close

Вход

Забыли?

вход по аккаунту

?

Codon 219 lys allele of PRNP is not found in sporadic Creutzfeldt-Jakob disease.

код для вставкиСкачать
BRIEF COMMUNICATIONS
Codon 219 Lys Allele of
PRNP Is Not Found in
Sporadic Creutzfeldt-Jakob
Disease
Satoshi Shibuya, MD,* Jun Higuchi, MD,*
Ryong-Woon Shin, MD,* Jun Tateishi, MD,t
and Tetsuyuki Kitamoto, MD*
~
~~
~
~
~
The polymorphism at codon 219 of the prion protein
gene (PRNP) was found in the general Japanese population with 6% allele frequency. Herein, we examined 85
cases of sporadic Creutzfeldt-Jakob disease (CJD) for the
codon 219 polymorphism. The codon 219G’”’Ly”heterozygous polymorphism was not found in these CJD
cases. In addition, we examined 43 patients with dementia of non-CJD origin, and 4 were found to have the
codon 219G1dLy*
heterozygous polymorphism with a similar allele frequency as in the general population. Thus,
the codon 219G’”’LFheterozygous polymorphism might
be uniquely excluded from sporadic CJD.
Shibuya S, Higuchi J, Shin R-W, Tateishi J,
Kitamoto T. Codon 219 Lys allele of PRNP is not
found in sporadic Creutzfeldt-Jakob disease.
Ann Neurol 1998;43:826-828
Creutzfeldt-Jakob disease (CJD) is characterized by the
accumulation of an abnormal isoform of a hostencoded glycoprotein, prion protein (PrP), which is
known to be the central component of the transmissiThis disease-related isoform
ble agent of the prion.
of PrP, which is referred to as PrP’“, is distinguishable
from the normal cellular isoform of PrP, referred to as
PrPC, by its insolubility and partial resistance to protease digestion.
Familial CJD and Gerstmann-Straussler-Scheinker
syndrome (GSS) are linked to a number of point and
insertional mutations of the prion protein gene,
PRNP.3-5 More than 80% of CJD cases are, however,
not associated with mutations in PRNP and lack family history, and these CJD cases are referred to as “sporadic.” A minority of CJD cases have been considered
to be ascribed to exposure to infective materials. Some
’,’
From the *Department of Neurological Science, Tohoku University
School of Medicine, Sendai; and ?Department of Neuroparhology,
Neurological Institute, Kyushu University, Fukuoka, Japan.
Received Sep 29, 1997, and in revised form Dec 1 and Dec 26,
1997. Accepted for publication Jan 13, 1998.
Address correspondence to Dr Kiramoto, Department of Neurological Science, Tohoku University School of Medicine, 2-1 Seiryomachi, Sendai 980, Japan.
826
of these CJD cases appeared to be iatrogenic due to
dura mater graft or human cadaveric derived pituitary
hormone administered as treatment.6
In addition to these pathogenic mutations, PRNP
was shown to harbor the methionine (Met)/valine
(Val) polymorphism at codon 129 in the general population as well as in familial and sporadic CJD.7s8
These CJD patients with codon 129Va”Metheterozygous polymorphism exhibited clinical features
different from those in the CJD patients with the
codon 12gMetiMethomozygous polymorphism.9”0 Recently, we reported that a new polymorphism of PRNP
exists in healthy Japanese people in which guanine is
replaced by adenine in the first position of codon 2 19
with substitution from glutamic acid (Glu) to lysine
(Lys).” As extension of our study on the codon 219
polymorphism, we then analyzed sporadic CJD for this
polymorphism.
Materials and Methods
Sporadic Creutzfeldt-/akob Disease Cases
We selected 20 definite cases and 65 probable cases of sporadic CJD (Table) in accordance with previously published
criteria.” Normal control subjects consisting of healthy Japanese people were already examined for the presence of the
codon 219 polymorphi~m.~
Cases of familial CJD were excluded from this study.
