close

Вход

Забыли?

вход по аккаунту

?

CLN3P the Batten's disease protein is a novel palmitoyl-protein -9 desaturase.

код для вставкиСкачать
CLN3P, the Batten’s Disease Protein, Is a
Novel Palmitoyl-Protein ⌬-9 Desaturase
Srinivas B. Narayan, PhD,1 Dinesh Rakheja, MD,2,3 Lu Tan, MS,1 Johanne V. Pastor, MS,3
and Michael J. Bennett, PhD, FRCPath1,4
Objective: Batten’s disease, one of the most common recessively inherited, untreatable, neurodegenerative diseases of humans, is
characterized by progressive neuronal loss and intraneuronal proteolipid storage. Although the gene for the disorder was cloned
more than a decade ago, the function of the encoded protein, CLN3P, has not been defined thus far.
Methods: Sequence analysis using the Pfam server identified a low stringency match to a fatty acid desaturase domain in the
N-terminal sequence of CLN3P. We developed a fatty acid desaturase assay based on measurement of desaturase products by gas
chromatography/mass spectrometry.
Results: We show that CLN3P is a novel palmitoyl-protein ⌬-9 desaturase, which converts membrane-associated palmitoylated
proteins to their respective palmitoleated derivatives. We have further demonstrated that this palmitoyl-protein ⌬-9 desaturase
activity is deficient in cln3⫺/⫺ mouse pancreas and is completely ablated in neuroblastoma cells by RNA inhibition.
Interpretation: We propose that palmitoyl-protein desaturation defines a new mechanism of proteolipid modification, and that
deficiency of this process leads to the signs and symptoms of Batten’s disease.
Ann Neurol 2006;60:570 –577
Juvenile neuronal ceroid lipofuscinosis (JNCL), or Batten/Spielmeyer–Vogt–Sjögren disease (CLN3, OMIM
#204200), is one of a group of severe, untreatable, inherited, neurodegenerative disorders described by their
known and putative genotypes as CLN1-9. These disorders share common clinical features including progressive loss of vision, seizures, motor dysfunction leading to spastic quadriplegia, cognitive loss, and early
death. Histopathologically, these disorders are characterized by progressive neuronal loss and by the accumulation, in the cytoplasm of brain neurons, of
lipofuscin-like autofluorescent storage material similar
to the aging pigment.1 JNCL is inherited in an autosomal recessive manner and occurs with an annual frequency of 0.7 to 7 per 100,000 live births, with the
highest incidence in Northern Europe. This makes
JNCL one of the most common recessively inherited
neurodegenerative disorders of humans.2,3 JNCL results from mutations in CLN3 on chromosome
16p12.1.4 The gene encodes a 438-amino acid
polypeptide known as CLN3P, or Battenin. CLN3P is
a 48kDa transmembrane protein that localizes to membrane lipid rafts in lysosomes, endosomes, and synaptosomes.5,6 It has been hypothesized that it may play a
role in neuronal vesicular trafficking and synaptic
transmission.6
The specific function of CLN3P and the mechanism
by which its deficiency results in massive neuronal
death remains unknown. Proposed hypotheses for the
function of CLN3P include possible roles in lysosomal
matrix acidification, trafficking of lysosomal enzymes,
lysosomal degradation of proteins, small-molecule
transport, endosomal trafficking, organelle fusion, and
neuronal apoptosis.6,7
Sequence analysis of CLN3P using the Pfam server
matched a possible fatty acid desaturase domain with a
low stringency.8 From this candidate functional match,
we decided to investigate the possibility that CLN3P
may have fatty acid desaturase activity. Here, we
present our data that clearly demonstrate that CLN3P
is, indeed, a previously unrecognized fatty acid ⌬-9 desaturase, with low substrate affinity for free fatty acids,
specifically palmitate, and the highest substrate affinity
for palmitoylated proteins. This substrate affinity differs sufficiently from the previously described and characterized desaturase enzymes to indicate that CLN3P
represents a new enzyme class. Furthermore, we show
that this enzymatic activity is deficient in tissues from
From the 1Department of Pathology and Laboratory Medicine, The
Children’s Hospital of Philadelphia, Philadelphia, PA; 2Department
of Pathology, Children’s Medical Center; 3Department of Pathology, University of Texas Southwestern Medical Center, Dallas, TX;
and 4Department of Pathology and Laboratory Medicine, University
of Pennsylvania School of Medicine, Philadelphia, PA.
