traits
Patrick Baud,1 Philippe Courtet,2,3 Nader Perroud,1 Fabrice Jollant,2,3 Catherine Buresi,1 and
Alain Malafosse1,3,4
1
Department of Psychiatry, University Hospital of Geneva, Geneva, Switzerland
Department of Psychological Medicine and Psychiatry, CHU Montpellier, France
3
INSERM E 361, Montpellier, France
4
Department of Medical Genetics and Development, School of Medicine, Geneva, Switzerland
2
Anger-related personality traits are considered
contributory risk factors for suicidal behavior.
According to twin studies, they are partially
under genetic control and their various clinical
expressions have been associated with serotonergic and catecholaminergic activities. A functional
polymorphism on the human catechol-O-methyltransferase (COMT) gene, which codes for the
catecholamines inactivating enzyme COMT, has
been shown to influence aggressive and angerrelated traits in various clinical populations. The
aim of the present study was to investigate the
association between anger traits (as characterized by the State-Trait Anger Expression Inventory, STAXI) and COMT Val158Met polymorphism
in suicide attempters (n ¼ 427) and control subjects (n ¼ 185). Results showed that the high
activity genotype (Val/Val) was more frequent in
suicide attempters than in normal controls. Moreover, the Val/Val genotype markedly affected the
scores on two STAXI subscales—Trait Anger and
Anger Control—in female suicide attempters,
thus suggesting a possible gender effect of the
COMT genotype on a stable personality trait.
These results are discussed in the light of recently
published data on the effect of COMT Val158Met
polymorphism on different cognitive and behavioral traits.
ß 2007 Wiley-Liss, Inc.
KEY WORDS: suicidal behavior; COMT gene;
anger-related personality traits
Please cite this article as follows: Baud P, Courtet P,
Perroud N, Jollant F, Buresi C, Malafosse A. 2007.
Catechol-O-Methyltransferase Polymorphism (COMT)
in Suicide Attempters: A Possible Gender Effect on
Anger Traits. Am J Med Genet Part B 144B:1042–1047.
Grant sponsor: Swiss National Foundation; Grant numbers: 32102168.03, 32-112084.
*Correspondence to: Patrick Baud, M.D., Department of
Psychiatry, Clinique de Belle-Idée, 2 chemin du Petit-Bel-Air,
1225 Chêne-Bourg, Switzerland. E-mail: patrick.baud@hcuge.ch
Received 11 October 2006; Accepted 6 March 2007
DOI 10.1002/ajmg.b.30541
ß 2007 Wiley-Liss, Inc.
INTRODUCTION
Anger-related personality traits are considered contributory
risk factors for suicidal behavior and may partially be under
genetic control. Indeed, a genetic contribution in anger-related
traits is suggested by the results of a twin study investigating
sibling similarity in angry aggression and irritability [Gustavsson et al., 1996] and—for trait anger specifically—by a
study of middle-aged male twins [Sluyter et al., 2000]. Most
studies on suicidal behavior investigated the synergy of
aggression and anger-related traits with impulsivity traits,
the interactions between these sets of behavioral dispositions
being complex and poorly disentangled [Apter et al., 1990;
Apter et al., 1993; Horesh et al., 1997; Critchfield et al., 2004;
Baud, 2005; Ramirez and Andreu, 2006].
Anger and the related construct of hostility-aggression are
thought to be associated with serotonergic as well as
catecholaminergic activities. Although, catecholamine-related
genes have been less investigated than serotonin-related genes
in suicidal behavior, the well-established link between aggressive and suicidal behaviors make them important candidate
genes for suicide studies.
Catechol-O-methyltransferase (COMT) is a major enzyme
involved in the inactivation of catecholamines, including
adrenaline, noradrenaline, and dopamine. A common functional polymorphism (a G to A substitution at codon 158 that
results in a change of amino acid from valine (Val) to
methionine (Met) of the human COMT gene) has been
identified [Lachman et al., 1996], the Met allele being
associated with a lower enzymatic activity than the Val allele.
In fact, homozygosity for the Met allele yields a threefold to
fourfold reduction in COMT enzymatic activity relative to Val
homozygotes [Weinshilboum et al., 1999; Shield et al., 2004].
The Val allele leads to a more efficient degradation of dopamine
and to lower prefrontal dopamine levels.
Associations have been reported between the COMT
Val158Met genotype and aggression in schizophrenic subjects.
Most studies found the Met allele to be associated with various
measures of aggression in schizophrenia [Strous et al., 1997;
Lachman et al., 1998; Kotler et al., 1999; Han et al., 2004],
although one study reported an association between the Val/
Val genotype and increased aggression [Jones et al., 2001].
Subsequent work from the same group failed to confirm this
result on a new sample of schizophrenic patients [Zammit
et al., 2004]. Another study on Chinese schizophrenic patients
failed to find an association between schizophrenia, violence or
suicide, and the COMT Val158Met polymorphism [Liou et al.,
2001].
