close

Вход

Забыли?

вход по аккаунту

?

Clinical and molecular overlap in overgrowth syndromes.

код для вставкиСкачать
American Journal of Medical Genetics Part C (Semin. Med. Genet.) 137C:4 –11 (2005)
A R T I C L E
Clinical and Molecular Overlap in
Overgrowth Syndromes
GENEVIÈVE BAUJAT, MARLÈNE RIO, SYLVIE ROSSIGNOL, DAMIEN SANLAVILLE,
STANISLAS LYONNET, MARTINE LE MERRER, ARNOLD MUNNICH, CHRISTINE GICQUEL,
LAURENCE COLLEAUX, AND VALÉRIE CORMIER-DAIRE*
Here, we report the clinical and molecular analysis of 75 patients with overgrowth and mental retardation,
including 45 previously reported cases [Rio et al., 2003; Baujat et al., 2004]. Two groups are distinguished: group I
corresponding to patients with recognizable overgrowth syndromes (Sotos syndrome (SS), Weaver syndrome
(WS), Beckwith–Wiedemann syndrome, Simpson–Golabi–Behmel syndrome (SGBS), and del(22)(qter)
syndrome) (60 cases) and group II corresponding to unclassified cases (15 patients). We investigated NSD1 and
GPC3 deletions or mutations, 11p15 abnormalities, and 22qter deletions. Surprisingly, in Group I, two SS patients
had 11p15 abnormalities and two patients with Beckwith–Wiedemann syndrome had NSD1 aberrations. In group
II, two cases of del(22)(qter) were identified but neither NSD1, 11p15, nor GPC3 abnormalities were detected.
These results emphasize the clinical and molecular overlap in overgrowth conditions.
ß 2005 Wiley-Liss, Inc.
KEY WORDS: Sotos syndrome; Weaver syndrome; Beckwith–Wiedemann syndrome; Simpson–Golabi–Behmel syndrome; del(22)(qter)
INTRODUCTION
Although problems in overgrowth were
documented and appreciated in the
nineteenth century, conditions such as
Beckwith–Wiedemann syndrome (BWS,
OMIM 130650) and Sotos syndrome
Dr. Geneviève Baujat has a Fellowship in
Pediatrics and received her M.D. in Genetics
from the University R. Descartes in Paris. She
currently focuses on developmental pediatrics and overgrowth syndromes.
Valérie Cormier-Daire M.D., Ph.D., is a
Medical Geneticist in the Department of
Medical Genetics of Necker Enfants Malades
Hospital in Paris, France. She has first trained
in Pediatrics and then in Medical Genetics.
Her PhD was focused on mitochondrial
disorders. She has spent one year in Los
Angeles at the Skeletal Dysplasia Registry.
She is now involved at a clinical and research
level in the skeletal dysplasia field and has a
particular interest in syndromes and overgrowth conditions. She is the coauthor of
more than 140 articles in the medical and
scientific literature.
Grant sponsor: Fondation pour la
Recherche Medicale (FRM); Grant sponsor:
le Fond de Recherche de l’Assistance Publique des Hôpitaux de Paris (FR-APHP).
*Correspondence to: Valérie CormierDaire, M.D., Ph.D., Département de Génétique Médicale, Hôpital Necker-Enfants
Malades, 149 rue de Sèvres, 75743 Paris
cedex 15, France. E-mail: cormier@necker.fr
DOI 10.1002/ajmg.c.30060
ß 2005 Wiley-Liss, Inc.
(SS, OMIM 117550) were delineated by
the 1960s. Other distinct overgrowth
syndromes have been defined since in
the early 1980s, such as Weaver syndrome (WS, OMIM 277590) [1974],
Perlman syndrome (PS, OMIM 267000)
[1975], Simpson–Golabi–Behmel syndrome (SGBS, OMIM 312870) [1975],
and Bannayan–Riley–Ruvalcaba syndrome (OMIM 153480) [1976].
This clinical overlap makes diagnosis
of overgrowth syndromes often difficult
[Verloes et al., 1995; Opitz et al., 1998].
More recently, molecular overlap has
been demonstrated within this group of
childhood overgrowth conditions [Li
This clinical overlap makes
diagnosis of overgrowth
syndromes often difficult.
