close

Вход

Забыли?

вход по аккаунту

?

Complex immunomodulatory effects of interferon- in multiple sclerosis include the upregulation of T helper 1-associated marker genes.

код для вставкиСкачать
Complex Immunomodulatory Effects of
Interferon-␤ in Multiple Sclerosis Include
the Upregulation of T Helper 1-Associated
Marker Genes
Klaus-Peter Wandinger, MD,1 Claus-Steffen Stürzebecher, MD,1 Bibiana Bielekova, MD,1 Greg Detore,1
Andreas Rosenwald, MD,2 Louis M. Staudt, MD, PhD,2 Henry F. McFarland, MD,1 and Roland Martin, MD1
Multiple sclerosis (MS) is considered an autoimmune disease that is mediated by proinflammatory T helper-1 lymphocytes. The putative mechanism of interferon-␤ (IFN-␤), an approved treatment for MS, includes the inhibition of T-cell
proliferation, blocking of blood-brain-barrier opening and T-cell transmigration into the brain via interference with cell
adhesion, and the upregulation of anti-inflammatory cytokines. In the present study, a gene expression analysis of
IFN-␤-treated peripheral blood mononuclear cells by cDNA microarray documents the broad effects of IFN-␤ that are
not purely anti-inflammatory. Specifically, we addressed the effect of IFN-␤ on T helper-1 differentiation- or lineage
markers such as the IL-12 receptor ␤2 chain and the chemokine receptor CCR5 that have been implicated in the
pathogenesis of MS. Both markers were significantly upregulated in vitro and in vivo under IFN-␤ therapy, supporting
that this cytokine exerts complex effects on the immune system. The combination of cDNA microarray and quantitative
PCR will expand our knowledge of the immunological effects of such pleiotropic agents as IFN-␤, may provide a key to
why certain patients fail to respond, and eventually may influence our view of the disease pathogenesis.
Ann Neurol 2001;50:349 –357
Interferon-␤ (IFN-␤) is the first approved drug for the
treatment of multiple sclerosis (MS), an inflammatory,
demyelinating disorder of the central nervous system
(CNS).1 In Phase III clinical trials, IFN-␤ has decreased relapse rate and severity, progression of disability, and development of new brain lesions as detected
by magnetic resonance imaging (MRI) in relapsingremitting and secondary progressive MS patients.2–5
However, while a number of activities are thought to
contribute to its efficacy, much has yet to be learned
about its mechanism of action.
The cause of MS remains unknown, but its pathogenesis is ascribed in part to a T-cell-mediated autoimmune response against myelin components.1 Based on
animal and in vitro studies in MS patients, the activation of proinflammatory TH1 cells in the systemic circulation and their recruitment into the CNS plays a
crucial role in the pathogenesis of MS.6 –11 Given the
immunoregulatory functions of IFN-␤, it has been
postulated that skewing of a TH1 bias in peripheral
blood mononuclear cells (PBMC) toward TH2 accounts for some of its beneficial effects in MS.12 This
notion is supported by the enhancement of interleukin
(IL)-10 expression by IFN-␤ treatment in MS.13 However, IFN-␤, at least transiently, also increases the
number of IFN-␥ secreting cells,14 indicating that
IFN-␤ stimulates the expression of anti-inflammatory
TH2 cytokines but also upregulates a prototypic,
proinflammatory TH1 molecule. Though this appears
contradictory with respect to its efficacy in MS, its
proinflammatory activity is also in agreement with recent experimental data that show Type I IFN as a major factor leading to TH1 development in human but
not mouse CD4⫹ T cells.15,16 In order to assess the
complex actions of IFN-␤ on the immune system, we
examined IFN-␤ treated PBMC by cDNA microarrays
to identify genes that are positively or negatively regulated by IFN-␤. Furthermore, to understand more
clearly the immunoregulatory functions of IFN-␤ in
MS, we examined its effects on two critical markers of
TH1 differentiation—the IL-12 receptor ␤2 chain (IL12R␤2) and the chemokine receptor CCR5.
The IL-12R␤2 chain is the binding and signaling
component of the IL-12R, selectively expressed on
From the 1Neuroimmunology Branch, National Institute of Neurological Disorders and Stroke; and 2Metabolism Branch, National
Cancer Institute, National Institutes of Health, Bethesda, MD.
Address correspondence to Dr Martin, Neuroimmunology Branch,
NINDS, National Institutes of Health, Building 10 Room 5B-16,
10 Center Drive, MSC 1400, Bethesda, MD 20892-1400.
E-mail: martinr@ninds.nih.gov
Received Oct 9, 2000, and in revised form Mar 21, 2001. Accepted
for publication Apr 23, 2001.
Published online Jun 27, 2001; DOI: 10.1002/ana.1096
This article is a US Government work and, as such, is in the public domain of the United States of America.
Published 2001 Wiley-Liss, Inc.
349
TH1 cells, and crucial for the maintenance of IL-12
responsiveness and TH1 lineage commitment.17 Of
particular interest, it has been demonstrated that expression of the IL-12R␤2 chain in response to autoantigen is an important step in the differentiation of encephalitogenic T cells in experimental allergic
encephalomyelitis (EAE), an animal model of MS.10
Furthermore, IL-12 expression has been associated with
MS disease activity.18 –20 CCR5, the chemokine receptor for RANTES, MIP-1␣ and ␤, is preferentially expressed on activated TH1 cells,21,22 and increased
numbers of CCR5⫹ IFN-␥ and tumor necrosis factor
–␣ secreting T lymphocytes were found in peripheral
blood as well as demyelinating lesions of MS patients.11,23,24 Our data demonstrate that IFN-␤ upregulates not only TH2 but also numerous TH1related, proinflammatory mediators. These data stress
that further research of the pleiotropic effects of IFN-␤
and of the disease mechanism in MS is needed.
