close

Вход

Забыли?

вход по аккаунту

?

Clinically distinct codon 69 mutations in major myelin protein zero in demyelinating neuropathies.

код для вставкиСкачать
BRIEF COMMUNICATIONS
Clinically Distinct Codon
69 Mutations in Major
Myelin Protein Zero
in Demyelinating
Neuropathies
v
Peter H. S. Meijerink, PhD,* Jessica E. Hoogendijk,
MD,?. Anneke A. W. M. Gabreels-Festen, MD,$
Ina Zorn,* Henk Veldman,? Frank Baas, PhD,'
Marianne de Visser, MD,* and Pieter A. Bolhuis, PhD'
Mutations in the major peripheral myelin protein zero
(PO) gene on chromosome lq21-q23 have been found
with the hereditary demyelinating polyneuropathy Charcot-Marie-Tooth type 1B. Here, we describe 2 patients
with distinct neurological characteristics, carrying different substitutions at the same codon-Arg69His and Atg69Cys. The patients were heterozygous for the mutation,
which in both appeared to be de novo. Histological examination of sural nerve biopsy specimens revealed defective
myelin as well as marked differences, confirming the importance of PO in the compaction of myelin.
Meijerink PHS, Hoogendijk JE, Gabreels-Festen
AAWM, Zorn I, Veldman H, Baas F, de Visser
M, Bolhuis PA. Clinically distinct codon 69
mutations in major myelin protein zero
in demyelinating neuropathies.
Ann Neurol 1996;40:672-675
Charcot-Marie-Tooth type 1 (CMT1 or hereditary
motor and sensory neuropathy [HMSN] type I) is the
most frequently inherited, autosomal dominant, demyelinating polyneuropathy and appears to be genetically
heterogeneous [l]. The locus for CMTIA, the most
common form, maps to chromosome 1 7 ~ 1 1 . 2and is
usually associated with a DNA duplication of 1.5 Mb
encompassing the peripheral myelin protein 22
(PMP22) gene. Single-base mutations in the PMP22
gene have been reported in a few nonduplicated
CMTlA cases [ l , 21.
Alterations in the major peripheral myelin protein
zero (PO) gene, localized on chromosome lq21-q23,
have been shown to cause CMTlB [ I , 31 and have
From the "Department of Neurology, Academic Medical Center,
Amsterdam; ?Department of Neurology, University Hospital
Utrecht, Utrechr; and $Institute of Neurology, University Hospital
Nijmegen, Nijmegen, the Netherlands.
also been found in patients with sporadic early-onset
disease with a more severe phenotype, also known as
Dejerine-Sottas syndrome [4].
PO is a 28-kd integral membrane glycoptotein encoded by 6 exons. It belongs to the immunoglobulin
superfamily, having a single extracellular domain resembling the immunoglobulin variable domain. In addition, PO contains single transmembrane and cytoplasmic domains [5]. A role for PO in myelin formation
has been demonstrated by the analysis of mice lacking
PO expression due to targeted mutagenesis [6].Since
the extracellular domain (encoded by exons 2 and 3)
is capable of homophilic interaction, PO presumably
plays a role in the compaction of peripheral myelin
[71.
We performed a mutation screening of the PO gene
in unrelated CMT patients, already characterized as
non-CMT1A, by single-stranded conformational analysis (SSCA) followed by sequencing of the relevant
DNA region. To study the effect of PO mutations on
myelin compaction, we also performed electron microscopic examinations on sural nerve biopsy specimens
from the patients.
Materials and Methods
Patients
C M T l patients were identified on the basis of neurological
abnormalities and markedly reduced nerve conduction. Patients had already been analyzed for the presence of the
C M T l A duplication and screened for mutations in the
PMP22 gene. With informed consent, surd nerve biopsy
samples were taken from the patients and examined by light
and electron microscopy.
Patient 1, a 28-year-old woman, had normal early development. From the age of 2 years onward, motor performances slowly deteriorated. Neurological examination at age
12 years revealed pes cavus, distal muscular weakness and
atrophy of the lower legs and the hands, slight distal sensory
loss, and nearly absent tendon reflexes. Motor nerve conduction velocity (MNCV) of the median nerve was 19 m/sec.