More recently, molecular
overlap has been demonstrated
within this group of childhood
overgrowth conditions.
et al., 2001; Baujat et al., 2004]. Finally,
large numbers of patients with overgrowth syndromes do not belong to any
recognizable condition. Here, we report
the clinical and molecular analysis of a
series of 75 patients with overgrowth and
mental retardation syndromes and provide additional evidence of clinical and
molecular overlap in these conditions.
MATERIALS AND METHODS
Patients
High-resolution chromosomal analysis and molecular analysis for fragile
X syndrome were systematically performed before inclusion of the patients.
Three unbalanced rearrangements were
identified in patients with overgrowth
and mental retardation: one case of
mosaicism for 20p11.2 trisomy, involving a region that contains the somatosatin receptor 4 gene (SSTR4); one child
with an overgrowth syndrome resembling SS [Faivre et al., 2000]; a 6q16;13q14
translocation, resulting in 6q16 deletion;
and, two sibs with 15q26.1-qter trisomy
involving a region that contains IGF1
[Faivre et al., 2002]. These three patients
were therefore excluded from this study.
ARTICLE
AMERICAN JOURNAL OF MEDICAL GENETICS (SEMIN. MED. GENET.)
Seventy-five patients were included
in the series. Among them, 45 have been
previously reported [Rio et al., 2003;
Baujat et al., 2004]. They all had the
following manifestations: height > 97th
centile, OFC > 97th centile, developmental
delay, and at least two minor features
among the following: bone age >90th
centile, abnormal craniofacial features,
and congenital malformations.
All patients were regularly followed
in the Department of Medical Genetics
of Necker–Enfants Malades hospital for
10 years and phenotypically scored by
clinical geneticists. They were classified
into two groups: group I (60 cases)
included patients with a recognizable
overgrowth disorder (38 SS, 6 WS, and 2
SGBS). Fourteen patients with BWS
with some degree of mental retardation
were also included in this group. Group II
(15 cases) included patients with unclassified overgrowth syndromes.
The rationale for the molecular
analysis of these patients was:
Group I patients were first investigated for suspected molecular
defects: NSD1 (nuclear receptor
SET domain containing protein)
screening in patients with SS and
WS, 11p15 region in BWS, and
GPC3 screening in SGBS. When
no abnormality was found,
patients were tested for other
molecular aberrations (Fig. 1).
Group II patients were screened
for NSD1 gene, 11p15 region,
GPC3, and 22qter region.
Cytogenetic and Molecular Studies
Consent was obtained from all patients
and/or parents. Genomic DNA from
each patient was isolated from blood
lymphocytes using a Nucleon kit
(Amersham, UK) according to the
manufacturer’s instructions.
NSD1 Analysis
To identify microdeletions in NSD1,
patients and their parents were genotyped using four polymorphic microsatellite markers (two intragenic and
two located next to the NSD1 gene),
according to Rio et al. [2003]. Patients
who were homozygous for both intragenic markers were subsequently
screened for a whole gene deletion by
FISH analysis using the PAC RPCI-1
118M12 as a probe. When NSD1
microdeletion was excluded by genotyping and FISH, patients were then
5
selected for NSD1 sequencing according to Rio et al. [2003].
11p15 Investigation
To screen for deletions or uniparental
disomy (UPD) of the 11p15 region,
three polymorphic microsatellite markers (D11S4046, D11S1338, and
D11S1346) were genotyped in patients
and their parents. Deletion and disomy
were further confirmed by performing
FISH analysis, using PACs RP11896B12 and RP11-908H22 probes,
located on distal chromosome 11p. The
methylation status of KCNQ1OT1 and
H19 in the 11p15 region was subsequently investigated, as described by
Gaston et al. [2001]. Finally, a germ line
CDKN1C mutation was searched for by
direct sequencing [Gaston et al., 2000].
GPC3 Mutation Analysis
Direct sequencing of the GPC3 gene
was performed, using primers as previously reported [Huber et al., 1997].
del(22)(q13) Detection
Patients and their parents were genotyped using three polymorphic micro-
Figure 1. Rationale for the molecular analysis of group I.
6
AMERICAN JOURNAL OF MEDICAL GENETICS (SEMIN. MED. GENET.)
ARTICLE
TABLE I. Primer Sequences for Chromosome 22qter Microsatellite Markers
Microsatellite
DNA marker
D22S1169
Z821 89
AL022 327
Primer sequence (50 !30 )
Distance from
the p telomere
Forward
Reverse
Approximate
size (bp)
47.63
48.