Patients and Methods
Patients
All MS patients from the National Institute of Neurological
Disorders and Stroke/National Institutes of Health (NINDS/
NIH) outpatient clinic had clinically definite, relapsingremitting MS. Healthy volunteers were selected from personnel of the Neuroimmunology Branch. Patients studied
longitudinally (n ⫽ 6) participated in a clinical trial of IFN␤-1b.25 These patients were monitored by monthly brain
magnetic resonance imaging (MRI; Signa 1.5-T MR unit,
General Electric, Milwaukee, WI), and new and total
gadolinium-enhancing (Magnevist, Berlex Laboratories, Cedar Knolls, NJ) lesions were recorded. None of the patients
had received immunomodulatory therapy other than IFN-␤
or corticosteroids for at least 2 months prior to blood sampling. The studies were approved by the NINDS Institutional Review Board.
Cells and Cell Culture Reagents
PBMC were isolated from fresh blood by Ficoll density gradient centrifugation (Bio-Whittaker, Walkersville, MD) and
resuspended in Iscove’s modified Dulbecco’s medium
(Gibco, Grand Islands, NY) supplemented with 2mM
L-glutamine, 50mg/ml gentamicin, 100U/ml penicillin/
streptomycin (Whittaker Bioproducts, Gaithersburg, MD),
and 5% human plasma. In some experiments, PBMC were
depleted of natural killer (NK) cells by magnetic bead separation using the MACS NK cell isolation kit (Miltenyi Biotec, Auburn, CA). The myelin basic protein (MBP) (87–99)specific TH1 clone 3A6 (HLA-restriction: DRB5*0101;
EC50 for proliferation: 1–10␮g/ml; IFN-␥/IL-4 ratio: 750)
was generated as described.26 Cell cultures were incubated in
a humidified atmosphere of 5% CO2 at 37°C. Where specified, cytokines or neutralizing antibodies were added to the
cultures as follows: recombinant human IFN-␣-2a,
1,000IU/ml (Roferon-A, Hoffman-LaRoche Inc., Nutley,
NJ); recombinant human IFN-␤-1b, 10, 100, and
1,000IU/ml (Betaseron, Berlex, Richmond, CA); recombi-
350
Annals of Neurology
Vol 50
No 3
September 2001
nant human IFN-␥, 1,000IU/ml (Immunoferon, Biogen Research Corp., Cambridge, MA); recombinant human IL12p70, 5ng/ml (Pharmingen, San Diego, CA); purified
mouse anti-human IFN-␥ monoclonal antibody, 250ng/ml
and 2.5␮g/ml (clone B27, catalog no. 20660D, isotype control: mouse IgG1, clone 107.3, catalog no. 20800D, Pharmingen). Neutralizing concentrations of anti-IFN-␥ antibody
were determined in a set of preliminary experiments (data
not shown). MBP (87–99) was synthesized on a peptide synthesizer (Beckman model 990) by Merrifields solid phase
methodology (and kindly provided by N. Ling, Neurocrine
Biosciences, San Diego, CA).
RNA Isolation and Quantitative Real-Time
Polymerase Chain Reaction
Total RNA was isolated from cells using the RNeasy Kit
(Quiagen, Santa Clarita, CA), reverse transcribed to cDNA
with random hexamers using the TaqMan Reverse Transcription Reagents as per manufacturer’s instructions (Perkin
Elmer, Foster City, CA). Quantitative real-time polymerase
chain reaction (rtPCR) was performed on an ABI Prism
7700 Sequence Detection System (Perkin Elmer, Foster City,
CA) by rtPCR.27 Amplification of glyceraldehyde-3phosphate dehydrogenase (GAPDH) and 18S rRNA for
stimulated conditions was used for sample normalization.
The amplification protocol followed the suggestions of the
TaqMan Gold RT-PCR kit. For detection of IL-4, IL12R␤2 chain, CCR5, and GAPDH transcripts, oligonucleotides were used at final concentrations of 200nM for forward
and reverse primer and 100nM for the fluorogenic probe as
follows:
IL-4 forward: 5⬘AACAGCCTCACAGAGCAGAAGACT3⬘,
reverse: 5⬘TGTGTTCTTGGAGGCAGCAA3⬘, probe:
5⬘FAM-TGTGCACCGAGTTGACCGTAACAGACATAMRA3⬘;
IL-12R␤2 chain forward: 5⬘GGCATTTTCTCAACGCATTACTT3⬘, reverse: 5⬘TGGATCTGGAATTTCTCTGCTACA3⬘, probe: 5⬘FAM-TTCTCCTAGCAGCCCTCAGACCTCAGTG-TAMRA3⬘;
MxA forward: 5⬘CAGCACCTGATGGCCTATCAC3⬘,
reverse: 5⬘GAGCATGAAGAACTGGATGATCAA3⬘,
probe: 5⬘FAM-AGCAAGCGCATCTCCAGCCACATCTAMRA3⬘;
CCR5 forward: 5⬘AAGCTATGCAGGTGACAGAGACTCTT3⬘, reverse: 5⬘CTCCCCGACAAAGGCATAGAT3⬘,
probe: 5⬘FAMATGACGCACTGCTGCATCAACCCCTAMRA;
GAPDH forward: 5⬘GAAGGTGAAGGTCGGAGT3⬘,
reverse: 5⬘GAAGATGGTGATGGGATTTC3⬘ probe:
5⬘FAM-CAAGCTTCCCGTTCTCAGCC-TAMRA3⬘.
