close

Вход

Забыли?

вход по аккаунту

?

Clinical and molecular genetic features of congenital spinal muscular atrophy.

код для вставкиСкачать
ClinicaI and Molecular Genetic Fea~uresof
Congenital Spinal Muscular Atrophy
Koenraad Devriendt, MD,* Martin Lammens, MD,f$ Els Schollen,* Chris Van Hole, M D , $
Re& Dom, MD,? Hugo Devlieger, MD,$ Jean-Jacques Cassiman, MD,*
Jean-Pierre Fryns, MD,* and Gert Matthijs, PhD*
A neonate presented with the fetal hypokinesia sequence and signs of spinal muscular atrophy (SMA). Severe pathological
changes including ballooned neurons and neuronophagia were found not only in the motor nerve nuclei but also in
the thalamic, cerebellar, and brainstem nuclei as well as in the dorsal root ganglia. Direct DNA analysis showed the
presence of a chimeric SMN gene, with a rearrangement occurring between exon 7 of the centromeric SMN gene and
exon 8 of the telomeric SMN gene. Circumstantial evidence suggests that only a single copy of this gene is present,
with transcriptional characteristics of a centromeric SMN gene. In addition, a homozygous deletion in the NAIP genes
was demonstrated. This observation demonstrates that at least some cases with fetal hypokinesia and SMA may represent
the severe end of a spectrum of disorders caused by deletions in the SMA locus on chromosome 5q13. In addition,
these findings are compatible with a modifying role for the centromeric SMN genes and the NAIP genes in the severity
of the SMA phenotype.
Devriendt K, Lammens M, Schollen E, Van Hole C, Dom R, Devlieger H, Cassirnan J-J,
Fryns J-P, Matthijs G. Clinical and molecular genetic features of congenital
spinal muscular atrophy. Ann Neurol 1936;40:731-738
Spinal muscular atrophy (SMA) is characterized by a
progressive loss of m o t o r neurons in the anterior horn
of the spinal cord. Clinically, three distinct types of
autosomal recessive SMA have been distinguished, depending on the time of onset and course of the disease
[I]. SMA type I (Werdnig-Hoffmann disease) is the
most severe manifestation; types I1 and I11 (KugelbergWelander disease) are milder. These three types are allelic and the majority are caused by a hoinozygous deletion in all or part of the telomeric survival motor neuron (SMN) gene on chromosome region 5q13 [2]. T h e
SMN gene resides within an inverted and duplicated
region of 500 kb on chromosome 5q13. As a result,
each chromosome 5 carries two copies of the SMN
gene, one centromeric and one telomeric copy. Both
the centromeric and the telomeric genes are transcribed, and their mRNAs code for identical proteins,
suggesting the presence of four functional copies of this
gene in the diploid genome [2]. In addition to these
classical SMA types, unusual SMA variants have been
described in patients with intrauterine onset of the disease, leading to features of the fetal akinesia sequence.
Some of these patients represent a distinct genetic entity, inherited as an X-linked disease [3], or caused by
a gene outside 5q13 [4, 51. Other infants presented
with multiple bone fractures [GI, distinct pathological
findings in the brain [7],
or unusually severe respiratory
distress [8], raising the possibility of further genetic
heterogeneity. We have conducted pathological and
molecular studies in a patient with the fetal hypokinesia sequence and signs of SMA.
From the ‘Center for Human Genetics and Departments of t N e u ropathology and $Pediairics, University Hospital Leuven, Leuven.
Belgium; and 4PAM.M Eindhovcn, l’hc Nerhcrlands.
Received Aug 17, 1995, and in revised form Feh 21 and May 13,
1996. Accepted for publication May 23, 1996.
Copyright
Materials and Methods
Clinirctl Report
l h e index patient, a boy, is the second child of healthy,
nonconsanguineous parents. During pregnancy, fetal movements were absent from 32 weeks on. There was no polyhydramnion. H e was born at term, with birth weight 3.1 kg
(p25-50), length 50.5 cm (p75), and head circumference 35
cni (p25- 50). There were no sponraneous respiratory ~novcments and he was incubated and ventilated artificially immediately. There were generalized edema and flexion contractures of the elbows and knees. Spontaneous movernenrs
of the limbs were absent, but facial movements were present.