Published online Oct 10, 2006, in Wiley InterScience
(www.interscience.wiley.com). DOI: 10.1002/ana.20975
Received Apr 6, 2006, and in revised form Jun 8. Accepted for
publication Aug 18, 2006.
570
Address correspondence to Dr Bennett, Department of Pathology
and Laboratory Medicine, The Children’s Hospital of Philadelphia,
34th Street and Civic Center Boulevard, Philadelphia, PA 19104.
E-mail: bennettmi@email.chop.edu
Published 2006 by Wiley-Liss, Inc., through Wiley Subscription Services
the cln3⫺/⫺ mouse, a model that expresses no CLN3P,
and is specifically ablated by small, interfering (siRNA)
inhibition in cultured neuroblastoma cells, thus providing unequivocal confirmation that the palmitoylprotein desaturase activity is a direct function of
CLN3P.
Materials and Methods
SH-SY5Y Cell Culture
SH-SY5Y neuroblastoma cells were cultured in T175 flasks
in high glucose Dulbecco’s minimum essential medium
(11mmol/L glucose) supplemented with 10% fetal bovine serum, 100U/ml penicillin, 100␮g/ml streptomycin, and
2mmol/L L-glutamine at 37°C under conditions of 95% air
and 5% CO2. The medium was changed twice a week and
on the day before the experiment. Cells were trypsinized
weekly and were used exclusively between passages 10 and
20.
Development of Stable SH-SY5Y Cells
Expressing CLN3P
SH-SY5Y cells were plated in six-well plates (density of 1 ⫻
106 cells/well) on the day before the experiment. Cells were
transfected with pCTAP vector containing Cln3 complementary DNA, using the GeneJammer reagent (Stratagene, La
Jolla, CA) per the manufacturer’s protocol. In brief, the cells
were incubated with a mixture of plasmid and transfection
reagent in serum-free medium for 3 hours. At the end of the
incubation, the cells were supplemented with additional medium and incubated for 72 hours. Then the cells were
trypsinized and split at a ratio of 1:5 and allowed to attach
overnight. The next day, the cells were transferred to fresh
medium containing the selection antibiotic (500␮g/ml
G418, with 10% fetal bovine serum). The cells were grown
in the selection medium until all the control cells were dead
and the surviving cells were pooled and grown in the maintenance medium with a lower concentration of the antibiotic
(100␮g/ml G418, 10% fetal bovine serum). All further cultures of this stable cell line were performed using medium
containing a low dose of the selection antibiotic.
Western Blot Analysis
Western blots were performed on samples containing 10␮g
of protein each. 4 –20% linear gradient precast gels (BioRad
Laboratories, Hercules, CA) were used for protein electrophoresis. The proteins were then transferred onto nitrocellulose membranes at a constant voltage (100V for 1 hour). The
membranes were incubated in blocking buffer (5% membrane blocking reagent in 1% TBS-T (tris[hydroxymethyl]aminomethane [Tris]-buffered saline with Tween 20) overnight at 4°C. The next day, the membranes were incubated,
at 4°C overnight, with anti-CLN3P antibody5,19 at a concentration of 5␮g/ml (reconstituted in TBS-T containing
1% blocking reagent). Immunoreactivity was visualized with
horseradish peroxidase–conjugated goat anti–rabbit immunoglobulins (Amersham Pharmacia Biotech, Piscataway, NJ),
followed by enhanced chemiluminescence detection (Amersham Pharmacia Biotech).
Quantitative Real-time Reverse Transcription
Polymerase Chain Reaction
Quantitative real-time reverse transcription polymerase chain
reaction (qRT-PCR) was performed to determine the extent
of overexpression of Cln3 messenger RNA (mRNA) in comparison with housekeeping mRNA, ␤-actin. Total RNA was
isolated from SH-SY5Y cells and SH-SY5Y-pCTAP/Cln3
stable cell line using QIAGEN Total RNA extraction kit
(Qiagen, Chatsworth, CA), following the procedure described by the manufacturer. RNA concentration was estimated by ultraviolet spectrophotometry (260/280 ratio) using CARY Bio-100 UV-Vis Spectrophotometer (VARIAN
Technologies, Palo Alto, CA). RT-PCR was performed in a
96-well plate using the TaqMan One-Step RT-PCR Master
Mix Reagents Kit (Roche Molecular Systems, Pleasanton,
CA). Each reaction contained 1X master mix, 900␮M of the
respective forward and reverse primers, 200␮M of the respective TaqMan probe, 1X RT enzyme mix containing
MultiScribe Reverse Transcriptase and RNAse inhibitor, and
400ng total RNA. mRNA was amplified with an initial cycle
of 30 minutes at 48°C and 10 minutes at 95°C, followed by
50 cycles of 15 seconds at 95°C and 1 minute at 60°C. Levels of mRNA expression were quantitatively analyzed using
the ABI 7000 Sequence Detection System (Perkin-Elmer,
Fremont, CA). A threshold cycle, CT, was determined for
both Cln3 mRNA and ␤-actin mRNA. Amplification of the
Cln3 mRNA was normalized to ␤-actin expression. Relative
levels of mRNA expression were calculated using the 2⌬⌬CT
method that Peirson and colleagues21 described.