Quantification of gene expression was calculated in comparison to 10-fold serial dilutions of plasmid cDNA run in
parallel to create a standard curve. For the detection of IL10, IL-12p40, IFN-␥ and TGF-␤ transcripts, predeveloped
TaqMan Assay Reagents (Perkin Elmer, Foster City, CA)
containing cytokine primers and probe were used and quantification of gene expression relative to GAPDH or 18S
rRNA was calculated by the protocol’s ⌬⌬CT method. 18S
rRNA was amplified using TaqMan Ribosomal RNA Control Reagents.
Microarray Procedures
DNA microarray analysis was performed as previously described.28 Arrays for this study contained 6,432 elements,
3,035 cDNAs representing known genes, and 3,397 ESTs
from IMAGE consortium cDNA libraries.29 About a quarter
of the arrayed genes were represented by duplicates or multiple array elements and derived from two or more different
cDNAs, providing internal controls for the reproducibility of
gene expression. cDNA probes were prepared from total
RNA by oligo dT-primed polymerization using SuperScript
II reverse transcriptase (Life Technologies, Gaithersburg,
MD). Cy3 or Cy5 labeled dUTP were incorporated into the
reverse transcriptase reaction. Hybridizations were carried out
at 65°C in a waterbath overnight in 17.5␮l volumes. Microarrays were scanned using the MicroArray Avalanche
Scanner (Molecular Dynamics, Sunnyvale, CA). DNA targets on the arrays were located using grid overlays, and spot
intensities were subsequently measured (IPLab ArraySuite
software package, kindly provided by Y. Chen, National Human Genome Research Institute). Relative levels of gene expression were calculated as the ratio of normalized intensities
of Cy5 signal and normalized intensities of Cy3 signal. The
color image of the hybridization results were made by representing the Cy3 fluorescent image as green and the Cy5 fluorescent image as red and merging the two color images.
Statistics
Statistical analysis was performed using Sigma-Stat software
(Sigma-Stat, Jandel Scientific, CA). The t test was used for
between-groups comparisons. For analysis of dependent variables, Wilcoxon’s signed-rank test was performed, and where
normality was passed, paired t test was used. Data involving
serial measurements was compared by repeated measures
ANOVA analysis on ranks, followed by Dunett’s as posterior
test. A p value of less than 0.05 was considered significant.
Results
Analysis of IFN-␤-Responsive Genes
Using cDNA Microarrays
To assess the complex immunoregulatory functions of
IFN-␤ in a broad and unbiased way, cDNA microarray
analyses were performed to examine changes in gene
expression of PBMC in response to IFN-␤ in vitro.
The transcriptional response to IFN-␤-1b (100 and
1,000IU/ml) was examined in 3 individuals (1 MS patient, 2 healthy volunteers) after 6 and 24 hour incubation. Out of 6,432 genes represented on each array,
about 200 genes were induced and about 300 repressed
by at least two-fold by IFN-␤-1b treatment. Upregulation of genes known to be tightly regulated by Type I
IFN (eg, IFN-inducible proteins 1-8U, 1-8D, 9-27,
17KD, 56 KD, 2⬘-5⬘ oligo A synthetase, and MxA
protein) served as internal validation controls. While
the two time points may still miss expression changes
in a substantial number of genes, they should reasonably reflect the complex influences of IFN-␤. A representative section of a microarray hybridization experiment is shown in Figure 1.
The Table lists genes with potential relevance to the
pathogenesis of MS that were induced or repressed in
PBMC by IFN-␤ treatment in more than one experiment. The expression profiles of several of these genes
were confirmed using TaqMan quantitative PCR (data
not shown). Results identified genes involved in innate
and specific immune responses that have not been discussed as potential effector targets of IFN-␤ in MS.
Interestingly, the transcriptional response to IFN-␤
also comprised genes that have been previously associated with disease activity in MS (CCR5 and IP10),11,23,24 as well as upregulation of proinflammatory
genes (eg, IL-15 receptor alpha chain). In addition, we
identified over 50 differentially expressed sequence tags
(EST), ie, genes with as yet unknown function, which
were strongly regulated in response to IFN-␤ treatment.
IFN-␤ Induces IL-12R␤2 Chain Gene Expression in
Peripheral Blood Mononuclear Cells and Fully
Differentiated TH1 Cells In Vitro
The above findings indicate that the biological mechanism of IFN-␤ is more complex than previously anticipated. To test whether IFN-␤ induces IL-12R␤2 chain
gene expression, an important step in TH1 development, we cultured PBMC from healthy volunteers and
MS patients in different cytokine conditions for 16
hours. Cells cultured in the presence of IFN-␣, -␤, and
-␥, as well as IL-12 significantly upregulated the IL12R␤2 chain expression (Fig 2A). Treatment with
IFN-␥ resulted in the highest increase in IL-12R␤2
chain mRNA levels. However, the effects of IFN-␤ on
IL-12R␤2 chain expression were not mediated by
IFN-␥ because comparable amounts of IL-12R␤2
chain mRNA levels were observed in cells incubated
with IFN-␤ in the presence or absence of neutralizing
anti-IFN-␥ antibody. Because NK cells have been reported to express IL-12R,30 PBMC were depleted of
NK cells. Results similar to those shown in Figure 1A
were obtained, thus excluding NK cells as the major
source of IL-12R␤2 chain gene expression (see Fig 2B).
