close

Вход

Забыли?

вход по аккаунту

?

Detection of Epstein-Barr virus in the brain by the polymerase chain reaction.

код для вставкиСкачать
Detection of Eostein-Barr Virus in
the Brain by the Polymerase Chain Reaction
Louise Pedneault, MD,§ Ben Z . Katz, MD,* and George Miller, MDVS
Epstein-Barr virus (EBV) has been implicated in a variety of central nervous system syndromes. In a few well-studied
patients, EBV has been detected by viral isolation or EBV D N A has been found by Southern hybridization analysis.
Using polymerase chain reaction, we evaluated brain biopsy specimens from 24 patients for the presence of EBV
genomes. EBV D N A was found in brain specimens from 18 patients in whom presence of the virus in the brain was
suspected clinically or on the basis of serological tests. Six patients had acquired immunodeficiency syndrome; 2 were
kidney transplant recipients. Brain specimens from 4 patients with encephalitis due to other herpes group viruses and
from a patient with metabolic encephalopathy were negative for EBV D N A as determined by polymerase chain
reaction. The findings indicate a need to evaluate the role of EBV in diverse neurological syndxomes, especially those
occurring in immunodeficient hosts.
Pedneault L, Katt BZ, Miller G. Detection of Epstein-Barr virus in the brain
by the polymerase chain reaction. Ann Neurol 1992;32:184-192
A variety of neurological syndromes can occur in association with primary Epstein-Barr virus (EBV) infection clinically manifested as infectious mononucleosis
El, 2). The central nervous system (CNS) syndromes
include diffuse or focal encephalitis [3-61, aseptic
meningitis, Guillain-BarrC syndrome, Bell’s palsy,
acute cerebellar ataxia, transverse myelitis, and peripheral neuropathy [7). Although such cases are rare [S),
encephalitis represents a serious and potentially fatal
complication of infectious mononucleosis. EBV has
also been implicated in CNS lymphomas, especially
in immunosuppressed patients who experience either
primary or reactivated EBV infection 19, 10). Rarely,
EBV DNA has been detected in CNS lymphomas that
occur in immunologically normal hosts [ll). The role
of EBV in demyelinating disease or subacute or
chronic meningoencephalitis such as Rasmussen’s encephalitis has been suspected but not yet investigated
in a systematic manner [12-16).
The diagnosis of EBV infection of the CNS is often
entertained but difficult to prove. When CNS signs are
the only or the predominant manifestation of primary
EBV infection, the classic hallmarks of acute infectious
mononucleosis, such as atypical lymphocytosis and heterophile antibody responses, are often absent [l, 2).
Laboratory confirmation of the role of EBV in CNS
disease has in some instances relied on serology to
EBV capsid (VCA), early (EA), or nuclear (EBNA)
From the Departments of ‘Epidemiology and Public Health, tPediatrics, and $Molecular Biophysics and Biochemistry, Yale University
School of Medicine, New Haven, CT.
§Current address: Departement de Microbiologie, Facult6 de Medicine, Universite de Montreal, HBpital Sainte-Justine, 3 175 Chemin
Cote Sainte Catherine, Montreal, Quebec, Canada.
antigens. While this method can indicate primary or
reactivated infection, by itself it is inadequate to document the role of the virus. EBV antibodies have been
detected in cerebrospinal fluid [17), but they could
have been transferred from the. blood. Rarely, EBVcontaining cell lines have been derived from cerebrospinal fluid lymphocytes or EBNA-positive cells have
been detected in the spinal fluid of patients with encephalitis [18, 191, but virus or viral genome detection
techniques are the most reliable methods to establish
an association with CNS disease.
EBV DNA is usually identified in brain samples by
Southern blotting or by in situ hybridization [ll]. Recently the polymerase chain reaction (PCR) has been
used to amplify and detect EB’V D N A in blood and
biopsy specimens from various tissues, especially those
from immunocompromised patients [20-241. In this
study we used PCR to examine brain biopsy specimens
submitted to us because of a clinical suspicion that
EBV was associated with a CNS syndrome. All samples
were also evaluated by Southern blotting, and the results of the two assays were compared.
Materials and Methods
Patient Samples
Brain samples from 24 patients were evaluated. The patients
could be grouped into six clinical syndromes at the time of
biopsy: encephalitis (lo), lymphoma ( 5 ) , fatal disseminated
Received Oct 28, 1991, and in revised form Jan 27, 1992. Accepted
for publication Feb 9, 1992.
Address correspondence to Dr Miller, Yale University School of
Medicine, Department of Pediatrics, 33.1 Cedar Street, New Haven,
CT 06510.
184 Copyright 0 1992 by the American Neurological Association
Table 1 . Clinical Features of Patients and Results of Southern Blotting of Unamplijied
and Amplzj5ed Products of Brain Specimens, afer Hybridization
Polymerase Chain
Reaction
Patient No.
