close

Вход

Забыли?

вход по аккаунту

?

Deficient expression in multiple sclerosis of the inhibitory transcription factor SP3 in mononuclear blood cells.

код для вставкиСкачать
BRIEF COMMUNICATIONS
Deficient Expression
in Multiple klerosis
of the Inhibitory
Transcription Factor Sp3
in Mononuclear
Blood Cells
Maria C. Grekova, MD, PhD,* Eve D. Robinson, BS,*
Marc A. Faerber, BS,* Paul Katz, MD,t
Henry F. McFarland, MD,$ and John R. Richert, MD*
To evaluate differential gene expression in multiple sclerosis (MS) patients and control subjects, we used differential display to screen for messenger RNAS that are differentially expressed in peripheral blood mononuclear cells
from monozygotic twins who are discordant for MS. We
identified a 232-bp complementary DNA fragment, present only in material from the normal twin, that exhibited
100% identity with the inhibitory transcription factor
Sp3. Oligonucleotide primers correspondingto Sp3 messenger RNA sequences amplified complementary DNA of
appropriate size from 83% of control subjects but from
only 21% of MS patients ( p < 0.001). These results suggest that Sp3 gene transcription is suppressed in peripheral blood mononuclear cells from most MS patients and
that other genes whose expression is normally suppressed
by Sp3 in immune cells may consequently be overexpressed.
Grekova MC, Robinson ED, Faerber MA, Katz P,
McFarland HF, Richert JR. Deficient expression in
multiple sclerosis of the inhibitory transcription
factor Sp3 in mononuclear blood cells.
Ann Neurol 1996;40:108-112
Multiple sclerosis (MS) is a putative autoimmune disease of the central nervous system. Both genetic and
environmental factors (e.g., infectious agents) may influence susceptibility to the disease [ l , 21. MS patients
demonstrate elevated immune responses to a variety of
antigens of infectious and host origin [ 3 ] ,suggesting
an alteration in the control mechanisms involved in
immune responsiveness.
Little is known about the mechanisms that control
the level of immune responsiveness. Complex interac-
From the Departments of 'Neurology and ?Medicine, Georgetown
University Medical Cenrer, Washington, DC, and the $Neuroimmunology Branch, National Institute of Neurological Diseases and
Stroke, Bethesda, MD.
Received Ju1 13, 1995, and in revised form Nov 21, 1795, and Jan
8, 1936. Accepted for publication Jan 25, 1336.
Address correspondence to Dr Richert, Department of Neurology,
Georgetown University Medical Center, 3800 Reservoir Road NW,
Washington, DC 20007.
108
tions exist between antigen-presenting cells, T cells,
and B cells. Potential alterations that could influence
immune reactivity may, for example, include human
leukocyte antigen (HLA) molecules, transporter molecules at the level of the endoplasmic reticulum or Golgi
apparatus, cytokines, various receptor molecules, adhesion molecules, or the variety of transcription factors
that control the expression of any of these proteins.
Systematically evaluating, in MS patients and control
subjects, the hundreds of candidate proteins whose alterations in expression could potentially underlie the
pathogenesis of MS presents a virtually insurmountable
task.
Alternatively, procedures exist for screening different
populations of cells for genes that are differentially expressed by the cell populations. The advantage of these
approaches is that one may detect genes that are differentially activated or suppressed without bias or preconception as to what these genes might be. Subtractive
hybridization has been used in this regard for a number
of years but is cumbersome and frequently generates
false-positive results. Differential display [4, 51 is a recently described polymerase chain reaction (PCR)based method that provides a number of advantages
over subtractive hybridization in evaluating differential
gene expression among similar but different populations of cells.
Differential display involves the use of a panel of
forward and reverse primers that, in combination, has
the potential for amplifying a large percentage of the
expressed genes in any cell population. The reverse
(antisense) primers were initially described as 12 oligonucleotides consisting of oligodeoxythymidine (oligo
[dT]) (to bind to the poly[A] tail of messenger RNA
[mRNA]) plus two additional bases (to provide specificity (Table 1). This combination of primers has the
potential to bind all mRNA species in the cell at the 3'
end of the molecule. These primers were subsequently
modified [5] so that only four oligonucleotides were
necessary, designated as T,,MN, consisting of the T11
tail as before, M representing a degenerate penultimate
base (consisting of a mix of deoxyadenine [dA],deoxycytidine [dC], and deoxyguanidine [dG]), and N consisting of any one of the four deoxynucleotides, thus
significantly streamlining the procedure.