There were no significant differences between PBMC
from MS patients and healthy volunteers. To examine
further whether IFN-␤ acts directly on T cells, a fully
differentiated CD4⫹ TH1 MBP (87–99)-specific Tcell clone (clone 3A6) was cultured for 16 hours with
IFN-␤. Again, IFN-␤ treatment resulted in the upregulation of IL-12R␤2 chain gene expression in an
IFN-␥ independent manner (see Fig 2C).
Wandinger et al: Interferon-␤ in MS
351
Fig 1. Section of a cDNA microarray comparing RNA isolated from peripheral blood mononuclear cells (PBMC) (10 8) after 24
hours of incubation in the presence or absence of interferon 1␤ (IFN-␤-1b) (100 IU/ml). The image shows genes whose mRNAs
are more abundant in IFN-␤ treated cells (ie, upregulated by IFN-␤) as green spots and genes whose mRNAs are more abundant
in untreated cells (ie, downregulated by IFN-␤) as red spots. Yellow spots represent genes whose expression does not vary substantially between the two samples. Arrows indicate the spots representing the following genes: 1, IFN-induced 56 kDa protein; 2,
CD14; 3, CCR5; 4, MxA; 5, IP-10; 6, IL-8; 7, TNF-␣ inducible gene; 8, CD32 (one of the low-affinity IgG Fc receptors); 9,
EST (IMAGE clone ID1671185); 10, Caspase-1; 11, EST (IMAGE clone ID1967364); 12, PECAM-1 (CD31).
IL-12R␤2 Chain Gene Expression is Upregulated by
Both Stimulation With Autoantigen and IFN-␤ in
an Autoreactive, MBP (87–99)-Specific TH1 Clone
To assess how IFN-␤ affects the regulation of IL12R␤2 chain gene expression in an antigen-specific system, we cultured the CD4⫹ MBP (87–99)-specific
TH1 clone 3A6 in the presence of autologous PBMC
as APC in increasing concentrations of IFN-␤-1b, or
with MBP (87–99) alone or in the presence of IFN␤-1b (1,000IU/ml). T cell activation by nominal antigen was characterized by a predominant upregulation
of IFN-␥ transcription (Fig 3A), which is consistent
with the previously described TH1 phenotype of
3A6.26 Interestingly, antigen-specific T-cell activation
resulted in the concomitant upregulation of IL-10 gene
expression. IL-12R␤2 chain gene expression was also
Table. List of IFN-␤ Responsive Genes with Potential Relevance to the Pathogenesis of MS as Identified
by cDNA Microarray Analysisa
Functional Group/Cluster
Upregulated
IFN-regulated genes
Cytokines/-receptors
Chemokines/-receptors
Adhesion molecules/MMPs
MxA, MxB, Several IFN-induced proteins
IL-1R antagonist, IP-10, CCR5,
IL-15R ␣ chain
ICAM-1
Immunoregulatory molecules
Surface receptors
CD40, TNF␣-induction gene
Apoptosis/cell cycle
CD95, APO-2 ligand
Caspase-1 ⫽ ICE
Proteosome chain 7 ⫽ LMP2
HLA-G, HLA-A2
Antigen presentation
Downregulated
Cytochrome P450
IL-1, IL-8, CXCR4
PECAM-1, MMP-9, LFA-1
P-selectin
CD32, CD30L, TRAF3 ⫽ CD40-TNFRand LMP1-associated protein CD14,
p38 MAP kinase
c-fos, c-jun
MHCII⫽DM-␤
a
Peripheral blood mononuclear cells (PBMC) (108) obtained from 3 individuals (1 MS patient, 2 healthy volunteers) were cultured in a final
volume of 25ml in the presence of IFN-␤-1b (100 and 1,000 IU/ml) for 6 and 24 hours. Genes listed were reproducibly up- or downregulated
two-fold or more by IFN-␤-1b incubation compared to untreated samples.
352
Annals of Neurology
Vol 50
No 3
September 2001
from T cells. Induction of IL-12R␤2 chain by IFN-␤
was paralleled by a dose-dependent upregulation of
IL-10 gene expression (see Fig 3A). The presence of
IFN-␤ during antigen-specific T-cell activation resulted
in a marked suppression of IL-12p40 gene expression
(see Fig 3C) and a simultaneous induction of IL-10
transcription (see Fig 3A).