Sex, Age
at Diagnosis
Associated Disease
(Underlying Disease)
Encephalitis
1
F, 3.5 yr
Disseminated hemorrhagic
chickenpox, streptococcal sepsis and abscess
None
None
None
None
JRA, chronic interstitial
pneumonitis
Clinical suspicion of CNS
toxoplasmosis (AIDS)
Acute IM
Acute IM
Suspected acute IM
M, 52 yr
M, 0.5 mo
M, 57 yr
M, 76 yr
F, l 8 m o
7
M, 31 yr
8
M, 17 yr
M, 7 yr
F, 8 yr
9
10
CNS lymphoma
11
12"
13
14
15
M, 63 yr
F, 61 yr
M, 28 yr
M, 46 yr
F, 22 yr
Fatal disseminated lymphoproliferation
16
F, 24 y r
17
F, 16 yr
Progressive multifocal leukoencephalopathy
18
M, 58 yr
19
M, 57 yr
Multiple sclerosis
20
F, 16 yr
21
F, 6 yr
Encephalopathy
22
23
24
M, 26 yr
F, 8 mo
M, 0.3 mo
None
None
(Kidney transplant)
MA1 in lung, (AIDS)
(Lymphomatoid granulomatosis)
Southern
Blotting
BMLFl
-
-
HSV
HSV
HSV
HSV
+
+
+
+
+
+
+
+
+
+
+
+
+
(Kidney transplant)
(AIDS)
+
+
PCP, (AIDS)
Disseminated Staphyloroccus aureus sepsis, DIC,
LIP, (AIDS)
Methylmalonic acidemia
Viral
Culture
-
None
None
None
Recurrent aseptic meningitis, LIP, acute bronchopneumonia, (AIDS)
BRLFl
-
ND
-
ND
ND
ND
ND
ND
ND
ND
ND
ND
ND
_.
IUD
_.
+
ND
+
+
ND
-
_-
--
"Clinical and radiological diagnoses of CNS lymphoma, not proven histopathologically.
ND = not done; HSV = herpes simplex virus; JRA = juvenile rheumatoid arthritis; CNS = central nervous system; AIDS = acquired
immunodeficiency syndrome; IM = infectious mononucleosis; MA1 = Mycobacterium avium-intraceluIare; LIP = lymphocytic interstitial
pneumonitis; PCP = Pneumorystis carinzi pneumonia; DIC = disseminated intravascular coagulopathy.
lymphoproliferation (2), progressive multifocal leukoencephalopathy (2), multiple sclerosis (2), and encephalopathy (3)
(Table 1).
The biopsy samples were received between 1971 and 1988
and were stored frozen at -20°C. Specimens from 14 patients (Patients 6, 8-17, 19, 21, and 22) were sent for EBV
genome analysis by Southern blotting. Three of the 5 patients
with CNS lymphoma were positive for EBV DNA by this
assay. Of 6 samples sent for viral culture (Patients 1-5 and
24), 4 were positive for herpes simplex virus. Four others
from patients with puzzling CNS findings (Patients 7 , 18,20,
and 23) Were examined both by viral culture and EBV genome analysis; none grew a Viral Pathogen in tissue culture
nor did they have any evidence of EBV DNA by Southern
analysis.
Control Samples
In all PCR experiments, positive and negative control samples were included for the specificity of the primers and
probes. Negative control samples consisted of 1 p,g of DNA
from three cell lines that lack EBV D N A (two were Bcell lines, BJAB and BL30, and one was a T-cell line, H-9
Pedneault et al: EBV in the Brain
185
Table 2. Sequences of OligonucleotidePrimer Pairs and Probes and Their Locations in the EBV Genome
Primer or Probe
Sequences (5'-3')
Primer 1182
Primer 1181
Probe 1100
Primer 1778
Primer 1779
Probe 1780
CACCACCITGTITTG ACGGG
GTCAACCAACAAGGACACAT
CCGCGGGAGCTAGGGGCAGG
GTCAAAAATAGACAGCCCAG
GTGCCCCAGCCACTTGACCC
AG A AATGTATCCAAG ATITC
Length (bp)
of Amplified Product
304
345
Location in EBV"
BMLFl 3501-3520
BMLF1 3804-3785
BMLFl 3659-3678
BRLFl 1435-1454
BRLFl 1779-1760
BRLFl 1493-1512
'EBV B95-8 strain [35'J.
1251); further negative control samples were the plasmid
pBR322 and the total PCR mixture without added DNA.
Positive control samples were cellular DNA from two
EBV-containing cell lines, Raji and B95-8 E26, 271,
pBR322:BamHI M and pBR322:BamHI 2,which encompass the regions of the EBV genome amplified by the two
primer pairs used, and 1 pg of cellular DNA extracted from
the brain samples of Patients 13 and 15 as well as a nasopharyngeal biopsy and a lymph node of 2 patients with nonHodgkin's lymphoma (Patients A and B) who were known
to contain EBV DNA as demonstrated by standard Southern
analysis. In addition, the PCR primers and probe were nonreactive with uninfected VERO cells and human foreskin cells,
as well as VERO cells infected with herpes simplex virus
types 1 and 2 (American Type Culture Collection [ATCC]
strains VR-539 and VR-540) and foreskin cells infected with
cytomegalovirus (ATCC strains AD-169 and Towne) and
varicella-zoster virus (ATCC strain Ellen).
Southern Blotting Analysis
DNA was extracted and Southern analysis was performed
using techniques already described 1281. Briefly, 1 to 15 pg
of total cellular DNA was digested with the restriction enzyme BamHI and electrophoresed on a 0.6% agarose gel.
The DNA was transferred to nitrocellulose and then probed
with one of four different EBV D N A fragments: EcoRI B,
EcoRI C, BamHI K, or BamHI W, all from strain FF41
of EBV 1291. The probes were radiolabeled with 32Pdeoxycytidine triphosphate (dCTP) by nick translation.