48.6
GCACACACATGCACATAATC
AATTCCCACCAGGATGCT
AGAGGGAGAGTCTCTTTCTC
AACAAAACTTCCAGCAGACG
ATTTTGCGGGCAGGATTCAG
GACATTGCCTCTTAGTTCAC
124
284
166
and 7968delGACA) [Baujat et al., 2004].
In these four cases, retrospective analysis
supported the initial diagnosis (Fig. 2A,B,
Table IIIA,B). Finally, within group I,
no molecular basis was identified in
24 patients (11 SS, 3 WS, and 10 BWS).
In group II (15 patients), the systematic molecular analysis permitted
identification of two cases of del(22)
(qter) (Fig. 3). No NSD1, 11p15, or
GPC3 abnormalities were found. Finally,
within this group II, the molecular basis
of 13 patients remained unidentified.
satellite markers of the 22qter region,
located near SHANK3 (Table I). Fluorescent genotyping was performed as
previously described [Rio et al., 2002].
The deletion was then confirmed by
FISH analysis using the cosmid
106G1220P [Bonaglia et al., 2001].
RESULTS
Table II summarizes the results. In group
I, 25/38 SS patients, and 3/6 WS
patients had an NSD1 abnormality (8
deletions and 20 intragenic mutations,
2/14 patients with BWS had an 11p15
abnormality (1 CDKN1C mutation,
514delAC, and 1 KCNQ1OT1 demethylation), and 2/2 patients with SGBS
had GPC3 mutations (1562C!T and
749G!A). The secondary molecular
analysis in the remaining patients of this
group (n ¼ 28) allows the identification
of four additional aberrations: (1) 11p15
paternal isodisomy in one case and
partial demethylation of KCNQ1OT1
with normal methylation of the H19
in a second case of SS; and (2) NSD1
mutations in two cases of BWS (4976insG
Patients with specific clinical
recognized entities (group I)
were the most frequent in our
series (60/75 patients) and,
among them, 53% were
confirmed by molecular
diagnosis. SS was the most
common condition in our
series and may be the most
often diagnosed overgrowth
syndrome.
DISCUSSION
The series of 75 patients reported here
represents nosologic difficulties faced by
clinical geneticists attempting to diagnose, molecularly diagnose, and counsel
in overgrowth conditions. Table IV lists
the classical findings in the five major
overgrowth disorders with known
molecular abnormalities.
Patients with specific clinical recognized entities (group I) were the most
frequent in our series (60/75 patients)
and, among them, 53 % were confirmed
by molecular diagnosis (Table II). SS was
the most common condition in our
series (38/60) and may be the most often
diagnosed overgrowth syndrome. WS,
now described as allelic to SS, is less
frequently observed (six cases in our
series). NSD1 abnormalities were found
in 65% of our SS cases and in 50% of
TABLE II. Results of the Molecular Screening
Molecular defects
Clinical diagnosis
Group 1: Sotos syndrome
Weaver syndrome
Beckwith–Wiedemann syndrome
Simpson–Golabi–Behmel syndrome
del(22)(qter) syndrome
Total
Group 2: unclassified
Total
Number of
patients
NSDI
11p15
GPC3
del (22)(qter)
No molecular
basis
38
6
14
2
0
60
15
75
25
3
2
0
0
30
0
30
2
0
2
0
0
4
0
4
0
0
0
2
0
2
0
2
0
0
0
0
0
0
2
2
11
3
10
0
0
24
13
37
ARTICLE
AMERICAN JOURNAL OF MEDICAL GENETICS (SEMIN. MED. GENET.)
TABLE IIIA. Patients Clinically Diagnosed as Beckwith–Wiedemann
Syndrome with NSD1 Mutations (n ¼ 2)a
Wiedemann syndrome
features of Sotos syndrome
Features of Beckwith
Presence of
Postnatal overgrowth
Hypoglycemia
Abdominal wall defect
Hemihypertrophy
Genito-urinary abnormalities
(renal cysts, ureteral reflux)
Absence of
Macroglossia
Ear lobe crease
Frontal angioma
Visceromegaly
a
Presence of
Postnatal overgrowth
Mental retardation
Scoliosis
2
1
2
1
2
1
2 (mild)
1
Absence of
Advanced bone age
Sotos facial features
CNS malformations
Seizures
Atypical feature: craniosynostosis in one case.
our WS cases, and this is consistent with
previously published series [Douglas
et al., 2003; Turkmen et al., 2003].