Fig 2. Interferon-␤ (IFN-␤) induces IL-12R␤2 chain gene
expression in peripheral blood lymphocytes and differentiated
TH1 cells in vitro. (A) Peripheral blood mononuclear cells
(PBMC) (5 ⫻ 106) were cultured in 24 well plates for 16
hours in a final volume of 2ml. Cells were incubated in media alone and with IFN-␣, IFN-␤, IFN-␥ or IL-12. Alternatively, cells were incubated with IFN-␤ in the presence of
neutralizing anti-IFN-␥ antibody. IL-12R␤2 chain mRNA
was quantitated by rtPCR. Gene expression levels were normalized to 18S rRNA. Results obtained in 5 individuals (3
patients, 2 healthy volunteers) are shown (mean ⫾ standard
deviation). Statistical significance of changes was tested by
Wilcoxon’s signed-rank test. *p ⬍ 0.05. (B) PBMC were depleted of NK cells prior to cell culture, incubated with IFN-␤
for 16 hours and evaluated for IL-12R␤2 chain gene expression. NK cells were undetectable by FACS staining for CD56
and CD57. (C) Differentiated CD4⫹ TH1 cells (2 ⫻ 105)
were cultured for 16 hours with IFN-␤ in the presence or
absence of neutralizing doses of anti-IFN-␥ antibody and evaluated for IL-12R␤2 chain gene expression. Similar results were
obtained in three independent experiments.
upregulated in response to antigen stimulation (see Fig
3B), but also by IFN-␤ in the absence of antigen. Similar results were obtained when B cells were used as
APC (data not shown), indicating that the detected IL12R␤2 chain transcripts were preferentially derived
IFN-␤ Treatment Upregulates Gene Expression of
IL-12R␤2 Chain and CCR5 in PBMC of MS
Patients In Vivo
We next examined whether IFN-␤ therapy leads to upregulation of IL-12R␤2 chain gene expression in peripheral blood of MS patients in vivo. To this end,
PBMC were obtained from 6 MS patients (mean age
38.3 years, mean disease duration 11 years) at baseline
and during the first 6 months of IFN-␤-1b therapy (8
MIU subcutaneously every other day). Patients were
selected who responded to IFN-␤ treatment as demonstrated by a marked decrease in new gadolinium (Gd)enhancing lesions on MRI25,31 (Fig 4). Induction of
MxA protein gene expression in PBMC of MS patients
was measured as a biological response marker to IFN-␤
therapy in vivo.32 Compared to baseline, spontaneous
gene expression of MxA protein in PBMC of MS patients was significantly enhanced for up to 6 months
after the beginning of IFN-␤ therapy (see Fig 4). Gene
expression of the TH1-markers IL12R␤2 and CCR5
was likewise significantly upregulated for a period of 4
and 6 months, respectively. Because IFN-␤ neutralizing antibodies were not detected during the period of
the study, the parallel upregulation of MxA, IL12R␤2
chain, and CCR5 may indicate a desensitization of
interferon-responsive genes or that adaptive processes
in the cytokine network set in after a few months.
IFN-␥ gene expression increased transiently after 2
months of therapy, whereas changes in in vivo IL-10
gene expression did not reach significance at any of the
individual time points tested. However, when the data
of 2, 4, and 6 months were collectively compared to
baseline, the mean IL-10 gene expression during the
first 6 months of treatment was also significantly increased (p ⬍ 0.05, Wilcoxon’s signed-rank test). The
expression of IL-12p40 and TGF-␤ mRNA did not
show significant variations in response to IFN-␤ therapy (data not shown).
Discussion
Current concepts of MS pathogenesis imply a diseasemediating effect of TH1-like T cells and protection by
TH2-like T cells.6 –11,33,34 Hence, studies on the
mechanisms of action of IFN-␤ in MS have focused on
its putative TH2 immunoregulatory properties. In the
present study, we demonstrate that IFN-␤ modulates a
large number of genes that are potentially relevant to
MS, including molecules involved in the control of cel-
Wandinger et al: Interferon-␤ in MS
353
Fig 3. IL-12R␤2 chain gene expression is upregulated by both self-antigen and interferon-␤ (IFN-␤) in an autoreactive, MBP (87–
99)-specific TH1 clone. The MBP (87–99)- specific TH1 clone 3A6 (2 ⫻ 105 cells) was cultured in the presence of autologous
peripheral blood mononuclear cells (PBMC) (106) as APC for 16 hours. Cells were incubated in media alone, in the presence of
increasing concentrations of IFN-␤-1b, or with 10␮g/ml MBP (87–99) in the absence and presence of IFN-␤-1b (1,000IU/ml).
Total RNA was extracted and IL-12R␤2 chain mRNA was quantitated by rtPCR. Gene expression levels were normalized to 18S
rRNA. Changes are expressed relative to gene expression levels in the untreated condition. Similar results were obtained in three
independent experiments.