Fasciculations of the tongue were observed. A small muscular
ventricle septa1 defect was diagnosed by means of cardiac
ultrasound.
Electromyography (EMG) of upper and lower limb muscles showed typical denervation signs, i.e., massive fibrillation
potentials with positive sharp waves, preservation of only a
few motor units with very unstable and polymorphic motor
Address correspondence to Gert Matthijs, Center for Human Cenetics, Herestraat 49, B-3000 Leuven, Belgium.
0 1996 by the American Neurological Association 731
unit potentials. Nerve conduction of the nervus fibularis profundus and medianus and right nervus tibialis could not be
obtained. Ophthalmological examination was normal. The
child could not be weaned from the ventilator and died at
the age of 25 days.
Both parents were clinically normal and had normal
EMGs and normal nerve conduction velocities. A sister of
the mother had typical Werdnig-Hoffniann disease; the first
clinical symptoms were noted at the age of 4 months. Typical denervation signs were present on EMG and a muscle
biopsy showed neurogenic muscle atrophy. She died at the
age of 1 year from respiratory failure.
Neu ropathology
Brain, spinal cord, and dorsal root ganglia were fixed in 10%
buffered formalin. Portions of brain, spinal cord, and dorsal root ganglia were embedded in paraffin and prepared
for light microscopic observation with hematoxylin-eosin
(H&E), Huver-Barrera, modified Bielschowsky, periodic
acid-Schiff (PAS), Masson and Sudan black B staining.
Immunocytochemistry was performed on selected slides
with the avidin-biotin complex method. Antibodies used
were as follows: anti-GFAP (1 : 100 dilution, Biogenix), antineurofilament (1 :10, Eurodiagnostica), anti-ubiquitin (1 :GO,
Dako), anti-tau (1:1,000, Sigma), and anti-MAP2 (1:100,
Sigma). For the detection of glial fibrillary acidic protein
(GFAP) and neurofilament, slides were pretreated with citrate buffer, p H 6.0, in a microwave oven (2 X 5 minutes,
900 W). Anti-MAP2 detection was optimalized by adding a
supplementary avidin-biotin complex.
A muscle biopsy was examined with classic histochemical
staining including H&E, modified Gomori trichrome staining, ATPase at p H 4.3, 4.6, and 9.4, PAS, NADH, and
osmium tetroxide with electron microscopy. A nerve biopsy
was evaluated on semithin sections stained with toluidine
blue and by electron microscopy.
The oligonucleotide primers SMA7A and SMA8B were
used to amplify a genomic fragment of the centromeric and
telomeric SMN genes, under identical PCR conditions (see
Fig 8). The fragment was partially sequenced using the
Thermo Sequenase cycle sequencing kit (Amersham).
RNA ANALYSIS. Total RNA was isolated from freshly frozen muscle biopsy (approximately 15 mg of wet tissue), using
RNAzol B, as prescribed (TelTest Inc). The RNA was reverse
transcribed into cDNA, using 4 p1 of oligo(dT) primers
(Pharmacia Biotech; 500 pg/ml) and 2 p1 Superscript I1
(GibcoBRL) in a rota1 volume of 80 pl with 1 X first-strand
buffer, 0.5 m M dNTPs, and 0.01 M dithiothreitol. One
microliter was used in the subsequent amplification reactions.
As a control, muscle biopsies from a patient with an inflammatory muscle disease and from a patient with muscular
atrophy unrelated to SMA were included. A cDNA fragment
of the SMN gene was amplified using oligonucleotides located in exons 6 and 8, exactly as described [2] (see Fig
4). Cloning of amplification products and sequencing were
according to established procedures.
Exon 5 of
the NAIP gene was amplified by PCR exactly as described
[9]. As a control, exon 13 was amplified in the same PCR.
ANALYSIS O F DELETIONS IN THE NAIP GENE.