Polymerase Chain Reaction
PCR was performed using primers from the BMLFl and the
BRLFl regions of the EBV genome (Table 2). All oligonucleotides were synthesized on an automated 380A D N A synthesizer (Applied Biosystems, Foster City, CA) using the
phosphoramidite method. Three twentymers were chosen
from the BMLFl region of the genome and three others
from the BRLFl region. Each encodes for an early antigen
of the virus [30, 311. There is evidence that BMLFl is highly
conserved among different EBV types (H. Jenson, unpublished data, 1990). Two oligonucleotides of each set were
used as primers, allowing amplification of a predicted 304-bp
sequence of EBV D N A in the BMLFl region, and of a 345bp fragment in the BRLFl region. The amplified products
were detected by probing with the third oligonucleotide of
each set, which was end-labeled with g a m ~ n a - ~ ~ P - A(AmTP
ersham, Arlington Heights, IL) by means of T 4 polynucleo-
186 Annals of Neurology Vol 32 N o 2 August 1992
tide kinase (Boehringer Mannheim Biochemicals, Indianapolis, IN).
PCR amplification of each sample was performed by using
Thermus aquaticus (Taq) heat-stable DNA polymerase in a
total volume of 100 ~ 1 according
,
to a modification of the
procedure described by Saiki and coauthors 132). In order
to increase the sensitivity of the assay, the magnesium and
primer concentrations of the reaction mixture were optimized, such that the final reaction mixture consisted of: 50
mM potassium chloride, 10 mM Tris chloride (pH 8.3), 1.5
mM magnesium chloride, 0.1% gelatin, 0.5 FM each primer
(1182 and 1181 for BMLI1, 1778 and 1779 for BRLFl
[see Table 2]), 200 p M each deoxynucleotide triphosphate
(dATP, dCTP, deoxyguanosine triphosphate, and deoxythymidine triphosphate), and 0.2 to 1.0 kgof the DNA template.
In general, 1.0 pg of D N A from the negative and positive
control samples and 500 ng of DNA from the brain biopsy
samples, corresponding to 1 to 2 x lo5cells, were used. The
reaction mixture was then heated to 60°C for 10 minutes, 0.5
pl (2.5 units) of Taq polymerase (US Biochemicals, Cleveland, OH) was added, and the mixture was overlaid with 100
pl of mineral oil. Amplification was carried out in a DNA
thermal cycler (Ericomp, San Diego, CA) for 35 cycles. The
same protocol was used for both primer pairs except for the
annealing and washing temperatures, which were optimized
for each set of primers. Samples were first heated to 94°C
for 1 minute to denature the DNA, cooled to 55°C (BMLFl)
or 45°C (BRLF1) for 2 minutes to allow the primers and the
DNA template to reanneal, and then heated to 74°C for 3
minutes for primer extension. After the last cycle, the s a m ples were incubated at 74°C for an additional 10 minutes to
ensure completion of the final extension step.
Detection of the Amplijied Product
One fifth of the PCR reaction mixture containing the amplified products was electrophoresed on a 5% polyacrylamide
gel, stained with ethidium bromide, denatured, and transferred onto a nylon filter membrane (Schleicher and Schuell,
Keene, NH). The filter was baked at 80°C for 2 hours and
prehybridized in 6 x SSC (0.9 M sodium chloride, 90 mM
sodium citrate [pH 6.35]), 10 x Denhardt's solution (0.2%
Ficoll, 0.2% polyvinylpyrollidine, 0.2% bovine serum albumin), 0.1% sodium dodecyl sulfate, and 0.1 % sodium pyrophosphate for 1.5 hours at 65°C for probe 1100 (BMLFl)
and 50°C for probe 1780 (BRLF1) (see Table 2). Hybridization was performed with the gamma-32P-ATPend-labeled
oligonucleotide probe (1 x 10' cpm/probe) for 4 hours at
65°C and 50”C, respectively, for the BMLFl and BRLFl
probes [33]. Blots were then washed three times: for probe
1100, in 6 x SSC at 55°C for 10 minutes, followed by 10
minutes at 55 to 60”C, and 5 minutes at 65°C; for probe
1780, in 3~ SSC at 43°C for 10 minutes, followed by 10
minutes at 43 to 47°C and a final wash at 50°C for 5 minutes.
The filters were then exposed to Kodak X-Omat AR films
(Rochester, NY) for 24 and 72 hours at - 70°C. Molecularweight markers (PhiX174 DNA, New England Biolabs,
Beverly, MA) were included on each gel.
Another aliquot of the PCR mixture was incubated with a
restriction endonuclease that has only one recognition site
within the predicted amplified product. This was PfrMI for
the BMLFl primers and Sgh for the BRLFl primers. All
products obtained after digestion were subjected to the same
gel analysis and hybridization procedure as the undigested
samples. A specimen was scored positive for EBV DNA
if an amplified product and its specific restriction enzyme
digestion fragments were detected with one andlor the other
set of primers following hybridization. If a reaction scored
positive by PCR, this meant that genomic EBV DNA corresponding to one or both regions was present in the sample.
As conducted, the PCRs did not detect RNA; therefore a
positive reaction did not mean that these regions were expressed in the sample.
Results
Detection of EBV D N A in Brain Samples
The results on the brain biopsy samples obtained from
24 patients are shown in Table 1. Samples from 19
(79%) of the 24 patients were positive by PCR while
only 3 (12.5%) of 24 samples contained EBV DNA
detectable by standard Southern analysis. All samples
positive for EBV DNA by Southern blotting were also
positive by PCR using both sets of primers.