lular and humoral immune reponses, apoptosis, and
antigen presentation, as well as a large number of ESTs
with as yet unknown function. We examined the effect
of IFN-␤ in vitro and in vivo on recently described
TH1 differentiation and lineage markers and show that
IFN-␤ induces IL-12R␤2 chain gene expression in
PBMC in vitro, and further in fully differentiated, autoreactive MBP (87–99) specific TH1 cells in a dosedependent manner. The upregulation of IL-12R␤2
chain expression could not only be shown in vitro, but
also in PBMC of MS patients ex vivo, and together
with the concomitant upregulation of the chemokine
receptor CCR5 suggests that the current concepts as to
how IFN-␤ exerts its therapeutic effect in MS may be
too simplistic. Ours and previously reported findings
indicate that the action of cytokines in the pathogenesis of MS and the animal model, experimental allergic
encephalomyelitis (EAE), is more complex than suggested by a simple TH1/TH2 dichotomy.14,33–35 For
example, while the injection of IFN-␥ induced exacerbations in MS patients,33 it appears to have protective
properties in EAE.35,37 Similarly puzzling observations
have been reported for another cytokine, TNF-␣,
which was long considered a major proinflammatory
cytokine that contributes to development of lesions
and myelin damage.38,39 The increased production of
IFN-␥ and TNF-␣ by PBMC of MS patients has been
354
Annals of Neurology
Vol 50
No 3
September 2001
shown to precede clinical attacks.6 High levels of
TNF-␣ were detected in cerebrospinal fluid of chronic
progressive MS patients and correlated with disability.34 Yet, TNF-␣ neutralization by antibodies or binding of the cytokine by a recombinant TNF receptor
p55 immunogloublin fusion protein (sTNFR-IgG p55)
led to increases in relapse rate and disease activity in
MS patients.36,40 The role of TNF-␣ in EAE is also
controversial.41,42 TNF-␣ can even have antiinflammatory effects in demyelinating CNS lesions.43
Furthermore, there is increasing evidence for a contribution of TH2-mediated mechanisms to the pathogenesis of MS. MBP-specific TH2 cells are capable of inducing EAE in immunodeficient mice.44 In a
marmoset model of MS, immune deviation toward a
TH2 phenotype resulted in lethal demyelination that
was ascribed to an increase in titers of autoantibodies
to myelin oligodendrocyte glycoprotein (MOG).45
Furthermore, there is evidence that autoantibodies
against specific myelin proteins mediate myelin damage in MS.46 Finally, it should be noted that the
TH1/TH2 ratio is not markedly shifted in T cells
infiltrating MS lesions.47
How do the above discrepancies relate to this study?
Although it cannot be excluded that the immediate effects of IFN-␤ on the blood-brain barrier, as demonstrated in the present and other studies, may override
Fig 4. MRI response and changes in spontaneous gene expression in MS patients
treated with IFN-␤-1b. Samples of peripheral blood mononuclear cells (PBMC)
from 6 patients were obtained every other
month before the beginning of IFN-␤-1b
therapy and during the first 6 months of
treatment. Total RNA was extracted and
relative mRNA levels were quantitated by
rtPCR. Gene expression levels were normalized to expression of GAPDH. Numbers of new gadolinium enhancing lesions
on MRI were determined as a subclinical
marker of disease activity. Induction of
MxA protein gene expression was measured
as a biological response marker to IFN-␤
therapy in vivo. Statistical significance of
changes after 2, 4, and 6 months of treatment compared to baseline was tested by
Dunett’s test. *p ⬍ 0.05.
any proinflammatory effects that are induced in the periphery,25,31 beneficial immunoregulatory effects may
include the increase of certain proinflammatory mediators. For example, it has been proposed recently that
inflammatory infiltrates in MS lesions might have a
neuroprotective effect, eg, via secretion of brain-derived
neurotrophic factor (BDNF).48,49 A more subtle balance of regulation of pro- and anti-inflammatory mediators in a complex network may also be postulated
based on our initial observations with cDNA microarrays. Given the presumed association of certain viruses
with MS and the observation of abnormal immune responses to a variety of viruses in MS patients, antiviral
effects of IFN-␤ should also be considered, and these
are likely proinflammatory.50 –53
While there is currently no way to assess the net outcome of the various influences on gene expression, it is
clear that IFN-␤ treatment has more complex effects
than previously anticipated. In order to identify the
functional relevant gene clusters of IFN-␤ therapy in
MS, future studies should carefully link gene and protein expression profiles with clinical and MRI activity
markers during MS. We anticipate that such studies
will lead to a more differentiated understanding of the
mechanism of action of IFN-␤ and also of the pathogenesis of MS. Furthermore, such analyses offer unprecedented opportunities to identify drug responders
and nonresponders and might also lay the foundation
for rational combination therapies.
K. P. Wandinger is a postdoctoral fellow of the Deutsche Forschungsgemeinschaft (Wa 1343/1-1). A. Rosenwald is supported by
a grant of the Mildred Scheel Stiftung. Claus-Steffen Stürzebecher is
a National Institutes of Health postdoctoral fellow.
References
1. Martin R, McFarland HF, McFarlin DE. Immunological aspects of demyelinating diseases. Annu Rev Imumnol 1992;10:
153–187.
Wandinger et al: Interferon-␤ in MS
355
2. IFNB Multiple Sclerosis Study Group and the University of
British Columbia MS/MRI Analysis Group. Interferon beta-1b
in the treatment of multiple sclerosis: final outcome of the randomized controlled trial. Neurology 1995;45:1277–1285.
3. Jacobs LD, Cookfar DL, Rudick RA, et al. Intramuscular interferon beta-1a for disease progression in relapsing multiple
sclerosis. Ann Neurol 1996;39:285–294.
4. European Study Group on Interferon beta-1b in Secondary
Progressive MS. Placebo-controlled multicentre randomised
trial of interferon beta-1b in treatment of secondary progressive
multiple sclerosis. Lancet 1998;352:1491–1497.
5. PRISMS (Prevention of Relapses and Disability by Interferon
beta-1a Subcutaneously in Multiple Sclerosis) Study Group.
Randomised double-blind placebo-controlled study of interferon beta-1a in relapsing/remitting multiple sclerosis. Lancet
1998;352:1498 –1504.