Patients with Dementia of Non-CJD Origin
We selected 43 cases of non-CJD patients with dementia due
to Alzheimer’s disease, vascular dementia, amyotrophic lateral sclerosis (ALS) with dementia, Parkinson’s disease with
dementia, or unknown origin. We analyzed these cases for
the codon 219 polymorphism.
Genetic Analysis
Genomic DNA was extracted from blood or unfixed brain.
The codon 219 polymorphism was analyzed by restriction
fragment length polymorphism (RFLP). Polymerase chain reaction (PCR) by using sense primer T-l (GATGCTGGT
TCTCTTTGTGG) and antisense primer T-2 (CCCAC
TATCAGGAAGATGAG) was performed to amplify the
open reading frame of PRNP, followed by nested PCR using a mismatched sense primer (Sc-7: AGCAGATGTG
TATCACCCCGTA) and a matched antisense primer
(Sc-4: AGGAAGATGAGGAAAGAGATC). The mismatched
primer Sc-7 was designed to induce a SplI restriction enzyme
site. The nested PCR products obtained with Sc-7 and Sc-4
primers generate a SplI cutting site CGTACG for the Glu
allele at codon 219, but not for the Lys allele because the Lys
allele PCR products yield CGTACA at this portion. SplI
cuts the Glu allele PCR products into 98-base pair (bp) and
20-bp fragments but does not cut the Lys allele PCR products (118 bp) (Fig). Insertion and point mutations at codons
102, 105, 117, 145, 178, 180, 200, and 232 were also examined by RFLP as previously de~cribed.~
To confirm the
results obtained by the RFLP analysis, the PCR products
Copyright 0 1998 by the American Neurological Association
Table. Codon 219 Polymorphism in Sporadic CJD and Patients with Dementia of Non-CJD Origin
Control
Sporadic CJD
Definite
Probable
Non-CJD demented patients
GldGlu
GlulLys
LysILys
Case Frequency (Yo)
Allele Frequency (Yo)
88
12
0
0
0
0
0
0
0
0
12"
0"
6"
0"
9.3"
4.7"
85
20
65
39
4
Case frequency is the frequency of cases with codon 219 Glu/Lys heterozygote; allele frequency, the frequency of codon 219 Lys allele.
"Significantly different between sporadic CJD and control subjects and non-CJD demented patients, but not different between non-CJD
demented patients and control subjects.
CJD = Creurzfeldt-Jakob disease; GluiGlu = codon 219 Glu/Glu homozygote; Glu/Lys
were sequenced by the Dye Terminator method (Applied
Biosystems, Foster City, CA) in some cases.
Results
In the previous s t ~ d ywe
, ~ showed that Glu-to-Lys substitution at codon 219 of PRNP is found in the general
Japanese population with an allele frequency of 0.06. In
the present study, 20 cases of definite sporadic CJD and
65 cases of probable sporadic CJD were selected and analyzed for the polymorphism at codon 219 of PRNP.
Analysis using RFLP revealed that none of these cases
had the polymorphic lysine at codon 219. The results
obtained by RFLP were confirmed by sequencing of the
PCR products in some cases. The observation of the absence of the codon 2 19 polymorphism in sporadic CJD
is in sharp contrast with that in the Japanese general
population. Statistic comparison of the occurrence of
cases with the polymorphism between sporadic CJD and
control subjects showed a significant difference (x2 =
9.02, p = 0.0027, x2 test for independence). No other
insertion and point mutations at codon 102, 105, 117,
145, 178, 180, 200, or 232 of PRNP were found in
these sporadic CJD cases (see Table).
Next we analyzed 43 patients with dementia of nonCJD origin including Alzheimer's disease, vascular dementia, ALS with dementia, Parkinson's disease with dementia, or unknown dementia, and 4 were found
to have the codon 219G'"'Lys heterozygous polymorphism. Statistical comparison of cases with the codon
2 1gGlulLys heterozygous polymorphism showed no difference between non-CJD demented patients and control subjects (x2 = 0.032, p = 0.857, x2 test for independence). Thus, the codon 219G1U'12yS
polymorphism
prevails in patients with dementia of non-CJD origin
with the same frequency as in general population.