The BMLFl primers were more sensitive reagents
for detection of EBV DNA in the brain than were the
BRLFl primers. Samples from 6 (25%) of 24 patients
reacted with both sets; 12 (50%) of 24 were positive
only with the BMLFl primers and 1 (4%) of 24 was
positive only with the BRLFl primers. The difference
in the rate of detection of EBV in the brain with the
two different primer pairs was consistent with measurements of the sensitivity of the PCR technique. The
BMLFl primers were approximately 25-fold more sensitive than the BRLFl primer pair. The BMLFl primers could detect as few as 4 x lo3EBV genomes while
the BRLF1 primers detected about 1 x lo5genomes
1341.
Most of the positive PCR signals were undetectable on ethidium bromide-stained gels and became evident only after electrotransfer and hybridization (Fig).
Moreover, especially with the BRLFl primers, there
was nonspecific amplification in the size range of the
expected specific PCR fragment seen on ethidium
bromide-stained gels; therefore, detection of the specific reaction product required hybridization. In each
instance the amplified product was of the predicted
size, based on the published DNA sequence of the
B95-8 strain of EBV 1351. Digestion of the amplified
products from the BRLFl region with Bgh yielded two
expected digestion fragments of 257 and 88 bp (see
Fig A); digestion of the amplified products from the
BMLFl region with PfEMI produced a 211-bp and a
93-bp fragment (see Fig B).
Clinical Syndromes of Patients Whose Brain Samples
Contained EBV D N A
In 18 of the 19 patients whose brain samples contained
EBV DNA by PCR, there was some clinical, serological, or epidemiological evidence to implicate EBV in
the pathogenesis of the CNS disease (see Table 1).
Six patients whose brain tissue contained EBV DNA had encephalitis. Two patients (Patients 8 and 9) developed symptoms following acute
infectious mononucleosis; both had positive results on
heterophile antibody tests as well as elevated IgM antibody titers of 1:80 and 1:320 to VCA. In a third
patient, recurrent episodes of meningoencephalitis followed an acute episode of infectious mononucleosis
recognized clinically, but specimens were not available
for EBV serology. Another positive specimen was
from a 31-year-old man with acquired immunodeficiency syndrome (AIDS) (Patient 7) who had chronic
meningoencephalitis. His biopsy sample showed granulomatous encephalitis; stains for mycobacteria, toxoplasmosis, and fungi were negative. He had EBV VCA
IgG titers of 1:640 but no EA antibodies. A fifth positive specimen was from an 18-month-old girl (Patient
6) with encephalitis and a clinical diagnosis of juvenile
rheumatoid arthritis. Histopathological study of‘ the
brain showed focal demyelination, perivascular lymphocytic cuffing, widespread ghosis, and occasional viral inclusions in oligodendrocyte nuclei; at autopsy she
was also found to have chronic interstitial pneumonitis.
The brain specimen from a 76-year-old man (Patient
5) with herpes simplex encephalitis was also positive
for EBV DNA when tested by PCR; the main pathological features at autopsy were hemorrhagic necrosis
and massive infiltration of the cortex and white matter
by mononuclear cells.
ENCEPHALITIS.
CNS LYMPHOMAS. Brain specimens from 5 patients
with a clinical and pathological diagnosis of lymphoma
were positive for EBV DNA by PCR. Three were also
reactive by standard Southern blotting; they were the
only brain samples in this series positive by Southern
analysis. Two tumors occurred in immunocompromised patients and two in normal hosts. The fifth (Patient 15), who had a history of “lymphomatoid granulomatosis” diagnosed histologically and then developed
a CNS lymphoma, may have had more widespread
Pedneault et al: EBV in the Brain
187
B
A
Detection of EBV D N A in the brain by means of polymerase
chain reaction (PCR). (A)The top is an ethidium bromidestained gel of the PCR products obtained afer amplification
with the BRLFl primers. The bottom is a blot of the gel hybridized with the R probe. The PCR products were examined
undigested (U) and afer digestion-with BglI (Dl). The sample
from Patient 14 as positive. (B) The top is an ethidium
bromide-stained gel of PCR products obtained afer amplzj5cation with the BMLFl primers. The bottom is a blot of the gel
hybrzdized with the M probe. Two different samples of brain
fmm Patient 11 were studied. The PCR products were digested
in this experiment with PiWl (D2). All samples shown are
positive for EBV DNA. M = molecular-weight markers, obtained by digesting phiXl74 D N A with Haeili.
188 Annals of Neurology
Vol 32 No 2 August 1992
EBV-associated disease, for autopsy specimens of lung
and liver were also positive for EBV D N A by PCR.
EBV-ASSOCIATED
LYMPHOPROLIFERAIn 2 patients, involvement of the brain by EBV
was part of a more widespread systemic EBV infection.
In Patient 16 the initial diagnosis was Reye’s syndrome;
after 1 month the patient continued to experience
fever, headache, and anorexia and then developed
lymphadenopathy, hepatosplenomegaly, and bone marrow necrosis. Her EBV serology was compatible with
chronic active EBV replication: The VCA IgG titer
was greater than 1:2,560 and the titer against the diffuse component of EA was greater than 1:320. The
anti-EBNA titer was 1 :40; IgM anti-VCA was not detected. Numerous EBNA-positive cells were found in
the lung and spleen and the lung contained EBV DNA
detectable by standard Southern blotting.