Members of the
family were typed for the following dinucleotide repeats:
cVS19 (D5S435, centromeric to the SMA locus), MAPS'
and MAPS' (D5S112, telomeric to the SMA locus), and
C272 (locared within the duplicated region, with two alleles
on each chromosome 5) [2, 10-131. One primer of each pair
was fluorescently labeled (FITC). All PCR products were
electrophoresed on an ALF DNA sequencer (Pharmacia Biotech) and analyzed using Fragment Manager software (Pharmacia Biotech).
MICKOSATELLITE M A K E R S ANALYSIS.
Molecular Investigations
Results
Genomic
DNA was extracted from white blood cells. Fragments of
exons 7 and 8 of the centromeric and telomeric SMN genes
were amplified by the polymerase chain reaction (PCR).
The oligonucleotide primers R1 1 1 (SMA7A), 541 C960
(SMAsA), and 5 4 1 ~ 1 1 2 0(SMA8B) were taken from Lefebvre and colleagues [2]. The antisense primer for exon 7
(SMA7B) was moved toward the 3' end of the exon (TCCTTAATTTAAGGAATGTGAGCA) (see Fig 8). Primers
SMA7B and SMA8B were FITC (fluorescein isothiocyanate)
labeled. Genomic DNA (300 ng) was used in an amplification reaction in 50 p1 of PCR mix containing 200 p M
dNTPs, 50 p M concentration of each primer, 1 unit Taq
polymerase (Perkin-Elmer) for 30 cycles (1 minute at 9 4 ° C
1 minute at 60"C, 1 minute at 72°C). Amplification products were analyzed by single-strand conformation polymorphism (SSCP); 15 p1 was mixed with an equal volume of
formamide, denatured for 5 minutes at 95°C and loaded
onto a native polyacrylamide gel (0.5 X Hydrolink MDE,
J. T. Baker, in 0.6 X TBE) for 12 hours at 400 V and at
4°C. The gels were analyzed directly on a Fluorimager (Vistra) and with ImagequaNT software (Molecular Dynamics).
Neuropathology
A muscle biopsy (musculi gastrocnemius) revealed
groups of atrophic fibers. No fiber-type grouping was
seen. A small nerve biopsy (sural nerve branch) did not
GENOMIC ANALYSIS OF SMN GENE DELETIONS.
732 Annals of Neurology
Vol 40
No 5
November 1996
reveal important changes.
Gross neuropathological examination revealed a
brain weight of 585 gm a n d moderate ventricular dilatation. On microscopic examination, the thalamus
showed disseminated chromatolytic neurons (Fig IA).
Several of these h a d a ballooned aspect, with a large
eosinophilic inclusion. In the ventral lateral thalamic
nucleus many basophilic round structures surrounded
by microglial cells were found, suggesting dead neurons
with neuronophagia. The chromatolytic and the ballooned neurons, as well as the basophilic structures
stained dark in Bielschowsky stains (Fig 2A). The involved neurons often showed intense silver staining of
t h e neuronal processes, especially in the proximal part.
T h e changes were very pronounced in the ventral Iatera1 thalamic nucleus. Chromatolytic neurons a n d bal-
Fig 1. (A) Ventral lateral thalamic nucleus showing neuronophagia (arrows), difise gliosis, and ballooned neurons (arrowheads)
(hematoxylin-eosin, X 70). (B) Interpeduncular nucleus with several ballooned neurons (hematoxylin-eosin, X 140). (C) Nerve
cell loss, gliosis, atrophic (arrows) and ballooned (arrowheads) neurons in the ventral born of the cervical spinal cord (hematoxylin-eosin, X 140). (0)
Ballooned neurons in the ventral horn (Bielschowsky, X 280).