Synthesis of Palmitoyl Cysteine
Palmitoyl cysteine was synthesized following the procedure
that Yousefi-Salakdeh and colleagues22 described. In brief,
palmitoyl chloride (0.34gm, 1.2 mmol, 1.2 equivalents) was
added to L-cysteine (100mg, 0.83mmol) in distilled trifluoroacetic acid (4ml). The mixture was stirred at room temperature for 10 minutes. The precipitated product was recovered by filtration and washed with chloroform.
Tissue and Cell Disruption Procedure for
Desaturase Assay
Tissues obtained from mice were first thawed on ice and
chopped into fine pieces using sterile disposable blades to
avoid tissue cross contamination. Tissues were resuspended
in 20 volumes of homogenization buffer (50mM Tris-HCl,
0.1% Triton X-100 [Sigma Labs, St. Louis, MO], pH 7.4)
and homogenized using a polytron homogenizer (Eppendorf,
Hamburg, Germany). The homogenate was centrifuged
(3,000g, 4°C) for 10 minutes to obtain a clear supernatant.
Cells were collected by trypsinization and washed twice
with phosphate-buffered saline (pH 7.4). Cells were pelleted
and resuspended in homogenization buffer (50mM TrisHCl, 0.1% Triton X-100, pH ⫽ 7.4) and subjected to sonication (40% cycle, 2 minutes with a 1-minute break each 30
seconds). Homogenized cells were centrifuged (3,000g, 4°C)
for 10 minutes to obtain a clear supernatant.
Fatty Acid Desaturase Assay
Various concentrations of myristoyl-, stearoyl-, and
palmitoyl-coenzyme A (CoA); free palmitic, myristic, stearic,
Narayan et al: Function of CLN3 Protein
571
oleic, and linoleic acids; and palmitoyl cysteine and
S-palmitoylated H-Ras protein were incubated, at 37°C for 1
hour, with 100␮g protein extracts in a buffer containing
50mM Tris-HCl, 0.1% bovine serum albumin, 5mM CaCl2
(pH 7.4), and 250␮M NADH in a final reaction volume of
300␮l (for SH-SY5Y cells) or 1.0ml (for mouse tissues). The
reaction was stopped by the addition of 5M sodium hydroxide (100␮l) and heated for 30 minutes at 65°C. This step
hydrolyzes the thioester linkages to release the free fatty acids. An internal standard was added at this stage (heptadecanoic acid, 50␮g/sample).
Extraction, Derivatization, and Analysis
of Fatty Acids
Fatty acids were extracted with ethyl acetate, three times, using 2ml extraction volume each time. The extracts were
dried under a steady stream of nitrogen. The fatty acids were
derivatized using N,O-Bis(trimethylsilyl)trifluoroacetamide
(BSTFA; Pierce Biotechnology, Rockford, IL) and pyridine
at 65°C for 30 minutes. The derivatized fatty acids were separated and analyzed using gas chromatography/mass spectrometry (HP-5MS, Column; Agilent Technologies, Palo
Alto, CA). Running conditions were: sample volume injected
1␮l, initial column temperature is 70°C, ramp 5°C/min to a
final temperature of 300°C, mass selective detector (MSD)
interface temperature is 280°C.
Results
Overexpression of CLN3P in SH-SY5Y Cells
We developed stable expression of CLN3P in SHSY5Y neuroblastoma cells by transfection with pCTAP
vector containing Cln3 complementary DNA. Overexpression of CLN3P was confirmed by Western blot
(Fig 1A). ␤-Actin was used as control to indicate that
an equal amount of protein has been loaded in each of
the wells. The increased expression of CLN3P was also
confirmed and measured by qRT-PCR for CLN3
mRNA (see Fig 1B).