After reverse transcription using the four reverse
primers, PCR is performed using the same reverse
primers and forward (sense) primers consisting of a
panel of 20 random 10-mers. When used under relatively nonstringent conditions, nearly every mRNA in
the cell should theoretically be bound by at least one
of these forward primers somewhere along its length.
PCRs are performed in 80 different tubes, each containing one of the 20 forward primers and one of the
four reverse primers. Thus, with these combinations of
primers, nearly all mRNAs in each cell population
Copyright 0 1996 by the American Neurological Association
systems). Ten units of human placental ribonuclease inhibitor and 200 units of Superscript reverse transcriptase (RT)
(Gibco-BRL) were added after 10 minutes of preincubation
at 37°C; then incubation was continued for another 50 minutes in a final volume of 20 pl. RT was then inactivated by
heating to 95°C for 5 minutes followed by chilling on ice.
PCR amplification was carried out in a 10-pl total volume
containing 1 pl of cDNA (approximately the amount reverse
transcribed from 0.01 pg of total RNA), 200 pM forward
primer, 1 pM reverse primer TIIMA,2 pM dNTPs, 1 unit
of Taq polymerase (Perkin Elmer), and 3.1 pCi 35S-deoxyadenosine triphosphate (dATP) in Taq polymerase buffer.
We chose our panel of 10-mer forward primers by picking
sequences out of a hat. The cycling parameters were as follows: 94°C for 30 seconds, 40°C for 2 minutes, and 72°C
for 30 seconds for 40 cycles, and an additional extension
period at 72°C for 5 minutes.
Table 1. Reverse Primers Used in Differential Display
5'
3'
TTTTTTTTTTTAA
TTTTTTTTTTTAC
TTTTTTTTTTTAG
TTTTTTTTTTTAT
TTTTTTTTTTTCA
TTTTTTTTTTTCC
TTTTTTTTTTTCG
TTTTTTTTTTTCT
TTTTTTTTTTTGA
TTTTTTTTTTTGC
TTTTTTTTTTTGG
TTTTTTTTTTTGT
should be detectable. W h e n differential display is performed comparing two populations of cells, the PCR
products generated with a given primer pair from each
of the two cell populations are examined side by side
in adjacent lanes o n the gel, with multiple bands (each
representing a given complementary DNA [cDNA])
displayed in each lane. As most of the expressed genes
will be identical in each cell population, the banding
pattern for each of these cDNAs will be the same in
the two lanes. However, genes that are expressed in
only one of the two cell populations will be detected
by a band that is present in only one of the two lanes.
Such a band can be cut from the gel, reamplified in
the PCR, sequenced, and identified.
To investigate the mechanisms that lead to the altered immune state in MS, we used differential display
to identify differentially expressed mRNAs in peripheral blood mononuclear cells (PBMCs) obtained from
MS patients and control subjects. To limit the number
of extraneous mRNAs identified by this procedure, we
studied, in our initial screening, monozygotic twins
discordant for MS [6]. cDNAs generated from mRNAs
differentially expressed in the twins were sequenced
and internal primers were used to screen PBMCs from
panels of MS patients and control subjects. W e report
that message specific for the inhibitory transcription
factor Sp3 is detected in most normal subjects and in
patients with rheumatoid arthritis (RA) but not in
PBMCs from most MS patients.