Fig 2. Ballooned neuron in the thalamus. (A) Bielschowsky
(X 280).
looned neurons were also prominent in mesencephalic
nuclei, in the pallidum, in the nucleus basalis of Meynert, and in the motor nuclei of the 111, IV, VI, VII,
and XI1 nerves (Fig IB). Basophilic bodies with neuronophagia were absent in cranial nerve nuclei. Less
pronounced but similar changes were seen in the nucleus dentatus of the cerebellum, in the vestibular nu-
(B) Anti-neurojlament
(X 280).
clei, in the inferior olivary nuclei, and in the motor
and sensory trigeminal nuclei. The nerve cell changes
in those nuclei were accompanied by a moderate astrocytic gliosis. In the spinal cord, neurons in the ventral
horns and in Clarke’s column showed chromatolysis
and ballooning, and gliosis was present at all levels (Fig
1C and D). The chromatolytic and ballooned neurons
Devriendt et al: Congenital Spinal Muscular Atrophy 733
Fig 3. Singlr-strand sor$ormation polymo@isrrz analysis o f
thr teloineric and crntroineric exons 7 and 8 of the SMN
genes on chronrosome 5 ~ 1 3shoLurd 11 honiozygous deletion of
the telomeric rxoii 7 (7TEL) and oj ’ rh r centromeric rxoii 8
(8CEN) in the patient (klnr I ) [1~5J.In the f i t h e r (lane 2)
and mother (lane 3 ) , at /ellst onr copy of rxons 7 rind 8 wlzs
present
ill
both the trlomeric and c-rwtromrric germ
stained intensively with Bielschowsky staining. Chromatolytic neurons were also present in the dorsal root
ganglia.
T h e sections taken from the cerebral cortex, including the motor cortex, and from the nucleus caudatus
and putamen did not reveal the characteristic ballooned
or chroniatolytic neurons. Immunohistocheniical staining showed intense staining of the ballooned neurons
with antibodies against neurofilanients, sometimes with
central clearing of the inclusion (Fig 2B). There was a
slight punctiforrn central staining with antibodies
against ubiquitin. The perikaryon and some processes
of the ballooned neurons were also stained with antibodies against MAPL. Staining with anti-tau was entirely negative.
MoIecidar Investigfitions
SSCP analysis of exon 7 revealed the honiozygous absence of the telonieric copies, whereas at least one copy
of rhe centromeric exon 7 was detected (Fig 3 ) . Analysis of exon 8 showed a homozygous deletion of the
centromeric copies, with the presence of at least one
copy of telomeric exon 8 (see Fig 3 ) . In the parents,
at least one copy of both the telonieric and centromeric
exons 7 and 8 was demonstrated. This SSCP assay does
734 Annals of Neurology Vol 40
No 5
November 1996
not allow to distinguish between the presence of one
versus two copies of a specific exon [14, IS].
The precise molecular nature of the mutations in
this patient was further investigated by PCR amplification at the genomic level using oligonucleotides located
in exon 7 (sense primer, SMA7A) and exon 8 (antisense primer, SMA8B) (see Fig 8). A fragment of approximately 1,100 bp was obtained, exactly as seen in
normal controls (result not shown). Direct sequence
analysis showed that this fragment contained a normal
centromeric exon 7 and a normal telonicric exon 8.
These observations suggest the presence of a “chimeric” SMN gene in this patient, with a rearrangement
between the centromeric exon 7 and telomeric exon 8
of the SMN genes (see Fig 8). To study the expression
of this gene, RT-PCR on RNA isolated from muscle
from this patient was performed, yielding amplification
products of approximately 420 bp and 360 bp, exactly
as in control samples (Fig 4), showing that this chimeric gene is transcriptionally functional. T h e amplification products were cloned and sequenced. All 10 analyzed clones represented the shorter fragment, and
sequence information confirmed that this fragment
consisted of an alternatively spliced cDNA, lacking
exon 7 but with a telomeric exon 8. No attempt was
made to specifically pick clones containing the underrepresented 420-bp fragment. 111 the patient’s sample,
the alternatively spliced 360-bp fragment was more
abundant compared with the 420-bp fragment, suggesting that a transcript lacking exon 7 is preferentially
generated from this chimeric gene.
Analysis of exon 5 of the NAIP gene showed a homozygous deletion in NAIP in this patient (Fig 5). T h e
parents both carry at least one copy of the N A P gene.