Two children with typical manifestations
of SGBS had GPC3 mutations. Finally,
14 patients with BWS in our series all
had some degree of mental deficiency,
which is not usually part of the BWS
spectrum, perhaps explaining the low
percentage of 11p15 abnormalities in
these patients. These findings illustrate
the importance of clinical analysis in
overgrowth conditions.
When a diagnosis is made by physical examination and confirmed by
molecular testing, clinical and molecular
overlap sometimes occurs (Fig. 4). Clinical similarities between SS and WS and
between BWS, SGBS, and PS have been
reported elsewhere [Verloes et al., 1995;
TABLE IIIB. Patients Clinically Diagnosed as Sotos Syndrome (SS) With
11p15 Abnormalities (n ¼ 2)a
Features of Beckwith–
Wiedemann syndrome
Features of Sotos syndrome
Presence of
Prenatal overgrowth
Postnatal overgrowth
Macrocephaly
Sotos facial features
Mental retardation
Seizures
Scoliosis
Absence of
CNS malformations
a
1
2
2
2
2
1
1 (severe)
Atypical feature: arachnodactyly in one case.
Presence of
Prenatal overgrowth
Postnatal overgrowth
Congenital heart defect
Septal hypertrophy
Absence of
Macroglossia
Ear lobe crease
Frontal angioma
Hypoglycemia
Abdominal wall defect
Visceromegaly
Hemihypertrophy
1
2
1
1
7
Opitz et al., 1998; Li et al., 2001]. SS and
WS share some features in common,
although distinctive features are present
in WS (hoarse low-pitched cry, distinctive facial appearance, deep-set nails,
finger pads, camptodactyly, and metaphyseal flaring) [Opitz et al., 1998]. The
identification of NSD1 aberrations in
both syndromes demonstrates that the
two conditions are allelic. Several patients
have been reassessed and diagnosed as
having SGBS after an initial diagnosis
of BWS [Verloes et al., 1995; Li et al.,
2001]. Indeed, both conditions share
many features, particularly during the
neonatal period: fetal overgrowth,
macroglossia, hernias, visceromegaly,
hypotonia, and hypoglycemia. The
molecular bases of these conditions can
explain the clinical overlap. BWS is
caused by dysregulation in the expression of imprinted genes in the 11p15
region, resulting in overexpression of
IGF2. SGBS is caused by mutations and
deletions in GPC3 and this gene encodes
an extracellular proteoglycan, glypican
3, which plays an important role in the
growth control of embryonic mesodermal tissue. Glypican 3 can interact with
IGF2 and forms a complex that modulates IGF2 action. Therefore, a defect
in glypican 3 should result in increased
IGF2. PS is a rare fetal overgrowth
disorder with nephroblastomatosis, distended abdomen, and hypoglycemia.
PS differs from BWS by the absence of
macroglossia, omphalocele and ear
creases, and by the presence of macrocephaly, deep-set eyes, broad and low
nasal bridge, long everted upper lip, and
low-set ears. However, the observation
of 11p15 aberrations in some PS cases
suggests that PS belongs to the phenotypic spectrum of BWS [Verloes et al.,
1995].
More surprisingly, our molecular
findings in clinically recognized conditions illustrate overlap between BWS
and SS [Baujat et al., 2004]. Two patients
clinically diagnosed as BWS had NSD1
mutations (Table IIIA, Fig. 2A). In both
cases, the diagnosis of BWS was based on
macrosomia, abdominal wall defect,
genitourinary anomalies, hemihyperplasia (1/2), neonatal hypoglycemia (1/
2), and absence of advanced bone age.
8
AMERICAN JOURNAL OF MEDICAL GENETICS (SEMIN. MED. GENET.)
ARTICLE
More surprisingly, our
molecular findings in clinically
recognized conditions illustrate
overlap between BWS and SS.
Two patients clinically
diagnosed as BWS had
NSD1 mutations.
Figure 2. A: Facial features of a patient with Beckwith–Wiedemann syndrome at
5 years of age with an NSD1 mutation. Note the absence of frontal bossing,
hypertelorism, and downslanting of palpebral fissures. B: Facial features of Sotos
syndrome (SS) patient at 15 months of age with 11p15 KCNQ1OT1 demethylation
(isolated). Note the frontal bossing, downslanting palpebral fissures, and anteverted
nostrils. Major scoliosis at 9 years of age.