CLN3P Desaturates Free Fatty Acids, But Not AcylCoenzyme A’s, in the ⌬-9 Position
Desaturase activity was measured using various substrates including myristoyl-, stearoyl-, and palmitoylcoenzyme A’s and free palmitic, myristic, stearic, oleic,
and linoleic acids. We identified the expected stearoylCoA desaturase activity, which was not increased in
our expression system (data not shown). Desaturase activity was detected for the saturated free fatty acids of
chain lengths C14 (myristic acid) and C16 (palmitic
acid) with maximum activity for palmitic acid. No activity was detected for stearic acid (saturated C18) and
Small, Interfering RNA of Cln3 to Inhibit the
Desaturase Activity
Using a DNA vector–based siRNA technology, we cloned a
small DNA (si-CLN3-1: AGCTATTTCTTGTTGCTCACA at position 812; si-CLN3-2: CTTTGCCGAGTATTTCATTAA at position 1012; Si-CLN3-scr1: GTGCCGTTCCTTATTATCTAA, sequence scrambled from the
si-CLN3-2 sequence) inserts encoding short hairpin RNA
targeting the Cln3 gene into a commercially available vector
(SD1219: pRNAT-H1.1/Adeno; Genscript Corporation,
Piscataway, NJ). The vector has a coral green fluorescent
protein (cGFP) expression cassette to track the transfection
efficiency. The siRNA vector was cotransfected with BJ5183
E. coli with pAdEasy vector-1 following the procedure described by the manufacturer (Stratagene) to generate adenoviral genome through homologous recombination. Restriction of adenovirus plasmid DNA using Pac 1 that yielded a
large fragment of 30kb and a small fragment of either 3.0 or
4.5kb were isolated. The positive recombinants were further
cloned into XL-10 gold competent cells for propagation, and
plasmids were isolated. The plasmid preparations subsequently obtained from the XL-10 gold cells were purified
and digested with Pac 1 and transfected into AD293 cells,
using the Lipofectamine protocol (Invitrogen, La Jolla, CA).
The transfection efficiency was followed by the GFP expression. The virus was harvested after 1 week from the AD293
cells and used for subsequent transfections to SH-SY5Y cells.
The targeted transfection efficiency was set at greater than
95%.
Statistical Analysis
Student’s t test was used to compare the kinetic data obtained from the control SH-SY5Y and SH-SY5Y-pCTAP/
Cln3 cells.
572
Annals of Neurology
Vol 60
No 5
November 2006
Fig 1. Overexpression of CLN3P in SH-SY5Y neuroblastoma
cells. (A) Western blot using a previously characterized polyclonal anti-CLN3P antibody. (B) Quantitative real-time reverse transcription polymerase chain reaction for CLN3
message.
the monounsaturated and diunsaturated C18 fatty acids. The end product of palmitic acid desaturation was
demonstrated by gas chromatography/mass spectrometry to be palmitoleic acid, which results from ⌬-9 desaturation of palmitic acid (Fig 2).
Palmitoylated-Proteins Are Physiological Substrates
for CLN3P
The kinetics of desaturation of free palmitic acid indicated that this was not a natural substrate for the
CLN3P activity (Table). Therefore, we evaluated a
membrane- and lipid raft–associated substrate, the
S-palmitoylated H-Ras protein, which was found to
have appropriate kinetics to be a candidate substrate
for the desaturation reaction. Encouraged by the very
low Km value that we obtained for H-Ras, we synthesized an artificial S-palmitoylated substrate, palmitoyl
cysteine, which was also found to have physiologically
relevant kinetics and to be an excellent substrate in a
diagnostic assay.
The Michaelis–Menten kinetics for free palmitic
acid, the H-Ras protein, and palmitoyl-cysteine desaturation are shown in the Table and Figure 3. The Km
value for free palmitic acid was 1,370nM in the SHSY5Y cells and 950nM in the SH-SY5Y-pCTAP/
CLN3 stable line. This difference was not statistically
significant ( p ⫽ 0.496) and provided evidence that
overexpression of CLN3P in our model system did not
have a secondary impact on the enzyme kinetics. There
was no statistically significant difference in the Vmax for
the palmitic acid desaturation between the SH-SY5Y
cells and the SH-SY5Y-pCTAP/CLN3 stable line.