As shown in Figure 6, analysis of flanking polymorphic markers MAP and CVS demonstrated that the
mutated alleles in the patient are both of grandpaternal
origin. There is no evidence for consanguinity. Analysis
of the polymorphic marker C272, which is located
within the duplicated region on chromosome 5 q l 3 , is
shown in Figure 7 ([2, 131; Fig 8). The patient’s father
did not inherit any C272 allele from his father. Since
the patient inherited this grandpaternal chromosome 5
(see Fig 6), his only allele (“4”) must be of maternal
origin, and thus, no C272 alleles are inherited from his
paternal grandfather. ‘This, together with the previous
results, strongly suggests the presence on this grandpaternal 5q13 region of a large deletion encompassing
both the centronieric and telonieric SMN genes and
probably also the NAIP gene(s). T h e other 5q13 region, inherited from the maternal grandfather, carries
a single C272 allele (“4”), and this is compatible with
the presence of a single chimeric SMN gene. T h e maternal aunt of this patient had classic SMA type I, suggesting that a de novo mutation probably did not occur
in this patient. No DNA was available from the aunt
5’-
-3’
1
chimeric SMN gene
RT-PCR
420 bp (7+)
360 bp (7-)
alternatively spliced
~
~
~
~
~
~
~
~
~
~
~~
~
~
~
~~
~
~
~
~
~~
Fig 4. Analysis of S M N gene expression by reverse transcription-polymerase chain reaction (RT-PCR). RT-PCR was pevformed on
RNA extractedjom muscle tissue of the patient (P),and two non-SMA patients with muscle disease ( N l , N2). Amplification
products of approximately 420 bp and 360 bp were obtained, representing the normal (7+)and alternatively spliced (7-, lacking exon 7)transcript. In the patient, the 7- transcript was more abundant, a feature of the centromeric S M N gene. The chimeric SMN gene and the ampliJed fiagments obtained afier RT-PCR are schematically represented above, with the location of the
oligonucleotide primers indicated by shaded arrows.
138
1 3 F132T 0 11404 0138
230 232
230 226
136
138
230
11364 F
136T 0 i : :
230 230
232
I
128
140
230
136
138
230
140
136
230
232
136
138
232
140
136
230
Fig 5. Analysis of NAIP gene deletions. Exon 5 (upper band)
and exon 13 (lower band) of the NAIP gene were amplified
by polymerase chain reaction. In the patient (arrow), a homozygous deletion of exon 5 was present.
Fig 6 Microsatellite analysis of markers Janking the SMA
locus. The patient inherited the SMA loci fiom both his
grandfathers. There is no evidence of consanguinity.
with SMA type I, but her probable genotype could be
reconstructed from the analysis of her parents, who
both must be carriers. The most likely situation is that
she inherited the chimeric SMN gene from her father.
The normal allele in her mother, i.e., the allele transmitted to her healthy daughter, carries a double dose
of C272 allele “2”.The mutated allele therefore carries
a single C272 allele “4”, which is compatible with the
presence of a single, most probably centromeric, SMN
gene.
Discussion
The index patient of this report presented clinical, electrophysiological, and pathological features of SMA type
I or Werdnig-Hoffmann disease. However, two unusual features were present. First, an extremely severe
disease with early, intrauterine onset resulting in the
fetal hypokinesia sequence and in early death. A congenital heart disease was also present, and these features
have been regarded as an exclusion criterion for the
diagnosis of SMA [16]. However, recently, SMN gene
Devriendt et a]: Congenital Spinal Muscular Atrophy 735
C272
pat. grandfather
pat. grandniother
father
patient
mother
mat. grandfather
mat. grandmother
Fig 7. Analysis of mirrosutellite iricirkrr C272 located in the
h i p h a t e d .?MA ~octts.Arrows iirdiizte t/Je inheritance of
C272 alleles. *Comtaiit bands, n o t representing .yec@c alleles.