There are few genetic association studies on the COMT
genotype with either suicidal behavior or anger-related traits
COMT Polymorphism in Suicide Attempters
in non-psychotic clinical populations. An investigation on a
small sample of patients did not find any association between
suicidal behavior or ideation and COMT Val158Met genotype
or allele frequencies [Russ et al., 2000]. In contrast with this
report, Nolan et al. [2000] found a significant association
between the COMT Val158Met genotype and a history of
violent suicide attempts in two samples of schizophrenic and
schizoaffective patients: the Met allele was more frequent
in male (but not female) subjects who had attempted suicide
by violent means. A recent study on a Japanese population
also reported a lower frequency of the Val/Val genotype in
male suicide completers than in male controls, allowing the
authors to suggest that this genotype could protect against
suicide [Ono et al., 2004]. Finally, the influence of COMT
Val158Met polymorphism was examined on both phenotypes—suicidal behavior and anger-related personality
traits—in two samples of suicide attempters and control
subjects [Rujescu et al., 2003]. The authors reported no overall
difference in allele/genotype frequencies between suicide
attempters and controls, but they described a complex picture
regarding anger traits, where carriers of the Met/Met genotype
expressed their anger more outwardly whereas carriers of the
Val/Val genotype expressed it more inwardly and reported
more state anger.
In summary, encouraging but still contradictory results
have been gained from association studies on suicidal behavior
and anger-related traits with the COMT gene.
The first aim of the present study was to investigate whether
the COMT Val158Met polymorphism was associated with
anger-related personality traits in suicide attempters. Another
related objective was to explore the relationships between
anger traits and COMT Val158Met genotypic distribution in a
non-clinical sample of unrelated subjects. Control subjects
recruited in a Blood Donor Center were compared with suicide
attempters for their scores on the subscales of the State-Trait
Expression Inventory and for COMT genotype distributions
and allele frequencies.
1043
unit. Suicide attempts were classified as violent according to
the criteria proposed by Asberg et al. [1976].
Anger-related traits were assessed using the State-Trait
Anger Expression Inventory (STAXI; Spielberger 1988). The
STAXI is a 44-item self-report questionnaire measuring
the experience and expression of anger, in accordance with
the state-trait personality theory [Eckhardt et al., 2004]. The
experience of anger comprises State Anger (the current
feelings experienced by an individual) and Trait Anger (the
individual disposition to experience anger or the ease,
frequency and intensity of becoming angered), whereas
the expression of anger comprises the three components of
Anger-In (which measures the tendency of an individual to
suppress angry feelings), Anger-Out (the tendency to outwardly express anger towards people or objects), and Anger
control (the capacity of an individual to regulate or control
his/her anger).
Genotyping
COMT Val158Met (G/A nucleotide or high and low activity,
respectively) genotyping was carried out according to the
following protocol: PCR was done in a 25 ml volume with 100 ng
DNA, 10 pmol primers COMTF (TCACCATCGAGATCAACCCC) and COMTR (ACAACGGGTCAGGCATGC), 200
nM DNTP, 1.2 mM MgCl2, 1 U Taq polymerase (Eurobio,
Brunschwig, Basel, Switzerland). Temperature annealing was
628C and elongation was 30 sec at 728C. The 96 bp PCR product
was cut by 5 U Nla III (Biolabs, Bioconcept, Allschwil,
Switzerland) and run on Spreadex EL 400 gel (Elchrom
Scientific, Cham, Switzerland) for 75 min at 120 V or on a
10% acrylamide gel (19/1) in 0.5X TBE for 150 min at 250 V.
After coloration with ethidium bromide and visualization
under UV, Val allele give a non-cut 83 bp fragment and Met
allele two fragments, a 65 and 18 bp. A 13 bp fragment was
constantly present after digestion.
Statistical Analyses
MATERIALS AND METHODS
Subjects
Suicidal patients were recruited from the University
Hospitals of Geneva (Switzerland) and Montpellier (France).
Swiss patients (n ¼ 107; 63.6% females) were recruited on the
basis of a past history of a suicide attempt, without considering
whether suicidal behavior was or was not the immediate
reason for hospitalization, whereas French patients (n ¼ 320;
73.1% females) were included in the study shortly after having
made a suicide attempt.
Control subjects (n ¼ 185, 29.7% females) were recruited
from the Blood Donor Center of the University Hospital of
Geneva.
All subjects were between 18 and 75 years old, French
speaking, and with all four biological grandparents originating
from Western European countries. Subjects with a neurological disorder were not included. After a complete description of
the study had been given to the subjects, written informed
consent was obtained.
The two populations of suicide attempters were compared
across demographic and clinical characteristics using Chisquare and t-tests. Differences in genotype and allele frequencies between French and Swiss samples of suicide attempters
were analyzed using the Chi-square test.