Materials and Methods
Differential Display
Total RNA from 2 X lo7 PBMCs from each twin in one
twin pair was isolated by overnight centrifugation at 113,000
g through a cesium chloride (CsC1) cushion. Contaminating
chromosomal DNA was removed with DNase I (GibcoBRL) in the presence of human placental ribonuclease inhibitor (Promega). Reverse transcription was performed with 1
p M T,,MA (M = mix of dA, dC, and dG) in first-strand
buffer (Gibco-BRL) with 0.2 pg of total RNA, 200 mM
dithiothreitol (DTT), and 20 p M dNTPs [5] (Applied Bio-
Preparation of Complementary DNA f o r Sequencing
The cDNAs amplified in the initial PCR were separated on
a 6% DNA sequencing gel that was subsequently dried without methanoUacetic acid fixation, and autoradiography was
performed overnight. The band of interest was cut from the
dried gel. The gel slice and paper backing were incubated in
Eppendorf tubes in 100 p1 of dHzO for 10 minutes to rehydrate the gel; then the cDNA was allowed to diffuse out by
boiling the gel slice for 15 minutes. The cDNA was precipitated with ethanol in the presence of 0.3 M NaOAc, with
5 pI of glycogen (10 mg/ml) as carrier. The cDNA fragment
was then reamplified with the same primers and the PCR
product run on a 2.0% agarose gel stained with ethidium
bromide. The band of interest was extracted from the gel
with GeneClean and cloned into the pT7Blue vector (Novagen). Plasmid DNA was isolated (QIAgen plasmid prep kit)
and sequenced [7, 81.
AmpLiJcation of Sp3-SpeciJc Sequences
Primers used for amplification are as follows: for fragment
22 16-2405: forward primer 5' TTGGTTATACATGACA
CTG 3', reverse primer 5' CCACACAGGATTGATGCA 3';
for fragment 2057-2405: forward primer 5' CAGCTTGTC
ACAGTTTCTGG 3', reverse primer 5' CCACACAGGAT
TGATGCA 3'; and for fragment 237-701: forward primer
5' GTGCAGTGTCCAGTGTTCAA 3', reverse primer 5'
GAGAAACCCGCTCACCAGT 3'. These sequences were
derived from previously published data on Sp3 [9, lo]. Total
RNA was isolated from PBMCs using RNAzol B and DNase
I and cDNA was generated with RT and an oligo d(T),,
primer. PCR was performed with the three primer sets and 1
unit of deep vent polymerase (BioLabs) under the following
conditions: 94°C for 1 minute, then 30 cycles of 94°C for
20 seconds, 55°C for 1 minute, and 72°C for 30 seconds,
with a final elongation step at 72°C for 4 minutes. In parallel
reactions, as negative control samples, cDNA was substituted
with water or 0.2 pg of RNA from the same subject. Amplification products were analyzed on 1.5% agarose gels.
All studies were performed in a blinded manner on coded
samples. Informed consent was obtained from all subjects
under protocols approved by the Georgetown University and
Brief Communication: Grekova et al: Sp3 Deficiency in MS
109
1
2
3
4
5
6
7
8
Fig 1. Aniplijcation of Sp3 transcripts in a monozygotic twin
pair discordant for MS. Three pairs of primers were designed
to generate Sp3 cDNA fragments of 464, 348, and 189 bp
(see text). Lanes 2-4 = normal twin; lanes 5-7 = MS
twin. Lanes I and 8 = 123-bp ladder; lanes 2 and 5 =
4M-bp primers; lanes 3 and 6 = 348-bp primers; lanes 4
and 7 = 189-bp primers.
National Institute of Neurological Disorders and Stroke institutional review boards.
Results
Dzferential Display with Peripheral Blood
Mononuclear Cells fiom Twins Discordant f o r MS
PCR using the reverse primer T,,MA [5] and forward
primer 5' CGCGTTATAC 3' amplified a band that
was detected only in PBMC cDNA generated from
the normal twin. This band was eluted from the gel,
reamplified with the same primers, and sequenced.
This revealed a 232-bp cDNA fragment demonstrating
100% identity with fragment 2217-2448 of mRNA
encoding the human transcription factor Sp3 [9] (also
referred to as Sp2R [lo]). Three pairs of internal primers were prepared, corresponding to fragments 22 162405 (189 bp), 2057-2405 (348 bp), and 237-701
(464 bp) of Sp3 mRNA. These were used in PCRs
with PBMC cDNA from each of the twins. Bands of
amplified cDNA were detected only from the healthy
twin (Fig 1). This demonstrated that no Sp3 mRNA,
corresponding to any part of the transcript studied,
could be detected in PBMCs from the MS twin. Furthermore, this demonstrated that the initial observation
(i.e, lack of expression in the MS twin) could not be
explained by partial splicing and that the initial amplified material in the normal twin did not represent partial sequence identity in a non-Sp3 cDNA.