A 16-year-old girl (Patient 17) had acute heterophile-positive infectious mononucleosis. She then deFATAL DISSEMINATED
TION.
veloped recurrent episodes of fever, diffuse maculopapular rash described histopathologically as vasculitis
with immune complex deposition, jaundice with hepatosplenomegaly, and pancytopenia, leading eventually
to death. The VCA IgG titer was 1:160, but antiEBNA, anti-EA, and IgM anti-VCA titers were not
detectable. Many EBNA-positive cells were found in
the peripheral blood; Southern analysis of lung, liver,
and spleen specimens obtained at autopsy were positive for EBV DNA.
. EBV
DNA was detected by PCR with both primer pairs
in 2 patients with progressive multifocal leukoencephalopathy, diagnosed by histopathology. Both patients were immunosuppressed; one had AIDS, and
the second, a renal transplant recipient, had IgG titers
against VCA of greater than 1:320; routine viral culture of a brain biopsy sample revealed negative
findings.
PROGRESSIVE MULTIFOCAL LEUKOENCEPHALOPATHY
MULTIPLE SCLEROSIS. The PCR was positive with one
of the two primer pairs in 2 patients with a histopathological diagnosis of multiple sclerosis. One patient, a
16-year-old girl, was previously normal. The other was
a 6-year-old child with AIDS and recurrent aseptic
meningitis who died of acute bronchopneumonia; the
pulmonary histological finding was that of lymphocytic
interstitial pneumonia. The clinical syndrome of multiple sclerosis was manifest at age 3 by transient hemiparesis and blindness. At autopsy, the main histopathological finding in the brain was extensive and severe
demyelination 1361; the lesions involved both white
and gray matter, though they did not resemble lymphoma or progressive multifocal leukoencephalopathy.
Serum titers of I& antibody to EBV VCA were persistently elevated to 1: 1,280 beginning 2 years after
the onset of the neurological syndrome.
Brain specimens from 2 paENCEPHALOPATHY.
tients with AIDS and encephalopathy were positive for
EBV DNA using the BMW1 primers. Patient 23 was
an 8-month-old child with lymphocytic interstitial
pneumonia and disseminated lymphoproliferative disease; autopsy specimens of bone marrow, lung, spleen,
and bowel contained EBV DNA by PCR. EBV serology showed VCA titers above 1:320 and a 1:20 antibody titer against the restricted component of EA.
AIDS
Patients Whose Brain Samples Were Negative
for EBV DNA
Of the 5 patients whose brain samples were negative
for EBV DNA by PCR, the clinical diagnosis was herpes simplex encephalitis documented by viral culture
in 3 (Patients 2-4), hemorrhagic chickenpox encephalitis in 1 (Patient l), and encephalopathy associated
with an inborn error in amino acid metabolism (methylmalonic acidemia) in a 9-day-old baby (Patient 24).
Discussion
Sensitivity of Polymerase Chain Reaction Relative to
Other Nucleic Acid Hybridization Techniques
The PCR technique is about 10- to 100-fold more sensitive than other DNA hybridization methods such as
hybridization by dot blot or by Southern blot. Thus,
PCR was able to detect EBV DNA in 18 of 24 patients’ biopsy specimens, as opposed to Southern analysis which detected EBV DNA in only 3 of the samples
(see Table 1). Previous studies from our laboratory
demonstrated that approximately lo5 genomes could
be detected by dot blot hybridization, and lo6 genomes by standard Southern blot hybridization E281.
In contrast, in a related study, we showed that the
BMLFl primers, our most sensitive reagents, will detect about 4 x lo3 EBV genomes C341.
An appreciation of the sensitivity of the different
nucleic acid hybridization techniques used to identify
EBV DNA in a given sample is important for interpreting the significance of the results of such testing.
For example, CNS lymphomas, in which all cells are
likely to contain several EBV genomes, will be positive
by Southern blotting as well as by other, more sensitive
techniques 1111. In the blood of an otherwise healthy
patient with acute infectious mononucleosis or an immunosuppressed patient with AIDS, the virus burden
is in the range of 1 EBV infected cell per lo4 mononuclear cells 137-391. This level of leukoviremia is rarely
detectable with standard hybridization techniques, and
even PCR was only able to demonstrate the presence
of EBV DNA in the peripheral blood of 3 of 5 patients
who were in the acute phase of infectious mononucleosis C23, 28, 347. Conversely, in a healthy EBVseropositive individual, in whom peripheral blood is
known to contain fewer than 1/106 to 1/10’ lymphocytes latently infected with EBV 137, 407, even the
exquisitely sensitive PCR technique did not produce
a positive result using cells harvested from standard
aliquots of peripheral blood 123, 341.
Since there are more EBV-infected cells in the blood
of an immunocompromised patient than in a healthy
EBV-seropositive individual, it is possible that a biopsy
sample from an immunosuppressed patient which contains EBV DNA detectable by PCR does so by virtue
of admixture of EBV-infected blood cells that contaminate the specimen. More likely, however, they represent nucleic acid from EBV-infected B lymphocytes
that infiltrate the brain. It is less likely that the EBV
DNA detected is present in brain parenchyma itself,
although this point requires further study.
The role of EBV in the pathogenesis of CNS disease
may thus be secondary either to infiltration of EBVinfected cells as part of a lymphoproliferative process
Pedneault et al: EBV in the Brain 189
or to an immunological response elicited by the virus.