Figure 3. Three patients with del(22)(qter) from group II (unclassified overgrowth
syndromes). Note the minor facial features, including a large forehead and prominent chin.
Both cases have, in addition, facial
features and developmental delay, which
are not usual findings of BWS. Conversely, two patients clinically diagnosed
as SS had 11p15 abnormalities (one
UPD and one KCNQ1OT1 demethylation) (Table IIIB, Fig. 2B). The two
children had overgrowth, macrocephaly,
advanced bone age, developmental
delay, characteristic facial features, ventriculomegaly (1/2), severe scoliosis (1/
2), and seizures (1/2). In addition, they
did not have macroglossia, earlobe
creases or pits, frontal nevus flammeus,
abdominal wall defect, or hypoglycemia.
These findings suggest considering NSD1
and 11p15 testing in children with
atypical features of BWS or SS. The
relationship between NSD1 and the
11p15 region is unknown, but NSD1
encodes a nuclear protein containing an
SET domain involved in histone methylation and may play a role in establishing
imprinting of the 11p15 region [Baujat
et al., 2004].
In group II, patients were considered as having unclassified overgrowth
disorders when no NSD1, 11p15 region,
or GPC3 abnormality was identified.
However, within this group, the systematic screening led to the identification of two 22 qter deletions. The two
patients with del(22)(qter) have in common overgrowth and behavioral alterations. The wide phenotypic spectrum
of del(22)(qter) syndrome has been
reviewed elsewhere [Phelan et al., 2001]:
mental retardation with severe verbal
delay, hypotonia, large ears, normal-toaccelerated growth, and behavioral
alterations. Minor facial features, suggestive of SS, have been also mentioned
(pointed chin, dolichocephaly, seizures,
recurrent ear infections, and highly
þ
þ (or hypertonia)
?
þþ
þþ (tube feeding: 40%)
þ
þ
þþþ
Deep fingernails
Marked (carpal age higher
than hand age)
þ
Camptodactyly
Deep horizontal chin crease
Large ears
Wide face
Micrognathia and
later macrostomia
Hoarse voice
Flat occiput
Hypertelorism
þþþ
Large
Scoliosis
Hands and feet
Macroglossia
Ear creases or posterior
helical ear pits
Facial nevus flammeus
Neonatal period
Feeding difficulties
Hypoglycemia
Jaundice
Hypotonia
þþþ (84%)
Hypertelorism
Downslanting palpebral
fissures
High cleft palate
Prominent jaw
Facial flushing
Pointed chin
þþþ
Large head
þþþ
Dolichocephalic
large head
Prominent forehead
Broad forehead
þþþ
þ
þþþ
Weaver syndrome
þþþ
þ
þþþ (83%)
Sotos syndrome
Skeletal
Advanced bone age
Prenatal features
Fetal overgrowth
Hydramnios
Postnatal overgrowth
(growth>90th centile)
Birth head circumference
Craniofacial configuration
Syndrome
þþþ
Coarse facies
þþþ
þ
þþþ
Simpson–Golabi–
Behmel syndrome
þþ
þþþ (30%–50%)
þ
þþ
þþþ (62%)
þþþ (95%)
þþþ (76%)
þþ (66%)
Prominent ears
Ptosis
Epicanthic folds
Pointed chin
Dolichocephaly
þþ (95% accelerated growth)
del(22)(qter )
syndrome
50% neonatal death
þ
þ
þ
þþ
(Continued)
þ (vertebral defects)
Short, broad with variable Large, fleshy hand, fifth finger
deformities
Clinodactyly (14%)
Complete transverse palmar
Hypoplasia of nails
crease Fingernail hypoplasia
Mild ectodermal dysplasia
þ
(þ)
þþ
Prominent eyes with relative
Hypertelorism
infraorbital hypoplasia
Prognathism
Downslanting palpebral fissures
Capillary nevus in the central
Epicanthic folds
forehead and eyelids
Short nose
Macrostomia
Dental malocclusion
Central groove of the lower lip
Relatively small
Protruding occiput
þþþ
þþþ
þþþ (88%–91%)
Beckwith–
Wiedeman syndrome
TABLE IV. Major Clinical and Molecular Findings in the Main Overgrowth Disorders
ARTICLE
AMERICAN JOURNAL OF MEDICAL GENETICS (SEMIN. MED. GENET.)