An univariate analysis of variance (ANCOVA) was used to
investigate the effect of each genotype on subscales of the
STAXI. Analyses were controlled for age, sex and suicidal
behavior. The covariate age was included because French
suicide attempters were younger than the Swiss ones (38 vs.
40.9, P ¼ 0.042) and gender was added because of a higher
number of women among suicide attempters. Furthermore,
suicidal behavior was added as a covariate in the analysis of
the whole population (comprising suicide attempters and
control subjects without suicide attempt). When the effect of
the genotype on a subscale of the STAXI was statistically
significant, ANCOVA was followed by a non-parametric test
(Kruskal–Wallis (KW)) to take into account the nonparametric distribution of the STAXI subscales. Analyses used
a two-tailed estimation of significance, and a level of P < 0.05
was considered statistically significant. Statistical package
SPSS V.11.0 was used.
Psychiatric and Behavioral Assessments
Patients and control subjects were assessed for psychiatric
diagnoses using the French version of the Diagnostic Interview
for Genetic Studies [Nurnberger et al., 1994]. A suicide attempt
was defined as intentional self-harm that was not selfmutilatory in nature [Mann, 2003] and required medical
evaluation and treatment in an emergency or intensive care
RESULTS
Clinical and demographic data of suicide attempters and
control subjects are presented in Table I. The COMT
Val158Met polymorphism was in Hardy–Weinberg equilibrium for clinical and control populations (0.91 and 0.3,
respectively) (Table II).
1044
Baud et al.
TABLE I. Clinical and Demographic Data of Suicide Attempters (SAs) and Control Subjects
n (%)
Suicide attempters
(n ¼ 427)
Control subjects
(n ¼ 185)
French SAs
(n ¼ 320)
Swiss SAs
(n ¼ 107)
302 (70.7)
125 (29.3)
55 (29.7)
130 (70.3)
234 (73.1)
86 (26.9)
68 (63.6)
39 (36.4)
285 (66.7)
64 (15)
29 (6.8)
6 (1.4)
6 (1.4)
9 (2.1)
10 (2.3)
2 (0.5)
16 (3.7)
36 (19.5)
1 (0.5)
3 (1.6)
0
5 (2.7)
0
15 (8)
125 (67.6)
0
239 (74.7)
29 (9.1)
23 (7.2)
5 (1.6)
5 (1.6)
0
3 (0.9)
2 (0.6)
14 (4.4)
46 (43)
35 (32.7)
6 (5.6)
1 (0.9)
1 (0.9)
9 (8.4)
7 (6.5)
0
2 (1.9)
244 (76.3)
75 (23.4)
1 (0.3)
68 (63.6)
33 (30.8)
6 (5.6)
Gender
Female
Male
Diagnosis
MDD
BP1
BP2
BP nos
Dysthymia
SZ þ SAD
Others
No diagnosis
Unknown
Suicide attempt
Non-violent
Violent
Unknown
Age
Mean (SD)
312 (73.1)
108 (25.3)
7 (1.6)
0
0
38.7 (12.8)
46.08 (12.8)
37.99 (13.6)
40.89 (9.9)
MDD: major depressive disorder; BP1: bipolar disorder type 1; BP2: bipolar disorder type 2; BP nos: bipolar
disorder not otherwise specified; SZ: schizophrenia; SAD: schizoaffective disorder.
TABLE II. Genotype Distributions and Allele Frequencies of the COMT Val158Met Polymorphism in Suicide Attempters (SAs) and
Control Subjects (C)
Allele frequencies, n (%)
Genotype distributions, n (%)
SAs (n ¼ 427)
C (n ¼ 185)
Val/Val
Val/Met
Met/Met
P; w2
Val
Met
P; w2
124 (29)
34 (18.4)
218 (51.1)
107 (57.8)
85 (19.9)
44 (23.8)
0.021; 7.72
466 (54.6)
175 (47.3)
388 (45.4)
195 (52.7)
0.019; 5.47
Genotype and Allele Distributions in Suicide
Attempters and Control Subjects
COMT Val158Met Genotype Effect on Anger Traits
COMT Val158Met genotype and allele distributions differed
significantly between suicide attempters (n ¼ 427) and control
subjects (n ¼ 185): suicide attempters have a higher frequency
of the Val/Val genotype than control subjects (29% vs. 18.4%;
P ¼ 0.021), as well as a higher Val allele frequency (54.6% vs.
47.3%; P ¼ 0.019) (Table II). There was no difference between
non-violent and violent suicide attempters, nor between
French and Swiss suicide attempters (data not shown).
After controlling for age and sex, an effect of COMT
Val158Met genotype distribution on various anger-related
traits was found in the whole population (controls and suicide
attempters): State Anger and Trait Anger scores appeared
significantly higher for the subjects with the high-activity
Val/Val genotype than for those carrying the Val/Met and
Met/Met genotype, whereas Anger Control scores were significantly lower (Table IV). However, there were no more
significant differences in any of the subscales between the
genotypes when suicide attempt was taken as a confounding
variable (Table IV).