When using palmitoyl cysteine as a substrate, the enzyme kinetics demonstrated a lower Km than that for
free palmitic acid, indicating that this is a more suitable substrate for enzyme analysis. The Km for palmitoyl cysteine was 27.2nM in the SH-SY5Y cells and
31.3nM in the SH-SY5Y-pCTAP/CLN3 stable line.
This difference was not statistically significant ( p ⫽
0.978). However, the Vmax was significantly higher in
Fig 2. Demonstration of palmitoleic acid generation as a product of the CLN3P desaturase reaction using palmitoyl cysteine or
H-Ras or free palmitate as the substrate. (top) After alkaline hydrolysis of the products of the enzyme reaction, a blank reaction
(lacking cell/tissue homogenate) in which there is no conversion of palmitate (peak 2) to palmitoleic acid (peak 1) is shown. Peak 3
is the heptadecanoic acid internal standard. (middle) One of the time points for the kinetics analysis of the desaturase reaction and
production of palmitoleic acid, which is confirmed mass spectrometrically (bottom).
Narayan et al: Function of CLN3 Protein
573
Table. Desaturation Kinetics
Substrate/cell type
Km (nM)
Palmitate
SHSY5Y wild type
SHSY5Y-pCTAP/CLN3
Palmitoyl cysteine
SHSY5Y wild type
SHSY5Y-pCTAP/CLN3
Palmitoylated H-Ras
SHSY5Y wild type
SHSY5Y-pCTAP/CLN3
NADH
SHSY5Y wild type
SHSY5Y-pCTAP/CLN3
1,370.00
950.00
SE
528
191
27.16
31.26
104.13
123.21
6.05
6.31
1.21e-4
1.24e-4
12.42
14.98
Vmax
(pmol/min/mg protein)
0.031
0.033
1.26
2.26
2499.46
4253.82
0.073
0.083
717.33
730.31
SE
6.14
3.28
199.4
384.2
0.0075
0.0089
12.44
19.87
SE ⫽ standard error.
the SH-SY5Y-pCTAP/CLN3 stable cell line than in
wild-type SH-SY5Y cells ( p ⫽ 0.015).
The desaturase activity demonstrated the highest
specificity when S-palmitoylated H-Ras was used as
substrate, with the Km values in picomolar range, suggesting that palmitoylated proteins are strong candidate
substrates for this novel fatty acid modification process.
There were no significant differences in the Km and
Vmax for the S-palmitoylated H-Ras desaturase activity
between the wild-type SH-SY5Y cells and the SHSY5Y-pCTAP/CLN3 stable line.
The Km value for the major cofactor, NADH, was
12.42 and 14.98nM in the SH-SY5Y cells and the SHSY5Y-pCTAP/CLN3 stable line, respectively ( p ⫽
0.378).
Tissues from the cln3⫺/⫺ Mice Demonstrate
Markedly Defective Desaturase Activity
The fatty acid desaturase activity for palmitoyl cysteine
was measured in pancreas and brain obtained from the
cln3⫺/⫺ mouse. In triplicate assays, the cln3⫺/⫺ mouse
pancreas demonstrated an 80% reduction in activity:
0.69 nmol/min/mg protein (standard deviation [SD],
0.082) compared with 3.38nmol/min/mg (SD, 0.281)
protein for the wild-type mouse (Fig 4). Similar results
were obtained for triplicate assays in brain from both
knock-out and wild-type mice. The cln3⫺/⫺ mouse
brain had a total desaturase activity of 0.6nmol/
min/mg protein (SD, 0.04) when compared with
3.11nmol/min/mg protein (SD, 0.16), which is a reduction by 81% of wild-type mouse brain desaturase
activity. This experiment provides additional evidence
that S-palmitoylated protein desaturase activity is the
specific function of CLN3P.
Cln3-Specific Small, Interfering RNA Probes Abolish
the Desaturase Activity
Using a DNA vector–based siRNA technology, we
cloned two small DNA inserts encoding short hairpin
574
Annals of Neurology
Vol 60
No 5
November 2006
RNA targeting the Cln3 message into a commercially
available vector (SD1219: pRNAT-H1.1/Adeno). The
vector has a cGFP expression cassette to track the
transfection efficiency. The vector containing si-CLN3SCR1 (a control with a scrambled sequence) showed
no decrease in activity. However, the activity decreased
significantly with si-CLN3-2 probe in SH-SY5Y cells
for which the activity was reduced by 99% and in SHSY5Y-pCTAP/CLN3 cells, which demonstrated an
87% reduction (Fig 5). The second probe, si-CLN3-1,
also resulted in slightly decreased desaturase activity in
both cell types (see Fig 5).