9
?
þ (?)
þ
(l case)
NSDI in_of cases (?)
AD
þ (8%)
þ
?
?
NSDI in 2/3 of cases (?)
AD
þ (cystic dysplasia)
þ
þ
þ
þ
Suppernumerary
(debated)
þ (macroglossia and
malocclusion)
Simpson–Golabi–
Behmel syndrome
cryptorchidism hypospadias
þ (6,5%)
þþ (35%)
þ
þ
þ
þ
þ
þ
þ (8%–8%, malignant, below 5 þ (malignant, below 5 years
years)
11p15 anomalies in 80%–85% GPC3 (Xq25-q27) X-linked,
Sporadic þþþ familial in 5%
Mild expression in
heterozygous females
þ
þþ (60%, cysts, hydronephrosis)
Large ventricles
þ
þ
þ
Hydrocephaly
þ
þþ (50%)
þþ
80%
þþþ
þ
þ
þþ (12.5%)
þþ (60%)
(debated)
þ (macroglossia)
Beckwith–
Wiedeman syndrome
þ
þ
þ
þþ
Weaver syndrome
Possible
þ
þ
þ
þþ
þ
þþ
Sotos syndrome
The frequency of clinical findings approximatively estimated as: nearly constant (þþþ), frequent (þþ), occasionally reported (þ), absent ().
Gene
Inheritance
Behavioral problems
Neurological findings
Ventriculomegaly
CNS malformation
Seizures
Congenital renal
abnormalities
Genitalia
Congenital heart defects
Heart arrhythmias
Polydactyly
Cleft palate
Neoplasms
Abdominal wall defect
Omphalocele
Umbilical hernia
Diastasis recti
Hemihypertrophy
Organomegaly
Nipples
Mental retardation
Lack of fine motor skills
Delay in speech
Syndrome
TABLE IV. (Continued)
SHANK3 disruption
þþþ
þþþ(severe)
þþ
del(22)(qter )
syndrome
10
AMERICAN JOURNAL OF MEDICAL GENETICS (SEMIN. MED. GENET.)
ARTICLE
ARTICLE
AMERICAN JOURNAL OF MEDICAL GENETICS (SEMIN. MED. GENET.)
Figure 4.
11
Clinical overlap between Sotos, Weaver, Beckwith–Wiedemann, and Simpson–Golabi–Behmel syndromes.
arched palate) (Table IV). The size of the
deletion is variable from 130 kb to over 9
Mb; FISH analysis with the SHANK3
probe and/or genotyping by microsatellite DNA markers [Wilson et al., 2003]
should probably be performed in unclassified overgrowth patients.
We conclude that, among recognized overgrowth syndromes, clinical
overlap suggests considering NSD1,
11p15, and GPC3 testing in individuals
with atypical features of SS or BWS with
some degree of mental retardation. In
patients with unclassified overgrowth
conditions, systematic screening for
del(22)(qter) will permit a better estimate of the incidence of this deletion.
REFERENCES
Baujat G, Rio M, Rossignol S, Sanlaville D,
Lyonnet S, Le Merrer M, Munnich A,
Gicquel C, Cormier-Daire V, Colleaux L.
2004. Paradoxical NSD1 mutations in Beckwith–Wiedemann syndrome and 11p15
anomalies in Sotos syndrome. Am J Hum
Genet 74:715–720.
Bonaglia MC, Giorda R, Borgatti R, Felisari G,
Gagliardi C, Selicorni A, Zuffardi O. 2001.
Disruption of the PROSAP2 gene in a
t(12;22) (q24.1;13.3) is associated with the
22q13.3 deletion syndrome. Am J Hum
Genet 69:261–268.
Douglas J, Hanks S, Temple K, Davies S, Murray
A, Upadhayaya M, Tomkins S, Hughes HE,
Cole TRP, Rahman N. 2003. NSD1
mutations are the major cause of Sotos
syndrome. Am J Hum Genet 72:132–143.
Faivre L, Viot G, Prieur M, Turleau C, Gosset P,
Romana S, Munnich A, Vekemans M,
Cormier-Daire V. 2000. Apparent Sotos
syndrome (cerebral gigantism) in a child
with trisomy 20p11.2-p12.1 mosaicism. Am
J Med Genet 91:273–276.