Tbe patient and h i s .fither @;led to inherit an allele j$om the
paternd gr~zndfutber,Jwggestirig tbe presence o f a h g t deletion. Tl~einheritance of’ 11 single v t a t e i x u l &le (“4’3
ft.m
his inotber i.c coinpatiblp urith the prexence of a single SMN
gene on this chromosome. Dosage m a & sbowed that tbe normal SMA locus of the maternal giwmhrrrother carries two
alleLes ‘2”:
7 % other
~
SMA locus has only it single (1272
allele (“‘4’3,which ir cortsistent with bizr being a carrier fir
SMA, most likely with tbe presenri, of (1 single, ceirtromeric
SMiVgene on 5g13.
deletions have been described in several patients with
infantile SMA and a congenital heart defect [17].
Second, distinct degenerative alterations were detected
in neurons beyond spinal motor neurons. WerdnigHoffmann disease is generally considered a lower motor neuron disease with onset usually in the first
months of life. However, a subgroup of infants with
SMA with distinct pathological findings such as ballooning and neuronophagia, extending far beyond the
motor nerve nuclei in the spinal cord and brainstem,
were reported [7].Although these pathological findings
were occasionally reported in so-called classic WerdnigHoffmann disease, they were mainly found in infants
with an unusually severe disease, with either features
of the fetal hypokinesia sequence or early death (for a
review. see [7]).
So far, it was not known with certainty
whether this subgroup represents a distinct entity or
merely the severe end of classic Werdnig-Hoffmann
disease. The homozygous absence, in the present patient, of part of the telomeric S M N gene demon-
736 Annals of Neurology
Vol 40
No 5
November 1996
strates for the first time that at least some patients
with the fetal hypokinesia sequence and features of
SMA are allelic to Werdnig-Hoffmann disease, thus extending the spectrum of disease associated with S M N
gene deletions. Furthermore, in this patient, a unique
mutation was found, i.e., a homozygous deletion in
both telomeric SMN genes, and the presence of a single chimeric gene, composed of a centronieric exon 7
(and most probably the 5’ end of the centromeric
SMN gene) and a telomeric exon 8 (and most likely
the 3’ end of the telomeric SMN gene). This chimeric
gene is transcribed in muscle tissue and generates both
a normal and a more abundant alternatively spliced
transcript, and has therefore transcriptional characteristics of a normal centromeric copy of the SMN
gene [2]. A genetic rearrangement, either due to gene
conversion or to a very special chromosomal rearrangement, must have occurred leading to this chimeric gene and thus functionally transforming the telomeric S M N gene into its centromeric counterpart.
This observation further illustrates the susceptibility of
this genomic region to rearrangements.
Similar mutations involving the telomeric SMN
genes in 5q13 can cause a wide spectrum of severity of SiMA and very little is known about genotypephenotype correlations thus far. T h e existence of modifying genes has been hypothesized [2]. Larger deletions
in the duplicated region of 5q13 are more often found
in the more severe SMA type I [13]. This leads to the
suggestion that larger deletions may encompass other
genes involved in neuronal survival. O n e candidate
gene, the neuronal apoptosis inhibitory protein (NAIP)
gene, has been isolated in the duplicated region in
chromosome 5q13 (91. I n the patient presented here,
a deletion involving exon 5 of all NAIP genes was demonstrated and this is consistent with a role for this gene
in determining the severity of SMA. Also, there is evidence that this patient carries a large deletion on one
chromosome, which may involve other genes in this
region.