110
Annals of Neurology Vol 40
No 1 July 1996
1
2
3
4
5
6
7
8
Fig 2. Representative samples from Sp3-negative subjects.
cDNA prepared from peripheral blood mononuclear cells was
amplijied from each of 3 Sp3-negative subjects. Lanes I and
8 = 123-bp ladders; lanes 3, 5, and 7 = products amplijed
with P-actin-speciJic primers; lanes 2, 4, and 6 = amplij5cation reactiori with Sp3-peciJic primers.
Amplifcation of Sp3-Specij5c Sequences in MS
Patients and Control Subjects
The three primer pairs were used to amplify cDNA
generated from 28 MS patients and 35 control subjects. The latter consisted of 7 patients with RA, 1 with
systemic lupus erythematosus (SLE), 1 with amyotrophic lateral sclerosis (AIS), 1 bone marrow transplant
recipient with graft-versus-host disease (GVHD), and
25 healthy subjects. Twenty-nine (83Yo) of the control
subjects, including the patients with SLE and ALS, as
well as 6 of the 7 patients with RA, exhibited the
bands, whereas the bands were amplified from only 6
(21%) of the MS patients ( p < 0.001). PCR products
were successfully amplified from the Sp3-negative
cDNAs with primers specific for p-actin (Fig 2) and
for other gene products identified in the differential
display reaction (data not shown) from all subjects. Of
the 6 control subjects from whom a band could not
be amplified, one was a DR2-positive cousin of an MS
patient, 1 had RA, and 1 had GVHD.
To determine if these findings merely reflected a
quantitative difference in Sp3 mRNA present in MS
versus control PBMCs, we used graded increments in
the amount of cDNA added to the PCR. Although the
amount of cDNA used was increased to 3 pl (approximately the quantity reverse transcribed from 0.03 pg
of RNA), which produced a smear on the gels and
Discussion
Table 2. Clinical Status of Sp3-Negative Subjects at the
Time of Collection of Peripheral Blood Mononuclear Cell
Samplef
Exacerbation
of MS
MS in
Chronic
Progressive MS
Control
Remission
9/11 (82%)
719 (78%)
618 (75%)
6/35 (17%)
Subjects
'The dam represent the proportion of subjects in each clinical category from whom Sp3-specific cDNA could not be amplified.
therefore prohibited further increments in cDNA concentration, no bands were amplified from the Sp3negative subjects (data not shown).
The Sp3-specific primers did amplie bands of appropriate size from chromosomal DNA obtained from
the MS patients (data not shown). This demonstrated
that these patients did indeed inherit the gene for Sp3
but that it was not being expressed. This corroborates
the conclusion reached as a result of the differential
expression of Sp3 in the identical twin pair, that is,
that the gene must have been inherited by both twins.
No amplified bands were detected when RNA samples
(after DNase I treatment) were placed in the PCR with
deep vent polymerase and the primer sets without prior
reverse transcription. Thus, it is unlikely that chromosomal DNA containing Sp3 sequences was contaminating the RNA preparations used for RT-PCR.
Clinical Correlations
The MS and non-MS groups were closely matched in
age, with mean ages of 39.4 and 37.5 years, respectively. Females made up 62% of the MS population
and 74% of the control population. There were no
clear-cut clinical features (e.g., course or duration of
disease, steroid responsiveness vs resistance, ethnic
background) that distinguished the 6 MS patients who
expressed Sp3 from the 22 who did not. The absence
of Sp3 expression in the MS population did not appear
to be due to the effects of steroids or other immunosuppressive medications. Only 1 MS patient was receiving immunosuppressive therapy (cyclophosphamide) at
the time of phlebotomy and 1 had received a course
of cyclophosphamide 5 years prior to phlebotomy.