In search of CJD cases with the codon 219 polymorphism of PRNP, we found 1 probable case of iatrogenic
CJD with the codon 219G1"'Lysheterozygous polymorphism due to cadaveric dura mater graft. This patient
received dura mater graft at 33 years of age and developed dementia at age 42. Dementia progressed rapidly
and she showed periodic synchronous discharge and my-
=
codon 219 GlulLys heterozygote.
oclonus. At 6 months from onset, she showed akinetic
mutism, and after a 2-year clinical course, she died. An
autopsy was not performed. No other insertion or point
mutations of PRNP were found in this patient.
Discussion
Recently, we reported a polymorphism of PRNP at
codon 219 in healthy Japanese p e ~ p l e This
. ~ polymorFig. Analysis by restriction j a p e n t length polymoPphism f . r
the codon 219 polymorphism. Polymerase chain reaction
(PCR) products with Sc-4 and Sc-7primers were digested
with Spll. Lanes I , 2, and 4, Spll digest of PCR products f . r
219GldGGu alleles; lane 3, Spll digest of PCR products f i r
213G1u'Ly'alleles. Lanes I , 2, and 4 contain only digested
98-bp fragment; and lane 3, undigested 118-bp PCR product
and digested 38-bp fragment. M, molecular marker.
Brief Communication: Shibuya et al: Codon 219 Polymorphism in CJD
827
phism was not detected in white s ~ b j e c t s . ' ~
Subsequently, we reported d Japanese family with GSS who
possesses the codon 2 19G1u'Lys
heterozygous polymorphism. The GSS patients who have codon 219Ly" on
an allele different from that of codon 10zLeushowed
the same clinical features as in previously reported GSS
patients with codon 102Le"and codon 219G'U'G1L'
.l 4 In
contrast, GSS patients with codon 102Le" and codon
2 19Lyson the same allele differ in clinicopathological
features from GSS patients with codon 102L"" and
codon 2 19Giu/C'1u
. In GSS, the amino acid substitution
to lysine at codon 219 of PRNP is likely to have the
effect of altering the disease processes when this substitution occurs on the same allele with the codon 102Leu
mutation.
Here, we further analyzed 85 cases with sporadic
CJD for the codon 219 polymor hism, and all were
shown to have the codon 2 19G1u/GPu homozygous polymorphism of PRNP. To determine whether the absence of the codon 219G1"/Ly'heterozygous polymorphism is unique to sporadic CJD cases, we also
analyzed patients with dementia not of CJD origin.
The occurrence of the codon 219"1"'Ly' heterozygous
polymorphism in this group of non-CJD demented patients was the same as in the general population. The
codon 2 19G1u'Lysheterozygous polymorphism might
be uniquely excluded from the disease of sporadic
CJD. Taken together, our present results indicate that
the codon 2 19G'u/12yys
heterozygous polymorphism of
PRNP is likely to serve as a protecting factor against
sporadic CJD. In support of our conclusion, recent in
vitro studies using a cultured cell system revealed that
PrP containing the codon 2 19Lyspolymorphism resists
conversion to the PrPsc form.15
The single patient with the codon 2 19G'u'Lysheterozygous polymorphism, who developed typical probable CJD of iatrogenic origin due to dura mater graft,
suggests two potentially valuable insights regarding
this polymorphism, which nevertheless remain tentative due to the limited case number. First, the presence
of the codon 219G1u/Lysheterozygous polymorphism
may not offer sufficient protection against direct invasion of infectious agents into the brain from dura mater graft. And, second, the codon 219G1"'Lysheterozygous polymorphism may not alter the disease processes
even if it is found in sporadic CJD patients. No influence by this polymorphism on the clinical course precludes the possibility that we failed to assemble CJD
patients exhibiting an atypical clinical course due to
this polymorphism. Therefore, our data for the absence
of the codon 219c;1"~Lys
heterozygous polymorphism
are not based on a deviating portion of the population
of sporadic CJD patients, but rather reflect the overall
population of these patients.