Indeed, while the COMT Val158Met genotype modulates
various anger-related traits in suicide attempters, this effect
was not observed in controls. Moreover, this effect remains the
STAXI Scores
The population of suicide attempters showed significantly
different STAXI scores on each subscale compared with control
subjects (Table III).
TABLE III. STAXI Subscales Scores in Suicide Attempters and Control Subjects
STAXI subscale
State anger
Trait anger
Anger in
Anger out
Anger control
Suicide attempters (n ¼ 427)
Control subjects (n ¼ 185)
Mean (SD)
Mean (SD)
P; t-test
20.2 (7.2)
23.7 (6)
21.1 (5)
16.5 (5)
21.3 (4.9)
13.2 (4.4)
19.4 (4.9)
15.8 (4.5)
12.3 (3.2)
24.6 (4.1)
<0.001; 12.2
<0.001; 8.5
<0.001; 12.5
<0.001; 10.4
<0.001; 8.1
COMT Polymorphism in Suicide Attempters
1045
TABLE IV. Scores for State-Trait Anger Expression Inventory (STAXI) Subscales as a Function of COMT Val158Met Genotype in
Suicide Attempters and Control Subjects (n ¼ 612)
Adjusted for SA
Genotype
STAXI
subscale
Val/Val
(n ¼ 158)
Val/Met
(n ¼ 325)
Met/Met
(n ¼ 129)
F
df
P
KW
(P; df; w2)
State anger
Trait anger
Anger-in
Anger-out
Anger Control
19.7 (7.5)
23.5 (6.2)
19.5 (5.4)
15.9 (5.4)
21.4 (5.3)
17.7 (7.2)
22.4 (5.9)
19.6 (5.4)
15.2 (4.8)
22.7 (4.8)
17.1 (6.5)
21 (6.1)
19.4 (5.6)
14.4 (4.7)
23.4 (4.4)
3.99
3.68
0.03
1.53
4.47
2/605
2/605
2/605
2/605
2/605
0.019
0.026
0.97
0.22
0.012
0.002; 2; 12.82
0.003; 2; 11.36
0.001; 2; 13.03
F
df
P
1
1
1
0.21
1.14
2/599
2/599
2/599
2/599
2/599
0.368
0.369
0.366
0.812
0.321
Data are presented as mean (SD).
same after controlling for sample origin. After pooling French
and Swiss suicide attempters (as there was no difference in the
COMT Val158Met genotype distribution) and taking into
account sex and age as confounding variables, Trait Anger
scores were found to be significantly higher and Anger Control
scores significantly lower in suicide attempters carrying the
Val/Val genotype than in those carrying the Val/Met or Met/
Met genotypes (Trait Anger: P ¼ 0.003; KW: P ¼ 0.001; Anger
Control: P ¼ 0.036; KW: P ¼ 0.003) (Table V). The effect of the
COMT Val158Met genotype on Trait Anger was still significant in the subgroup of violent suicide attempters (P ¼ 0.013,
F ¼ 4.5, df ¼ 2/101; KW: P ¼ 0.018, w2 ¼ 8.01, df ¼ 2).
The effect of COMT Val158Met could be mostly accounted for
by the female population, which represents more than 70% of
the SA group. Indeed, gender plays an important role in the
effects of the COMT Val158Met genotype on STAXI subscales
scores. Scores for Trait Anger were significantly higher
(P ¼ 0.002, F ¼ 6.26, df ¼ 2/298, KW: 0.002; df ¼ 2; w2 ¼ 12.55)
and scores for Anger Control significantly lower (P ¼ 0.003,
F ¼ 4.98, df ¼ 2/298, KW: P ¼ 0.002, df ¼ 2, w2 ¼ 12.8) in female
suicide attempters carrying the high-activity Val/Val genotype. It should be noted that the subgroup of violent female
SAs, in spite of its small size, contributed significantly to the
global genotypic and allelic influences of the high-activity
COMT variant on Trait Anger scores in the whole female
population of SAs, as indicated by the following data: nonviolent female SAs (n ¼ 240): P ¼ 0.04 and KW 0.03; violent
female SAs (n ¼ 58): P ¼ 0.046 and KW 0.051. The effect of the
high-activity COMT genotype on Trait Anger is specific to
female gender, as there is no such difference in male suicide
attempters.
DISCUSSION
Here, we report an association between the COMT Val158Met genotype and anger-related personality traits in suicidal
behavior. In our population, this association was genderspecific: female suicide attempters homozygous for the Val
allele displayed higher scores on Trait Anger and lower scores
on Anger Control, whatever the nature of the suicidal gesture,
than female suicide attempters carrying a Met allele.