Sural nerve biopsy was performed. In the following years her
condition hardly deteriorated. The patient carried a
Arg67His substitution in exon 3 of the PO gene (see Results).
Patient 2, a girl, had normal development until the age
of 6 months. Motor development then stopped and she deteriorated after the age of 10 months. At 14 months, she had
an extreme head lag, had difficulties coughing, choked, and
cried without sound. She did not roll over nor did she push
herself up anymore. The arms and legs were weak and flaccid
with areflexia. Sural nerve biopsy was performed. She died
at the age of 22 months. M N C V in the ulnar nerve was 8.5
m/sec. She carried a Arg69Cys substitution in exon 3 of the
PO gene (see Results).
Received Dec 6, 1395, and i n revised ktrm Feh 8 and Apr 4, 1996.
Accepted for puhlication Apr 4 , 1996.
Address correspondence to Dr Bolhuis, Department of Neurology,
Academic Medical Center, Meibergdreef 9, 1105 A 2 Amsterdam,
the Netherlands.
672
Mutution Detection
Genomic DNA was isolated from leukocytes according to
standard procedures. Primers were chosen according to pub-
Copyright @ 1796 by the American Neurological Association
lished PO exonic and intronic sequences [ 5 ] : primers (5'3')-POex2R1 CTGAGACCCACTCACTGGAC; POex2F2
AGGTCCATGGTGCTGTGG; POex2R2 TTATCCAACC
CCAGGATTCC; POex3F1 AGGGTCCTCTCACATGC
TTC; POex3R1 AGGTTGTGTATGACAATGGAGC; and
POex3F2 TGGCTCCATTGTCATACACA. Primers A to F
described by Hayasaka and colleagues [8] were also used.
SSCAs were carried out essentially as described by Nicholson
and coauthors [9]. For analysis of the separate alleles, the
SSCA fragments were cut out of the gel and eluted in 100
p1 of sterile water. After three cycles of freezing (liquid nitrogen) and thawing (65"C), 5 pI was used in a 50+1 standard
polymerase chain reaction (PCR) for sequencing. PCR products for sequencing were also generated from genomic DNA
(100 ng). Products were column purified (Qiagen) and 50 ng
was directly sequenced using the dideoxy chain termination
method with the Sequitherm Cycle Sequencing Kit (Epicentre Technologies) and '3P-end-labeled PO primers. Samples were electrophoresed on 7% denaturing polyacrylamide
gels.
Nucleotide numbering of PO starts at the initiation site of
translation. Amino acid numbering starts at the first amino
acid (Ile) of the mature PO protein (without the 29 amino
acids from the signal peptide) [lo].
Light und Electron Microscow
Sural nerve biopsy specimens were prepared for light and
electron microscopic examination including morphometric
analysis. For ultrastructural analysis nerve specimens were
fixed immediately in 2% glutaraldehyde in 0.1 M cacodylate
buffer, pH 7.4, at 4°C for 3 hours and postfixed in 2%
osmium tetroxide, pH 7.4, for 1 hour, dehydrated in alcohol,
and embedded in epoxy resin (Epon). More than 1,000
nerve biopsy specimens were analyzed this way, including
from more than 100 patients with HMSN [ll].
Results
Mutations
W e analyzed the PO gene for the presence of mutations
using SSCA and direct sequencing. Patient 1 carried a
G-to-A mutation at position 293, leading to an amino
acid substitution of Arg to His at codon 69 (the same
mutation was found in another CMTlB patient [12]).