6. Beck J, Rondot P, Catinot L, et al. Increased production of
interferon gamma and tumor necrosis factor precedes clinical
manifestation in multiple sclerosis: Do cytokines trigger off exacerbations? Acta Neurol Scand 1988;78:318 –323.
7. Ando DG, Clayton J, Kono D, et al. Encephalitogenic T cells
in the B10.PL model of experimental allergic encephalomyelitis
(EAE) are of the Th-1 lymphokine subtype. Cell Immunol
1989;124:132–143.
8. Powell MB, Mitchell D, Lederman J., et al. Lymphotoxin and
tumor necrosis factor-alpha production by myelin basic proteinspecific T-cell clones correlates with encephalitogenicity. Int
Immunol 1990;2:539 –544.
9. Rieckmann P, Albrecht M, Kitze B, et al. Tumor necrosis
factor-alpha messenger RNA expression in patients with
relapsing-remitting multiple sclerosis is associated with disease
activity. Ann Neurol 1995;37:82– 88.
10. Chang JT, Shevach EM, Segal BM. Regulation of interleukin
(IL)-12 receptor ␤2 subunit expression by endogenous IL-12: a
critical step in the differentiation of pathogenic autoreactive T
cells. J Exp Med 1999;189:969 –978.
11. Strunk T, Bubel S, Mascher B, et al. Increased numbers of
CCR5⫹ interferon-␥ and tumor necrosis factor-␣ secreting
T-lymphocytes in MS patients. Ann Neurol 2000;47:269 –273.
12. Yong VW, Chabot S, Stuve O, Williams G. Interferon beta in
the treatment of multiple sclerosis: mechanisms of action. Neurology 1998;51:682– 689.
13. Rudick RA, Ransohoff RM, Peppler R, et al. Interferon beta
induces interleukin-10 expression: relevance to multiple sclerosis. Ann Neurol 1996;40:618 – 627.
14. Dayal AS, Jensen BS, Lledo A, Arnason BGW. Interferongamma-secreting cells in multiple sclerosis patients treated with
interferon beta-1b. Neurology 1995;45:2173–2177.
15. O’Shea JJ, Visconti R. Type I IFNs and regulation of TH1
responses: enigmas both resolved and emerge. Nature Immunol
2000;1:17–19.
16. Farrar JD, Murphy KM. Type I interferons and T helper development. Immunol Today 2000;21:484 – 489.
17. Presky DH, Yang H, Minetti LJ et al. A functional interleukin
12 receptor complex is composed of two ␤-type cytokine receptor subunits. Proc Natl Acad Sci U S A 1996;93:14002–14007.
18. Windhagen A, Newcombe J, Dangond F, et al. Expression of
costimulatory molecules B7–1 (CD80), B7–2 (CD86), and interleukin 12 cytokine in multiple sclerosis lesions. J Exp Med
1995;182:1985–1996.
19. Balashov KE, Smith DR, Khoury SJ, et al. Increased interleukin
12 production in progressive multiple sclerosis: induction by
activated CD4⫹ T cells via CD40 ligand. Proc Natl Acad Sci
U S A 1997;94:599 – 603.
20. van Boxel-Dezaire AH, Hoff SC, van Oosten BW, et al. Decreased interleukin-10 and increased interleukin-12p40 mRNA
356
Annals of Neurology
Vol 50
No 3
September 2001
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
are associated with disease activity and characterize different disease stages in multiple sclerosis. Ann Neurol 1999;45:695–703.
Bonecchi R, Bianchi G, Bordignon PP, et al. Differential expression of chemokine receptors and chemotactic responsiveness
of Type-1 T-helper cells (Th1s) and Th2s. J Exp Med 1998;
187:129 –134.
Qin S, Rottman JB, Myers P, et al. The chemokine receptors
CXCR3 and CCR5 mark subsets of T cells associated with certain inflammatory reactions. J Clin Invest 1998;101:746 –754.
Sorensen TL, Tani M, Jensen J, et al. Expression of specific chemokines and chemokine receptors in the central nervous system
of multiple sclerosis patients. J Clin Invest 1999;103:807– 815.
Balashov KE, Rottman JB, Weiner HL, Hancock WW.
CCR5(⫹) and CXCR3(⫹) T cells are increased in multiple
sclerosis and their ligands MIP-1␣ and IP-10 are expressed in
demyelinating brain lesions. Proc Natl Acad Sci U S A 1999;
96:6873– 6878.
Stone LA, Frank JA, Albert PA, et al. The effect of interferon-␤
on blood-brain barrier disruptions demonstrated by contrastenhanced magnetic resonance imaging in relapsing-remitting
multiple sclerosis. Ann Neurol 1995;37:611– 619.
Vergelli M, Hemmer B, Utz U, et al. Differential activation of
human autoreactive T cell clones by altered peptide ligands derived from myelin basic protein peptide (87–99). Eur J Immunol 1996;26:2624 –2634.
Heid CA, Stevens J, Livak KJ, Williams PM. Real time quantitative PCR. Genome Res 1996;6:986 –994.
Alizadeh AA, Eisen MB, Davis RE, et al. Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature 2000;403:503–511.
Lennon G, Auffray C, Polymeropoulos M, Soares MB. The
I.M.A.G.E. Consortium: an integrated molecular analysis of genomes and their expression. Genomics 1996;33:151–152.