Moreover, violent suicide attempters with the Val/Val
genotype also showed a significantly elevated score on Trait
Anger, which could partly be due to the sample of female
violent suicide attempters.
Finally, the modest but significant effect of the Val/Val
genotype on State Anger, Trait Anger and Anger Control found
in the whole population of suicide attempters and control
subjects was exclusively accounted for by the sample of suicide
attempters.
It is noteworthy, however, that the smaller number of men
than women and violent suicide attempters than non-violent
cases, as well as the smaller number of controls than cases,
might partly explain these results.
While adding to the existing data set on the influence of the
COMT gene on anger and aggressive personality traits, our
findings are in apparent contradiction with the results of most
association studies, where aggressive behaviors and angerrelated personality traits were linked to the Met variant.
Several factors could account for these contradictory results.
First, the inconsistencies may be due to the specific clinical
characteristics of the populations under scrutiny: among the
few studies reporting an association between the Met genotype/allele and violent suicide, one relates to schizophrenia
patients [Nolan et al., 2000], whereas there were almost no
schizophrenic patients included in our samples of suicide
attempters (Table I). In schizophrenia studies the Met
genotype/allele was mainly found associated with aggressive
behaviors rather than with suicidal behavior. In fact, the
association reported between violent suicidal behavior and the
Met genotype/allele in the Nolan et al. study could be due to the
co-presence in their schizophrenic patients of other-directed
violent and aggressive behaviors, an overlapping phenotypic
characteristic present in the majority of their clinical population. Moreover, cognitive disturbances have been repetitively
associated with the Val genotype-allele, in schizophrenia, and
more recently also in non-clinical populations. Indeed, lower
performances on prefrontal executive cognition and working
TABLE V. Scores for State-Trait Anger Expression Inventory (STAXI) Subscales as a Function of
COMT Val158Met Genotype in Suicide Attempters (n ¼ 427)
Genotype
STAXI subscale
Val/Val
(n ¼ 124)
Val/Met
(n ¼ 218)
Met/Met
(n ¼ 85)
F
df
P
State anger
Trait anger
anger-in
Anger-out
Anger control
21.2 (7.4)
25.1 (5.6)
20.9 (4.8)
17.1 (5.2)
20.4 (5)
19.8 (7.3)
23.7 (5.9)
21.3 (4.9)
16.5 (4.9)
21.2 (4.7)
19.5 (6.4)
21.6 (6.5)
21.1 (5.4)
15.5 (5)
22.7 (4.7)
1.09
6
0.03
1.43
3.36
2/420
2/420
2/420
2/420
2/420
0.34
0.003
0.97
0.24
0.036
Data are presented as mean (SD).
KW
(P; df; w2)
0.001; 2; 14.57
0.003; 2; 11.85
1046
Baud et al.
memory tasks have been associated with the Val variant [Egan
et al., 2001; Malhotra et al., 2002]. These cognitive disturbances could also play a role in suicidal behavior in schizophrenic patients.
Another study reporting an association between suicide and
the Met allele [Ono et al., 2004] focused on completed suicide,
whereas we studied suicide attempts. Most cases in the Ono
et al. study were classified as violent suicides, but the clinical
backgrounds of the suicide completers could not be obtained.
There are some arguments to support the view that the clinical
phenotype(s) of suicide attempt(s) may well differ from the
phenotype(s) of suicide completion [Muller-Oerlinghausen and
Roggenbach, 2002; Mann, 2003] and therefore both may
depend on specific and partly different vulnerability genes. If
this was the case, extrapolation from one clinical population to
the other could become hazardous.
However, these critical remarks could not explain the
discrepancies between our results and those of [Rujescu
et al., 2003], as both studies investigate the same COMT
Val158Met polymorphism and relate on the STAXI scale to
characterize anger traits in suicide attempters and control
subjects. These authors reported no overall difference in
COMT Val158Met allele/genotype frequencies between suicide
attempters and controls, but they found a difference regarding
the expression of anger: subjects with the Met/Met genotype
expressed their anger more outwardly whereas the Val/Val
genotype carriers expressed it more inwardly and reported
more state anger. They concluded that the COMT Val158Met
polymorphism may modify the phenotype of suicide attempts
and anger-related traits, a conclusion that our data do not
confirm. It is worth mentioning that the STAXI subscale scores
found in our whole sample (suicide attempters plus controls)
are far higher than those in the Rujescu et al. study (e.g. Trait
Anger scores in subjects with the Val/Val genotype were 23.5 in
our sample, versus 17.3 in the Rujescu et al. study. Scores for
the low-activity genotype were respectively 21 and 17.5). The
discrepancies between the results of the two studies may be
explained by the size of the samples and the STAXI scores:
being of a greater size and having higher Trait Anger scores
(and lower Anger Control scores), our sample may be more
sensitive to detect a genetic effect.