Discussion
Although the gene responsible for Batten’s disease was
identified more than a decade ago,4 the specific function of the CLN3 protein, and consequently the mechanism for neuronal loss in Batten’s disease, has been
debated but has not been affirmed.6 Our studies were
undertaken from an observed low stringency match of
the CLN3P peptide sequence to established fatty acylCoA desaturases.8 In particular, the candidate sequence
is rich in histidine residues, which are critical for the
desaturase function.9
In our studies, we provide compelling evidence that
CLN3P is, indeed, a novel fatty acid desaturase with a
⌬-9 desaturase function and a requirement for NADH
as a cofactor. This enzymatic activity differs from the
previously recognized desaturases because the substrates
are not fatty acyl-CoA’s.10 The enzymatic activity was
measured using standard spectrophotometric analysis of
NADH oxidation and also confirmed using gas chromatography/mass spectrometry–based detection of the
monounsaturated product.
The enzymatic activity was first identified using
palmitic acid (C16:0) as a substrate, with the product
of the reaction being palmitoleic acid (C16:1 n-7), but
the kinetics of this reaction would not be predicted to
sustain a physiological role for the desaturase activity.
Fig 3. Michaelis–Menten kinetics plot for palmitoyl-protein desaturase using free palmitate (A), palmitoyl cysteine (B), and palmitoylated H-Ras (C). The saturability of the substrates demonstrates the specificity of the enzyme toward all three substrates at different concentration levels.
Narayan et al: Function of CLN3 Protein
575
Fig 4. Palmitoyl-protein desaturase activity in 3-month-old
wild-type (purple bars) and cln3⫺/⫺ (blue bars) mouse pancreas and brain demonstrating marked deficiency in the
knock-out mouse tissues (n ⫽ 3).
As the next step, we chose to study a palmitoylated
protein as candidate substrate for the desaturase activity. Our choice of this substrate was influenced by the
fact that the infantile form of neuronal ceroid lipofuscinosis (CLN1) results from a deficiency of palmitoylprotein thioesterase and is now confirmed as a classic
lysosomal enzymatic defect.11 CLN1 was first identified as an enzymatic defect using the same
S-palmitoylated H-Ras protein.12 Our determination
of a low Km value for the desaturation of palmitoylated H-Ras indicates that palmitoylated proteins are
likely physiological substrates for CLN3P activity, in
addition to being substrates for palmitoyl-protein thioesterase. The natural substrate(s) for palmitoyl-protein
thioesterase–catalyzed depalmitoylation and CLN3P
desaturase activity are currently unknown, but are
likely to lead us to a critical pathway for the prevention
of neuronal death. Many proteins that are translocated
into membranes by palmitoylation have critical signaling roles. Such proteins include neurotransmitter receptors, cytokine receptors, oncogene products such as
H-Ras, and src family kinases.13 The introduction of a
double bond into the palmitoyl component of a
membrane-localized protein was not previously recognized as a component of palmitoylated protein metabolism. We believe that the insertion of a double bond
should have a profound effect on the physical nature of
the fatty acid moiety, leading to a disruption of the
ordered nature of the lipid rafts, in a manner similar to
that observed with prenylated proteins,14 and impact
any signaling properties that the palmitoylated protein
may have. Consistent with this hypothesis, Moffett and
colleagues found a significant reduction in the amount
of fatty-acylated Galpha(i) in rafts, when myristoylated
Galpha(i) was thioacylated with cis-unsaturated fatty
acids instead of saturated fatty acids.15 Thus, this novel
fatty acid modification process may play a role in modulation of several important pathways such as neurotransmitter receptor sensitivity, signaling, and vesicular
576
Annals of Neurology
Vol 60
No 5
November 2006
trafficking. Earlier published work on the function of
CLN3P indicates that membrane-associated signaling
processes are, indeed, impacted both in Batten’s disease
patients and in cln3⫺/⫺ mice. In a model based on cultured skin fibroblasts from Batten’s disease patients, it
was shown that protein kinase C translocation and
bradykinin-induced calcium efflux was impaired compared with control fibroblasts.16 Recent works from
Boustany and coworkers have indicated that the signaling pathway most likely to be associated with CLN3P
is the ceramide pathway of neuronal apoptosis.17 In a
recent study using nuclear magnetic resonance techniques, Pears and colleagues18 showed that the neurotransmitter cycling is defective in the mouse model of
Batten’s disease. Our own studies on an antiapoptotic
role for CLN3P strongly support this assertion.19
These metabolic pathways involve several palmitoylated
proteins that are potential substrates for depalmitoylation and desaturation. It is likely that CLN3P has multiple physiological substrates affecting more than one
pathway, thus providing a plausible explanation for
and generating the first unifying mechanism to explain
the multiple biochemical anomalies that have been attributed to CLN3P.