Both of these patients lacked Sp3 expression. Twentyfive of the 28 MS patients had previously been treated
with steroids at least once during their illness. These
included 5 of the 6 SP3-positive patients and 20 of
the 22 SP3-negative patients. Six of the 7 Sp3-positive
patients with RA or SLE were receiving steroids and 3
were receiving methotrexate. None of the normal control subjects had received immunosuppressive medication. Thus, immunosuppressive treatment did not account for the loss of Sp3 expression. Data on the
patients' clinical state and Sp3 status a t the time of
sample collection are shown in Table 2.
We used differential display to identify genes that are
differentially expressed in identical twins who are discordant for MS. A total of 20 mRNAs that were expressed in one twin but not the other were detected
in our preliminary studies. Some of these were expressed only in the MS twin, some only in the healthy
twin. The differentially expressed gene reported here
coded for Sp3, a negative regulator of gene expression.
We report the absence of detectable Sp3 transcripts
in PBMCs from most MS patients studied. This is not
associated with inflammatory disease in general, as 7
of the 8 patients with RA or SLE expressed detectable
transcripts.
Sp3 has been shown to exert a repressor influence
on gene transcription [11, 121. To date, it has been
shown to bind to regulatory elements associated with a
subset of T-cell receptor V a gene segments [9], human
immunodeficiency virus long terminal repeats [ I l l ,
and c-myc [12]. The full range of genes influenced by
Sp3 is not yet known.
The deficient expression of this inhibitory transcription factor in immune cells from a majority of MS
patients has the potential for causing immune cell
function to be released from some of its normal constraints. This, in turn, has the potential for explaining
the tendency for MS patients to be hyperresponders to
a variety of antigenic stimuli and may potentially underlie the putative autoimmune process in the disease.
Although we have not yet determined if there is restriction of Sp3 expression to certain subpopulations of
PBMCs, other studies showed it to be ubiquitously expressed in a variety of tissues, including transformed
T-cell and B-cell lines [9, 101.
It is uncertain why the lack of Sp3 expression was
not found in 100% of MS patients and why its presence was not detected in 100% of normal subjects and
other control subjects. It is likely that MS is a heterogeneous disease. For example, it is known that different
patterns of HLA expression are seen in patients with
relapsing-remitting versus primary chronic progressive
disease [13]. Thus, the finding of heterogeneity of Sp3
expression in the MS population is not surprising.
As it is clear that the mode of inheritance of MS
susceptibility is not mendelian and is almost certainly
polygenic [14], one would expect to find individuals
who inherit or express one or more of these traits without developing the disease. Lack of Sp3 expression may
represent only one of several traits necessary in order
for MS to manifest in most people. Thus, we would
expect to find some individuals lacking Sp3 expression
without developing the disease. The full significance of
this finding awaits further study of the targets of Sp3
function and the cause of defective Sp3 expression in
these patients.
Brief Communication: Grekova et al: Sp3 Deficiency in MS
111
This work was supported by National Multiple Sclerosis Society
pilot grant PP0305, National Institutes of Health grant
R01 AI26675, and the Straus, Smith, Wadsworth, Anderson, Blaisdell, and Rosen Funds.
We thank P. Liang, D. Singer, W. Biddison, K. Becker, P. Drew,
and M. Cohn for helpful discussions and R. Cahill for supplying
peripheral blood mononuclear cells from the patient with graftversus-host disease.