T h e Arg69His mutation appeared to be absent from
exon 3 of both clinically normal parents, demonstrating the de novo origin of the substitution. Another de
novo base change ( C to T at position 292) was detected in the severely affected patient (Patient 2), resulting in an amino acid substitution of Arg by Cys at
the same codon 69. T h e patients were heterozygous
for the mutant and the normal allele. Paternity was
confirmed for both patients. Furthermore, the entire
coding region of the PO gene of the patients was sequenced and revealed n o further mutations,
Light and Electron Microscopy
Sural nerve biopsy specimens from both patients
showed a marked reduction in density of myelinated
~
~
~~
~
~~~
Electron microscopy of sural nerve specimen k o m Patient 1
(Arg69His), age 12 years. Uncompaction of myelin is seen at
the inner and outer parts of the myelin sheath. Dilatation of
major dense Lines is most pronounced. At some places, fusion
ofintraperiod lines has occurred (arrow). Bar = 1 pm.
fibers. Patient 1 (Fig 1) had 6,010 and Patient 2 7,200
fibers/mm2, corresponding to 57% and 46% of the
age-related values, respectively. I n Patient I , largediameter fibers (> 6.5 pm) were totally lacking; most
fibers were thinly myelinated and surrounded by onion
bulbs of concentrically arranged Schwann cell lamellae.
By ultrastructural examination of cross sections, the
vast majority of fibers (80%) showed uncompacted myelin lamellae, which in some cases (> 12%) could not
be discerned from a Schmidt-Lanterman incisure. T h e
uncompacted structure was present over the whole or
part of the circumference of the fiber and commonly
involved the inner lamellae, but occasionally the outer
lamellae as well. Dilatation of the major dense line was
most pronounced, with often changing amounts of
Schwann cell cytoplasm in between. Partial fusion of
intraperiod lines was observed on occasional fibers.
O n the other hand, Patient 2 showed only few onion bulbs, clearly too-thin myelin sheaths in comparison with axon diameter, and almost no large fibers (2%
> 6 p m , 0% > 8 pm). Increased neurofilament accumulation was observed in demyelinated axons. O n
cross sections almost half the fibers (43%) showed a
partially uncompacted structure of myelin, much more
often than Schmidt-Lanterman incisures were present
(see Discussion). About one third of the fibers showed
myelin figures at the axonal side of the sheath, often
suggestive of early myelin degradation.
Brief Communication: Meijerink et al: Codon 69 Substitutions in PO
673
Discussion
PO, the major structural component of peripheral nervous system myelin, is an integral membrane protein
and its expression is confined to myelating Schwann
cells. We screened genomic DNA of CMTl patients
for mutations in the coding part of the PO gene and
demonstrated mutations in both patients. In contrast
to Patient 1, Patient 2 was diagnosed as severely affected with CMT1. Surprisingly, the same exon 3 codon in both patients was substituted with different
amino acids-Arg69His
(Patient 1) and Arg69Cys
(Patient 2). This amino acid is highly conserved among
many species [lo], suggesting that Arg69 plays an important role in formation and maintenance of the myelin sheath. Interestingly, the severely affected CMTl B
patient described by Hayasaka and colleagues [4] carried a Ser34Cys substitution, suggesting a more dramatic effect on the function of PO when cysteine is
substituted at certain amino acid positions. Thus far,
the majority of disease-associated amino acid substitutions in CMTlB patients have been found in the extracellular domain of PO [I].
Direct binding experiments have shown a major role
for the PO extracellular domain in the compaction of
peripheral myelin [7].
The PO extracellular domain
contains a nonasaccharide that is N-linked to Am93
and two cysteines at positions 21 and 98. Both PO
molecules in the homophilic pair have to be glycosylated for adhesion to take place [ 131. The cysteines form
a disulfide bond that is essential to the functioning of
PO as an adhesion molecule [14]. The cytoplasmic domain of PO is thought to interact with a component
of the opposing membrane in compact myelin, thereby
holding these membranes together at the major dense
line [15].
Recently, a molecular model of the PO extracellular
domain was described [16]. According to this model,
Arg69 is postulated to be on putative P-strand 6 of the
PO extracellular domain. This residue is predicted to
be essential for complementary electrostatic interactions from apposed membranes and may also be involved in the protein-carbohydrate interaction at the
base of the molecule [17]. Substitution of this residue
with cysteine probably results in inappropriate formation of either intramolecular or intermolecular disulfide
bonds, whereas Arg69His most likely leads to disrupted
PO-PO interactions through steric hindrance or changes
in electrostatic interactions, or both, all leading to defective myelin [17]. O n the other hand, both mutations also might lead to deleterious conformational
changes or disrupt the PO extracellular domain-carbohydrate link.