The latter scenario would mirror the pathogenesis
of heterophile-positive infectious mononucleosis, in
which only a few EBV-infected B lymphocytes (too
few to be routinely detected by standard nucleic acid
hybridization techniques 1281) elicit a major immunological response responsible for the clinical manifestations of illness.
Novel Associations of EBV DNA with
Neurological Disease
EBV DNA was detected in brain biopsy specimens
from 9 patients whose neurological syndrome had not
been previously associated with EBV; however, EBV
was suspect, usually because of AIDS or another immunosuppressive disorder. Each of these groups of patients warrants brief discussion.
The brain sample of 1 of 4 patients with cultureproved herpes simplex encephalitis, a 76-year-old,
EBV-seropositive man, was positive for EBV DNA by
the PCR reaction with the M primers. This result was
not likely to be due to cross-reactions between herpes
simplex virus type 1genes and EBV, since the M primers did not react with tissue culture cells infected with
herpes simplex virus type 1, nor is it likely to be due
to contamination of the sample with peripheral blood,
for the level of EBV DNA present in the blood of
healthy EBV-seropositive individuals cannot be detected by PCR. Three possible mechanisms may be
suggested as a basis for further study of this positive
PCR result: (1) The inflammatory process, especially
mononuclear cells, may selectively recruit lymphocytes
infected with EBV. (2) Herpes simplex virus infection
of lymphocytes may activate latent EBV. (3) The brain
may be latently infected with EBV; on infection with
herpes simplex virus type 1, latent EBV may be induced into lytic replication. Such mechanisms could
not be generally operative, however, since the specimens from the other three patients with herpes simplex encephalitis were not positive for EBV DNA.
Patient 6, an 18-month-old girl with a diagnosis of
“juvenile rheumatoid arthritis” developed a chronic
progressive encephalomyelitis. There have been a few
reports of CNS disturbances in patients with juvenile
rheumatoid arthritis, including, rarely, acute toxic encephalopathy and cerebral vasculitis 141, 42); in the
single case with histopathological examination, there
was demyelination in the central pontine region. The
pathological changes in the brain of our patient were
most compatible with subacute, chronic, or possibly
recurrent viral encephalitis and thus resemble those
recently described for “Rasmussen’s encephalitis” 161.
In 2 immunocompromised patients the neuropathological diagnosis was progressive multifocal leukoencephalopathy. So far only polyomaviruses such as JC
virus have been regularly associated with progressive
190 Annals of Neurology Vol 32
No 2 August 1992
multifocal leukoencephalopathy, which is invariably
found in patients with defective cell-mediated immunity 143, 441. The condition has been recognized with
increasing frequency since the onset of the AIDS epidemic 144, 451. EBV DNA was found in both biopsy
specimens. The etiological role of EBV in this disorder,
either alone or in combination with other pathogens,
needs further exploration.
In 2 patients the neuropathological diagnosis was
multiple sclerosis. In 1 patient, this was an unexpected
diagnosis. The patient was a 6-year-old child with
AIDS, lymphocytic interstitial pneumonitis, and recurrent aseptic meningitis, whose brain showed extensive
and severe demyelination at autopsy. Recently, Berger
and coauthors described 7 patients with multiple sclerosis-like illness occurring in the context of human
immunodeficiency virus type 1 (HIV-1) infection 1461.
In 3, signs of multiple sclerosis were evident years before the patients became HIV-1 seropositive. The
other patient with multiple sclerosis whose brain was
positive for EBV DNA was not immunocompromised.
However, only the R primer pair produced a positive
PCR signal; therefore this result must be viewed with
caution, since the R primer pair is generally less sensitive than the M primer pair.
Although measles and human T lymphotropic virus
type I are the two viruses most often implicated in
the pathogenesis of multiple sclerosis 147-491, there is
some evidence in favor of a role for EBV { 13- 15,501.
Epidemiological analyses have shown that the patient
with multiple sclerosis shares attributes of the patient
with infectious mononucleosis such as higher socioeconomic status 1121. There is also evidence for clustering of multiple sclerosis patients between the ages
of 13 and 20, when individuals are most likely to develop acute infectious mononucleosis 1501. This has
prompted the speculation that multiple sclerosis may
be caused by a virus that usually infects adolescents
112, 501. Serological studies have shown a higher prevalence and higher titers of EBV antibodies in patients
with multiple sclerosis than in control subjects [13,
141. Furthermore, there is an increased number of
EBV-carrying B lymphocytes in the blood of multiple
sclerosis patients during the active phase of the disease
1151.
The brains of 2 patients with AIDS encephalopathy
and 1 with AIDS who had chronic meningoencephalitis were positive for EBV DNA. If one adds the patients with progressive multifocal leukoencephalopathy, CNS lymphoma, and the multiple sclerosis-like
syndrome, 6 of 19 positive samples were from patients
with AIDS. Although EBV DNA has been detected
in some non-Hodgkin’s lymphomas and lymphoproliferative syndromes in AIDS patients, it has not yet been
reported to be present in the brains of patients with
AIDS encephalitis or encephalopathy. However, pa-
tients with AIDS often have increased levels of EBV
replication. There are increased titers of the virus in
oropharyngeal sites, and oral “hairy” leukoplakia of the
tongue, a disease characterized by lytic EBV replication, is known to occur in patients with AIDS 1511.