References
1. McFarlin DE, McFarland HF. Multiple sclerosis. N Engl J
Med 1982;307:1183-1188, 1246-1251
2. Kurtzke JF. Evidence for multiple sclerosis as an infection. Clin
Microbiol Rev 1993;6:382-427
3. Allen I, Brankin B. Pathogenesis of multiple sclerosis-the immune diathesis and the role of viruses. Neuropathol Exp Neurol 1993;52:95-105
4. Liang P, Pardee AB. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science
1992;257:967-97 1
5. Liang P, Averboukh L, Pardee AB. Distribution and cloning
of eukaryotic mRNAs by means of differential display: refinements and optimization. Nucleic Acids Res 1993;2 1:32693275
6. McFarland HF, Greensrein J , McFarlin DE, er al. Family and
twin studies in multiple sclerosis. Ann NY Acad Sci 1985;436:
118-124
7. Sanger F, Nicklen S, Coulson AR. DNA sequencing with
chain-terminating inhibitors. Proc Natl Acad Sci USA 1977;
74:5463-5467
8. Tabor S, Richardson CC. DNA sequence analysis with a inodified bacteriophage T 7 DNA polymerase. Proc Natl Acad Sci
USA 1987;84:4767-4771
9. Kingsley C, Winoto A. Cloning of G T box-binding proteins:
a novel Spl multigene family regulating T cell receptor gene
expresaion. Mol Cell Biol 1992;12:4251-4261
10. Hagen G, Muller S, Beato M , Suske G. Cloning by recognition
site screening of two novel Gr box binding proteins: a family
of Spl related genes. Nucleic Acids Res 1992;20:5519-5525
11. Majello B, DeLuca P, Hagen G, et al. Different members of
the Spl multigene family exert opposite transcriptional regulation of che long terminal repeat of HIV-1. Nucleic Acids Res
1994;22:4914-4921
12. Majello B, De Luca P, Suske G, Lania L. Differential transcriptional regulation of c-myc promoter through the same DNA
binding sites targeted by Spl-like proteins. Oncogene 1995;
10:1841-1 848
13. Olerup 0,
I-lillert J, Fredrikson S, et al. Primarily chronic progressive and reiapsinglremitring multiple sclerosis: two immunogenetically distinct disease entities. Proc Natl Acad Sci USA
1989;86:7113-7117
14. Ebers GC, Sadovnick AD. The role of genetic factors in multiple sclerosis susceptibility. J Neuroimmunol 1994;54: 1-17
Motor Neuron Disease:
A Paraneoplastic Process
Associated with Anti-Hu
Antibody and Small-Cell
Lung Carcinoma
Ashok Verma, MD,* Joseph R. Berger, MD,? Susan
Snodgrass, MD,$ and Carol Petito, MDS
~
~
Although isolated lower motor neuron disease has been
reported as a paraneoplastic complication, it has not been
previously described in association with anti-Hu antibody. We report a 51-year-old man in whom weakness
heralded the presence of a small-cell cancer of the lung.
His neurological disorder was characterized by an unremitting progression of limb, neck, and chest wall weakness and wasting that commenced and remained predominant in the upper limbs. Electrophysiological studies
demonstrated widespread denervation and examination
of a muscle biopsy specimen showed evidence of acute
and chronic denervation. High titers of anti-Hu antibody
were detected in the serum and cerebrospinal fluid. Neither objective measures of strength nor titers of anti-Hu
antibody responded to corticosteroids, cyclophosphamide, intravenous immunoglobulins, or plasmapheresis.
Death from the complications of motor neuron disease
ensued 23 months after the onset of weakness. Autopsy
revealed tumor in the lung and on pleural and peritoneal
surfaces. There was a loss of anterior horn cells in the
spinal cord. Despite the absence of symptomatic cerebellar disease, a decrease in the number of Purkinje cells
was also detected.
Verma A, Berger JR, Snodgrass S , Petito C. Motor
neuron disease: a paraneoplastic process associated
with anti-Hu antibody and small-cell lung
carcinoma. Ann Neurol 1996;40:112- 1 16
Paraneoplastic processes may affect the lower motor
neuron. In 1944, Wechsler and colleagues [ 11 reported
patients with motor neuron disease believed to be due
to an identifiable cause. They referred to this illness as
“symptomatic” (in contradistinction to “primary” or
idiopathic) motor neuron disease and described it in
association with pancreatic carcinoma in 1 patient [ 11.
In pathological studies, Brain and Henson [2, 31 deFrom the Departments of Neurology at the *University of Miami
School of Medicine, Miami, FL; tuniversity of Kentucky College
of Medicine, Lexington, KY; and $University Hospitals, Cleveland,
O H ; and rhe SDepartmenr of Pathology, University of Miami, FL.
Address correspondence to D r Berger, Department of Neurology,
University of Kentucky College of Medicine, Lexington, KY 405360226.
112 Copyright 0 1996 by the American Neurological Association
Документ
Категория
Без категории
Просмотров
2
Размер файла
546 Кб
Теги
expressions, factors, inhibitors, deficiency, transcription, sp3, sclerosis, multiple, mononuclear, blood, cells
1/--страниц
Пожаловаться на содержимое документа