Gately MK, Renzetti LM, Magram J, et al. The interleukin-12/
interleukin-12-receptor system: role in normal and pathologic
immune responses. Annu Rev Immunol 1998;16:495–521.
Calabresi PA, Stone LA, Bash CN, et al. Interferon beta results
in immediate reduction of contrast-enhanced MRI lesions in
multiple sclerosis patients followed by weekly MRI. Neurology
1997;48:1446 –1448.
von Wussow P, Jakschies D, Hochkeppel HK, et al. The human
intracellular Mx-homologous protein is specifically induced by
type I interferons. Eur J Immunol 1990;20:2015–2019.
Panitch HS, Hirsch RL, Schindler J, Johnson, KP. Treatment
of multiple sclerosis with gamma interferon: exacerbations associated with activation of the immune system. Neurology 1987;
37:1097–1102.
Sharief MK, Hentges R. Association between tumor necrosis
factor-␣ and disease progression in patients with multiple sclerosis. N Engl J Med 1991;325:467– 472.
Ferber IA, Brocke S, Taylor-Edwards C, et al. Mice with a disrupted IFN-gamma gene are susceptible to the induction of experimental autoimmune encephalomyelitis (EAE). J Immunol
1996;156:5–7.
van Oosten BW, Barkhof F, Truyen L, et al. Increased MRI
activity and immune activation in two multiple sclerosis patients treated with the monoclonal anti-tumor necrosis factor
antibody cA2. Neurology 1996;47:1531–1534.
Willenborg DO, Fordham S, Bernard CC, et al. IFN-gamma
plays a critical down-regulatory role in the induction and effector phase of myelin oligodendrocyte glycoprotein-induced autoimmune encephalomyelitis. J Immunol 1996;157:3223–3227.
Selmaj KW, Raine CS. Tumor necrosis factor mediates myelin
and oligodendrocyte damage in vitro. Ann Neurol 1988;23:
339 –346.
Selmaj K, Raine CS, Cannella B, Brosnan CF. Identification of
40.
41.
42.
43.
44.
45.
46.
lymphotoxin and tumor necrosis factor in multiple sclerosis lesions. J Clin Invest 1991;87:949 –954.
The Lenercept Multiple Sclerosis Study Group and the University of British Columbia MS/MRI Analysis Group. TNF neutralization in MS: results of a placebo-controlled multicenter
study. Neurology 1999;53:457– 465.
Ruddle NH, Bergman CM, McGrath KM, et al. An antibody
to lymphotoxin and tumor necrosis factor prevents transfer of
experimental allergic encephalomyelitis. J Exp Med 1990;172:
1193–1200.
Frei K, Eugster HP, Bopst M, et al. Tumor necrosis factor ␣
and lymphotoxin ␣ are not required for induction of acute experimental autoimmune encephalomyelitis. J Exp Med 1997;
185:2177–2182.
Liu J, Marino MW, Wong G, et al. TNF is a potent antiinflammatory cytokine in autoimmune-mediated demyelination. Nat Med 1998;4:78 – 83.
Lafaille JJ, van de Keere F, Hsu AL, et al. Myelin basic proteinspecific T helper 2 (Th2) cells cause experimental autoimmune
encephalomyelitis in immunodeficient hosts rather than protect
them from disease. J Exp Med 1997;186:307–312.
Genain CP, Abel K, Belmar N, et al. Late complications of
immune deviation therapy in a nonhuman primate. Science
1996;274:2054 –2057.
Genain CP, Cannella B, Hauser SL, Raine CS. Identification of
47.
48.
49.
50.
51.
52.
53.
autoantibodies associated with myelin damage in multiple sclerosis. Nat Med 1999;5:170 –175.
Cannella B, Raine CS. The adhesion molecule and cytokine profile of multiple sclerosis lesions. Ann Neurol 1995;37:424 – 435.
Moalem G, Leibowitz-Amit R, Yoles E, et al. Autoimmune T
cells protect neurons from secondary degeneration after central
nervous system axotomy. Nat Med 1999;5:49 –55.
Kerschensteiner M, Gallmeier E, Behrens L, et al. Activated human T cells, B cells, and monocytes produce brain-derived neurotrophic factor in vitro and in inflammatory brain lesions: a
neuroprotective role of inflammation? J Exp Med 1999;189:
865– 870.
Neighbour PA, Miller AE, Bloom BR. Interferon responses of
leukocytes in multiple sclerosis. Neurology 1981;31:561–566.
Wandinger KP, Wessel K, Neustock P, et al. Diminished production of type I interferons and interleukin-2 in patients with
multiple sclerosis. J Neurol Sci 1997;149:87–93.
Soldan SS, Berti R, Salem N, et al. Association of human herpes virus 6 (HHV-6) with multiple sclerosis: Increased IgM response to HHV-6 early antigen and detection of serum HHV-6
DNA. Nat Med 1997;3:1394 –1397.
Wandinger KP, Jabs W, Siekhaus A, et al. Association between
clinical disease activity and Epstein-Barr virus reactivation in
MS. Neurology 2000;55:178 –184.
Wandinger et al: Interferon-␤ in MS
357
Документ
Категория
Без категории
Просмотров
1
Размер файла
753 Кб
Теги
market, effect, complex, associates, helpex, include, immunomodulator, genes, upregulation, sclerosis, multiple, interferon
1/--страниц
Пожаловаться на содержимое документа