Faivre L, Gosset P, Cormier-Daire V, Odent S,
Amiel J, Giurgea I, Nassogne MC, Pasquier
L, Munnich A, Romana S, Prieur M,
Vekemans M, de Blois MC, Turleau C.
2002. Overgrowth and trisomy 15q26.1qter including the IGF1 receptor gene:
Report of two families and review of the
literature. Eur J Hum Genet 10:699–706.
Gaston V, LeBouc Y, Gicquel C. 2000. Assessment
of p57 (KIP2) gene mutation in Beckwith–
Wiedemann syndrome. Horm Res 54:1–545.
Gaston V, Le Bouc Y, Soupre V, Burglen L,
Donadieu J, Oro H, Audry G, Vazquez MP,
Gicquel C. 2001. Analysis of the methylation status of the KCNQ1OT and H19
genes in leukocyte DNA for the diagnosis
and prognosis of Beckwith–Wiedemann
syndrome. Eur J Hum Genet 9:409–418.
Huber R, Crisponi L, Mazzarella R, Chen C-N,
Su Y, Shizuya H, Chen EY, Cao A, Pilia G.
1997. Analysis of exon/intron structure and
400 kb of genomic sequence surrounding
the 50 -promoter and 30 terminal ends of the
human glypican 3 (GPC3) gene. Genomics
45:48–58.
Li M, Shuman C, Fei YL, Cutiongco E, Bender
H, Stevens C, Wilkins-Haug L, DaySalvatore D, Yong S, Geraghty M, Squire J,
Weksberg R. 2001. GPC3 mutation analysis
in a spectrum of patients with overgrowth
expands the phenotype of Simpson–Golabi–
Behmel. Am J Med Genet 102: 161–168.
Opitz J, Weaver D, Reynolds J. 1998. The
syndromes of Sotos and Weaver: Reports
and review. Am J Med Genet 179:294–304.
Phelan M, Rogers R, Saul R, Stapleton G, Sweet
K, McDermid H, Shaw S, Claytor J, Willis J,
Kelly D. 2001. 22qter deletion syndrome.
Am J Med Genet 101:91–99.
Rio M, Molinari F, Heuertz S, Ozilou C, Gosset
P, Raoul O, Cormier-Daire V, Amiel J,
Lyonnet S, Le Merrer M, Turleau C, De
Blois C, Prieur M, Romana S, Vekemans M,
Munnich A, Colleaux L. 2002. Automated
fluorescent genotyping defects 10% of
cryptic subtelomeric reaarngements in idiopathic syndromic mental retadation. J Med
Genet 39:266–270.
Rio M, Clech L, Amiel J, Faivre L, Lyonnet S, Le
Merrer M, Odent S, Lacombe D, Edery P,
Brauner R, Raoul O, Gosset P, Prieur M,
Vekemans M, Munnich A, Colleaux L,
Cormier-Daire V. 2003. Spectrum of
NSD1 mutations in Sotos and Weaver
syndromes. J Med Genet 40:436–440.
Turkmen S, Gillessen-Kaesbach G, Meinecke P,
Albrecht B, Neumann L, Hesse V, Palanduz
S, Balg S, Majewski F, Fuchs S, Zschieschang
P, Greiwe M, Mennicke K, Kreuz F, Dehmel
HJ, Rodek B, Kunze J, Tinschert S,
Mundlos S, Horn D. 2003. Mutations in
NSD1 are responsible for Sotos syndrome,
but are not a frequent finding in other
overgrowth phenotypes. Eur J Hum Genet
11:858–865.
Verloes A, Massart B, Dehalleux I, Langhendries
JP, Koulischer L. 1995. Clinical overlap of
Beckwith–Wiedemann,
Perlman
and
Simpson–Golabi–Behmel syndromes: A
diagnostic pitfall. Clin Genet 47:257–
262.
Wilson H, Wong A, Shaw S, Tse W, Stapleton G,
Phelan M, Hu S, Marshall J, McDermid H.
2003. Molecular characterisation of the
22q13 deletion syndrome supports the role
of haploinsufficiency of SHANK3/PROSAP2 in the major neurological symptoms. J
Med Genet 40:575–584.
Документ
Категория
Без категории
Просмотров
0
Размер файла
176 Кб
Теги
overlay, molecular, clinical, syndrome, overgrowth
1/--страниц
Пожаловаться на содержимое документа