Subsequent to our observation of the fatty acid desaturase function of CLN3P, we synthesized a readily
manufactured alternative substrate, palmitoyl cysteine,
which has slightly reduced affinity for CLN3P desaturase activity when compared with the S-palmitoylated
H-Ras protein, but much greater affinity when compared with free palmitic acid. This substrate was found
to be of value in a robust in vitro assay system that we
developed for measuring the desaturase activity. Using
this artificial substrate, we were able to demonstrate a
deficiency of palmitoyl-cysteine desaturase activity in
pancreatic tissue obtained from the cln3⫺/⫺ mouse
when compared with wild-type littermates. This experiment provides further confirmation that this is a true
functional assay for CLN3P. We chose to measure the
Fig 5. Results of palmitoyl-protein desaturase activity after
small, interfering RNA knock-down in control and CLN3P
expressing SH-SY5Y cells showing the efficiency of two different inhibitory probes (si1, si2). The experiments were repeated
thrice with duplicate measurements for each run. SCR ⫽ control scrambled probe.
enzyme activity in freshly isolated and snap-frozen tissues from young cln3⫺/⫺ mice in preference to tissues
from patients with Batten’s disease because the time
delay that occurs in collecting and freezing postmortem
tissues and the massive neuronal loss that is seen in
end-stage disease are both likely to impact any functional measurements of CLN3P. The residual desaturase activity (approximately 20%) in the mouse pancreas may arise from the recently described CLN3P
homologue called CLN3-like protein (CLN3LP),
which is overexpressed in brain and pancreas from the
cln3⫺/⫺ mouse and contains an identical region in the
proposed desaturase domain.20 We did attempt measuring the desaturase activity in lymphoblast cell lines
from patients with Batten’s disease using palmitoyl cysteine, but the desaturase activity in control lymphoblasts was not detectable, making a lymphocyte assay
impractical at this time.
To provide additional support to our findings, we
then used siRNA probes to specifically knock-down
the CLN3 gene products. Two probes were generated
that were targeted to the N-terminal sequence of
CLN3P to inhibit all the possible alternatively spliced
mRNA species and to quench any residual desaturase
activity. Both probes resulted in reduction of enzyme
activity and one in particular totally ablated all of the
desaturase activity, providing additional evidence that
the residual activity is due to isoforms of CLN3P. This
experiment provided an independent line of evidence
demonstrating unequivocally that CLN3P is, indeed, a
fatty acid desaturase.
In conclusion, we have demonstrated that CLN3P is
an S-linked palmitoyl-protein ⌬-9 desaturase (PPD),
which catalyzes a previously unrecognized mechanism
of membrane-associated proteolipid modification. This
modification is likely to impact the function(s) of all
CLN3P-associated membrane lipid rafts. We propose
that genetic loss of this enzymatic activity leads to intracellular proteolipid accumulation, neuronal cell
death, and the signs and symptoms of the intractable
neurodegenerative Batten’s disease.
We thank Dr H. Mitchison for kindly providing tissues from the
cln3⫺/⫺ mouse, and Dr S. Hofmann for providing the
S-palmitoylated H-Ras protein substrate.
References
1. Haltia M. The neuronal ceroid-lipofuscinoses. J Neuropathol
Exp Neurol 2003;62:1–13.
2. Claussen M, Heim P, Knispel J, et al. Incidence of neuronal
ceroid-lipofuscinoses in West Germany: variation of a method
for studying autosomal recessive disorders. Am J Med Genet
1992;42:536 –538.
3. Uvebrant P, Hagberg B. Neuronal ceroid lipofuscinoses in
Scandinavia. Epidemiology and clinical pictures. Neuropediatrics 1997;28:6 – 8.