In support of this hypothesis, the histological examinations of sural nerve biopsy specimens showed defective compaction of myelin (see Fig). Although in several instances the uncompacted myelin structure might
674 Annals of Neurology
Vol 40
No 4 October 1996
be ascribed to Schmidt-Landerman incisures, the overa11 frequency on cross sections (80% in Patient 1, 43%
in Patient 2) markedly surpassed the frequency of
Schmidt-Lanterman incisures in normal sural nerves
(O-5.5%, n = 3) or in nerves from patients with genetically unspecified, demyelinating HMSN ( 5 9%, n
= 9) [18]. In both patients wide spacing of myelin
layers was seen most frequently at the inner layers of
the sheath. Patient 2 with Arg69Cys showed an increase in neurofilament density of demyelinated axons,
a feature sometimes seen in demyelinated axons in human or animal pathology [ l l , 191. Family analysis
showed that both Arg69 substitutions were de novo
mutations, underlining the role of PO in the pathogenesis of CMTlB.
This work was supported by a grant from the Netherlands Organization for Scientific Research (NWO). The authors thank L. Valentijn and N. van den Bosch for helpful discussions.
References
1. Suter U, Snipes GJ. Biology and genetics of hereditary motor
and sensory neuropathies. Annu Rev Neurosci 1995;18:45-75
2. Valentijn LJ, Baas F, Wolterman RA, et al. Identical point
mutations of PMP-22 in Trembler-J mouse and CharcotMarie-Tooth disease type 1A. Nature Genet 1992;2:288-291
3. Kulkens T, Bolhuis PA, Wolterman RA, et al. Deletion of the
serine 34 condon from the major peripheral myelin protein PO
gene in Charcot-Marie-Tooth disease type 1B. Nature Genet
1993;5:35-39
4. Hayasaka K, Himoro M, Sawaishi Y, et al. De novo mutation
of the myelin PO gene in Dejerine-Sottas disease (hereditary
motor and sensory neuropathy type 111). Nature Genet 1993;
5:266-268
5. Pham-Dinh D, Fourhil Y, Blanquet F, et al. The major peripheral myelin protein zero gene: structure and localization in the
cluster of Fc-gamma receptor genes on human chromosome
lq21.3-q23. Hum Mol Genet 1993;2:2051-2054
6. Giese KP, Martini R, Lemke G, et al. Mouse PO gene disruption leads to hypomyelination, abnormal expression of recognition molecules and degeneration of myelin and axons. Cell
1992;71:565-576
7 Filbin MT, Walsh FS, Trapp BD, et al. Role of myelin PO
protein as a homophilic adhesion molecule. Nature 1990;344:
871-872
8. Hayasaka K, Himoro M, Sato W, et al. Charcot-Marie-Tooth
neuropathy type 1B is associated with mutations of the myelin
PO gene. Nature Genet 1993;5:31-34
9. Nicholson GA, Valentijn LJ, Cherryson AK, et al. A frameshift mutation in the PMP22 gene in hereditary neuropathy
with liability to pressure palsies. Nature Genet 1994;6:263266
10. Hayasaka K, Nanao K, Tahara M, et al. Isolation and sequence
determination of cDNA encoding the major structural protein
of human peripheral myelin. Biochem Biophys Res Commun
1991;180:515-518
11. Cabreels-Festen AAWM, Joosren EMG, Gahreels FJM, er a!.
Early morphological features in dominantly inherited demyelinating motor and sensory neuropathy (HMSN type I). J Neurol Sci 1992;107:145-154
12. Hayasaka I(, Ohnishi A, Takada G, et al. Mutation of the
myelin PO gene in Charcot-Marie-Tooth neuropathy type I.