Beside the commonly proposed reasons for contradictory
results in genetic association studies—the nature of the associated psychiatric disorders, the effect of population stratification, and the lack of statistical power—these discrepancies
may possibly find an explanation in the light of a recent study
showing that haplotypes containing either the Val or the Met
variant could influence a given phenotype (extraversion in the
case) in the same direction [Stein et al., 2005]. Thus, Val allele
as well as Met allele could exert a same phenotypic effect
according to their haplotypic configuration. This aspect warrants new investigations.
Interestingly, in the study by Stein et al. [2005], the genetic
associations to COMT were confined to women (either from a
single polymorphism or from a haplotype perspective), a result
already reported in a study on harm avoidance [Enoch et al.,
2003]. Furthermore, several studies, although yielding contradictory results, have found associations of panic disorder
and the COMT Val158Met genotype in women specifically
[Domschke et al., 2004; McGrath et al., 2004; Woo et al., 2004]
and preclinical data suggest that COMT variants could
produce sexually dimorphic effects on catecholamine metabolism [Huotari et al., 2002].
These discrepancies may also be explained by the fact that all
these studies do not take into account gene x environment
interaction. Recently, Thapar et al. [2005] showed that Val/Val
genotype and lower birth weight interact to increase symptoms
of conduct disorders in patients with attention-deficit/hyperactivity disorder. Interestingly, restricted fetal growth has
also been shown to be a risk factor for suicide attempt
[Mittendorfer-Rutz et al., 2004]. These data let us to hypothesize that Val/Val genotype also interacts with restricted fetal
growth to increase anger-related traits in suicide attempters.
The fact that in our study male suicide attempters do not
display a significant difference in anger-related traits according to the COMT genotype could be due to the smaller sample
size, but it could also indicate that various personality patterns
contribute differently to the risk of suicidal behavior.
Engstrom et al. [1997] categorized suicide attempters by
cluster analysis into different groups according to temperamental traits. One of the identified clusters was characterized
by ‘‘neurotic, impulsive and aggressive’’ traits and was mainly
seen in borderline and histrionic patients. Characteristics of
high levels of anger and impulsivity could be more frequent
in female suicide attempters, which represent an elevated
proportion (70.7%) of our clinical sample. As anger and impulsivity seem to be tightly related in increasing the risk of selfdestructive or self-harming behaviors [Milligan and Waller,
2001; Mann, 2003], future investigations should analyze the
effects of COMT genotype or other candidate genes on a
phenotype combining the characteristics of both anger- and
impulsivity-related personality traits.
Finally, anger-related personality traits could be phenotypically related to various cognitive processes, such as attentional control tasks, executive functioning or higher order
mental processing, all of which have recently been shown to be
negatively affected by the Val allele [Blasi et al., 2005; Bruder
et al., 2005; de Frias et al., 2005].
In conclusion, the results of the present study showed an
association between the COMT Val158Met polymorphism and
anger-related personality traits in suicide attempters. COMT
Val158Met showed a strong effect on Trait Anger and Anger
Control scores in female suicide attempters and a weaker effect
on the Trait Anger score in violent suicide attempters of both
genders. Since Trait Anger represents a long-lasting disposition to experience angry feelings, the COMT genotype could be
considered—if these results were to be confirmed—as influencing a personality dimension in a clinical population. If a same
effect of the COMT genotype could be seen in non-clinical
populations is still a matter of debate and requires larger
samples of subjects.
REFERENCES
Apter A, van Praag HM, Plutchik R, Sevy S, Korn M, Brown SL. 1990.
Interrelationships among anxiety, aggression, impulsivity, and mood: A
serotonergically linked cluster? Psychiatry Res 32(2):191–199.
Apter A, Plutchik R, van Praag HM. 1993. Anxiety, impulsivity and
depressed mood in relation to suicidal and violent behavior. Acta
Psychiatr Scand 87(1):1–5.
Asberg M, Träskman L, Thorén P. 1976. 5-HIAA in the cerebrospinal fluid a
biochemical suicide predictor? Arch Gen Psychiatry 33:1193–1197.
Baud P. 2005. Personality traits as intermediary phenotypes in suicidal
behavior: Genetic issues. Am J Med Genet Part C Semin Med Genet
133C(1):34–42.
Blasi G, Mattay VS, Bertolino A, Elvevag B, Callicott JH, Das S, Kolachana
BS, Egan MF, Goldberg TE, Weinberger DR. 2005. Effect of catechol-Omethyltransferase val158met genotype on attentional control. J Neurosci 25(20):5038–5045.
Bruder GE, Keilp JG, Xu H, Shikhman M, Schori E, Gorman JM, Gilliam TC.
2005. Catechol-O-methyltransferase (COMT) genotypes and working
memory: Associations with differing cognitive operations. Biol Psychiatry 58(11):901–907.