A second hypothesis proposes that the number of
residual centromeric SMN genes may modify the severity of the phenotype [2]. Even though a homozygous
deletion in the centromeric genes is found in approximately 5% of normal individuals, a deletion involving
both the two telomeric as well as the two centromeric
SMN genes has never been detected i n any of the 390
patients with SMA reported thus far, suggesting that
this may be lethal for the embryo [2, 141. I n the present patient all evidence points to the presence of only
a single, chimeric S M N gene with transcriptional characteristics of a centromeric SMN gene, and this was
associated with an unusually severe disease. This is
compatible with a critical role of the centromeric SMN
genes in neuronal development and survival, in the absence of functional telomeric S M N genes. It is interest-
A
CENTROMERIC
(NAIP)
TELOMERIC
SMN
b
4b4
8B
8A 7 8 7A
c272
SMN
PC
SMN I*
DT
PC
b4b
c272
7A 7R 8A
SMN
PT
SMN
b
4
8B
IA
I*
NAIP
4
8B
NAP
NAIP
P'
I
c2 7-7
Fig 8. Srbematir representation of the SkL4 loci on rhromosome 5q13.1. (A) Normirl cbroinosome. An inverted dirplicated frirgnient is present, with telomerir (shaded) and rentromerir (blank) SMN aiid NAIP genes. The arrow points front the 5' toiL:ard
the 3' end of the gene. PT iiidircrtes tbe promoter region of tbe telomeric SMN gene, P tbe promoter o f tbe rentromerir SMN
gene. The position of exons 6, 7, and 8 of tbe SMN genes are indirnted. (*) Indicates sequence differences between the teloineric
irnd rentromerir exons 7 and 8. These iilloui to distinguish t h e exons by single-strand rowforwintion polymorphism (SSCP). Tbe
location of the primers used .fir po4ymerase chain reartion (PCR) are indirated (filled arrowheads). The rentromerir NAIP gene is
between brackets, becriuse its exact nature is not clear. The location of micro-satellite mnrker C272 is sboum (B) Patient(I rbrontosomes. The paternal rbromosome contains a large-scale deletion in die SMA locus, enronipmivtg both telomerir and rentromerir
SMN and NAIP genes arid both ropies of C272. On the maternal cliromosome, IZ single C272 allele is present. A deletion in
both NAIP genes is present. A chimeric SMN gene is found, with its 3' end incliiding exon 8 originating front the telomeric
SMN gene (shaded), and its 5' end up to exon 7 originrriirig f r o m tbe rentromerir SMN gene (bhnk). Evidence in fivor of tbij.
stems from SSCP and revem transrription-PCR analysis rind fiom tbe f . c t that PCR with primers 7A aiid 8B yields n rbimeric
PCR fragment of 1. I kb. Tl,e orieritiitiori ofthis rbimerir gene is irndeterniined.
ing that his maternal aunt, with a less severe SMA type
I, most probably had two centronieric genes, one normal copy on her maternal chromosome and the chimeric gene on her paternal chromosome. T h e occurrence
of a similar chimeric SMN gene has been reported in
a patient with SMA rype 111 [2]. This patient was from
consanguineous parents, and therefore carried, most
likely, two copies of this chimeric gene, which again
could explain his less severe phenotype.
A dosage effect of the centromeric and telomeric
SMN genes in neuronal degeneration may thus exist;
the deletion of the telomeric S M N genes leads to a
spinal motor neuron degeneration, but a simultaneous
disruption of one or two centromeric S M N genes may
accelerate this process. This could lead to an earlier,
prenatal onset of the disease with an earlier death. In
addition, the pathological findings in the brains of the
present patient suggest an essential role for genes in
the SMA locus in the survival of neurons not only of
the motor nerve nuclei but also of neurons in the thalamus, mesencephalon, pallidum, and brainstem and spinal ganglia. This is in accordance with the widespread
S M N gene expression, including in the brain [2].O n
the other hand, not all neurons seem to be affected,
as, for instance, the cortical and striatal neurons seem
to be spared. T h e common denominator of the susceptible neurons must still be determined, although several
cholinergic neurons as in the nucleus basilaris and mo-
Devriendr et al: Congenital Spinal Muscular Atrophy
737
tor nerve nuclei seem to be especially vulnerable. T h e
immunohistochemical findings with accumulation of
neurofilaments suggest an alteration in neurofilament
metabolism [IS].
A simple dosage effect of the SMN genes cannot be
the sole explanation for a more severe disease in the
present patient, because homozygous deletions of the
centromeric SMN genes alone are not associated with
clinical disease [2]. Given the identical sequence of the
telomeric and the centromeric S M N genes, other molecular mechanisms are needed to explain this difference in biological function, such as a different temporal
or spatial expression pattern or a different splicing of
the two genes. It is of interest that only the centromeric
gene has an alternatively spliced form, lacking exon 7 ,
and thus a different 3' end of the protein [2]. Also, at
present, it is not clear whether the centrorneric and
telomeric S M N genes have different temporal and spatial expression patterns.