Biochem Biophys Res Commun 1993;194:1317-1322
13. Filbin MT, Tennekoon GI. Homophilic adhesion of the myelin PO protein requires glycosylation of both molecules in the
homophilic pair. J Cell Biol 1993;122:451-459
14. Zhang K, Filbin MT. Formation of a disulfide bond in the
immunoglobulin domain of the myelin PO protein is essential
for its adhesion. J Neurochem 1994;63:367-370
15. Ding Y, Brunden KR. The cytoplasmic domain of myelin glycoprotein PO interacts with negatively charged phospholipid
bilayers. J Biol Chem 1994;269:10764-10770
16. Wells CA, Saavedra RA, Inouye H, Kirschner DA. Myelin POglycoprotein: predicted structure and interactions of extracellular domain. J Neurochem 1993;61:1987-1995
17. Kirschner DA, Saavedra RA. Mutations in demyelinating peripheral neuropathies support the molecular model of myelin
PO-glycoprotein extracellular domain. J Neurosci Res 1994;39:
63-69
18. Schroder JM, Himmelmann F. Fine structural evaluation of
altered Schmidt-Lanternian incisures in human sural nerve biopsies. Acta Neuropathol (Bed) 1992;83: 120-133
19. Waegh de SM, Lee VM-Y, Brady ST. Local modulation of
neurofilament phosphorylation, axonal caliber, and slow axonal
transport by myelinating Schwann cells. Cell 1992;68:451-463
Cognitive and Brain
Magnetic Resonance
Imaging Findings in
Adrenomyeloneuropathy
David Edwin, PhD,* Lynn J. Speedie, PhD,*
Wolfgang Kohler, MD,$ Sakkubai Naidu, MD,?
Bernd Kruse, MD,S and Hugo W. Moser, MDt
Neuropsychological functioning and brain magnetic
resonance imaging (MRI) were evaluated in 84 men with
adrenomyeloneuropathy (AMN). MRI was normal in
6l%, the “pure AMN” group, while 399’0, the “cerebral
AMN” group, showed brain white matter abnormalities.
Except for mild deficits in psychomotor speed and visual
memory, neuropsychologicalfunction was normal in pure
AMN. Most patients with cerebral AMN had normal I Q
and language but evidenced impaired psychomotor speed,
spatial cognition, memory, and executive functions. Patients with MRI evidence of very severe cerebral disease
had global and language impairment as well, and deficits
in all patients were highly correlated with degree of brain
MRI involvement.
Edwin D, Speedie LJ, Kohler W, Naidu S,
Kruse B, Moser HW. Cognitive and brain
magnetic resonance imaging
findings in adrenomyeloneuropathy.
Ann Neurol 1996;40:675-678
X-linked adrenoleukodystrophy (ALD) [I] presents in
childhood as a rapidly dementing illness with a characteristic pattern of demyelination demonstrable by magnetic resonance imaging (MRI) [2]. In adulthood, it
presents most commonly as a slowly progressive paraparesis associated with degeneration of the long tracts
in the spinal cord [2],which is referred to as adrenomyeloneuropathy (AMN). While, in comparison with
childhood ALD cerebral function in AMN is well preserved, we have shown previously that some AMN patients develop subcortical dementia [ 3 ] ,and 45% have
white matter abnormalities demonstrable by MRI [4].
This report correlates neuropsychological function and
brain MRI in AMN patients.
From the Departments of *Psychiatry and Behavioral Sciences, and
?Neurology, Johns Hopkins University School of Medicine, Baltimore, MD; and $Department of Neurology, Moabit Hospital, Berlin, and SGeorg August University, Gottingen, Germany.
Received Sep 21, 1995, and in revised form Feb 5 and Apr 17,
1996. Accepted for publication Apr 17, 1996.
Address correspondence to Dr Edwin, Department of Psychiatry
and Behavioral Sciences, Johns Hopkins University School of Medicine, 600 N. Wolfe Street, Meyer 218, Baltimore, M D 212877218.
Copyright 0 1996 by the American Neurological Association 675
Документ
Категория
Без категории
Просмотров
4
Размер файла
440 Кб
Теги
major, mutation, distinct, clinical, zero, protein, myelin, codon, demyelination, neuropathic
1/--страниц
Пожаловаться на содержимое документа