In conclusion, EBV DNA was detected by PCR in
brain biopsy samples obtained from patients in whom
EBV was suspected to play a role in the neurological
syndrome. In most of these specimens, EBV DNA
could not be documented by the less sensitive technique of Southern analysis. These results provide a
stimulus for further investigation of the role of EBV
in the pathogenesis of neurological disorders. In situ
assays will be required to demonstrate which and how
many cells of the brain may harbor the virus. It seems
that EBV-carrying B lymphocytes in the brain are the
most likely source of the positive PCRs, but we cannot
rule out direct infection of brain parenchyma at this
time. Molecular analyses will be needed to distinguish
between the latent and lytic phases of the viral life
cycle. More brain specimens will need to be studied
from individuals who die of causes not thought to be
related to EBV in order to learn whether EBV or
EBV-infected lymphocytes are common residents of
the nervous system.
This work was supported by grants from the National Institutes of
Health (CA 48270 [to B. Z. K.1 and A1 22959 [to G. M.]). Dr
Pedneault was a postdoctoral fellow of the Medical Research Council
of Canada
The authors thank Dr H. Jenson for helpful advice and discussions
and D. M. Horstmann and J. C. Niederman for critical readings of
the manuscript.
Presented in part at the 30th Interscience Conference on Antimicrobial Agents and Chemotherapy, Atlanta, GA, Oct 23, 1990.
References
1. Siverstein A, Steinberg G, Nathanson M. Nervous system
involvement in infectious mononucleosis. Arch Neurol 1972;
292:353-358
2. Grose C, Henle W, Henle G, Feorino PM. Primary EpsteinBarr virus infections in acute neurologic diseases. N Engl J Med
1975;292:392-395
Culebras A. Cerebellitis in infectious mononucleo3. Gilbert JW,
sis. JAMA 1972;220:727
4. Bajada S. Cerebellitis in glandular fever. Med J Aust 1976;l:
153-156
5. Bennett DR, Peters HA. Acute cerebellar syndrome secondary
to infectious mononucleosis in a fifty-two year old man. Ann
Intern Med 1961;55:147-149
6. Cleary TG, Henle W, Pickering LK. Acute cerebellar ataxia
associated with Epstein-Barr virus infection. JAMA 1980;243:
148-149
7. Schooley RT, Dolin R Epstein-Barr virus (infectious mononucleosis). In: Mandell GL, Douglas RG Jr, Bennett JE, eds. Principles and practice of infectious diseases. 3rd ed. New York:
Churchill-Livingstone, 1990:1172-1185
8. Bernstein TC, Wolff HG. Involvement of the nervous system
in infectious mononucleosis. Ann Intern Med 1 9 5 0 3 : 11201138
9. Bashir RM, Harris NL, Hochberg FH, Singer RM. Detection of
Epstein-Ban virus in CNS lymphomas by in situ hybridization.
Neurology 1989;39:813-817
10. Hanto DW, Gail-Peczalska KJ, Fritzera G, et al. EpsteimBarr
virus (EBV) induced polyclonal and monoclonal B-cell lymphoproliferative diseases occurring after renal transplantation. Ann
Surg 1983;198:356-369
11. Hochberg FH, Miller G, Schooley RT,et al. Central nervous
system lymphoma related to Epstein-Barr virus. N Engl J Med
1983;309:745-748
12. Warner HB, Carp RI.Multiple sclerosis etiology-An EpsteinBarr virus hypothesis. Med Hypotheses 1988;25:93-97
13. Sumaya CV, Myers LW, Ellison GW, Ench Y. Increased prevalence and titer of Epstein-Barr virus antibodies in patients with
multiple sclerosis. Ann Neurol 1985;17:371-377
14. h e n PD, Bloomer LC, Bray PF. Epstein-Barr nuclear antigen
and viral capsid antigen antibody titers in multiple sclerosis.
Neurology 1985;35:435-438
15. Fraser KB, Haire M, MillarJHD, McCrea S. Increased tendency
to spontaneous in vitro lymphocyte transformation in clinically
active multiple sclerosis. Lancet 1979;2:715-7 17
16. Walter GF, Renella RR.Epstein-Barr virus in brain and Rasmussen’s encephalitis. Lancet 1989;1:279-280
7. Joncas JH, Chicoine L, Thivierge R,Bertrand M. Epstein-Barr
virus antibodies in the cerebrospinal fluid. A case of infectious
mononucleosis with encephalitis. Am J Dis Child 1974;
127~282-285
8. Halsted CC, Chang RS. Infectious mononucleosis and encephalitis: recovery of EB virus from spinal fluid. Pediatrics 1979;
641257-2 58
9. Schiff JA, SchaeferJA, Robinson JE. Epstein-Barr virus in cerebrospinal fluid during infectious mononucleosis encephalitis.
Yale J Biol Med 1982;55:59-63
20. Saito I, Servenius B, Compton T, Fox RI. Detection of EpsteinBarr virus DNA by polymerase chain reaction in blood and
tissue biopsies from patients with Sjogren’s syndrome. J Exp
Med 1989;169:2 191-2 198
21. Patton DF, Shirley P, Raab-Traub N, et al. Defective viral :DNA
in Epstein-Barr virus-associated oral hairy leukoplakia. J Virol
1990;64:397-400
22. Rogers BB, Alpert LC, Hine EAS, Buffone GJ. Analysis of
DNA in fresh and fixed tissue by the polymerase chain reaction.