Critchfield KL, Levy KN, Clarkin JF. 2004. The relationship between
impulsivity, aggression, and impulsive-aggression in borderline personality disorder: An empirical analysis of self-report measures. J Personal
Disord 18(6):555–570.
de Frias CM, Annerbrink K, Westberg L, Eriksson E, Adolfsson R, Nilsson
LG. 2005. Catechol O-methyltransferase Val158Met polymorphism is
COMT Polymorphism in Suicide Attempters
1047
associated with cognitive performance in nondemented adults. J Cogn
Neurosci 17(7):1018–1025.
as risk factors for suicidal behaviour of offspring: A cohort study. Lancet
364(9440):1135–1140.
Domschke K, Freitag CM, Kuhlenbaumer G, Schirmacher A, Sand P,
Nyhuis P, Jacob C, Fritze J, Franke P, Rietschel M, et al. 2004.
Association of the functional V158M catechol-O-methyl-transferase
polymorphism with panic disorder in women. Int J Neuropsychopharmacol 7(2):183–188.
Muller-Oerlinghausen B, Roggenbach J. 2002. Concretism in biological
suicide research—Are we eating the menu instead of the meal?
Some thoughts on present research strategies. Pharmacopsychiatry
35(2):44–49.
Eckhardt C, Norlander B, Deffenbacher J. 2004. The assessment of anger
and hostility: A critical review. Aggress Violent Behav 9: 17–43.
Egan MF, Goldberg TE, Kolachana BS, Callicott JH, Mazzanti CM, Straub
RE, Goldman D, Weinberger DR. 2001. Effect of COMT Val108/158 Met
genotype on frontal lobe function and risk for schizophrenia. Proc Natl
Acad Sci USA 98(12):6917–6922.
Engstrom G, Alling C, Gustavsson P, Oreland L, Traskman-Bendz L. 1997.
Clinical characteristics and biological parameters in temperamental
clusters of suicide attempters. J Affect Disord 44(1):45–55.
Nolan KA, Volavka J, Czobor P, Cseh A, Lachman H, Saito T, Tiihonen J,
Putkonen A, Hallikainen T, Kotilainen I, et al. 2000. Suicidal behavior in
patients with schizophrenia is related to COMT polymorphism.
Psychiatr Genet 10(3):117–124.
Nurnberger JI Jr, Blehar MC, Kaufmann CA, York-Cooler C, Simpson SG,
Harkavy-Friedman J, Severe JB, Malaspina D, Reich T. 1994.
Diagnostic interview for genetic studies. Rationale, unique features,
and training. NIMH Genetics Initiative. Arch Gen Psychiatry
51(11):849–859; discussion 863–864.
Enoch MA, Xu K, Ferro E, Harris CR, Goldman D. 2003. Genetic origins of
anxiety in women: A role for a functional catechol-O-methyltransferase
polymorphism. Psychiatr Genet 13(1):33–41.
Ono H, Shirakawa O, Nushida H, Ueno Y, Maeda K. 2004. Association
between catechol-O-methyltransferase functional polymorphism
and male suicide completers. Neuropsychopharmacology 29(7):
1374–1377.
Gustavsson JP, Pedersen NL, Asberg M, Schalling D. 1996. Exploration into
the sources of individual differences in Aggression-, Hostility- and
Anger-related (AHA) personality traits. Pers Individ Dif 21(6):1067.
Ramirez JM, Andreu JM. 2006. Aggression, and some related psychological
constructs (anger, hostility, and impulsivity); some comments from a
research project. Neurosci Biobehav Rev 30(3):276–291.
Han DH, Park DB, Na C, Kee BS, Lee YS. 2004. Association of aggressive
behavior in Korean male schizophrenic patients with polymorphisms in
the serotonin transporter promoter and catecholamine-O-methyltransferase genes. Psychiatry Res 129(1):29–37.
Rujescu D, Giegling I, Gietl A, Hartmann AM, Moller HJ. 2003. A
functional single nucleotide polymorphism (V158M) in the COMT gene
is associated with aggressive personality traits. Biol Psychiatry 54(1):
34– 39.
Horesh N, Rolnick T, Iancu I, Dannon P, Lepkifker E, Apter A, Kotler M.
1997. Anger, impulsivity and suicide risk. Psychother Psychosom 66(2):
92–96.
Russ MJ, Lachman HM, Kashdan T, Saito T, Bajmakovic-Kacila S. 2000.
Analysis of catechol-O-methyltransferase and 5-hydroxytryptamine
transporter polymorphisms in patients at risk for suicide. Pschiatry
Research 93: 73–78.
Huotari M, Gogos JA, Karayiorgou M, Koponen O, Forsberg M, Raasmaja A,
Hyttinen J, Mannisto PT. 2002. Brain catecholamine metabolism in
catechol-O-methyltransferase (COMT)-deficient mice. Eur J Neurosci
15(2):246–256.