In conclusion, the present observation is compatible
with a role for the NAIP and centromeric SMN genes
in modifying the severity of the phenotype. Further
molecular studies in SMA patients with early-onset disease and widespread pathological changes are needed
to confirm the present observation.
~
~
We thank Mrs L. Van Roey and Mr I<. Van Hezik for technical
assistance.
References
I . DubowitL V. Muscle disorders in childhood. London: WB
Saunders, 1978:146-178
2. Lefebvre S, Burglen L, Reboullet S, et al. ldenrification and
characterization of a spinal muscular atrophy-determining gene.
Cell 1995;80:155-165
3. Kobayashi H.Baumbach L, Matiae l ' C , et 1' 1. A gene for a
severe lethal form of X-linked arthrogryposis (X-linked infantile
spinal muscular atrophy) maps to human chromosome Xpl 1.3q11.2. H u m Mol Genet 1995;4:1213-1216
738 Annals of Neurology
Vol 40
No 5
N o v e m b e r 1996
4. Cobben J M , Scheffer H, de Visser M , et al. Apparent SMA I
unlinked to 514. J Med Genet 1994;31:242-244
5. Novelli G, Capon F, Tamisari L, er al. Neonatal spinal muscular atrophy wirh diaphragmatic paralysis is unlinked to 5ql1.2q13. J Med Genet 1995;32:216-219
6. Borochowitz Z, Glick B, Blazer S. Infantile spinal muscular
atrophy (SMA) and multiple congenital bone fractures in sibs:
a lethal new syndrome. J Med Genet 1991;28:345-348
7. Towfighi J, Young RSK. Ward RM. Is Werdnig-Hoffmann
disease a pure lower motor neuron disorder? Acta Neuropathol
1985;65:270-280
8. Shapira D, Swash M. Neonatal spinal muscular atrophy presenting as respiratory distress: a clinical variant. Muscle Nerve
1985;8:661-663
9. Roy N, Mahadevan MS, McLean M, er al. The gene for
neuronal apoptosis inhibitory protein is partially deleted in
individuals with spinal muscular atrophy. Cell 1995;80:167178
10. Soares VM, Brzustowics LM, Kleyn I'W, et al. Refinemenr of
the spinal muscular atrophy locus to an inrerval between
D5S435 and MAP-1 B. Genomics 1993;15565-371
1 I . Lien LL, Royce FM, Kleyn P, et al. Mapping of human tnicrotubule-associated protein 1B in proximity to the spinal muscular atrophy locus a t 5q1.3. Proc Natl Acad Sci USA 1'191;88:
7873-7876
12. Clermont 0 , Burler P, Burglen L, et al. U s e of genetic and
physical mapping to locate the spinal muscular atrophy locus
between cwo new highly polymorphic DNA markers. Am J
H u m Genet 1994;54:687-694
13. Melki J, Ixfebvre S. Burglen L, et al. De novo and inherited
deletions of the 5q13 region in spinal muscular atrophies. Science 1994;264: 1474- 1477
14. Rodrigues NR, Owen N, Talbot K, et al. Deletions in the
survival motor neuron gene on 5q13 in autosomal recessive
spinal muscular atrophy. H u m Mol Genet 1995;4:631--634
15. Matthijs G, Schollen E, Legius E, et 31. Unusual molecular
findings in aurosomal recessive spinal muscular atrophy. J Med
Genet 1996;33:469-474
16. Munsat TL. Workshop reporr: international SMA collaboration. Neuromusc Disord 1991;1:81
17. Biirglen L, Spiegel R, lgnatius J. et al. SMN gene deletion in
variant of infantile spinal muscular atrophy. Lancet 1995;346:
316-3 I7
18. Murayama S, Bouldin TW,Suzuki K. lmmunocytochemical
and ultrastructural studies of Werdnig-Hoffmann disease. Acta
Neuroparhol 1991;81:408-417
Документ
Категория
Без категории
Просмотров
0
Размер файла
938 Кб
Теги
atrophy, features, spina, molecular, clinical, congenital, genetics, muscular
1/--страниц
Пожаловаться на содержимое документа