In conclusion, the codon 2 19G1u'Lysheterozygous
828
Annals of Neurology
Vol 43
No 6
June 1998
polymorphism is a unique genetic modifying factor in
the inhibition of the pathogenesis of sporadic CJD.
The present data are sure to add a new view to the
understanding of mechanisms that underlie genetic association with the pathogenesis of sporadic CJD.
This study was supported by a grant from the Program for Promotion of Fundamental Studies in Health Sciences of the Organization
for Drug ADR Relief, R&D Promotion and Product Review of Japan (T.K.), a grant from the Science and Technology Agency (S.S.
and T.K.), a grant from the Ministry of Health and Welfare (T.K.),
and a Grant-in-Aid for Scientific Research from the Ministry of Education, Science and Culture (T.K. and R.-W.S.).
We thank Yumi Watanabe for technical assistance.
References
1. Prusiner SB. Novel proteinaceous infectious particles cause
scrapie. Science 1982;216: 136-144
2. McKinley MP, Bolton DC, Prusiner SB. A protease-resistant
protein is a structural component of the scrapie prion. Cell
1983;35:57-62
3. Kitamoto T , Tateishi J. Human prion diseases with variant protein. Philos Trans R Soc Lond [Biol] 1994;343:391-398
4. Hsiao K, Baker HF, Crow TJ, et al. Linkage of a prion protein
missense variant to Gerstmann Straussler syndrome. Nature
1989;338:342-345
5. Doh-ura K, Tateishi J, Sasaki H, et al. Pro Leu change at position 102 of prion protein is the most common but not the
sole mutation related to Gerstmann-Straussler syndrome. Biochem Biophys Res Commun 1989;163:974-979
6. Weller RO. Iatrogenic transmission of Creutzfeldt-Jakob disease. Psycho1 Med 1989;19:1-4
7. Parchi P, Castellani R, Capellani S, et al. Molecular basis of
phenotypic variability in sporadic Creutzfeldt-Jakob disease.
Ann Neurol 1996;39:767-778
8. Goldfarb LG, Petersen RB, Tabaton M, et al. Fatal familial
insomnia and familial Creutzfeldt-Jakob disease: disease phenotype determined by a DNA polymorphism. Science 1332;258:
806-808
9. Doh-ura K, Kitamoto T, Sakaki Y, et al. CJD discrepancy. Nature 199 1;353:801-802
10. Palmer MS, Dryden AJ, Hughes JT, et al. Homozygous prion
protein genotype predisposes to sporadic Creutzfeldt-Jakob disease. Nature 1991;352:340-342
11. Furukawa H, Kitamoto T , Tanaka Y, et al. New variant prion
protein in a Japanese family with Gerstmann-Straussler syndrome. Mol Brain Res 1995;30:385-388
12. Budka H, Aguzzi A, Brown P, et al. Neuropathological diagnostic criteria for Creutzfeldt-Jakob disease (CJD) and other
human spongiform encephalopathies (prion diseases). Brain
Pathol 1995;5:459 -466
13. Petraroli R, Pocchiari M. Codon 219 polymorphism of PRNP
in healthy Caucasians and Creutzfeldt-Jakob disease patients.
Am J Hum Genet 1996;58:888-889
14. Tanaka Y, Minematsu K, Moriyasu H, et al. A Japanese family
with a variant of Gerstmann-Strassler-Scheinker disease. J Neurol Neurosurg Psychiatry 1997;62:454-457
15. Kaneko K, Zulianello L, Scotr M, et al. Evidence for binding to
a discontinuous epitope on the cellular prion protein during
scrapie prion propagation. Proc Natl Acad Sci USA 1997;94:
10069 -10074
Документ
Категория
Без категории
Просмотров
0
Размер файла
455 Кб
Теги
prnp, lys, allele, found, jakos, disease, codon, 219, sporadic, creutzfeldt
1/--страниц
Пожаловаться на содержимое документа