Jones G, Zammit S, Norton N, Hamshere ML, Jones SJ, Milham C, Sanders
RD, McCarthy GM, Jones LA, Cardno AG, et al. 2001. Aggressive
behaviour in patients with schizophrenia is associated with catechol-Omethyltransferase genotype. Br J Psychiatry 179:351–355.
Kotler M, Barak P, Cohen H, Averbuch IE, Grinshpoon A, Gritsenko I,
Nemanov L, Ebstein RP. 1999. Homicidal behavior in schizophrenia
associated with a genetic polymorphism determining low catechol-Omethyltransferase (COMT) activity. Am J Med Genet 88(6):628–633.
Lachman HM, Papolos DF, Saito T, Yu YM, Szumlanski CL, Weinshilboum
RM. 1996. Human catechol O-methyltransferase pharmacogenetics:
Description of a functional polymorphism and its potential application to
neuropsychiatric disorders. Pharmacogenetics 6(3):243–250.
Lachman HM, Nolan KA, Mohr P, Saito T, Volavka J. 1998. Association
between catechol O-methyltransferase genotype and violence in schizophrenia and schizoaffective disorder. Am J Psychiatry 155(6):835–837.
Liou YJ, Tsai SJ, Hong CJ, Wang YC, Lai IC. 2001. Association analysis of a
functional catecol-o-methyltransferase gene polymorphism in schizophrenic patients in Taiwan. Neuropsychobiology 43(1):11–14.
Malhotra AK, Kestler LJ, Mazzanti C, Bates JA, Goldberg T, Goldman D.
2002. A functional polymorphism in the COMT gene and performance on
a test of prefrontal cognition. Am J Psychiatry 159(4):652–654.
Mann JJ. 2003. Neurobiology of suicidal behaviour. Nat Rev Neurosci 4(10):
819–828.
McGrath M, Kawachi I, Ascherio A, Colditz GA, Hunter DJ, De Vivo I. 2004.
Association between catechol-O-methyltransferase and phobic anxiety.
Am J Psychiatry 161(9):1703–1705.
Milligan R-J, Waller G. 2001. Anger and impulsivity in non-clinical women.
Pers Individ Dif 30:1073–1078.
Mittendorfer-Rutz E, Rasmussen F, Wasserman D. 2004. Restricted fetal
growth and adverse maternal psychosocial and socioeconomic conditions
Shield AJ, Thomae BA, Eckloff BW, Wieben ED, Weinshilboum RM. 2004.
Human catechol O-methyltransferase genetic variation: Gene resequencing and functional characterization of variant allozymes. Mol Psychiatry 9(2):151–160.
Sluyter F, Keijser JN, Boomsma DI, van Doornen LJ, van den Oord EJ,
Snieder H. 2000. Genetics of testosterone and the aggression-hostilityanger (AHA) syndrome: A study of middle-aged male twins. Twin Res
3(4):266–276.
Spielberger CD. 1988. State-Trait Anger Expression Inventory: Professional
manual research edition. Odessa: Odessa, Fla.
Stein MB, Fallin MD, Schork NJ, Gelernter J. 2005. COMT polymorphisms
and anxiety-related personality traits. Neuropsychopharmacology
30(11):2092–2102.
Strous RD, Bark N, Parsia SS, Volavka J, Lachman HM. 1997. Analysis of a
functional catechol-O-methyltransferase gene polymorphism in schizophrenia: Evidence for association with aggressive and antisocial
behavior. Psychiatry Res 69(2–3):71–77.
Thapar A, Langley K, Fowler T, Rice F, Turic D, Whittinger N, Aggleton J,
Van den Bree M, Owen M, O’Donovan M. 2005. Catechol O-methyltransferase gene variant and birth weight predict early-onset antisocial
behavior in children with attention-deficit/hyperactivity disorder. Arch
Gen Psychiatry 62(11):1275–1278.
Weinshilboum RM, Otterness DM, Szumlanski CL. 1999. Methylation
pharmacogenetics: Catechol O-methyltransferase, thiopurine methyltransferase, and histamine N-methyltransferase. Annu Rev Pharmacol
Toxicol 39:19–52.
Woo JM, Yoon KS, Choi YH, Oh KS, Lee YS, Yu BH. 2004. The association
between panic disorder and the L/L genotype of catechol-O-methyltransferase. J Psychiatr Res 38(4):365–370.
Zammit S, Jones G, Jones SJ, Norton N, Sanders RD, Milham C,
McCarthy GM, Jones LA, Cardno AG, Gray M, et al. 2004. Polymorphisms in the MAOA, MAOB, and COMT genes and aggressive
behavior in schizophrenia. Am J Med Genet Part B Neuropsychiatr
Genet 128B(1):19–20.
Документ
Категория
Без категории
Просмотров
2
Размер файла
80 Кб
Теги
catechol, effect, angel, polymorphism, methyltransferases, possible, gender, suicide, attempters, traits, comte
1/--страниц
Пожаловаться на содержимое документа