Am J Pathol 1330;136:541-548
23. Telenti A, Marshall WF, Smith TF. Detection of Epstein-Barr
virus by polymerase chain reaction. J Clin Microbiol 1990;
28~2187-2190
24. Fernand J-P, Gozlan J, Bendelac A, et al. Detection of EpsreinBarr virus in epidermal skin lesions of an immunocompromised
patient. Ann Intern Med 1990;112:511-515
25. Dahl KE, Burrage T, Jones F, Miller G. Persistent nonproductive infection of Epstein-Barr virus transformed human B lymphocytes by human immunode‘ficiency virus type 1. J Virol
1990;64:1771-1783
26. Pulvertaft RIV. A study of malignant tumors in Nigeria by short
term tissue culture. J Clin Pathol 1965;18:261-273
27. Miller G, Lipman M. Release of infectious Epstein-Barr virus
by transformed marmoset leukocytes. Proc Natl Acad Sci USA
1973;70:190-194
28. Andiman W, Gradoville L, Heston L, et al. Use of cloned probes
to detect Epstein-Barr viral DNA in tissues of patients with
neoplastic and lymphoproliferative diseases. J Infect Dis 1983;
148:967-977
29. Fischer DK, Miller G, Gradoville L, et al. Genome of a mononucleosis Epstein-Barr virus contains DNA fragments previously
Pedneault et al: EBV in the Brain
191
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
regarded to be unique to Burkitt’s lymphoma isolates. Cell
1981;24:543-553
Wong K-M, Levine A. Identification and mapping of EpsteinBarr virus early antigens and demonstration of a viral gene activator that functions in trans. J Virol 1986;60:149-156
Hardwick JM, Lieberman P, Hayward SD. A new Epstein-Barr
virus transactivator, R, induces expression of a cytoplasmicearly
antigen. J Virol 1988;62:2274-2284
Saiki RK, Gelfand DH, Stoffel S, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988;239:487-491
Davis LG, Dibner MD, Battey JF. Basic methods in molecular
biology. New York: Elsevier, 1986:72-89
Pedneault L, Katz BZ, Miller G . Epstein-Barr virus associated
lymphoproliferative disorders: a re-evaluation using the polymerase chain reaction. In: Interscience Conference on Antimicrobial Agents and Chemotherapy. 1989 (Abstract no. 802)
Baer R, Bankier AT, Biggin MD, et al. DNA sequence and
expression of the B95-8 Epstein-Barr virus genome. Nature
1984;310:207-211
Shaw C-M, Alvord EC. Multiple sclerosis beginning in infancy.
J Child Neurol 1987;2:252-256
Rocchi G, de Felici A, Ragona G, Heinz A. Quantitative evaluation of Epstein-Barr virus-infected mononuclear peripheral
blood leukocytes in infectious mononucleosis. N Engl J Med
1977;296:132-134
Chang RS, Thompson H , Pomerantz S. Epstein-Barr virus infections in homosexual men with chronic, persistent generalized
lymphadenopathy. J Infect Dis 1985;151:459-463
Sumaya CV, BosweU RN, Ench Y,et al. Enhanced serological
and virological findings of Epstein-Barr virus in patients with
AIDS and AIDS-related complex. J Infect Dis 1986;154:
864-870
192 Annals of Neurology Vol 32 No 2 August 1992
40. Yao QY, Rickinson AB, Epstein MA. A re-examination of the
Epstein-Barr virus carrier state in healthy seropositive individuals. Int J Cancer 1985;35:35-42
41. Jan JE, Hill RH,Low MD. Cerebral complications in juvenile
rheumatoid arthritis. Can Med Assoc J 1972;107:623-625
42. Editorial. Cerebral involvement in juvenile rheumatoid arthritis.
JAMA 1972;222:1555
43. Brooks BR, Walker DL. Progressive multifocal leukoencephalopathy. Neurol Clin 1984;2:299-3 13
44. Berger JR, Kaszovitz B, Donovan Post J, Dickinson G. Progressive multifocal leukoencephalopathy associated with human immunodeficiency virus infection. A review of the literature with
a report of sixteen cases. Ann Intern Med 1987;107:78-87
45. Elder GA, Sever JL. Neurologic disorders associated with AIDS
retroviral infection. Rev Infect Dis 1988;10:286-302
46. Berger JR, Sheremata WA, Resnick L, et al. Multiple sclerosislike illness occurring with human immunodeficiency virus infection. Neurology 1989;39:324-329
47. Rodriguez M. Multiple sclerosis: basic conceprs and hypothesis.
Mayo Clin Proc 1989;64:570-576
48. Greenberg SJ, Ehrlich GD, Abbott MA, et al. Detection of
sequences homologous to human retroviral DNA in multiple
sclerosis by gene amplification. Proc Natl Acad Sci USA 1989;
86:2878-2882
49. Roman GC. Retrovirus-associated myelopathies. Arch Neurol
1987;44:659-663
50. Riise T, Gronning M, Klauber MR, et al. Clustering of residence
of multiple sclerosis patients at age 13 to 20 years in Hordaland,
Norway. Am J Epidemiol 1991;133:932-939
51. Greenspan JS, Greenspan D, Lennetre ET, ec al. Replication
of Epstein-Barr virus within the epithelial cells of oral “hairy”
leukoplakia, an AIDS-associated lesion. N Engl J Med 1985;
3 13:1564- 157 1
Документ
Категория
Без категории
Просмотров
0
Размер файла
914 Кб
Теги
barry, epstein, reaction, chains, detection, virus, brain, polymerase
1/--страниц
Пожаловаться на содержимое документа