4. The International Batten Disease Consortium. Isolation of a
novel gene underlying Batten disease, CLN3. Cell 1995;82:
949 –957.
5. Rakheja D, Narayan SB, Pastor JV, Bennett MJ. CLN3P, the
Batten disease protein, localizes to membrane lipid rafts
(detergent-resistant membranes). Biochem Biophys Res Commun 2004;317:988 –991.
6. Phillips SN, Benedict JW, Weimer JM, Pearce DA. CLN3, the
protein associated with batten disease: structure, function and
localization. J Neurosci Res 2005;79:573–583.
7. Ramirez-Montealegre D, Pearce DA. Defective lysosomal arginine transport in juvenile Batten disease. Hum Mol Genet
2005;14:3759 –3773.
8. Bateman A, Coin L, Durbin R, et al. Pfam Protein Families
Database. Nucleic Acids Res 2004;32(database issue):
D138 –D141.
9. Man WC, Miyazaki M, Chu K, Ntambi JM. Membrane topology of mouse stearoyl-CoA desaturase 1. J Biol Chem 2006;
281:1251–1260.
10. Ntambi JM, Miyazaki M. Regulation of stearoyl-CoA desaturases and role in metabolism. Prog Lipid Res 2004;43:91–104.
11. Hofmann SL, Lee LA, Lu JY, Verkruyse LA. Palmitoyl-protein
thioesterase and the molecular pathogenesis of infantile neuronal ceroid lipofuscinosis. Neuropediatrics 1997;28:27–30.
12. Camp LA, Hofmann SL. Purification and properties of a
palmitoyl-protein thioesterase that cleaves palmitate from
H-Ras. J Biol Chem 1993;268:22566 –22574.
13. Resh MD. Fatty acylation of proteins: new insights into membrane targeting of myristoylated and palmitoylated proteins.
Biochim Biophys Acta 1999;1451:1–16.
14. Melkonian KA, Ostermeyer AG, Chen JZ, et al. Role of lipid
modifications in targeting proteins to detergent-resistant membrane rafts. Many raft proteins are acylated, while few are prenylated. J Biol Chem 1999;274:3910 –3917.
15. Moffett S, Brown DA, Linder ME. Lipid-dependent targeting
of G proteins into rafts. J Biol Chem 2000;275:2191–2198.
16. Bennett MJ, Poirier SF, Chern L, et al. Juvenile neuronal
ceroid-lipofuscinosis: characterization of the dyslipoproteinaemia and demonstration of membrane phospholipid and
phospholipid-dependent signal transduction abnormalities in
cultured skin fibroblasts. J Inherit Metab Dis 1993;16:
308 –311.
17. Puranam KL, Guo WX, Qian WH, et al. CLN3 defines a novel
antiapoptotic pathway operative in neurodegeneration and mediated by ceramide. Mol Genet Metab 1999;66:294 –308.
18. Pears MR, Cooper JD, Mitchison HM, et al. High resolution
1H NMR-based metabolomics indicates a neurotransmitter cycling deficit in cerebral tissue from a mouse model of Batten
disease. J Biol Chem 2005;280:42508 – 42514.
19. Narayan SB, Rakheja D, Pastor JV, et al. Over-expression of
CLN3P, the Batten disease protein, inhibits PANDER-induced
apoptosis in neuroblastoma cells: further evidence that CLN3P
has anti-apoptotic properties. Mol Genet Metab 2006;88:
178 –183.
20. Narayan SB, Pastor JV, Mitchison HM, Bennett MJ. CLN3L,
a novel protein related to the Batten disease protein, is overexpressed in Cln3⫺/⫺ mice and in Batten disease. Brain 2004;
127:1748 –1754.
21. Peirson SN, Butler JN, Foster RG. Experimental validation of
novel and conventional approaches to quantitative real-time
PCR data analysis. Nucleic Acids Res 2003;31:e73.
22. Yousefi-Salakdeh E, Johansson J, Stromberg RA. Method for Sand O-palmitoylation of peptides: synthesis of pulmonary surfactant protein-C models. Biochem J 1999;343:557–562.
Narayan et al: Function of CLN3 Protein
577
Документ
Категория
Без категории
Просмотров
3
Размер файла
381 Кб
Теги
batten, protein, disease, novem, palmitoyl, cln3p, desaturase
1/--страниц
Пожаловаться на содержимое документа